KR20140102956A

KR20140102956A - Composition for preventing or treating cancer comprising Auricular auricuralia dichloromethane fraction

Info

Publication number: KR20140102956A
Application number: KR1020130016522A
Authority: KR
Inventors: 박승춘; 이승진
Original assignee: 경북대학교 산학협력단
Priority date: 2013-02-15
Filing date: 2013-02-15
Publication date: 2014-08-25

Abstract

The present invention relates to a composition for preventing or treating cancers containing dichloromethane fraction of Thymus mushroom as an active ingredient. The diclofenac fraction of Thymus mushroom according to the present invention has excellent cell survival rate, remarkably reduces the volume of the tumor, significantly inhibits the growth of the tumor, decreases the mRNA expression of Bcl-2 and increases mRNA expression of P53 , And has excellent anticancer activity. Therefore, the dichloromethane fraction of the present invention can be used for preventing or treating cancer.

Description

[0001] The present invention relates to a composition for preventing or treating cancer comprising dichloromethane fraction as an active ingredient,

The present invention relates to a composition for preventing or treating cancers containing dichloromethane fraction of Thymus mushroom as an active ingredient.

Cancer is characterized by "uncontrolled cell growth." These abnormal cell growths form a mass of cells called tumors that penetrate into surrounding tissues and, in extreme cases, to other organs of the body. Academicly, it is also called neoplasia.

Cancer is an intractable chronic disease that, even if treated with surgery, radiation, and chemotherapy, in many cases can not be cured, causes pain to the patient, and ultimately leads to death. More than 20 million people worldwide suffer from cancer, more than six million people die each year from cancer, and by 2020, 11 million people are expected to die of cancer, so cancer must be urgently addressed It is an important disease. Although cancer varies from country to country, it accounts for more than 20% of the total deaths in developed countries or Korea. However, despite many efforts, the precise cause and mechanism of cancer development is still unknown.

There are many factors that cause cancer, but they are divided into internal factors and external factors. It is not known exactly how the normal cells transform into cancer cells through the mechanism, but at least 80-90% of them are known to be affected by external factors such as environmental factors. Internal factors include genetic factors, immunological factors, and external factors include chemicals, radiation, and viruses. The genes involved in the development of cancer include oncogenes and tumor suppressor genes. Cancer occurs when the balance between them is destroyed by the internal or external factors described above.

Cancer is widely classified into blood cancer and solid cancer, and it occurs in almost all parts of the body such as lung cancer, stomach cancer, breast cancer, oral cancer, liver cancer, uterine cancer, esophageal cancer and skin cancer. Among the methods used to treat these malignant tumors, chemotherapeutic agents other than surgery or radiation therapy are collectively referred to as anticancer drugs, and most of them exhibit anticancer activity by inhibiting the synthesis of nucleic acids.

Chemotherapy agents are classified broadly into antimetabolites, alkylating agents, antimitotic drugs, and hormones. Metabolic antagonists inhibit the metabolic processes required for cancer cell proliferation and include folic acid derivatives such as methotrexate, purine derivatives such as 6-mercaptopurine and 6-thioguanine, 5 And pyrimidine derivatives such as 5-fluorouracil and cytarabine. The alkylating agent is an agent for introducing an alkyl group into the guanine of DNA to modify the structure of the DNA and cleave the chain to exert an anti-cancer effect. Examples of the alkylating agent include nitrogene mustard-based compounds such as chlorambucil and cyclophosphamide, An ethylenimine compound such as thiotepa, an alkyl sulfonate compound such as busulfan, a nitroso urea compound such as carmustine, or a triazine compound such as dacarbazine, have. The mitotic inhibitor is a mitotic phase specific drug that inhibits mitosis by blocking mitosis and is an anticancer anticancer agent such as actinomycin D, doxorubicin, bleomycin, mitomycin; Plant alkaloids such as vincristine and vinblastine; And a taxoid, which is a mitotic inhibitor including a taxane ring. In addition, hormones such as corticosteroids or progesterone and platinum-containing compounds such as cisplatin are used as anticancer drugs.

The biggest problem with chemotherapy is drug resistance, which is the main factor that ultimately causes treatment failure, despite the initial successful response to chemotherapy. In addition to research to identify the cause of drug resistance, there is a continuing need to develop an anticancer drug with a new mechanism in order to treat cancer with resistance to existing drugs. Anticancer drugs currently under development include drug resistance blockers, angiogenesis inhibitors, tumor metastasis inhibitors, and drugs targeting gene expression.

