KR20140100925A - Method for diagnosing and screening asthma using neuropilin 1 - Google Patents

Abstract

The present invention relates to a kit for diagnosing and screening asthma including neuropilin (NRP) genes and to a method for screening an asthma treating agent using the same. In particular, the expression of NRP1 is increased by means of an asthma patient and a dust mite extract. The mRNA of asthma-related MMP9, the expression of proteins, the activities of enzymes, and the activities of promoters are decreased by means of the controlled expression f NRP1. As a result, it has been confirmed that NRP1 can be usefully applied as a target for developing an asthma treating agent.

Description

Ｎｅｕｒｏｐｉｌｉｎ １ A method for diagnosing asthma and screening asthma treatment using a gene {Method for diagnosing and screening asthma using Neuropilin １}

The present invention relates to the use of the NRP1 gene as an asthma marker or a target for the development of an asthma therapeutic agent.

Allergic diseases with increasing incidence worldwide include anaphylaxis, allergic rhinitis, and asthma, atopic dermatitis and urticaria (Wuthrich B. Int.Arch.Allergy Appl.Immunol., 90, pp3-10, 1989). Among these allergic diseases, asthma is a disease characterized by bronchial hyperresponsiveness to various stimuli, causing chronic airway inflammation and wheezing caused by extensive narrowing of the airways.喘鳴), dyspnea, cough, etc., which can be improved spontaneously or reversibly by treatment (Minoguchi K and Adachi M. Pathophysiology of asthma. In: Cherniack NS, Altose MD, Homma I, editors.Rehabilitation) of the patient with respiratory disease.New York: McGraw-Hill , pp97-104, 1999).

In general, asthma is recognized as a chronic inflammatory disease caused by proliferation, differentiation, and activation of inflammatory cells by interleukin-4, 5, and 13 produced by TH2 type immune cells, moving to and infiltrating the airways and surrounding tissues (Elias JA , et al., J. Clin. Invest. , 111, pp291-297, 2003). In this case, inflammatory cells such as activated eosinophils, mast cells, alveolar macrophages, etc. secrete various inflammatory mediators (cysteine leukotriene, prostaglandin, etc.), and strong bronchial contraction plays an important role in the process (Maggi E., Immunotechnology , ). 3, pp233-244, 1998; Pawankar R., Curr. Opin.Allergy Clin. Immunol ., 1, pp3-6, 2001; Barnes PJ, et al., Pharmacol Rev. , 50, pp515-596, 1998).

Therefore, the production of cytokines such as IL-4, IL-5, and IL-13, which are involved in inflammatory cell activation, and immunoglobulin E, and the biosynthesis of cysteine leukotriene secreted from inflammatory cells such as eosinophils due to their action, are related to inflammation and allergic reactions Since it is a major cause of asthma caused by, many studies are being conducted to develop drugs to inhibit their production. In particular, understanding of allergic diseases, including asthma and non-conjunctivitis, is gaining a lot from studies using animal models. Research using animal models not only made it possible to understand the immunological mechanisms underlying allergies, but also evaluated the therapeutic agents under development.

Neuropilin (NRP) includes neuropilin 1 and neuropilin 2. Neuropilin 1 and neuropilin 2 were first discovered in neurons (Takagi S et al., Dev Biol, 1987). Subsequently, neuropilin 2 was identified as a receptor for semaphorin 3A (SEMA3A), which avoids axons and inhibits expression in growth cones, and mediates axon guidance. (He Z, Cell, 1997). Soon, neuropilin was known to play a role as a receptor of the vascular endothelial growth factor (VEGF) family, known as a receptor involved in angiogenesis (Soker S et al., Cell, 1998).

Neuropilin is 130 to 140 kDa, and as a single transmembrane glycoprotein, neuropilin 1 is composed of about 923 amino acids, neuropilin 2 is composed of about 926 amino acids, has a similar domain structure in common, and has a total of 44 It is known to have% amino acid homology (Caroline PELLET-MANY et al., Biochem J., 2008).

NRP1 and NRP2 are expressed in various types of human tumor cell lines and human tumors (neoplasms) and human tumors (Bielenberg, D. R et al, Exp. Cell Res, 2006; Soker, S. et al, Cell, 1998; Ellis, LM, Cancer Ther, 2006). In addition, it is known that VEGF and semaphorin are related to the effect of proliferation, survival, and migration of cancer cells (Bachelder, RE et al, Cancer Res, 2001; Chabbert-de Ponnat et al, J. Invest. Dermatol., 2006 ; Miao et al, FASEB J., 2000). NRP1 is produced in samples from patients with colon cancer, breast cancer, lung cancer, prostate cancer, and pancreatic cancer, but not in normal epithelial tissue. In addition, NRP1 has been found in various tumors such as neuroblastoma, malignant melanoma, and astrocytoma. NRP2 has been reported to be expressed in lung cancer, neuroblastoma, osteosarcoma, bowel cancer and bladder cancer. In addition, NRP1 is known to be expressed in various cell types including bone marrow-derived progenitor cells, platelets of bovine granulosa cells, and granulosa and theca cells (Caroline PELLET-MANY et al, Biochem J. ., 2008). NRP1 is expressed in naive T-cells and immature dendritic cells (antigen-presenting cells), and the cell type that responds to the initial immune response period in secondary lymphoid organs removes antigens. It is known to be essential for inducing proliferation and differentiation of mature T cells, which react again with antigen-presenting cells that mediate (Matthies, AM, et al, Am. J. Pathol., 2002).

There are many reports that NRP1 is overexpressed by tissue wound response, and it is estimated that it is involved in regeneration and recovery. In Xenopus, when the optic nerve is damaged and needs regeneration, the expression of NRP1 increases, and even after healing, the expression of NRP1 has been reported to increase over several weeks (Matthies, AM, et al, Am. J. Pathol). ., 2002). In addition, a large amount of NRP1 is found in new blood vessels in the wound angiogenesis process, and NRP1 plays an important role in angiogenesis through the result that angiogenesis due to wounds is reduced by anti-NRP1 antibodies. It can be seen that (Elena Geretti1 et al, Cell Adhesion & Migration, 2007).

Many animal models have been used to elucidate the function of NRP. In the first literature showing that NRP1 is involved in angiogenesis, when NRP1 was overexpressed in transgenic mice, the state of the embryo was endangered, and excessive blood vessel generation, dilated blood vessels, bleeding and abnormal heart and limbs. (limbs) showed symptoms of formation (Herzog Y et al., Mech Dev., 2001). In NRP1 gene-deficient mice, embryos died in the uterus between 12.5 and 13.5 days of onset, abnormal yolk sac, abnormal neurovascularization, abnormal vascular system, defect of normal branching, defect of capillary network, and bronchial arches. arches), dorsal aorta abnormalities, and cardiovascular abnormalities including aortic arches (Yuan L et al, Development, 2002). In mice with NRP2 gene deficiency, arteries and veins develop normally, but the formation of lymph nodes and microvessels is significantly reduced (Yuan L et al, Development, 2002). Mice in which the NRP1/NRP2 gene was knocked out at the same time die on the 8.5th day of onset, and more severe blood vessel formation such as avascular yolk sac, growth inhibition, and vascular development, capillary formation and lack of branches compared to mice with a NRP1 gene deletion. (Eichmann A et al, Int J Dev Biol, 2005).

