KR20140107954A - PHARMACEUTICAL COMPOSITION COMPRISING ATTENUATED FACULTATIVE BACTERIA AND IL-1β FOR PREVENTING OR TREATING CANCER - Google Patents

Abstract

Provided in the present invention is a composition to prevent and treat cancer which comprises attenuated salmonella species strain and interleukin-1β (IL-1β) to increase an anticancer effect of attenuated anaerobic bacteria for treatment. According to an embodiment of the present invention formed like the same, a composition to prevent and treat cancer, and a treatment method using the same increasing the anticancer effect of the attenuated salmonella strain can be provided.

Description

[0001] The present invention relates to a composition for preventing and treating cancer comprising an attenuated bacterium and IL-1 [beta] as an active ingredient,

The present invention relates to a composition for preventing and treating cancer, and more particularly, to a composition for preventing and treating cancer comprising an attenuated anaerobic bacterium and IL-1? (Interleukin 1-beta) as an active ingredient.

Some bacterial species have been reported to prefer proliferation and accumulation in cancer. Moreover, since bacteria have advantageous properties including the ability to simultaneously carry and express multiple therapeutic proteins, and because they can be easily removed by antibiotics, this suggests that bacterial therapy is promising for cancer treatment (Nauts et al., Acta. Med. Scand. Suppl . 276: 1-103, 1953). In addition, there is a direct assassination effect of living attenuated or genetically modified non-pathogenic bacteria, or an attempt to use the bacteria as an anticancer agent by assassinating and transferring molecules to cancer tissue, (Forbes, Nat. Biotechnol. , 24: 1484-1485, 2006).

As Salmonella typhimurium (Salmonella typhimurium) Among them may be clustering in solid cancer as invasive Gram-negative bacteria with mobility (Pawelek et al, Cancer Res, 57:.. 4537-4544, 1997). In vitro conditions, the chemotactic compounds produced by the pausing cancer cells have been shown to induce this effect (Kasinskas and Forbes, Biotechnol. Bioeng. , 94: 710-721, 2006). In vivo, salmonella has been shown to clusters primarily in nourishment-rich necrotic areas (Forbes et al., Cancer Res. , 63: 5188-93, 2003). Salmonella has also been successfully used to deliver cancer-mediated molecules such as prodrug-converting enzymes and antigens to cancer (King et al., Hum. Gene Ther. , 13: 1225-1233, 2002).

The present invention firstly identifies a method for remarkably enhancing the anticancer effect of an attenuated bacterial strain through the basal action in which an antitumor effect of attenuated bacteria is exhibited. The attenuated Salmonella strain and IL-1? And to provide a composition for preventing and treating cancer. However, these problems are exemplary and do not limit the scope of the present invention.

According to one aspect of the present invention, there is provided a composition for preventing and treating cancer, which comprises attenuated anaerobic bacteria and IL-1? (Interleukin-1?).

According to another aspect of the present invention, there is provided a composition for preventing and treating cancer comprising an attenuated anaerobic bacterium transformed to express a mammalian IL-1? As an active ingredient.

The attenuated anaerobic bacterium may be a mutant lacking the ability to synthesize ppGpp, and may contain an inactivated relA gene or spoT gene encoding ppGpp cytosetase for ppGpp synthesis.

The attenuated anaerobic bacteria Escherichia (Escherichia) genus, Salmonella (Salmonella) genus, Clostridium (Clostridium) genus Bifidobacterium (Bifidobacterium), A yeosi California (Yersinia) genus Listeria (Listeria) in , mycoplasma (mycoplasma), or in may be a genus Streptomyces Cocos (Streptococcus), the genus Salmonella bacteria may be a Salmonella typhimurium, Salmonella choleraesuis, or Salmonella enteritidis.

The cancer may be any one selected from the group consisting of liver cancer, colon cancer, cervical cancer, kidney cancer, stomach cancer, prostate cancer, breast cancer, brain cancer, lung cancer, cervical cancer, bladder cancer, blood cancer and pancreatic cancer.

The mammal may also be a human.

At this time, the composition according to an embodiment of the present invention may preferably contain 0.1 to 50% by weight of the composition for preventing and treating cancer, based on the total weight of the composition. In addition, the composition may further contain at least one kind of active ingredient which exhibits the same or similar function as the composition for cancer prevention and treatment, but preferably does not exceed the content of the effective ingredient.