On the other hand, Auricularia auricular (Hook.) Underw is a mushroom belonging to the throat family. It is distributed throughout the world from spring to autumn and grows on hardwoods and dry branches of broad-leaved trees. Fruiting body is 3 ~ 12 ㎝ in diameter, bell - shaped in ears, gelatinous, visa - dull layer is dense with fine hairs and yellowish brown to red. Thymus mushroom contains abundant nutrients and its main components are 21 free amino acids, ergosterol, 6 fatty acids, 12 trace metals, vitamin B1, B2, D and niacin, glycerol, mannitol, Beta-glucan as antitumor component, Gluconoxylomannan as anti-inflammatory / cholesterol lowering component, and the like. The pharmacological actions of thymus mushrooms include anti-inflammatory, antitumor, anti-gram-negative, serum, and cholesterol-lowering effects (Korean Medicinal Mushroom Guidebook, 1999). The main functions of throat mushroom are nourishment by nourishment supply, ability to stimulate appetite by man, and control function to control the health condition of human body. Among the mushrooms, throat mushrooms are known to have a very high antitumor inhibitory rate. They are good for improving the odor, stopping the dysentery and the blood, purifying the blood, helping skin diseases, anemia, hypertension, Because it contains a large amount of natural gelatin, it promotes excretion and has a good effect on constipation, and anti-thrombotic function and memory enhancing function are also reported.

As described above, although various pharmacological effects of thrips mushrooms have been reported, the anticancer effect of the dichloromethane fraction of thrips mushrooms has not yet been known, and no studies have been conducted on them.

Therefore, there is a need for development of a dichloromethane fraction of chestnut mushroom as an effective substance for prevention or treatment of cancer.

The inventors of the present invention have studied the mushroom solvent fraction as an effective substance for preventing or treating cancer and found that the dichloromethane fraction in the mushroom solvent fraction is excellent in cell survival rate and remarkably reduces the volume of the tumor, And that the anticancer activity is very excellent by decreasing mRNA expression of Bcl-2 and increasing mRNA expression of P53, thus completing the present invention.

Accordingly, the present invention is intended to provide a composition for preventing or treating cancer comprising dichloromethane fraction of Staphylococcus epidermidis as an active ingredient.

The present invention provides a composition for preventing or treating cancer comprising a dichloromethane fraction of Chestnut mushroom as an active ingredient.

The composition comprises a pharmaceutical composition or a food composition.

Hereinafter, the present invention will be described in detail.

The mushroom extract of the present invention and the solvent fraction thereof can be obtained by a conventional extraction method, and commercially available ones can be purchased and used. Typical extraction methods include, but are not limited to, ultrasonic extraction, filtration, and reflux extraction.

In the composition of the present invention, the dichloromethane fraction of chestnut mushroom, which is an active ingredient, can be obtained by the following method. First, the throat mushroom is dried and crushed to powder. Add throat mushroom powder to water, C ₁ -C ₄ alcohol or a mixed solvent of water and alcohol, then immerse at 80 to 100 ° C for 5 to 7 hours and extract twice. At this time, the volume of the solvent is 1 to 10 times, preferably 3 to 8 times the weight of the mushroom powder. The C ₁ -C ₄ alcohol may be selected from 1 to 100% methanol or 1 to 100% ethanol, and preferably 1 to 100% ethanol. Then, the mushroom extract is filtered, and the filtrate is distilled under reduced pressure to obtain a crude mushroom crude extract.

Distilled water is added to the above-obtained mushroom crude extract, and an equal amount of dichloromethane is added. The mixture is allowed to stand for 24 hours to separate into an aqueous layer and a dichloromethane layer. Ethyl acetate was added to the aqueous layer, and the mixture was allowed to stand for 24 hours to separate into an aqueous layer and an ethyl acetate layer. To the aqueous layer was added n-butanol and the mixture was allowed to stand for 24 hours to separate into an aqueous layer and an n-butanol layer.

The ethanol extract of Throat fungus obtained above and the respective solvent fractions (dichloromethane, ethyl acetate, n-butanol, water) isolated therefrom were mixed with mouse leukemia cell line (P388D1) and sarcoma 180 cell line, human- NSCLC NCI H358) and gastric cancer cell line (SNU1), and the cell survival rate was measured by MTT assay and SRB assay. As a result, the best cell survival rate was shown in the mushroom dichloromethane (DCM) fraction, Respectively.

In addition, when a mouse transplanted with a sarcoma 180 mouse-derived sarcoma cell line, the volume of the tumor was reduced to a size similar to that of the positive control doxorubicin and significantly decreased compared to the negative control group , Tumor growth inhibition rate is significantly better than negative control, and spleen index is lower than negative control.

In addition, the dormant dichloromethane fraction (DCM) shows excellent anticancer activity by decreasing mRNA expression of Bcl-2 and increasing mRNA expression of P53 in human-derived lung cancer cell line (NSCLC NCI H358) and gastric cancer cell line (SNU1) Concentration-dependent decrease of DPPH free radical scavenging activity.

As described above, the thymus mushroom dichloromethane fraction according to the present invention has excellent cell survival rate, remarkably reduces tumor volume, significantly inhibits tumor growth, reduces Bcl-2 mRNA expression, By increasing mRNA expression, the anticancer activity is excellent.

Therefore, the dichloromethane fraction of the present invention can be used for preventing or treating cancer.