Matrix metallopeptidase 9 (MMP9) protein is involved in the decomposition of the extracellular wall matrix in disease processes such as arthritis and metastasis, as well as normal physiological functions such as embryogenesis, regeneration and tissue remodeling. . Most MMPs are secreted in the form of inactive proproteins and are cleaved by extracellular proteinases. The enzyme encoded by MMP9 breaks down collagen IV and V types. According to a study using rhesus monkey, it was reported that the enzyme encoded by MMP9 is involved in the fluidity of bone marrow-derived hematopoietic progenitor cells by IL-8. According to the results, it has been reported that it is associated with tumor-related tissue remodeling.

MMP9 is derived from macrophages (Welgus HG et al, J Clin Invest, 1990), eosinophilic leukocytes (hno I et al, Am J Respir Cell Mol Biol., 1997), macrophages (Kanbe N, et al. , Eur J Immunol, 1999) and dendritic cells (Bartholome EJ, J Interferon Cytokine Res, 2001). MMP9 is an inflammatory molecule and also plays a role in sustaining an immune response (Renckens R. et al, J Immunol, 2006), and at the same time, it has a function that is involved in regeneration after tissue injury. As it is directly related to airway inflammation, it has been reported that MMP9 expression is increased in sputum and at the same time acts to thicken the airway (Matsumoto H, et al, Thorax, 2005). Currently, there are many reports that MMP9 is related to respiratory diseases such as asthma, but the exact mechanism has not been identified.

Accordingly, as a result of research for the development of asthma markers or asthma therapeutics, the present inventors have treated cells with a house dust mite (D.pteronissinus ) extract known to induce asthma, and the expression of inflammatory cytokines and NRP1 is increased, and asthma occurs. In the terminal blood cells of the patient, the expression of NRP1 was also significantly increased compared to the normal control, and the mRNA, protein, and enzyme activities of MMP9 were decreased by NRP1 expression or inhibitory activity, and the promoter activity of MMP9 was NRP1 expression or inhibitor of activity. The present invention was completed by revealing that NRP1 (neurophilin 1) can be usefully used as a marker for diagnosing asthma, and that the genetic marker can be used to screen for asthma treatment.

Takagi S, Tsuji T, Amagai T, Takamatsu T, Fujisawa H. Specific cell surface labels in the visual centers of Xenopus laevis tadpole identified using monoclonal antibodies. Dev Biol 1987; 122:90-100. He Z, Tessier-Lavigne M. Neuropilin is a receptor for the axonal chemorepellent. Semaphorin III. Cell 1997; 90:739?51. Soker S, Takashima S, Miao HQ, Neufeld G, Klagsbrun M. Neuropilin-1 is expressed by endothelial and tumor cells as an isoform?specific receptor for vascular endothelial growth factor. Cell 1998; 92:735-745. Caroline PELLET-MANY, Paul FRANKEL, Haiyan JIA, and Ian ZACHARY. (2008) Neuropilins: structure, function and role in disease (REVIEW ARTICLE) Bielenberg, D. R., Pettaway, C. A., Takashima, S. and Klagsbrun, M. (2006) Neuropilins in neoplasms: expression, regulation, and function. Exp. Cell Res. 312, 584-593 Soker, S., Takashima, S., Miao, H. Q., Neufeld, G. and Klagsbrun, M. (1998) Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell 92, 735-745 Ellis, L. M. (2006) The role of neuropilins in cancer. Mol. Cancer Ther. 5, 1099-1107 Bachelder, R. E., Crago, A., Chung, J., Wendt, M. A., Shaw, L. M., Robinson, G. and Mercurio, A. M. (2001) Vascular endothelial growth factor is an autocrine survival factor for neuropilin-expressing breast carcinoma cells. Cancer Res. 61, 5736-5740 Chabbert-de Ponnat, I., Buffard, V., Leroy, K., Bagot, M., Bensussan, A., Wolkenstein, P. and Marie-Cardine, A. (2006) Antiproliferative effect of semaphorin 3F on human melanoma cell lines. J. Invest. Dermatol. 126, 2343-2345 Miao, H. Q., Lee, P., Lin, H., Soker, S. and Klagsbrun, M. (2000) Neuropilin-1 expression by tumor cells promotes tumor angiogenesis and progression. FASEB J. 14, 2532-2539 Fujisawa, H., Takagi, S. and Hirata, T. (1995) Growth-associated expression of a membrane protein, neuropilin, in Xenopus optic nerve fibers. Dev. Neurosci. 17,343-349 Matthies, A. M., Low, Q. E., Lingen, M. W. and DiPietro, L. A. (2002) Neuropilin-1 participates in wound angiogenesis. Am. J. Pathol. 160, 289-296 Elena Geretti1, Michael Klagsbrun Targets for Anti-Angiogenesis Therapies Cell Adhesion & Migration 2007; Vol. 1 Issue 2 Herzog Y, Kalcheim C, Kahane N, Reshef R, Neufeld G. Differential expression of neuropilin-1 and neuropilin-2 in arteries and veins. Mech Dev 2001; 109:115-9. Yuan L, Moyon D, Pardanaud L, Breant C, Karkkainen MJ, Alitalo K, Eichmann A. Abnormal lymphatic vessel development in neuropilin 2 mutant mice. Development 2002;129:4797-4806. Eichmann A, Yuan L, Moyon D, Lenoble F, Pardanaud L, Breant C. Vascular development:From precursor cells to branched arterial and venous networks. Int J Dev Biol 2005;49:259-267.

An object of the present invention is to provide a kit for diagnosing asthma or a method for diagnosing asthma using the NRP1 (neurophilin 1) gene.

In addition, an object of the present invention is to provide a screening method for treating asthma using NRP1.

In addition, it is an object of the present invention to provide a pharmaceutical composition for the treatment of asthma containing an inhibitor of NRP1 gene expression or activity as an active ingredient.

The present invention provides a DNA microarray for diagnosis of asthma comprising the NRP1 (neurophilin 1) gene or a complementary strand molecule thereof.

In addition, the present invention provides a kit for diagnosing asthma comprising a DNA microarray for diagnosing asthma comprising the NRP1 (neurophilin 1) gene or a complementary strand molecule thereof.

In addition, the present invention provides a kit for diagnosing asthma comprising a primer set consisting of a forward primer and a reverse primer that is complementary to the NRP1 gene and capable of amplifying the gene.

In addition, the present invention provides a protein detection method for providing information on asthma diagnosis comprising the following steps:

1) measuring the expression level of NRP1 in the sample derived from the subject as an experimental group;

2) comparing the expression level of NRP1 in step 1) with the expression level of NRP1 in a sample derived from a normal individual as a control; And

3) Determining that the risk of developing asthma is high when the NRP1 expression level is increased compared to the control group.

In addition, the present invention provides a method for screening a therapeutic agent for asthma, comprising the following steps:

1) treating the test compound or composition to NRP1 or a cell line expressing NRP1 and MMP9;

2) measuring the expression level of NRP1, or NRP1 and MMP9 in the treated cell line of step 1); And

3) selecting a test compound or composition whose expression levels of NRP1, or NRP1 and MMP9 of step 2) are reduced compared to the untreated control cell line.

In addition, the present invention provides a screening method for treating asthma comprising the following steps:

1) treating the test compound or composition to an asthma diagnostic kit comprising a DNA microarray or a kit for diagnosing asthma comprising a primer set consisting of a forward primer and a reverse primer that is complementary to the NRP1 gene and capable of amplifying the gene;

2) measuring the expression level of NRP1 in the treated kit of step 1); And

3) selecting a test compound or composition whose NRP1 expression level of step 2) is decreased compared to the control group.