The composition can be administered orally or parenterally at the time of clinical administration and can be administered orally or parenterally in the case of parenteral administration by intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrauterine injection, intracerebral injection, And may be used in the form of a general pharmaceutical preparation.

Compositions in accordance with one embodiment of the present invention further comprise an inert ingredient, including a pharmaceutically acceptable carrier. As used herein, the term " pharmaceutically acceptable carrier "refers to a composition, specifically a component other than the active ingredient of a pharmaceutical composition. Examples of pharmaceutically acceptable carriers include binders, disintegrants, diluents, fillers, lubricants, solubilizers or emulsifiers and salts.

In practical use, the composition according to one embodiment of the present invention may be combined with a pharmaceutical carrier according to conventional pharmaceutical formulation techniques. The carrier may take a wide variety of forms depending upon the preparation desired, for example, for oral or parenteral administration (including intravenous administration).

In addition, the composition according to one embodiment of the present invention may be administered at a dose of 0.1 mg / kg to 1 g / kg, more preferably 0.1 mg / kg to 500 mg / kg. On the other hand, the dose can be appropriately adjusted according to the age, sex and condition of the patient.

According to another aspect of the present invention, there is provided a method for treating cancer, comprising administering the composition to a subject having cancer.

According to an embodiment of the present invention as described above, a composition for preventing and treating cancer, which improves the anticancer effect of attenuated Salmonella strains, and a method of treating using the composition can be implemented. Of course, the scope of the present invention is not limited by these effects.

FIG. 1 is a graph showing changes in the volume of cancer tissues (FIG. 1A) and the degree of cancer cell death (FACS analysis) after administration of an attenuated StΔppGpp / lux strain according to an embodiment of the present invention 1b, 1c).
FIG. 2 is a graph showing changes in the level of cytokine mRNA in vivo (FIG. 2A), changes in protein level (FIG. 2b) and cytokine secretion amount change (Fig. 2C).
FIG. 3 is a photograph (FIG. 3A) of staining cancer tissue using a tissue immunostaining method after administration of an attenuated StΔppGpp / lux strain according to an embodiment of the present invention to a cancer animal model 1b < / RTI > and 1c) in cancer tissues.
4 (a) and 4 (b) are graphs showing the expression of CD68 (Mac) (Fig. 4A), CD68 (Neu) (Fig. 4B) using tissue immunostaining method after administering the attenuated St.DELTA.ppGpp / lux strain according to an embodiment of the present invention to a cancer animal model. ) And CD11c (DC) (Figure 4c) and IL-1 [beta].
FIG. 5 is a graph showing the results of inhibition of cancer growth after the administration of an attenuated St.DELTA.ppGpp / lux strain according to an embodiment of the present invention to a cancer animal model, ³ shows changes in IL-1β and TNF-α mRNA levels (FIG. 5A) and protein levels (FIG. 5B) of 'reccurrence'.
FIG. 6 is a graph showing an experimental procedure (FIG. 6A) for confirming the anti-cancer effect by administering IL-1β to a cancer animal model together with an attenuated StΔppGpp / lux strain according to an embodiment of the present invention 6b), and a photograph of cancer tissue (Fig. 6c).

The terms used in this document are defined as follows.

As used herein, " attenuation " means modifying the pathogenicity of a microorganism to reduce it. Attenuation is done for the purpose of reducing toxicity and other side effects when the microorganism is administered to the patient. The attenuated bacteria may be produced through a variety of methods known in the art. For example, attenuation is achieved by destroying or destroying the virulence factor that causes the bacteria to survive in the host cell. Such deletions and deletions are well known in the art and are carried out by methods such as homologous recombination, chemical mutagenesis, irradiation mutagenesis or transposon mutagenesis. Examples of toxic agents of Salmonella that can lead to attenuation if deleted include: 5'-adenosine monophosphate (Biochenko et al. , Bull. Eksp. Biol. Med. 103: 190-192, 1987) (Fields et al., Science, 243: 1059-62, 1989), DNAK (Buchmeier et al., Proc. Nat . Acad. Sci . USA 91: 489-493, 1994) al., Science 248: 730-732, 1990), Pimbria (Ernst et al., Infect. Immun., 58: 2014-2016, 1990), GroEL (Buchmeier et al., Science 248: 1990), Inv loci (Ginocchio et al., Proc. Natl. Acad Sci . USA 89: 5976-5980, 1992), lipoprotein (Stone et al., J. Bacteriol. 174: 3945-3952, LPS (Gianella et al, J. Infect Dis 128:... 69-75, 1973), PhoP and PhoQ (Miller et al, Proc Natl Acad Sci USA 86:..... 5054-5058, 1989), Pho active genes (Abshiro et al, J. Bacteriol, 175:.. 3734-3743, 1993), PhoP and PhoQ regulatory genes (Behlau et al, J. Bacteriol 175 :.. 4475-4484, 1993), morpholine (Tufano et al., Eur. J. Ep 4: 110-114 , 1988), toxic factors (Loos et al., Immun. Infekt. 22: 14-19, 1994; Sansonetti, Rev. Prat . 42: 2263-2267, 1992). The contents of attenuated bacteria are described in detail in WO 96/40238, which is incorporated herein by reference.