Wherein the cancer is selected from the group consisting of lung cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, gastric cancer, Endometrioid cancer, thyroid cancer, pituitary cancer, adrenal cancer, sarcoma cancer, urethral cancer, penile cancer, prostate cancer, uterine cancer, endometrial cancer, endometrial cancer, uterine cancer, vaginal cancer, vulvar carcinoma, Hodgkin's disease, (CNS), primary central nervous system lymphoma, spinal cord tumor, brainstem glioma, pituitary adenoma, and the like, as well as a prophylactic or therapeutic agent for the treatment or prophylaxis of chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or ureteral cancer, .

The composition of the present invention may contain at least one known active ingredient having anticancer activity together with the dichloromethane fraction of the mushroom mushroom.

The composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the above-described effective ingredients for administration. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components. If necessary, an antioxidant, , And other conventional additives such as a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA.

The composition of the present invention may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) depending on the intended method, and the dose may be appropriately determined depending on the patient's weight, age, , Diet, administration time, method of administration, excretion rate, and severity of the disease. The daily dosage of the dichloromethane fraction of the throat mushroom is about 10 to 20,000 mg / kg, preferably about 60 to 2,000 mg / kg, and is preferably administered once a day to several times a day.

The composition of the present invention can be used alone or in combination with methods for the prevention or treatment of cancer or using surgery, hormone therapy, drug therapy and biological response modifiers.

The composition of the present invention can be added to a health functional food for the purpose of preventing or improving cancer. When the dichloromethane fraction of the present invention is used as a food additive, the dichloromethane fraction of the present invention can be used as it is or in combination with other food or food ingredients, and can be suitably used according to a conventional method. The amount of the active ingredient to be mixed can be suitably determined according to the intended use (prevention, health or therapeutic treatment). Generally, in the production of foods or beverages, the throat mushroom dichloromethane fraction of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount exceeding the above range.

There is no particular limitation on the kind of the food. Examples of the food to which the above substances can be added include dairy products including meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, Alcoholic beverages, and vitamin complexes, all of which include health functional foods in a conventional sense.

The health beverage composition of the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. The above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, polysaccharides such as disaccharides such as maltose and sucrose, dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate is generally about 0.01 to 0.20 g, preferably about 0.04 to 0.10 g per 100 ml of the composition of the present invention.

In addition to the above, the composition of the present invention may further contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acids and salts thereof, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, A carbonating agent used in a carbonated beverage, and the like. In addition, the composition of the present invention may contain flesh for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components may be used independently or in combination. Although the ratio of such additives is not critical, it is generally selected in the range of 0.01 to 0.20 parts by weight per 100 parts by weight of the composition of the present invention.

The diclofenac fraction of Thymus mushroom according to the present invention has excellent cell survival rate, remarkably reduces the volume of the tumor, significantly inhibits the growth of the tumor, decreases the mRNA expression of Bcl-2 and increases mRNA expression of P53 , And has excellent anticancer activity.

Brief Description of the Drawings Fig. 1 is a schematic view showing a process for separating an extract of Chestnut mushroom and a solvent fraction thereof according to the present invention.
FIG. 2 is a graph showing the cell survival rate of a thymus mushroom extract and a solvent fraction thereof of a mouse-derived leukemia cell line (P388D1) by MTT assay (A: ethyl acetate fraction (EtOAc), B: fraction, C: dichloromethane (DCM) fraction, D: ethanol (EtOH) extract, E: water (H ₂ O) fraction).
FIG. 3 is a graph showing the results of MTT assay for the cell survival rate of the chestnut mushroom extract and the solvent fraction thereof against a mouse-derived sarcoma 180 cell line (A: ethylacetate fraction (EtOAc), B: butanol BuOH) fraction, C: dichloromethane (DCM) fraction, D: ethanol (EtOH) extract, E: water (H ₂ O) fraction).
FIG. 4 is a graph showing the effect of the dichloromethane fraction of the present invention on tumor volume and tumor growth inhibition rate in an animal model transplanted with a mouse-derived sarcoma 180 cell line (A: tumor volume, B: tumor growth Lt; / RTI >
FIG. 5 is a graph showing the effect of the dichloromethane fraction of the present invention on the spleen size in an animal model transplanted with a mouse-derived sarcoma 180 cell line. FIG.
FIG. 6 shows the results of MTT assay for the cell survival rate of human chestnut mushroom extract and its solvent fraction against a human-derived lung cancer cell line (NSCLC NCI H358) (A: ethyl acetate fraction (EtOAc), B: BuOH) fraction, C: dichloromethane (DCM) fraction, D: ethanol (EtOH) extract, E: water (H ₂ O) fraction).
FIG. 7 is a graph showing the cell survival rate of a human chestnut mushroom extract and its solvent fraction for a human gastric cancer cell line (SNU1) measured by MTT assay (A: ethyl acetate fraction (EtOAc), B: fraction, C: dichloromethane (DCM) fraction, D: ethanol (EtOH) extract, E: water (H ₂ O) fraction).
FIG. 8 shows the effect of the extract of the present invention and its solvent fraction on mRNA expression of Bcl-2, Bax, P53 and CD147 in a lung cancer cell line (NSCLC NCI H358) (1: negative control (PBS) 5: ethylacetate fraction (EtOAc), 6: butanol (BuOH) fraction, 7: water fraction (H ₂ O) )).
FIG. 9 is a graph showing the effect of the extract of the present invention and its solvent fraction on mRNA expression of Bcl-2, Bax, P53 and CD147 in a gastric cancer cell line (SNU1) (1: negative control (PBS) 5: ethylacetate fraction (EtOAc), 6: butanol (BuOH) fraction, 7: water fraction (H ₂ O)) as a positive control (doxorubicin), 3: ethanol extract (EtOH), 4: dichloromethane fraction .
10 is a graph showing the measurement results of the DPPH free radical scavenging activity of the dichloromethane fraction of Thymus mushroom of the present invention.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples.