In addition, the present invention provides a pharmaceutical composition for the treatment of asthma containing an inhibitor of the expression or activity of the NRP1 gene as an active ingredient.

The expression of the NRP1 gene of the present invention is increased by treatment with a house dust mite extract, which is an asthma inducing factor, and its expression is observed in terminal blood cells of asthma patients compared to normal people, and expression of MMP9 related to asthma by suppressing the expression of NRP1, Since the enzyme activity and the activity of the promoter are suppressed, the NRP1 (neurophilin 1) gene can be usefully used in a kit for diagnosing asthma and a screening method for treating asthma using the same.

Figure 1 is a graph confirming the increase in the expression of inflammatory cytokines and NRP1 gene by house dust mite (D.pteronissinus) extract:
1A is a graph confirming the expression of the cytokine IL6 mRNA after treatment with a house dust mite extract on the THP1 cell line;
LPS: Lipopolysaccharides;
*: p<0.05;
***: p<0.001;
1B is a graph confirming the expression of the cytokine IL8 mRNA after treatment with the house dust mite extract on the THP1 cell line;
LPS: Lipopolysaccharides;
**: p<0.01;
***: p<0.001;
1C is a graph confirming the expression of the cytokine MCP1 mRNA after treatment with the house dust mite extract on the THP1 cell line;
LPS: Lipopolysaccharides;
***: p<0.001;
1D is a graph confirming the expression of the cytokine IL8 mRNA after treatment with a house dust mite extract on the THP1 cell line;
**: p<0.01;
***: p<0.001; And
LPS: Lipopolysaccharides.
Figure 2 is a graph confirming that the inflammatory cytokine increased by the house dust mite extract was reduced by NRP1 siRNA:
2A is a graph showing a decrease in the expression of NRP1 mRNA after treatment with a house dust mite extract and NRP1 siRNA reducing the expression of the NRP1 gene in a THP1 cell line;
si-control: control siRNA;
si-NRP1: NRP1 siRNA;
LPS: Lipopolysaccharides;
***: p<0.001;
2B is a graph showing a decrease in the expression of the cytokine IL6 mRNA after treatment with a house dust mite extract and NRP1 siRNA in a THP1 cell line;
si-control: control siRNA;
si-NRP1: NRP1 siRNA;
LPS: Lipopolysaccharides;
*: p<0.05;
**: p<0.01;
2C is a graph showing a decrease in the expression of the cytokine IL8 mRNA after treatment with a house dust mite extract and NRP1 siRNA in a THP1 cell line;
si-control: control siRNA;
si-NRP1: NRP1 siRNA;
LPS: Lipopolysaccharides;
**: p<0.01;
***: p<0.001;
2D is a graph showing a decrease in expression of the cytokine MCP1 mRNA after treatment with a house dust mite extract and NRP1 siRNA in a THP1 cell line;
si-control: control siRNA;
si-NRP1: NRP1 siRNA;
LPS: Lipopolysaccharides; And
***: p<0.001.
3 is a graph comparing the expression of NRP1 in terminal blood cells of a normal control group and an asthma patient:
3A is a graph comparing the expression of NRP1 mRNA in blood cells at the end of the control group and the asthma patient group;
**: p<0.01;
3B is a graph comparing the expression of NRP1 mRNA in terminal blood cells of the asthma patient group and the patient who did not receive the drug and the patient group who received the drug; And
**: p<0.01.
Figure 4 is a graph comparing the expression of NRP1 according to the smoking pattern of the normal control and asthma patients:
4A is a graph comparing NRP1 mRNA expression in blood cells at the end of smokers and smokers in the control group;
4B is a graph comparing the expression of NRP1 mRNA in blood cells at the end of a smoker and a smoker in an asthma patient group; And
**: p<0.01.
5 is a graph confirming the relationship between MMP9 and NRP1 related to asthma:
5A shows the activity of the MMP9 promoter after 1.5 hours treatment with NRP1-shRNA in a RAW 264.7 cell line containing the pGL4.14-pMMP9 (-670/+3) vector capable of measuring the activity of the MMP9 promoter. -This is a graph comparing according to the shRNA concentration;
WT: untreated RAW 264.7 cell line;
vector: control shRNA;
nrp1: NRP1 shRNA;
5B shows the activity of the MMP9 promoter after treatment with NRP1-shRNA for 3 hours in a RAW 264.7 cell line containing the pGL4.14-pMMP9 (-670/+3) vector capable of measuring the activity of the MMP9 promoter. -This is a graph comparing according to the shRNA concentration;
WT: untreated RAW 264.7 cell line;
vector: control shRNA;
nrp1: NRP1 shRNA;
5C shows the activity of the MMP9 promoter after treatment with NRP1-shRNA for 6 hours in the RAW 264.7 cell line containing the pGL4.14-pMMP9 (-670/+3) vector capable of measuring the activity of the MMP9 promoter. -This is a graph comparing according to the shRNA concentration;
WT: untreated RAW 264.7 cell line;
vector: control shRNA; And
nrp1: NRP1 shRNA.
6 is a diagram showing an increase in the enzyme activity of MMP9 according to the concentration of TNF-α, through gelatin zymography, when TNF-α was treated for 24 hours in the HT1080 cell line.
Figure 7 is a picture confirming the effect of NRP1 siRNA in the HT1080 cell line:
7A is a diagram illustrating the expression of NRP1 mRNA according to the concentration of NRP1 siRNA treatment in the HT1080 cell line;
NT: untreated HT1080 cell line;
siNC: control siRNA;
siNRP1: siRNA of NRP1;
7B is a graph quantifying the standard of the amount of beta-actin mRNA expressed in NRP1 mRNA according to the concentration of NRP1 siRNA treatment in the HT1080 cell line;
αNT: untreated HT1080 cell line;
siNC: control siRNA; And
siNRP1: siRNA of NRP1.
Figure 8 is a picture confirming the expression of the NRP1 protein according to the NRP1 siRNA treatment in the HT1080 cell line:
NT: untreated HT1080 cell line;
siNC: control siRNA; And
siNRP1: siRNA of NRP1.
Figure 9 is a picture confirming that the expression of MMP9 decreased after inhibition of the expression of NRP1:
9A is a diagram showing that the expression of MMP9 mRNA increased by TNF-α treatment is decreased by NRP1 siRNA;
9B is a graph quantifying that the expression of MMP9 mRNA increased by TNF-α was decreased by NRP1 siRNA based on the amount of GAPDH expression;
NT: untreated HT1080 cell line;
siNC: control siRNA; And
siNRP1: siRNA of NRP1.
Figure 10 is a picture confirmed by Western blot that the expression of MMP9 increased by TNF-α, decreased by NRP1 siRNA:
siNC: control siRNA; And
siNRP1: siRNA of NRP1.
11 is a diagram confirming that the enzyme activity of MMP9 induced by TNF-α decreases in a concentration-dependent manner by concentration-dependent treatment of NRP1 siRNA:
FIG. 11A is a diagram illustrating the enzyme activity of MMP9 confirmed through a gelatin zymography experiment after treating the HT1080 cell line with TNF-α for 24 hours, then treating the NRP1 siRNA by concentration;
NT: untreated HT1080 cell line;
siNC: control siRNA;
siNRP1: siRNA of NRP1;
FIG. 11B is a graph quantifying the enzyme activity of MMP9 shown after treating HT1080 cell line with TNF-α for 24 hours and then treating NRP1 siRNA by concentration by density measurement;
NT: untreated HT1080 cell line;
siNC: control siRNA; And
siNRP1: siRNA of NRP1.
12 is a diagram showing the pGL4.4-pMMP9 (-670/+3) vector used in luciferase assay in order to measure the activity of the MMP9 promoter.
13 is a graph confirming through luciferase analysis that the increased MMP9 promoter activity decreases with increasing the treatment concentration of NRP1 siRNA after 24 hours of TNF-α treatment in the HT1080 cell line containing the pGL4.4-pMMP9 vector:
NT: untreated HT1080 cell line;
siNC: control siRNA; And
siNRP1: siRNA of NRP1.