As used herein, the term " inactivated relA gene and / or spOT gene " refers to a modification of the relA gene and / or the spoT gene that results in transcription or translation of the gene or impairment of activity of the gene product do. Such genetic modification may include inactivation of the ppGpp cytoset sequencing (CDS) as well as inactivation of its promoter. The specific inactivation of only the gene of interest on the bacterial genome is possible by mutation through substitution, insertion, deletion, or a combination thereof in all or at least one subdomain of the coding gene. For example, deletion of a gene and insertion of a heterogenous sequence into a gene can be accomplished by truncation of a gene, nonsense mutation, frameshift mutation, missense mutation, etc. . The specific inactivation of these genes can be accomplished through methods established in the art. On the other hand, gene deletion can be carried out through various mutagenesis methods known in the art. For example, deletion of the relA gene or spoT gene can be performed by PCR mutagenesis and cassette mutagenesis (Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001) ). ppGpp synthesis deficiencies make a crucial contribution in targeting the bacteria of the present invention to cancer tissue.

Hereinafter, the present invention will be described in more detail with reference to Examples and Experimental Examples. It should be understood, however, that the invention is not limited to the disclosed embodiments and examples, but may be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, It is provided to fully inform the owner of the scope of the invention.

Example 1: Culture of mouse CT26 cell line

Colon adenocarcinoma CT26 was cultured as a monolayer and cultured in a cDMEM (Invitrogen) containing 10% FBS (Gibco, Invitrogen) and 1% P / S (penicillin and streptomycin, Gibco, Invitrogen) at 37 ° C under 5% and cultured in endotoxin-free DMEM high glucose medium (Hyclone, Thermal scientific).

Example 2: Preparation of attenuated Salmonella strains

To an attenuated Salmonella typhimurium strain (StΔppGpp / lux, SHJ2168) and E. coli MG1655 (E. coli, not E coli -lux) to non-expression of the lux genes it was used in the experiment (10. Min, JJ et al. , Mol. Imaging Biol. , 10, 54-61, 2008; Yoshimura, K. et al., Cancer Res. , 66, 1096-1104, 2006). The E. coli MG1655 was resistant to ampicillin and was used for bacterial localization and counting.

The attenuated Salmonella typhimurium (StΔppGpp / lux) lacks the ability to synthesize ppGpp (guanosine 5'-diphosphate 3'-diphosphate) due to deletion of the relA gene and spoT gene. Specifically, 50 μg / ml kanamycin (Difco Laboratories) with 37 ° C, and incubated at 37 ° C with S. typhimurium ΔppGpp strain (SHJ2037, Accession No. KCTC10787BP) with vigorous air supply. For bioluminescence imaging, the? PpGpp strain was transformed with a bioluminescent reporter gene. The bacterial luciferase gene (lux) of S. typhimurium- Xen26 (Xenogen-Caliper) was introduced into strain SHJ 2037 by the P22HT intransfection method and then cultured in LB medium containing 50 μg / ml kanamycin. The pBAD-pelB-RLuc8 plasmid was then introduced into the strain by electro-transformation. Colonies growing on LB agar plates containing ampicillin (20 μg / ml) were selected ( S. typhimurium strain (StΔppGpp / lux, SHJ2168)).

Example 3: Preparation of female animal model

5-6 week old male Balb / c mice (20 g, Samtaco, Orient-Charles River Lab., Korea) were used for the experiments. All animal breeding, experiments and euthanasia were conducted in accordance with the protocol approved by the Animal Research Association of Chonnam National University and the Guidance on the Rehabilitation and Use of Laboratory Animals (published by the National Institute of Health) (Announcement 85-23, Rev. 1985).

1x10 < ⁶ > of the colon cancer cell CT26 cells cultured in Example 1 was implanted subcutaneously in the right thigh of the mouse. Ten days after the transplantation, experiments were carried out in which the attenuated bacteria or IL- Respectively.