Example One : Preparation of Extract of Chestnut mushroom and Its Fraction of Solvent

1. Preparation of ethanol extract of Thymus mushroom

Dried by hot air blowing, dried and crushed to a powdery state, with a water content of 10% or less. To 20 g of throat mushroom powder was added 1 L of 70% ethanol, followed by immersion for 6 hours at 100 DEG C, followed by extraction twice and filtration. The filtrate was concentrated by distillation under reduced pressure (ethanol removal) to obtain ethanol extract of Mushroom mushroom (3.56 g). The ethanol extract of Thymus mushroom was dissolved in 10% DMSO solution and used in the experiment.

2. Preparation of the solvent fraction of thistle mushroom from ethanol extract of Thymus mushroom

500 ml of distilled water was added to the ethanol extract of Thymus mushroom obtained in the above step 1, and an equal amount of dichloromethane was added thereto. The mixture was allowed to stand for 24 hours, and separated into an aqueous layer and a dichloromethane layer (0.21 g). 500 ml of ethyl acetate was added to the water layer, and the mixture was allowed to stand for 24 hours, and the aqueous layer was separated into ethyl acetate layer (0.04 g). 500 ml of n-butanol was added to the water layer, and the mixture was allowed to stand for 24 hours to separate an aqueous layer (2.84 g) and an n-butanol layer (0.18 g). Each solvent fraction was then dried and dissolved in 10% DMSO and used in the experiment.

The process for separating the extract of Thripsch mushroom and its solvent fraction according to the present invention is shown in FIG.

Experimental Example One : Anticancer Activity Measurement of Extracts of Mushroom Mushroom and Its Solvent Fraction

In order to confirm the anticancer activity of the extract of the present invention and its solvent fraction, the following experiment was conducted.

1. Cell culture

The leukemia cell line (P388D1) and the sarcoma cell line (sarcoma 180) used in this experiment were mouse-derived tumor cell lines and were sold in KOREAN CELL LINE BANK. The culture medium for the culture and maintenance of the tumor cell line was RPMI 1640, and 10% fetal bovine serum (FBS) was added thereto. The culture medium in which the penicillin and streptomycin were mixed at 10,000 units / ml and 10 mg / 25 cm < ₂ > at 37 < 0 > C, 5% And cultured in a cell incubator.

2. Measurement of cell survival rate

(MTT) assays (Mosmann et al., 1983) and SRB (sulforhodamine B) assays (Kim et al., 2004) were used to evaluate the cell viability of the extracts and their solvent fractions against Leukemia cell line (P388D1) and sarcoma cell line 1996) was slightly modified and performed as follows. Doxorubicin (DOX) was used as a positive control.

2-1. MTT Assay

(P388D1) and an sarcoma cell line (sarcoma 180) were inoculated so as to have a cell number of 5,000 per well. Each of the solvent fractions of the mushroom prepared in Example 1 was cultured at 1, 0.3, 0.1 , 0.03, and 0.01 mg / ml, respectively. And cultured for 4 days after inoculation. After the incubation, 50 μl of MTT (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide, SIGMA, USA) was added to each well and further cultured for 4 hours. After the incubation, the medium was carefully removed from each well. Then, 150 μl of DMSO (dimethylsulphoxide) was added to each well to dissolve the formazan crystal. The stained cell plates were measured for absorbance at 490 nm using a microplate reader (VERSAmax (TM), Molecular Devices, USA). The number of cells (%) was measured by the following formula (1) to evaluate the effect of each fraction of the mushroom solvent on the tumor cells. Statistical analysis was performed using SAS statistical package (release 8.1 SAS Institute Inc., Cary, North Carolina, USA) and statistical significance was determined at p <0.05 level.

[ Equation One]

Cell number (%) = [absorbance of well treated with throat mushroom solvent fraction / absorptivity of negative control well without treatment of test substance] x 100

The results of MTT assay of the cell viability of the thymus mushroom extract and the solvent fraction thereof against the leukemia cell line (P388D1) are shown in Tables 1, 2 and 2, And the cell survival rate of the solvent fraction thereof were measured by MTT assay are shown in Tables 1, 2 and 3.