Hereinafter, the present invention will be described in detail.

The present invention provides a DNA microarray for diagnosis of asthma comprising an oligonucleotide or a complementary strand molecule thereof, which is a fragment of the gene composed of the nucleic acid sequence of the NRP1 (neurophilin 1) gene.

The NRP1 gene is preferably a DNA microarray for diagnosis of asthma, which is characterized by having a nucleotide sequence represented by SEQ ID NO: 1, but is not limited thereto.

In a specific embodiment of the present invention, the present inventors treat house dust mite extract ( D. pteronyssinus ) known to induce asthma in THP1 cells, which are cells derived from acute monocytic leukemia, by concentration, and then inflammatory cytokines IL6, IL8, MCP1 And NRP1 mRNA expression was confirmed. As a positive control for this, lipopolysaccharides (LPS), which are known to induce inflammatory cytokines, were treated. As a result, as the concentration of the house dust mite extract treatment increased, inflammatory cytokines increased, and this result was similar to the result of increasing inflammatory cytokines when treated with LPS, a positive control. In addition, it was observed that NRP1 mRNA was increased by the house dust mite extract (see Fig. 1).

In addition, in a specific embodiment of the present invention, THP1 cells were treated with house dust mite extract and NRP1 siRNA. To confirm whether NRP1 siRNA effectively inhibits the expression of NRP1, THP1 cells were treated with house dust mite extract and NRP1 siRNA, and then the expression of NRP1 was examined. As a result, the expression of NRP1 mRNA in the group treated with NRP1 siRNA was compared to the control siRNA. By observing a significant decrease compared to the treated group, it was confirmed that the NRP1 siRNA functions effectively. In addition, it was observed that the expression of IL6, IL8, and MCP1 inflammatory cytokines, which were increased after treatment with the house dust mite extract, significantly decreased in the NRP1 siRNA-treated group compared to the control siRNA-treated group (see FIG. 2).

In addition, in a specific embodiment of the present invention, NRP1 mRNA expression was compared in terminal blood cells of asthma patients and normal people. As a result, it could be observed that NRP1 expression was significantly increased in terminal blood cells of asthma patients compared to control patients. In addition, the expression of NRP1 was significantly decreased in the group receiving the asthma drug (see Fig. 3). In addition, as a result of comparing the amount of NRP1 expression measured in terminal blood cells of asthma patients and normal subjects according to the smoking status and medical history of the study subject, it was observed that among asthma patients, smokers had a significant increase in NRP1 expression compared to non-smokers. (See Fig. 4). In addition, according to the history of tuberculosis, allergic rhinitis, atopic dermatitis and urticaria, as a result of comparing the amount of NRP1 expression, in the case of asthma patients with atopic dermatitis, a tendency to increase the amount of NRP1 was confirmed (see Table 1 and Table 2).

In addition, in a specific embodiment of the present invention, NRP1 shRNA was treated by concentration in the RAW 264.7 cell line containing the pGL4.14-pMMP9 (-630/+3) vector capable of measuring the activity of the MMP9 promoter, The activity was measured. Increased expression of MMP9 is known to be a major factor in causing airway remodeling, an important pathology of chronic asthma. As a result of treatment by NRP1 shRNA treatment time and concentration in the RAW 264.7 cell line through luciferase assay, the expression of MMP9 decreased as the concentration and treatment time of NRP1 shRNA increased from 1.5 hours to 6 hours. It could be confirmed (see Fig. 5). In addition, after treating HT1090 cells with NRP1 siRNA by concentration, the change in enzyme activity of MMP9 was confirmed through a gelatin zymography experiment, and as a result, it could be observed that the activity of MMP9 was decreased depending on the concentration of NRP1 (see FIG. 6). .

In addition, in a specific embodiment of the present invention, in order to confirm the effect of NRP1 siRNA in HT1080 cells, NRP1 siRNA was treated on the cells at a concentration of 5, 10, 20, 50 nM, and then the amount of NRP1 mRNA expression was observed. As a result, when NRP1 siRNA was treated, it was observed that the expression level of NRP1 was significantly decreased compared to the group treated with the negative control siRNA, and the expression of NRP1 was the most at the NRP1 siRNA concentrations of 10 nM and 20 nM. It could be observed that it was effectively suppressed (see Fig. 7). In addition, in order to confirm whether the NRP1 siRNA can also effectively inhibit the expression of the NRP1 protein, a 20 nM concentration of NRP1 siRNA that can effectively inhibit the expression of NRP1 identified in FIG. 7 was treated on HT1080 cells, and then the NRP1 protein. The expression of was observed using the Western blot method. As a result, it was observed that the expression of the NRP1 protein was effectively reduced in the group treated with NRP1 siRNA compared to the control siRNA (see FIG. 8).

In addition, in a specific embodiment of the present invention, in order to confirm the asthma treatment effect of NRP1 siRNA, when treated with 5 and 20 nM of NRP1 siRNA in HT1080 cells, and then treated with TNF-α, it is increased by TNF-α. It was observed whether the expression of MMP9 and NRP1 could be inhibited by NRP1 siRNA. As a result, it was observed that the expression of MMP9 was increased by TNF-α treatment, but the expression of MMP9 was decreased depending on the concentration of NRP1 siRNA by NRP1 siRNA (see FIG. 9). In addition, in order to confirm whether the NRP1 siRNA can reduce the expression of MMP9 and NRP1 increased by TNF-α at the protein level, the present inventors conducted NRP1 siRNA and TNF-α in HT1080 cells under the same conditions as in FIG. 9. After treatment, protein expression of MMP9 and NRP1 was measured using Western blot. As a result, it was confirmed that the expression of NRP1 and MMP9 proteins was increased by TNF-α, but the expression of NRP1 and MMP9 proteins was decreased by NRP1 siRNA, as in the result of FIG. 9, and this reduction was confirmed to be dependent on the concentration of NRP1 siRNA treatment. Could be (see Fig. 10). In addition, in order to confirm whether the enzymatic activity of MMP9 increased by TNF-α is reduced by NRP1 siRNA, HT1080 cells were treated with NRP1 siRNA and TNF-α, and then the enzymatic activity of MMP9 using gelatin zymography. Was measured. As a result, similar to the results shown in Figs. 9 to 13, it was observed that the enzyme activity of MMP9 increased by TNF-α decreased depending on the concentration of NRP1 siRNA (see Fig. 11).