Experimental Example 1: Antitumor effect analysis of attenuated Salmonella strains

1-1: Cancer volume change

In order to analyze the anticancer effect of the attenuated Salmonella strain, the attenuated Salmonella strain (St? PpGpp / lux, SHJ2168) prepared in Example 2 and E. coli MG1655 not expressing the lux gene were cultured in the same manner as in Example 3 After administration to the model, changes in the size of the implanted cancers were observed. The S. typhimurium strain (StΔppGpp / lux, SHJ2168) is 4.5 × 10 ⁷ cells / 100 μl PBS was administered intravenously and the solution, E. coli MG1655 (not E-coli lux) is 5 × 10 ⁷ cells / 100 μl PBS solution, and the control group was administered with 100 μl PBS solution once. Thereafter, changes in the volume (mm < ³ >) of the cancer for 18 days were measured using a caliper.

As a result, as shown in FIG. 1A, the group to which the attenuated StΔppGpp / lux strain according to one embodiment of the present invention was administered showed a significantly higher incidence of cancer than the control group and E. coli MG1655 (not E coli-lux) (See Fig. 1A).

1-2: FACS analysis

Next, the present inventors performed FACS analysis after separating lymph nodes injected with cancer cells.

In Experimental Example 1-1, a mouse injected with bacteria was used. After 2 days from the injection of the bacteria, the cancer was extracted. The lymph nodes injected with cancer cells were separated, homogenized using a 40 μm sterilized stainless steel mesh (BD Falcon, USA), and suspended in RPMI 1640 medium for T cells. At this time, the RPMI 1640 medium was supplemented with 10% FBS, 1% penicillin / streptomycin, L-glutamine, sodium pyruvate, non-essential amino acid and 2-mercaptoethanol , And the FACS analysis was performed using annexin V (early stage apoptosis marker) and 7-ADD (late stage apoptosis marker) markers.

As a result, as shown in FIG. 1B, the group to which the attenuated StΔppGpp / lux strain according to one embodiment of the present invention was administered showed a significantly increased cancer cell death compared with the control group and the group administered with E. coli MG1655 .

1-3: Analysis of killed cancer cells

Next, the present inventor quantified the FACS analysis result of Experimental Example 1-2.

As a result, as shown in FIG. 1C, in the group administered with the attenuated attenuated StΔppGpp / lux strain according to one embodiment of the present invention, the killed cancer cells were treated with the control and the control group and the group administered with E. coli MG1655 And the cancer cells were killed by about 35%, which is consistent with the result of FIG. 1A. That is, the above results demonstrate the anticancer effect of the attenuated Salmonella strain according to one embodiment of the present invention, which is supported by the reduction of the volume of cancer tissue in vivo and the increase in the number of killed cancer cells . In the following examples, the 'suppression' during the first 10 days in which cancer growth is inhibited and the period of growth of cancer volume up to 1,500 mm ³ are divided into 'reccurrence' And compared with each other.

Experimental Example 2: Cytokine analysis

Through analysis of cytokine changes in vivo by attenuated bacteria according to an embodiment of the present invention, it was confirmed whether the secretion of specific cytokines capable of inhibiting cancer cells is increased.

2-1: Analysis of cytokine levels by RT-PCR analysis

The cancer tissues of Example 3 were infected with Salmonella strains (StΔppGpp / lux, SHJ2168) and E. coli MG1655, and the cancer tissues were sterilized by a sterilized tool at the point in time two days passed (suppression stage) Lt; / RTI > The skin and surrounding lipids were removed to inhibit the mixing of tissues other than the infection and cancer. As soon as the tissue was separated, the tissue was dissociated. The degradation of the tissue was performed using an enzyme, which was performed according to the 'Dissociation of cells from primary tissue' of Invitrogen Laboratories. To summarize briefly, cancer tissues were washed with sterile PBS and then diluted to 2-3 mm ³ volumes. The tissue was then reacted with 25% trypsin (Gibco, Invitrogen, USA) and reacted at a ratio of 10 ml of enzyme per gram of tissue, facilitating penetration of the enzyme into cancer tissue and maximizing enzyme activity For 2 hours at < RTI ID = 0.0 > 4 C. < / RTI > Then, the enzyme-treated cancer tissues were reacted in a cell culture incubator (37 ° C, 5% carbon dioxide) for 20 minutes, the supernatant was removed, and the enzyme reaction was stopped by adding cDMEM. Thereafter, the cancerous tissue was carefully pulverized and then filtered using a 100 占 퐉 sterilized stainless steel mesh (BD Falcon, USA) to isolate a single cell mixture.