Thirsty mushroom solvent fraction
(1 mg / ml) MTT assay Leukemia cell line
(P388D1) Sarcoma cancer cell line
(sarcoma 180) The ethyl acetate fraction (EtOAc) 42.78 0.78 ^# 69.61 ± 2.19 Butanol (BuOH) fraction 48.13 ± 3.16 ^# 65.74 ± 2.44 The dichloromethane (DCM) fraction 53.95 + - 7.67 ^# 73.97 ± 1.11 Ethanol (EtOH) extract 46.57 ± 6.32 65.71 + - 9.14 The water (H ₂ O) fraction 37.23 + - 0.87 64.48 + - 3.51 The positive control (Dox, 1 mg / ml) 44.33 + - 9.11 72.54 + 0.26

#: P <0.05

Thirsty mushroom solvent fraction
(占 퐂 / ml) IC ₅₀ Leukemia cell line
(P388D1) Sarcoma cancer cell line
(sarcoma 180) The ethyl acetate fraction (EtOAc) 143.80 108.90 Butanol (BuOH) fraction 94.62 134.10 The dichloromethane (DCM) fraction 38.32 94.20 Ethanol (EtOH) extract 44.03 133.00 The water (H ₂ O) fraction 28.19 102.30 The positive control (Dox, ng / ml) 100.00 95.00

As shown in Table 1, Table 2, Fig. 2 and Fig. 3, the cell survival rate of the mushroom extract and its solvent fraction was measured by MTT assay for mouse-derived leukemia cell line (P388D1) and sarcoma cell line (sarcoma 180) As a result, it was confirmed that the best cell survival rate was obtained in the diclofenac dichloromethane (DCM) fraction and the anticancer activity was the best.

2-2. SRB Assay

A mouse-derived leukemia cell line (P388D1) and an sarcoma cell line (sarcoma 180) were inoculated in a 96-well plate so as to be 10,000 cells per well, followed by culturing for 24 hours. Each solvent fraction of the mushroom prepared in Example 1 was inoculated at 1 mg / ml and further cultured for 48 hours. Tumor cells were supplemented with 50% TCA (trichloroacetic acid), fixed at 4 ° C for 2 hours, and washed 5 times with distilled water to remove the fixative. Tumor cells were stained with 0.4% sulforhodamine B (SIGMA) for 30 min at room temperature. Tris base (10 mM, pH 10.5) was added to the tumor cells to stain only the surviving tumor cells It dissolved. The stained cell plates were measured for absorbance at 490 nm using a microplate reader. The number of cells (%) was measured by the above equation (1) in order to evaluate the effect of each fraction of the mushroom solvent on the tumor cells.

The results are shown in Table 3.

Thirsty mushroom solvent fraction
(1 mg / ml) SRB assay Leukemia cell line
(P388D1) Sarcoma cancer cell line
(sarcoma 180) The ethyl acetate fraction (EtOAc) 46.01 ± 2.12 ^# 69.08 + - 4.03 ^# Butanol (BuOH) fraction 51.17 ± 2.07 ^# 67.53 + - 1.30 ^# The dichloromethane (DCM) fraction 51.71 + - 3.71 ^# 72.67 + - 2.47 ^# Ethanol (EtOH) extract 47.42 ± 6.33 59.67 ± 1.97 The water (H ₂ O) fraction 37.93 + - 1.70 58.39 + - 4.59 The positive control (Dox, 1 mg / ml) 46.04 + - 2.76 72.81 ± 2.09

#: P <0.05

As shown in Table 3, the cell survival rate of the extracts of Sphagnum mushroom and the solvent fraction thereof for the mouse-derived leukemia cell line (P388D1) and the sarcoma cell line (sarcoma 180) were measured by SRB assay, ) Fraction showed the best cell survival rate and the best anticancer activity.

Experimental Example 2 : Measurement of Anticancer Activity of Dichloromethane Fraction in Throat Mushroom in Animal Model in vivo )

In order to confirm the anticancer activity of the dichloromethane fraction of Chrysanthemum morifolium, which showed the best anticancer activity in Experimental Example 1, in an animal model, the following experiment was conducted.

1. Measurement of tumor volume and tumor growth inhibition rate

Seven-week-old male BALB / c mice (Charles River Technology) were purchased from Orient. The weight of the mouse was 22 ~ 24 g. In the laboratory animal room, the temperature was maintained at 20 ~ 25 ℃ for 12 hours and the relative humidity was maintained at 55 ± 10%. Sarcoma 180, a Korean cell line bank, was cultured in RPMI medium and transplanted into an animal model. That is, sarcoma 180 (2 × 10 ⁶ cells / 0.2 ml / mouse) was diluted in physiological saline (0.85% NaCl) and subcutaneously injected into mice. On the 6th day after inoculation, a visible mass of cancer was observed. Procedures for all animal experiments were approved by Kyungpook National University Experimental Animal Ethics Committee. Animal models were adapted for use in the animal breeding room for 1 week.