In addition, in order to measure the change in MMP9 promoter activity by NRP1 siRNA, a pGL4.14-pMMP(-670/+3) vector including the promoter region of MMP9 was constructed (see FIG. 12). After treating HT1080 cells containing the pGL4.14-pMMP(-670/+3) vector with NRP1 siRNA at a concentration of 5, 10, and 20 nM, a luciferase assay was performed. As a result, it was observed that the MMP9 promoter activity, which is increased by TNF-α, decreases in NPR1 siRNA concentration-dependently (see FIG. 13).

Therefore, the relationship between NRP1 and asthma was revealed through specific examples of the present invention, and more specifically, through the result of inhibiting MMP9 expression and function by an inhibitor of NRP1 expression or activity, NRP1 (neurophilin 1) is a marker for asthma diagnosis. Or it can be seen that it can be usefully used as a target for the development of asthma treatment.

In addition, the present invention provides a kit for diagnosing asthma comprising a DNA microarray for diagnosing asthma comprising an oligonucleotide or a complementary strand molecule thereof, which is a fragment of the gene composed of the nucleic acid sequence of the NRP1 (neurophilin 1) gene.

In the examples of the present invention, it was observed that the expression of the NRP1 gene is increased by an asthma inducing factor, and the expression of the NRP1 gene is increased in the terminal blood cells of the asthma patient compared to the normal person. In addition, since the expression and function of the MMP9 gene related to asthma is reduced by the NRP1 expression or activity inhibitor, a DNA microarray including the NRP1 gene can be usefully used as a kit for diagnosing asthma.

In addition, the present invention provides a kit for diagnosing asthma comprising a primer set consisting of a forward primer and a reverse primer that is complementary to the NRP1 gene and capable of amplifying the gene.

The primer set is characterized in that the forward primer has a nucleotide sequence described in SEQ ID NO: 2 (5'-CCACAGTGGAACAGGTGATG-3') and the reverse primer has a nucleotide sequence described in SEQ ID NO: 3 (5'- GCACGTGATTGTCATGTTCC-3'). It is preferable that it is a kit for diagnosing asthma, but is not limited thereto.

When detecting NRP1 using an NRP1-specific primer, when applied to a PCR amplification reaction, reagents required for selective PCR amplification, such as buffers, DNA polymerases (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermusfiliformis, Thermostable DNA polymerase obtained from Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactors, and dNTPs. The kit of the present invention may be manufactured in a number of separate packaging or compartments including the reagent components described above.

In a specific embodiment of the present invention, the NRP1 gene is expressed at a higher level than that of a normal person in terminal blood cells of asthmatic patients, and its expression is increased by an extract of house dust mite known to induce asthma. In addition, since the expression and function of MMP9, which is known to play an important role in asthma, is reduced by NRP1 expression or activity inhibitor, a primer set consisting of a forward primer and a reverse primer that is complementary to the NRP1 gene and capable of amplifying the gene is used for asthma. It can be usefully used for diagnosis.

In addition, the present invention provides a protein detection method for providing information on asthma diagnosis, including the following steps, but is not limited thereto:

1) measuring the expression level of NRP1 in the sample derived from the subject as an experimental group;

2) comparing the expression level of NRP1 in step 1) with the expression level of NRP1 in a sample derived from a normal individual as a control; And

3) Determining that the risk of developing asthma is high when the NRP1 expression level is increased compared to the control group.

In the protein detection method for providing information for diagnosis of asthma, the sample is from the group consisting of blood, plasma, serum, urine, tears, saliva, sputum, secretions, bronchial secretions, bronchial lavage fluid, lung secretions, and alveolar lavage fluid. It is preferably selected, but is not limited thereto. In addition, in the protein detection method for providing information for diagnosis of asthma, the expression level of NRP1 in step 1) is Western blotting, enzyme-linked immunosorbent assay (ELISA), and immune tissue. It is preferable to detect by any one method selected from the group consisting of immunohistochemical staining, immunoprecipitation, and immunofluorescence, but is not limited thereto.

In the zymography of the present invention, the expression of NRP1 is increased by terminal blood of asthma patients and by extract of house dust mite and TNF-α, which are asthma inducing factors, and expression of MMP9 known to be involved in asthma by NRP1 expression or inhibitor of activity. It was confirmed that it suppressed. Therefore, in order to provide information for diagnosis of asthma, the expression level of NRP1 can be compared with a sample derived from a subject and a control normal individual, and can be usefully used in a protein detection method to determine the degree of risk of asthma according to the expression level.

In addition, the present invention provides a screening method for treating asthma comprising the following steps:

1) treating the test compound or composition to NRP1 or a cell line expressing NRP1 and MMP9;

2) measuring the expression level of NRP1, or NRP1 and MMP9 in the treated cell line of step 1); And

3) selecting a test compound or composition whose NRP1, or NRP1 and MMP9 expression levels of step 2) are reduced compared to the untreated control cell line.

In the specific zymography of the present invention, the expression of NRP1 is increased by the terminal blood of asthma patients and the house dust mite extract and TNF-α, which are asthma inducing factors, and expression of MMP9, which is known to be involved in asthma by NRP1 expression or activity inhibitor. And inhibiting the function, the NRP1 gene can be usefully used in a screening method for treating asthma.

In addition, the present invention provides a screening method for treating asthma comprising the following steps:

1) treating the test compound or composition to an asthma diagnostic kit comprising a DNA microarray or a kit for diagnosing asthma comprising a primer set consisting of a forward primer and a reverse primer that is complementary to the NRP1 gene and capable of amplifying the gene;

2) measuring the expression level of NRP1 in the treated kit of step 1); And

3) selecting a test compound or composition whose NRP1 expression level of step 2) is decreased compared to the control group.

In the specific zymography of the present invention, NRP1 is increased in expression by the terminal blood of asthma patients and the house dust mite extract and TNF-α, which are asthma inducing factors, and enzyme activity as well as the expression of MMP9 by NRP1 expression or inhibitor of activity Functions such as promoter activity were suppressed. Therefore, the NRP1 gene can be usefully used in a screening method for treating asthma.

In addition, the present invention provides a pharmaceutical composition for the treatment of asthma containing an inhibitor of the expression or activity of the NRP1 gene as an active ingredient.

The NRP1 gene expression or activity inhibitor is NRP1 It is preferably any one selected from the group consisting of antisense nucleotides complementary to the mRNA of the gene, short interfering RNA (short interfering RNA) and short hairpin RNA (short hairpin RNA), and small interfering RNA and short hairpin RNA. More preferably, it is most preferably a short hairpin RNA, but is not limited thereto. In an embodiment of the present invention, NRP1 is expressed in the terminal blood of asthma patients, and its expression is increased by the asthma inducing factors, house dust mite extract and TNF-α, and NRP1 expression or inhibitor of activity inhibits the expression and function of MMP9. Could be observed. Therefore, the relationship between the NRP1 gene and asthma was confirmed, and since the expression and function of MMP9 related to asthma is suppressed by the NRP1 expression or activity inhibitor, an inhibitor of the expression or activity of the NRP1 gene may be useful as a pharmaceutical composition for the treatment of asthma. have.