MRNA was extracted from 1 x 10 < ⁶ > of isolated cancer cells using the TRI reagent (Molecular Research Center, USA). To perform the reverse transcription reaction, cDNA was synthesized by reacting 1 μg of the extracted mRNA, 20 μl of oligo (dT) primer (Promega, Madison, Wis. USA) and Improm-II Reverse Transcriptase (Promega) Respectively. 1 μg of the synthesized cDNA was amplified using the following primers:

Sequence (5- > 3) SEQ ID NO: HPRT Forward TTATGGACAGGACTGAAAGAC One HPRT Reverse GCTTTAATGTAATCCAGCAGGT 2 IL-1? Forward GCAACTGTTCCTGAACTCAACT 3 IL-1? Reverse ATCTTTTGGGGTCCGTCAACT 4 IL-6 Forward GAGGATACCACTCCCAACAGACC 5 IL-6 Reverse AAGTGCATCATCATCGTTGTTCA 6 IFN-γ Forward TCAAGTGGCATAGATGTGGAAGAA 7 IFN-γ Reverse TGGCTCTGCAGGATTTTCATG 8 TNF-α Forward CATCTTCTCAAAATTCGAGTGACAA 9 TNF-α Reverse TGGGAGTAGACAAGGTACAACCC 10 TGF-β Forward GAAGGCAGAGTTCAGGGTCTT 11 TGF-β Reverse GGTTCCTGTCTTTGTGGTGAA 12 18S Forward GTAACCCGTTGAACCCCATT 13 18S Reverse CCATCCAATCGGTAGTAGCG 14 28S Forward CTAATAGGGAACGTGAGCTGGG 15 28S Reverse GCGGTTCCTCTCGTACTGAG 16

As a result, as shown in FIG. 2A, the attenuated StΔppGpp / lux strain according to an embodiment of the present invention significantly increased cytokine mRNA levels compared to E. coli , and particularly IL-1β and TNF -α was increased about 200 times and 20 times, respectively. These results suggest that IL-1 [beta] and TNF- [alpha] may play an important role in tumor suppression in the bacterial treatment method using the attenuated St [Delta] ppGpp / lux strains (see FIG.

2-2: Analysis of cytokine levels using Western blot analysis

In order to measure the amount of pro IL-1 beta and caspase-1 synthesized in the cells, 1 x 10 ⁴ cancer cells isolated in Experimental Example 2-1 were dissolved using a protein extraction solution (Intron Biotechnology, Korea) . The protein was then loaded on a 15% SDS-PAGE (linear gradient gel) and transferred to a nitrocellulose membrane (Bio-rad, USA). The membranes were incubated with polyclonal goat anti-mouse IL-1β antibody (catalog # AF-401-NA, R & D Systems, 1: 2000 dilution) or polyclonal rabbit anti- mouse kesephase- Biotechnology, 1: 1000 dilution), followed by reaction with HRP donkey anti-goat IgG (Santa Cruz Biotechnology) and polyclonal goat anti-rabbit IgG (P0448, Dako) as secondary antibodies . After that, the bioluminescence was catalyzed by using a lumino reagent and then the band was detected using a LAS3000 instrument.

As a result, as shown in FIG. 2B, the expression level of pro IL-1β was higher than that of IL-1β in a cancer animal model infected with an attenuated StΔppGpp / lux strain according to an embodiment of the present invention, It means that IL-1 [beta] has not been isolated in the form of mature IL-1 [beta] (see FIG. 2b).

2-3: Analysis of cytokine secretion using ELISA kit

After infecting Salmonella strains (StΔppGpp / lux, SHJ2168) and E. coli MG1655 attenuated in the animal model of Example 3, the cancer tissues were sterilized after 2 days (suppression stage) The mixture was homogenized by mixing the tissue and protein extraction solution (Intron Biotechnology, Korea) at a ratio of 1: 2 (w / v). Subsequently, the supernatant was separated and centrifuged three times for 15 minutes at 4 ° C and 12,000 rpm. IL-1β and TNFα ELISA test kit (eBioscience, USA) was used to measure the levels of cytokines. The color reaction of the substrate was measured at 450 nm wavelength using an ELISA reader (SpectraMax, Molecular dervices, US).