The experimental animals were divided into 4 groups and 6 animals were assigned to each group. Group 1 (normal) was not inoculated with cancer cells. Group 2 (negative control) was orally administered 0.85% physiological saline after inoculation of cancer cells. Group 3 (experimental group) (100 mg / kg bw, po). After 7 days of administration, the size and presence of cancer were confirmed. Group 4 (positive control) was administered with doxorubicin (3 mg / kg b.w., i.p.) in the abdominal cavity of mice after inoculation with cancer cells. After 7 days of dosing, all mice were sacrificed. Then, the tumor mass was measured, and the inhibition rate of the tumor growth and the tumor volume were calculated by the following equations (2) and (3), respectively (Lee et al., 2003). The results are shown in Table 4 and FIG.

[ Equation 2]

Inhibitory rate (%) of tumor growth = [1- (T / C)] x 100

※ T: Tumor size of experimental group, C: Tumor size of negative control group.

[ Equation 3]

Tumor volume (cm3) = 4/3? (A2b) / 2,

※ a: Short diameter (㎟), b: Long diameter (㎟).

Weight (g) Tumor weight (g) Tumor growth inhibition (%) Full regression
(complete regression) Negative control group 26.00 ± 1.27 1.89 ± 0.15 00.00 0/6 Positive control group
(Doxorubicin) 26.67 ± 1.63 0.96 + 0.76 49.23 2/6 Experimental group
(Dichloromethane fraction of chestnut mushroom) 27.5 + 1.38 1.08 + - 0.84 42.62 2/6

As shown in FIG. 4, when the chimeric dichloromethane fraction of the present invention was administered to mice transplanted with a mouse-derived sarcoma 180 cell line, the tumor volume was reduced to a size similar to that of the positive control doxorubicin, Compared to the control group (A). In addition, the inhibition rate of tumor growth was remarkably superior to that of the negative control, and the tumor size was reduced to 76.13% (B).

In addition, as shown in Table 4, the tumor weight of the group administered with the dichloromethane fraction of the present invention and the positive control group was reduced to 33.33% as compared with the negative control group in mice transplanted with a sarcoma 180 mouse derived sarcoma cell line , Tumor growth inhibition rate of 40 ~ 50%. However, there was no difference in weight change among the three groups.

2. Spleen index ( Spleen Index ) Measure

Spleen is an important organ that plays a role in hematopoiesis, including granulocytes, monocytes, lymphocytes and non-granular leukocytes. This plays an important role in humoral immunity in mice. The high spleen index of mice with splenic hypertrophy and cancer is known to be caused by paraneoplastic syndrome and is influenced by splenic cytokines and humoral factors in the presence of cancer (Yoneda et al., 1991.).

Therefore, in order to examine the influence of the dichloromethane fraction of the throat mushroom on the spleen size in the animal model transplanted with the sarcoma 180 cell line, the spleen was aseptically extracted from the tumor animal model of each experimental group to measure the spleen weight Respectively. The spleen index was calculated according to Equation (4) based on the weight of the spleen and mouse body weight. The results are shown in Fig.

[ Equation 4]

As shown in FIG. 5, it was confirmed that the spleen index of the group administered with the dichloromethane fraction of Chrysanthemum morifolium was three times lower than that of the negative control group. Therefore, it can be seen that the dichloromethane fraction of the thymus mushroom has excellent anticancer activity.

Experimental Example 3 : Anticancer Activity Measurement of Extracts of Mushroom Mushroom and Its Solvent Fraction

In order to confirm the extract of the present invention and its solvent fraction in the lung cancer cell line (NSCLC NCI H358) and the gastric cancer cell line (SNU1), the following experiment was conducted.

1. Cell culture

The lung cancer cell line (NSCLC NCI H358) and the gastric cancer cell line (SNU1) used in this experiment were human-derived tumor cell lines and were sold in Korean Cell Line Bank (Seoul, Korea). These cell lines were cultured in RPMI-1640 medium containing 10% FBS (fetal bovine serum), L-glutamine (2 mM), penicillin (100 iu / ml) and streptomycin (10 mg / . The culture conditions were as follows: 37 ° C, 5% CO ₂ incubator.

2. Measurement of cell viability - MTT Assay

The cell viability of chestnut mushroom extract and its solvent fraction for human lung cancer cell line (NSCLC NCI H358) and gastric cancer cell line (SNU1) was slightly modified by MTT (microtetrazolium) assay (Mosmann et al., 1983) as follows.