The therapeutically effective amount of an inhibitor of NRP1 expression or activity may vary depending on several factors, such as the method of administration, the site of interest, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined as an appropriate amount in consideration of safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations when determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

The compositions of the present invention may also contain carriers, diluents, excipients or combinations of two or more commonly used in biological preparations. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of an inhibitor of NRP1 expression or activity, and, for example, Merck Index, 13th ed., Merck & Co. Inc. Compounds described in, saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components can be mixed and used, and other antioxidants, buffers, bacteriostatic agents, etc. Conventional additives can be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets. Further, it may be preferably formulated according to each disease or component by an appropriate method in the art or by using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

In addition to the composition of the present invention, one or more active ingredients exhibiting the same or similar function may be contained. The composition of the present invention contains 0.0001 to 10% by weight, preferably 0.001 to 1% by weight of the protein based on the total weight of the composition.

The composition can be administered parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) or orally according to the desired method, and the dosage is the patient's weight, age, sex, health status, diet, administration The range varies depending on the time, administration method, excretion rate, and severity of disease. The daily dosage of the composition according to the present invention is 0.0001 to 10 mg/ml, preferably 0.0001 to 5 mg/ml, and it is more preferable to administer it in divided doses from once to several times a day.

Hereinafter, the present invention will be described in detail by Examples, Experimental Examples and Preparation Examples.

However, the following Examples, Experimental Examples, and Preparation Examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following Examples, Experimental Examples, and Preparation Examples.

<Example 1> Cell culture

<1-1> THP1 cell culture

Human macrophage precursor cells, THP1 cells, It was cultured in Dulbecco's modified Eagles medium (DMEM, Life Technologies, USA) containing 10% FBS, 100 units/ml penicillin, and 100 μg/ml streptomycin.

<1-2> HT-1080 cell line culture

The HT1080 cell line (ATCC CCL121), a human fibrosarcoma cell, contains Dulbecco's modified Eagles medium (DMEM, Life Technologies) containing 10% FBS, 100 units/ml penicillin, and 100 μg/ml streptomycin. , USA).

<1-3> RAW 264.7 cell line culture

Rat monocyte/macrophage cell line RAW264.7 was prepared in Dulbecco's modified Eagles medium (DMEM, Life Technologies, USA) in 100 U/ml penicillin, 100 µg/ml streptomycin, 10% FBS, 6 g/L HEPES, 3.7 Incubated in a carbon dioxide thermostat (5% carbon dioxide, 95% relative humidity, 37°C) using a medium to which g/L sodium hydrogen carbonate was added.

<Example 2> Construction of vector for luciferase analysis

To construct a reporter vector for verifying the transcriptional activity of MMP-9, the oligonucleotides GATCCTCGAGCTAGAGGCTGCTACTTGC (SEQ ID NO: 4) and GATCAAGCTTTCTGACTGCAGCTGCTGT (SEQ ID NO: 5) were synthesized and human cDNA was used as a template. The promoter region of 9 (-670/+3) was amplified by PCR. As a transcription reporter, a report vector pGL4.14 (purchased from Promega) expressing a luciferase-expressing gene and a hygromycin B phosphotransferase as a selection marker is used. Was used. The report vector was digested with XhoI and HindIII enzymes, and the MMP-9 promoter region (-670/+3) synthesized by PCR was ligated to obtain a reporter vector, pGL4.14-pMMP-9-Luc, having a human MMP-9 promoter region. Was produced.

<Example 3> Cell line preparation method for luciferase analysis

One day before transfection of HT1080 cells and RAW264.7 cells grown in DMEM medium, after culturing in fresh medium one day, vector pGL4.14-pMMP-9-Luc DNA was transfected with FuGeneHD (Roche, USA) After mixing well using the solution, it was evenly distributed over the two cells. After culturing for 6 hours, it was changed to a new medium and cultured for 2 days. After 2 days, the cells were transferred to a selective medium containing the antibiotic G418 at a concentration of 0.8 mg/ml at a ratio of 1:15, replaced with a new medium every 4 days, and the colonies formed during cultivation were separated again. Some were stored in liquid nitrogen. Colonies of cells growing without dying in DMEM containing antibiotic G418 at a concentration of 1 mg/ml were selected to obtain HT1080-pMMP9-luc cell lines and RAW-pGL4-MMP9-luc cell lines.

In the case of HT1080 cells, TNF-a (5 ng/ml) was treated, and in the case of raw cells, LPS (Lipopolysaccharide) (1 µg/ml) was treated, and the degree of activity of luciferase produced compared to untreated cells was examined Thus, cell lines showing high activity were selected. The same experiment was performed again using cells of various concentrations in order to find conditions showing high activity for the selected cell lines.

<Experimental Example 1> Measurement of expression of inflammatory cytokines and NRP by house dust mites

House dust mite ( D.pteronissinus ) extract (purchased from Medical Arthropod Material Bank (Yonsei University College of Medicine)) was treated with 0, 0.1, 1, 10, 50 ㎍/㎖ in THP1 cell line, and then the expression of inflammatory cytokines Was measured. In addition, lipopolysaccharides (LPS), known to express inflammatory cytokines, were used as a positive control. After treatment with house dust mite extract and lipopolysaccharide on the THP1 cell line, interleukin 6 (IL6), interleukin 8 (IL8), monocyte chemoattractant protein 1 (MCP1), and neuropilin 1 ( Neuropilin 1, NRP1) mRNA expression was confirmed.

^{After adding 2 ml of THP1 cells at a density of 2 × 10 6} /ml to each well of a 12 well plate, a low dose of house dust mite extract, the most potent causative agent of asthma, was added to the cells stabilized for 24 hours ( 10 µg/ml) and high dose (50 µg/ml) and cultured for 48 hours. As a positive control, an inflammation-inducing substance LPS (lipopolysaccharide) was treated with 1 µg/ml. After incubation for 48 hours, total RNA (total RNA) was separated and purified using an RNeasy kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions, and 1 µg of total RNA was added to the cDNA Reverse Transcription Kit (Applied Biosystems, Inc. , Foster City, CA, USA). Real-time PCR was performed using StepOne (Applied Biosystems, Inc., Foster City, CA, USA) equipment. For PCR, a final reaction volume of 20 µl was prepared with a composition of TaqMan gene expression master mix, 250 nM TaqMan Probe, 2 µM of each primer, and 2 µl of cDNA, and repeated three times. The PCR tube mixed with an appropriate composition was reacted at 95°C for 10 minutes, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. The primer used in Real-Time PCR was used by purchasing an assay on demand gene expression product from Applied Biosystems (Applied Biosystems, Inc., Foster City, CA, USA). The product number is as follows:

IL6: Hs00174131_m1;

IL8: Hs99999034_m1;

MCP1: Hs00234140_m1; And

NRP1: Hs00818574_m1.

18s rRNA was used as an internal control:

18s rRNA: Hs99999901_s1.

As a result, when the LPS used as a positive control was treated, the expression of all of the inflammatory cytokines IL6, IL8, and MCP1 increased, and the expression levels of IL6 and IL8 cytokines increased as the concentration of the house dust mite extract treatment increased. It was possible (A and B in Fig. 1). MCP1 did not show a difference in expression level from the group not treated with the house dust mite extract at a low concentration of 0.1 ~ 10 ㎍ / ㎖, but it was confirmed that the expression level increased rapidly at a concentration of 50 ㎍ / ㎖ (Fig. 1 C. ). In addition, it was observed that the expression level of NRP1 mRNA significantly increased as the concentration of treatment with the house dust mite extract increased in NRP1 (Fig. 1D). That is, it was observed that the house dust mite extract increased the expression of inflammatory cytokines and NRP1 (FIG. 1).