As a result, as shown in FIG. 2C, the attenuated StΔppGpp / lux strain according to an embodiment of the present invention increased the secretion of IL-1β and TNF-α by about 4-fold and 1,000-fold compared to the control and E. coli (See FIG. 2C). These results were consistent with the results of FIG. 2A.

Experimental Example 3: Analysis of immune response

3-1: Analysis of Immune Response in Cancer Tissue Using Tissue Immunostaining

After infestation with Salmonella strains (StΔppGpp / lux, SHJ2168) and E. coli MG1655 attenuated in the animal model of Example 3, 2 days later (suppression stage), 4% paraformaldehyde The tissues were fixed by perfusion with aldehyde. Then, the cancer tissue was removed, dehydrated in PBS containing 30% sucrose, and the tissue was frozen at -80 ° C. The tissues were cut to a thickness of 5 탆 using a cryomicrotome and then seeded on CD 45 (BD science, USA), Gr-1 (BD science, USA), CD68 (BD science, USA) BD science, USA) antibody. Tissue staining results were confirmed using an optical microscope (Olympus).

As a result, as shown in FIG. 3A, in a cancer animal model infected with an attenuated StΔppGpp / lux strain according to an embodiment of the present invention, the induction of a severe inflammatory reaction was confirmed by the expression of CD45, Gr-1 CD68, and CD11c (See FIG. 3A).

3-2: Analysis of immune response in cancer tissues using FACS analysis

After the infection of Salmonella strains (StΔppGpp / lux, SHJ2168) and E. coli MG1655 attenuated in the animal model of Example 3, cancer cells were injected at the time of 2 days (suppression stage) The lymph nodes were separated, homogenized using a 40 μm sterilized stainless steel mesh (BD Falcon, USA) and suspended in RPMI 1640 medium for T cells. At this time, the RPMI 1640 medium was supplemented with 10% FBS, 1% penicillin / streptomycin, L-glutamine, sodium pyruvate, non-essential amino acid and 2-mercaptoethanol , And the present tan solution was used for FACS analysis. Leukocyte antigen (CD45), Ly-6G (Neutrophil), F4 / 80 (macrophage) and CD11c (DC) were used as markers.

As a result, as shown in FIG. 3B, in a cancer animal model infected with an attenuated strain StΔppGpp / lux according to an embodiment of the present invention, the cytokine significantly inhibited the expression of E. coli MG1655 (See FIG. 3B).

Next, the inventor repeated the experiment of FIG. 3B three times or more, and the results were quantified and quantified in FIG. 3c. 3 (c) represents the macrophage, which is a quantitative result of analysis using F4 / 80 marker. DC means dendritic cell, and the result of analysis using CD11c marker is quantified It is.

Experimental Example 4: Analysis of IL-1β cytokine-secreting cells using a tissue staining method

After infestation with Salmonella strains (StΔppGpp / lux, SHJ2168) and E. coli MG1655 attenuated in the animal model of Example 3 above, 4 days after the passage of 5 days (suppression stage) The tissues were fixed by perfusion with aldehyde. Then, cancer tissues were extracted and placed in PBS containing 30% sucrose overnight, dehydrated until the tissue was submerged, washed once with PBS solution and embedded in OCT compound (Leica microsystem, German) . And stored at -80 ° C until the tissue section. . Next, the tissue was cut into a thickness of 5 μm using a cryomicrotome (Microm HM 525 (Thermo Scientific)), and the tissues embedded in the OCT compound were coated with 0.3% Triton X-100, 5% BSA and TBS-T (Blue) of cancer tissues was stained with CD68 (Invitrogen, USA) using DAPI / Antifade (1: 200; Invitrogen, USA). Then, the mixed solution was reacted for 2 hours and permeable and blocking were performed together. (1: 100; BD Pharmingen, USA) were used to stain dendritic cells with macrophages and neutrophils using 1: 500 (USA serotech, USA) 100, Invitrogen, USA) was reacted with Alexa Fluor 488 chicken anti-rabbit (1: 100, Invitrogen, USA) as a secondary antibody, and Pro- (P36930, Invitrogen) reagent was added thereto. The stained tissue was examined using a confocal optical microscope (Fluoview-1000 (FV-1000) laser scanner ng confocal microscope, Olympus).

As a result, as shown in Figs. 4A to 4C, it was confirmed that cytokine IL-1 beta is produced in dendritic cells and some neutrophil cells (Figs. 4A to 4C).