Specifically, a human-derived lung cancer cell line (NSCLC NCI H358) and a gastric cancer cell line (SNU1) were inoculated into each well of a 96-well plate at a cell number of 1 × 10 ⁵ per well, and pre- Were inoculated at a concentration of 1, 0.3, 0.1, 0.03, and 0.01 mg / ml. And cultured for 4 days after inoculation. After the incubation, 50 μl of MTT (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide, SIGMA, USA) was added to each well and further cultured for 4 hours. After the incubation, the medium was carefully removed from each well. Then, 150 μl of DMSO (dimethylsulphoxide) was added to each well to dissolve the formazan crystal. The stained cell plates were measured for absorbance at 490 nm using a microplate reader (VERSAmax (TM), Molecular Devices, USA). The number of cells (%) was measured by the above equation (1) in order to evaluate the effect of each fraction of the mushroom solvent on the tumor cells. Doxorubicin (DOX) was used as a positive control.

The results of MTT assay of the cell viability of the chestnut mushroom extract and its solvent fraction for the human-derived lung cancer cell line (NSCLC NCI H358) and the gastric cancer cell line (SNU1) are shown in FIGS. 6 and 7, respectively.

As shown in FIGS. 6 and 7, the cell survival rate of the human chestnut mushroom extract and its solvent fraction was measured by a MTT assay for a human-derived lung cancer cell line (NSCLC NCI H358) and a gastric cancer cell line (SNU1) Methane (DCM) fraction showed the best cell survival rate and showed the best anticancer activity.

Experimental Example 4 : Extract of Chestnut mushroom and its solvent fraction Bcl -2, Bax , P53 And CD147 of mRNA Effect on expression

Bax, P53 and CD147 mRNA expression in the lung cancer cell line (NSCLC NCI H358) and the gastric cancer cell line (SNU1), the following experiment was conducted. Respectively.

Specifically, the cells were cultured in a human-derived lung cancer cell line (NSCLC NCI H358) and a gastric cancer cell line (SNU1), and then total RNA was extracted using a triazole reagent (BioNEER, Korea). The isolated total RNA was incubated with RNA oligo (dT) 15 primer. For apoptosis analysis, PCR amplification was performed using Bax, Bcl-2, P53 and CD147 as four human apoptosis primers. β-actin was used as a housekeeping gene. The primers used are shown in Table 5 below.

gene primer Accession No. β-actin (S) CTGTCTGGCGGCACCACCA X00351 .One (AS) GCAACTAAGTCATAGTCCGC Bax (S) AAGCTGAGCGAGTGTCTCAAGCGC L 22473 (AS) TCCCGCCACAAAGATGGTCACG Bcl-2 (S) AGATGTCCAGCCAGCTGCACCTGAC M 13994 (AS) AGATAGGCACCCAGGGTGATGCAAGCT P53 (S) AAGACCTGCCCTGTG NM_000546.4 (AS) TGACGCACACCTATTGCAAG CD147 (S) CCATGCTGGTCTGCAAGTCAG AB085790 (AS) CCGTTCATGAGGGCCTTGTC

Reaction conditions for PCR amplification were as follows: Initial denaturation was 5 min at 95 ° C (Bax, Bcl-2 and β-actin), 5 min at 94 ° C (P53) and 1 min at 94 ° C (CD 147). The amplification conditions were: denaturation at 95 DEG C for 30 seconds for Bcl-2 , annealing for 30 seconds at 66 DEG C and 40 cycles for elongation at 72 DEG C for 30 seconds; 35 cycles of denaturation at 94 DEG C for 30 seconds, annealing at 64 DEG C for 45 seconds, and extension at 72 DEG C for 30 seconds for Bax ; 40 cycles of denaturation at 94 DEG C for 30 seconds for P53 , annealing for 45 seconds at 62 DEG C and extension at 72 DEG C for 30 seconds; For CD147 , denaturation at 97 DEG C for 20 seconds, annealing at 64 DEG C for 20 seconds, and elongation at 72 DEG C for 20 seconds; For β-actin , denaturation at 95 ° C for 45 seconds, annealing at 55 ° C for 45 seconds and elongation at 72 ° C for 45 seconds. 30 cycles: Finally, additional extension at 72 ° C for 10 minutes for all genes, .

PCR amplification was performed by a thermocycler (2720 Thermal Cycler, Applied Biosystems, U.S.A.) and AccuPower RT-Premix (BioNEER, Korea) according to the manufacturer's instructions. The RT-PCR product was analyzed with 2% TAE agarose gel. Stained with ethidium bromide and analyzed with EAGLE-EYE ™ (Startagene, La. Jolla, CA, USA).

The effects of the extract of the present invention and its solvent fraction on mRNA expression of Bcl-2, Bax, P53 and CD147 in lung cancer cell lines (NSCLC NCI H358) and gastric cancer cell line (SNU1) are shown in FIGS. 8 and 9, respectively .

As shown in FIGS. 8 and 9, the DCM fraction of the throat mushroom decreased the expression of Bcl-2 mRNA in human lung cancer cell lines (NSCLC NCI H358) and gastric cancer cell line (SNU1) Respectively. Therefore, it can be seen that the thymus mushroom dichloromethane (DCM) fraction of the present invention shows the most excellent anticancer activity.