<Experimental Example 2> Measurement of changes in inflammatory cytokine expression by NRP1 siRNA

The THP1 cell line was transfected with NRP1 siRNA and a control siRNA (si-control) therefor, and then treated with house dust mite extract (10, 50 µg/ml) and LPS, and then the expression change of inflammatory cytokines was measured.

The THP1 cell line was ^{prepared at 2×10 6} cells/mL in a 12 well dish. NRP1 siRNA and control siRNA were purchased from Santacruz, and the product numbers are as follows:

NRP1 siRNA: Santacruz, sc-36038; And

control siRNA: Santacruz, sc-37007.

At a concentration of 60 M siRNA, it was treated with Lipofectamin RNAiMAX reagent (Invitrogen, 12778) for 6 hours. Thereafter, house dust mite extract and LPS were treated according to each concentration, cultured for 48 hours, and used for real-time PCR analysis.

As a result, when transfected with NRP1 siRNA, NRP1 mRNA expression was significantly reduced compared to the group transfected with control siRNA, and house dust mites that induce the expression of inflammatory cytokines in the group transfected with NRP1 siRNA. When the extract was treated, it was confirmed that the NRP1 siRNA was effectively operated by significantly reducing the expression of NRP1 compared to the group treated with the control siRNA (Fig. 1A). The expression of the inflammatory cytokines IL6, IL8, and MCP1 increased as the treatment concentration of the house dust mite extract increased as in the result of <Experimental Example 1>, but in the group transfected with NRP1 siRNA, the control siRNA was transfected. It could be observed that the expression was significantly decreased compared to the specified group (B, C, and D of FIG. 1).

<Experimental Example 3> Measurement of NRP1 expression in terminal blood cells of asthma patients

MRNA was extracted from terminal blood cells of normal control patients and asthma patients, and the expression of NRP1 mRNA was compared. General characteristics of the patients participating in the experiment of the present invention are as shown in Table 1 below (Table 1).

Asthma patients and controls were recruited at Yongsan Hospital affiliated with Chung-Ang University. 10 cc of peripheral blood from patients was collected on an empty stomach and centrifuged at 3,000 rpm for 15 minutes to separate the leukocyte layer (buffy coat). The isolated white blood cell layer (buffy coat) was stored at -80°C after separating and purifying total RNA according to the manufacturer's instructions using the ^{RiboPure™ Blood Kit (Ambion).} For asthma patients, the prescription of inhalants (steroids, beta-2 agonists, bronchodilators, etc.) and oral drugs (steroids, theophylline, leukotriene modulators, beta-2 agonists, antihistamines, etc.) for the past 3 months from the time of peripheral blood collection. Investigated. Patients who visited the hospital for the first time were collected peripheral blood and classified as patients who had not been previously administered.

As a result, it could be observed that the expression of NRP1 mRNA was significantly increased in terminal blood cells of asthma patients compared to control patients (Fig. 3A). In addition, it was observed that NRP1 mRNA expression was significantly decreased in the group receiving the asthma drug (64 patients) among the total asthma patient groups compared to the group not receiving the asthma drug (8 patients) (FIG. 3B).

In addition, the present inventors analyzed the difference in the expression pattern of NRP1 according to the smoking pattern. As shown in Table 1, 6 out of 34 in the control group were smokers, showing a smoking rate of 18.2%, and in the asthma group, 16 out of 72 people were smokers and a smoking rate of 22.2% (Table 1). In the normal control group, there was no difference in the expression of NRP1 mRNA regardless of smoking patterns (Fig. 4A). However, in the case of asthma patients, it was observed that the mRNA expression of NRP1 was significantly increased in the terminal blood cells of smokers (FIG. 4B).

In addition, the expression pattern of NRP1 according to the patient's medical history was examined. There were tuberculosis, allergic rhinitis, atopic dermatitis and urticaria in the medical history of the asthma patient group.As a result of comparing NRP1 mRNA expression in the four diseases, as shown in Table 2 below, NRP1 expression increased in patients with atopic dermatitis history. The tendency could be confirmed (P value <0.1) (Table 2).

General characteristics of the patient being studied Control
(n=34) asthma
(n=72) P-value Sex ratio (male: female) 22:11 36:36 0.156 ^b age 46.97 ± 2.22 ^a 52.42 ± 1.77 0.083 ^c BMI(kg/m ² ) 24.42 ± 0.64 24.36 ± 0.36 0.324 ^d FEV1(L) 3.04 ± 0.13 2.47 ± 0.10 0.006 ^d FEV1 (expected value %) 90.04 ± 2.07 90.64 ± 2.74 0.030 ^d FVC(L) 3.88 ± 0.16 3.58 ± 0.91 0.994 ^d FEV1/FVC(%) 78.60 ± 1.26 68.71 ± 1.73 0.000 ^d Smoking (No: Yes (% of smokers) 28:6 (18.2%) 56:16 (22.2%) 0.762 ^d

a: mean ± SE

b: P-value obtained by Chi-square test.

c: P-value obtained by ANOCOVA based on the sex ratio.

d: P-value obtained by ANOCOVA based on sex ratio and age.

NRP1 mRNA expression level according to the past medical history of asthma patients case history radish U P-value Tuberculosis 57 (1.38 ± 0.08) ^a 15 (1.59 ± 0.29) 0.148 ^b Allergic rhinitis 51 (1.42 ± 0.11) 21 (1.45 ± 0.16) 0.853 Atopic dermatitis 65 (1.37 ± 0.08) 7 (1.93 ± 0.52) 0.098 hives 60 (1.42 ± 0.09) 12 (1.47 ± 0.30) 0.948

a: mean ± SE. NRP1 mRNA levels were expressed as a percentage of the mean of the control group.

b: P-value obtained by ANOCOVA based on sex ratio and age.

<Experimental Example 4> Measurement of the change in the activity of the promoter of MMP9 by inhibition of NRP1 expression

The siRNA vector construction for the NRP1 gene is as follows. The siRNA target primer of NRP1 was designed using two types of siRNA target programs (http://www.promega.com/siRNADesigner/program; http://www/genscript.com/ssl-bin/app/rnai). , The siRNA target primer contains the sequence of the forward CTGCACAAATCTCTGAAACTA (SEQ ID NO: 6) and consists of 21 bases with a GC range of 30 to 60%. The siRNA target primers were positioned in the forward and reverse directions to form a loop in the center, and BamHI and HindIII restriction enzymes were inserted at both ends for easy cloning into a vector. The siRNA target forward primer (SEQ ID NO: 7: 5'-GATCCCGTAGTTTCAGAGATTTGTGCAGTTGATATCCGCTGCACAAATCTCTGAAACTATTTTTTCCAAA-3') and the reverse primer (SEQ ID NO: 8: 5'-AGCTTTTGGAAAAAATAGTTTCAGAGATTTGTGCAGCGGATATCAACTACGCACone') were purchased

Similarly, the scrambled siRNA sequence contains the forward GGCGCGCTTTGTAGGATTCG (SEQ ID NO: 9), and is located in the forward and reverse directions to form a loop in the center.BamHI and HindIII restriction enzymes are at both ends for easy cloning into a vector. Is inserted. The scrambled siRNA forward primer set in this way (SEQ ID NO: 10: 5'-GATCCCGCGAATCCTACAAAGCGCGCTTGATATCCGGCGCGCTTTGTAGGATTCGTTTTTTCCAAA-3') and the scrambled siRNA reverse primer (SEQ ID NO: 11: 5'-AGCTTTTGGAAAAAACGAATCCTATCGCAAGCGCGGCGGCGGGCGGGCC') After combining the two sequences, the purchased sequence was cloned into pRNAT-U6.1/NEO vector (purchased from Genescript) cut with BamHI and HindIII using T4 ligase, and then the binding reaction product was introduced into E. coli strain DH5a. In pRNA-U6/Neo vector, colony PCR is performed using forward and reverse primers that can confirm the sequence to obtain a monoclonal into which the siRNA target is inserted, and the single strain into which the siRNA target is inserted is separated from the DNA to perform base analysis. I checked again through.