Experimental Example 5: Analysis of cytokine expression level by cancer stage

At the time of 2 days after the bacterial infection (suppression stage), or when the cancer volume infected with StΔppGpp / lux was 1,500 mm ³ (recurred stage), the cancer tissues were treated with a sterilized tool . The skin and surrounding lipids were removed to inhibit the mixing of tissues other than the infection and cancer. As soon as the tissue was separated, the tissue was dissociated. Thereafter, the tissue was digested in the same manner as described in Experimental Example 2-1, and mRNA was extracted therefrom. To perform the reverse transcription reaction, cDNA was synthesized by reacting 1 μg of the extracted mRNA, 20 μl of oligo (dT) primer (Promega, Madison, Wis. USA) and Improm-II Reverse Transcriptase (Promega) Respectively. 1 μg of the synthesized cDNA was amplified using the following primers:

IL-1? Forward: 5'-GCAACTGTTCCTGAACTCAACT-3 '(SEQ ID NO: 3);

IL-1? Reverse direction: 5'-ATCTTTTGGGGTCCGTCAACT-3 '(SEQ ID NO: 4);

TNF? Forward: 5'-CATCTTCTCAAAATTCGAGTGACAA-3 '(SEQ ID NO: 9); And

TNF? Reverse direction: 5'-TGGGAGTAGACAAGGTACAACCC-3 '(SEQ ID NO: 10).

As a result, as shown in FIG. 5A, the levels of IL-1β and TNFα mRNA levels at the recurrence time were significantly higher in the cancer tissues of the cancer animal model infected with the attenuated StΔppGpp / lux strain according to one embodiment of the present invention It was observed that it was remarkably decreased.

The present inventors then investigated whether pro-IL-1? And caspase-1 synthesized intracellularly are effective in inhibiting the proliferation of cells infected at the time point two days after the bacterial infection (suppression stage) When the cancer volume was 1,500 mm ³ (recurred stage), cancer tissues were digested in the same manner as described in Experimental Example 2-1. Thereafter, the 1 × 10 ⁴ live cancer cell suspension was dissolved using a protein extraction solution (Intron Biotechnology, Korea) and loaded on a 15% SDS-PAGE (linear gradient gel) to separate the proteins. The proteins were separated on a nitrocellulose membrane (Bio-Rad, USA). The membranes were incubated with polyclonal goat anti-mouse IL-1β antibody (catalog # AF-401-NA, R & D Systems, 1: 2,000 dilution) or polyclonal rabbit anti- mouse kesephase- (Santa Cruz Biotechnology, USA) and polyclonal goat anti-rabbit IgG (P0448, Dako, USA) were used as secondary antibodies, respectively. . After that, the bioluminescence was catalyzed by using a lumino reagent and then the band was detected using a LAS3000 instrument.

As a result, as shown in FIG. 5B, at the recurrence time, pro IL-1β, IL-1β and caspase-1β in cancer tissues of a cancer animal model infected with StΔppGpp / lux strain according to an embodiment of the present invention, 1 expression was markedly decreased.

Experimental Example 6: Antitumor effect analysis by the combination of attenuated Salmonella strains and IL-1β

In order to inhibit IL-1? Production, 5 占 퐂 of IL-1? Specific antibody (AF401-NA, R & D system) was suspended in 100 占 퐇 of 1 占 PBS, and Salmonella strain attenuated in the animal model of Example 3 (StΔppGpp / lux, SHJ2168), and the IL-1β-specific antibody was administered twice a week for 2 weeks after the infection. In addition, a hamster immunoglobulin (EQUITECH Bio) was administered as a control. In addition, recombinant IL-1β (rIL-1β, 401-ML / CF, R & D systems, USA) was administered every 2 days from the 5th day after infection with salmonella and IL- 0.5 μg was suspended in 5 μl of 1 × PBS, and then administered into a cancer using a microfilter syringe (Hamilton company) equipped with a PrecisionGlide needle (BDM011455-1, BD bioscience). In addition, a group to which only recombinant IL-1? Was administered on the 0th day of the experiment without infecting the Salmonella strain (St? PpGpp / lux, SHJ2168) attenuated in the animal model of Example 3 was used for comparison Reference).

The bacterial infection time was determined as 0 day, and the cancer volume of the cancer animal model was measured for 20 days. As a result, the volume of cancer tissue in the combination of recombinant IL-1β protein and attenuated salmonella strain (StΔppGpp / lux, SHJ2168) Followed by a decrease in the volume of cancer tissues in the group treated with attenuated Salmonella strains (StΔppGpp / lux, SHJ2168) or attenuated Salmonella strains (StΔppGpp / lux, SHJ2168) and IgG. On the other hand, in the group administered with IL-1 beta antibody one day before the administration of Salmonella strain or in the group administered with IL-1 beta alone, the anti-cancer effect was slight compared to the control group, (See FIG. 6B).