Experimental Example 5 : Determination of Antioxidative Activity of Dichloromethane Fraction of Mushroom Mushroom

In order to confirm the antioxidative activity of the dichloromethane fraction of the present invention, DPPH free radical scavenging activity of dichloromethane fraction (10, 3, 1, 0.3, 0.1 mg / ml) Were measured. As a positive control, ascorbic acid was used.

The results are shown in FIG.

As shown in Fig. 10, the dichloromethane fraction of the present invention showed a concentration-dependent decrease in DPPH free radical scavenging activity.

Examples of formulations for the composition of the present invention are illustrated below.

Formulation example One : Preparation of pharmaceutical preparations

1. Manufacturing of powder

Dichloromethane fraction 200 mg

Lactose 100 mg

The above components were mixed and packed in airtight bags to prepare powders.

2. Preparation of tablets

Dichloromethane fraction 200 mg

100 mg of corn starch

Lactose 100 mg

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

3. Preparation of capsules

Dichloromethane fraction 200 mg

100 mg of corn starch

Lactose 100 mg

Magnesium stearate 2 mg

After mixing the above components, the capsules were filled in gelatin capsules according to the conventional preparation method of capsules.

4. Preparation of injections

Dichloromethane fraction 200 mg

100 mg mannitol

Na ₂ HPO ₄ .12H ₂ O 2 mg

Sterile sterilized water for injection

Injection was prepared by mixing the above components per ampoule (2 mL) according to the usual injection preparation method.

Formulation example 2 : Manufacturing of food

Foods containing the throat mushroom dichloromethane fraction of the present invention were prepared as follows.

1. Preparation of cooking seasoning

A cooked seasoning for health promotion was prepared from 20 to 95% by weight of dichloromethane fraction of chestnut mushroom.

2. Manufacture of tomato ketchup and sauce

0.2 ~ 1.0 wt% of dichloromethane fraction of chestnut mushroom was added to tomato ketchup or sauce to prepare healthy tomato ketchup or sauce.

3. Manufacture of flour food

0.5 ~ 5.0 wt.% Of the dichloromethane fraction was added to wheat flour, and bread, cake, cookies, crackers and noodles were prepared using this mixture to prepare foods for health promotion.

4. Manufacture of soups and gravies

0.1 ~ 5.0 wt.% Of dichloromethane fraction of Thunbuchon mushroom was added to soup and juice to prepare health promotion meat product, noodle soup and juice.

5. Manufacture of ground beef

A ground beef for health promotion was prepared by adding 10% by weight of dichloromethane fraction to the ground beef.

6. Manufacture of dairy products

5 to 10% by weight of the dichloromethane fraction of chestnut mushroom was added to milk, and the milk was used to make various dairy products such as butter and ice cream.

Formulation example 3 : Manufacture of beverages

1. Manufacture of carbonated beverages

Syrup mushroom Mix the additives of 10 ~ 15% of dichloromethane fraction, 5 ~ 10% of sugar, 0.05 ~ 0.3% of citric acid, 0.005 ~ 0.02% of caramel and 0.1 ~ 1% of vitamin C and mix 75 ~ 80% I made syrup. The syrup was sterilized at 85 to 98 ° C for 20 to 180 seconds, mixed with cooling water at a ratio of 1: 4, and 0.5 to 0.82% of carbon dioxide gas was injected to prepare a carbonated drink containing a dichloromethane fraction of mushroom.

2. Manufacture of health drinks

(70%, 0.12%), vitamin C (0.02%), calcium pantothenate (0.02%), and water extracts of the dormant mushroom dichloromethane (solid content: 2.5%, 97.16%), jujube extract , And licorice extract (solid content: 65%, 0.01%) were uniformly blended and instant sterilized, and then packaged in small containers such as glass bottles and plastic bottles to produce health drinks.

3. Manufacture of vegetable juice

Healthy vegetable juice was prepared by adding 0.5g of dichloromethane fraction to 1000ml of tomato or carrot juice.

4. Manufacture of fruit juice

Healthy fruit juice was prepared by adding 0.1 g of dichloromethane fraction of chestnut mushroom to 1,000 ml of apple or grape juice.

Claims

A pharmaceutical composition for preventing or treating cancer comprising dichloromethane fraction as an active ingredient.

The method of claim 1, wherein the cancer is selected from the group consisting of lung cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, gastric cancer, , Breast cancer, fallopian tube carcinoma, endometrial carcinoma, cervical cancer, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small bowel cancer, endocrine cancer, thyroid cancer, pituitary cancer, adrenal cancer, sarcoma cancer, (CNS) tumors, primary central nervous system lymphoma, spinal cord tumors, brain tumors, prostate cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or ureteral cancer, kidney cell carcinoma, renal pelvic carcinoma, Glioma, and pituitary adenoma. The pharmaceutical composition for preventing or treating cancer according to claim 1,

The pharmaceutical composition according to claim 2, wherein the cancer is lung cancer, gastric cancer, chronic or acute leukemia, or sarcoma.

A food composition for preventing or ameliorating cancer comprising dichloromethane fraction as an active ingredient.