In addition, on the 0th, 5th, and 21st days after the experiment, the cancer tissue was observed by incising the thigh region of the animal model, and the cancer was remarkably decreased in the group treated with the Salmonella strain which was attenuated and the recombinant IL-1β (See FIG. 6C).

The present inventors have demonstrated that IL-1β plays an important role in the anticancer activity of the attenuated Salmonella strain (StΔppGpp / lux, SHJ2168) according to one embodiment of the present invention, In vivo experiments were carried out to compare the effects of attenuated anaerobic bacteria and IL-1β on the anticancer efficacy of co-administration of Salminella (StΔppGpp / lux, SHJ2168) or IL-1β Can be usefully applied in the treatment of cancer.

While the present invention has been described with reference to exemplary embodiments, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the invention. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

<110> Industry Foundation of Chonnam National University <120> Pharmaceutical composition comprising attenuated facultative          bacteria and Il-1 beta for preventing or treating cancer <130> PD12-0526 <160> 16 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HPRT Forward primer <400> 1 ttatggacag gactgaaaga c 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HPRT Reverse primer <400> 2 gctttaatgt aatccagcag gt 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-1 beta Forward primer <400> 3 gcaactgttc ctgaactcaa ct 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> IL-1 beta reverse primer <400> 4 atcttttggg gtccgtcaac t 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL-6 Forward primer <400> 5 gaggatacca ctcccaacag acc 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL-6 Reverse primer <400> 6 aagtgcatca tcatcgttgt tca 23 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IFN-gamma Forward primer <400> 7 tcaagtggca tagatgtgga agaa 24 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> IFN-gamma Reverse primer <400> 8 tggctctgca ggattttcat g 21 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha Forward primer <400> 9 catcttctca aaattcgagt gacaa 25 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha Reverse primer <400> 10 tgggagtaga caaggtacaa ccc 23 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TGF-beta Forward primer <400> 11 gaaggcagag ttcagggtct t 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TGF-beta Reverse primer <400> 12 ggttcctgtc tttgtggtga a 21 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18S Forward primer <400> 13 gtaacccgtt gaaccccatt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18S Reverse primer <400> 14 ccatccaatc ggtagtagcg 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 28S Forward primer <400> 15 ctaataggga acgtgagctg gg 22 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 28S Reverse primer <400> 16 gcggttcctc tcgtactgag 20

Claims (10)

A composition for preventing and treating cancer, which comprises attenuated anaerobic bacteria and IL-1? (Interleukin-1?). A composition for preventing and treating cancer, which comprises as an active ingredient an attenuated anaerobic bacterium transformed to express a mammalian IL-1? 3. The method according to claim 1 or 2,
Wherein the attenuated anaerobic bacteria is a mutant lacking the ability to synthesize ppGpp. 3. The method according to claim 1 or 2,
Wherein the attenuated anaerobic bacterium comprises an inactivated relA gene or a spoT gene encoding ppGpp &lt; RTI ID = 0.0 &gt; cytosetase &lt; / RTI &gt; for ppGpp synthesis. 3. The method according to claim 1 or 2,
The attenuated anaerobic bacteria Escherichia (Escherichia) genus, Salmonella (Salmonella) genus, Clostridium (Clostridium) genus Bifidobacterium (Bifidobacterium), A yeosi California (Yersinia) genus Listeria (Listeria) in , Mycoplasma genus or Streptococcus genus. 6. The method of claim 5,
Wherein said Salmonella genus is Salmonella typhimurium , Salmonella choleraesuis or Salmonella enteritidis . The method according to claim 6,
Wherein the Salmonella genus is Salmonella typhimurium . 3. The method according to claim 1 or 2,
Wherein said cancer is any one selected from the group consisting of liver cancer, colon cancer, cervical cancer, kidney cancer, stomach cancer, prostate cancer, breast cancer, brain cancer, lung cancer, uterine cancer, colon cancer, bladder cancer, blood cancer and pancreatic cancer. / RTI &gt; 3. The method of claim 2,
Wherein said mammal is a human. A method for treating cancer, comprising administering to a subject a composition of any one of claims 1 to 9

Images