The RAW 264.7 cell line containing the pGL4.14-pMMP9(--670/+3) vector, which can measure the activity of the MMP9 promoter, ^{was dispensed into 96 wells at 3 X 10 4} cells/well one day before transfection and 24 hours later. After changing to DMEM that does not contain FBS, pRNAT-U6/neo vector, scambled shRNA, and NRP1 shRNA are mixed according to the instructions of the FuGeneHD (purchased from Roche) transfection reagent, and then treated by concentration and luciferase ( luciferase) expression level was confirmed.

As a result, it was observed that the activity of the MMP9 promoter increased as the time to cultivate the RAW 264.7 cell line increased, but in the group treated with NRP1 shRNA, the treatment time of 1.5 hours, 3 hours and 6 hours increased. It was confirmed indirectly through the activity of the promoter that the expression was significantly decreased compared to the group treated with the control vector (FIG. 5).

<Experimental Example 5> Measurement of the activity of MMP9 enzyme by TNF-α

In order to test the inhibitory effect of the gelatin-degrading activity, MMP-9 enzyme activity by TNF-α, the conditional medium obtained from the HT1080 cell culture solution treated with 5, 20, 50, 100 ng/ml of TNF-α was 62.5 mM Tris. Re-diluted in the same buffer containing -HCl (pH 6.8), 10% glycerol, 2% SDS and 0.00625% (w/v) bromophenol blue. And the solution was electrophoresed without heating on 10% polyacrylamide gel containing 0.1% (w/v) gelatin. After electrophoresis, the gel was washed at room temperature for 30 minutes using an appropriate amount in reaction buffer [1M Tris-HCL (pH 7.5), 0.1 M NaCl, 2.5% Triton X-100]. Next, the gel contained in the reaction buffer [1 M Tris-HCl (pH 7.5), 10 mM CaCl ₂ ] was immersed in each tank container. The gels treated with 5, 20, and 50 ng/ml of TNF-α thus prepared were kept warm at 37° C. for 16 hours. The white band corresponding to the enzyme activity can be confirmed by staining with Coomassie brilliant blue G, and the staining was re-diluted in a buffer containing ethanol and acetic acid.

After treating HT1080 cells with TNF-α at a concentration of 5, 20, 50, 100 µg/ml for 24 hours, the activity of MMP9 was observed through the gelatin zymography test method. As shown in FIG. 6, TNF As the -α treatment concentration increased, it could be observed that the enzyme activity of MMP9 increases (FIG. 6).

<Experimental Example 6> Measurement of the effect of NRP1 siRNA in HT1080 cell line

In order to verify the effect of NRP1 siRNA in the HT1080 cell line, after NRP siRNA was treated by concentration, the expression level of NRP1 mRNA was confirmed through PCR.

HT1080 cell line was treated with 5 nM, 10 nM, 20 nM, 50 nM of NRP1 siRNA and siRNA (siRNA n egative c ontrol), a negative control siRNA for it, extracted RNA, and then analyzed the expression level of NRP1 through PCR. Confirmed. As a result, as shown in FIG. 7A, it was confirmed that the expression of NRP1 was decreased depending on the concentration of NRP1 siRNA treatment (FIG. 7A). In addition, as a result of quantifying the expression level of NRP1 based on the expression level of beta-actin, the result is shown as a graph. As shown in Fig. 7B, the expression of NRP1 increases as the concentration of NRP1 siRNA increases. It was confirmed that this decrease was observed (FIG. 7B).

In addition, in order to confirm that the NRP1 siRNA can effectively inhibit the expression of the NRP1 protein in the HT1080 cell line, 20 nM of NRP1 siRNA effectively inhibited by the NRP1 mRNA in FIG. 7 was treated with the HT1080 cell line, and then the expression of the NRP1 protein was westernized. It was confirmed through blot. HT1080 cell extract treated with 20 nM NRP1 siRNA was prepared, and the amount of MMP-9 expression was assayed as a protein by Western blot method. At this time, beta-actin was used as an internal control. Cells treated with 20 nM NRP1 siRNA for 24 hours were buffered [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% NP-40, 0.25% sodium (Na-deoxycholate), 1 mM EDTA, 1 mM NaF, 1 mM Na ₃ VO ₄ , 1 mM PMSF, Protease inhibitor cocktail (purchased from calbiochem)]. For protein quantification in the cell extract, a Bio-Rad protein quantification kit (Bio-Rad, USA) was used. Protein extracts were prepared using the protein extraction buffer solution, and 50 μg of protein extracts of the control group and the NRP1 siRNA-treated group were each subjected to electrophoresis on a denatured polyacrylamide gel (SDS-polyacrylamide gel). The electrophoresed protein was adsorbed on a polyvinylidene difluoride membrane and then blocked with 5% skim milk for 2 hours, followed by NRP1, beta-actin antibody (Santa Cruz). I bought it from) and reacted. The membrane bound to the antibody was washed with TBST buffer, reacted with a secondary antibody labeled with horseradish peroxidase (purchased from Santa Cruz), washed again with TBST buffer, and then ECL system (ECL system, Amersham Pharmacia Biotec) was used to detect the protein.

As a result, as shown in FIG. 8, it was observed that the expression of the NRP protein was significantly decreased compared to the group treated with the negative control siNC (FIG. 8).

<Experimental Example 7> Measurement of changes in MMP9 expression by NRP1 siRNA

In order to confirm the asthma treatment effect of NRP1, HT1080 cells were treated with NRP1 siRNA, and then TNF-α, which is known to play an important role in asthma, was treated, and the expression levels of MMP9 and NRP1 were confirmed.

*HT1080 cells were treated with NRP1 siRNA in a concentration-dependent manner, and then MMP9 mRNA expression was compared according to TNF-α treatment. As a result, it was observed that the expression level of MMP9 increased by TNF-α treatment was significantly decreased when NRP1 siRNA was treated (Fig. 9A). In addition, as a result of quantifying the expression of MMP9 based on the amount of beta-actin expression, the result was shown as a graph. As a result, a difference in the decrease in expression of MMP9 according to the increase in the NRP1 siRNA treatment concentration could also be observed (FIG. 9B).

In addition, in order to confirm whether the protein expression level of MMP9 and NRP1 siRNA can be reduced by NRP siRNA, 20 ng/ml of TNF-a was treated in the group treated with NRP1 siRNA on HT1080 cells, and then the NRP1 and MMP9 proteins were Expression was confirmed using Western blot. The experimental method of beta-actin and NRP1 was carried out in the same manner as in <Experimental Example 8>, and protein expression of MMP9 was quantified in the same manner as above by collecting the cell culture medium, and then using the same buffer to obtain protein extract. made. The experimental procedure after this was carried out in the same manner as in <Experimental Example 7>, and an MMP9 antibody (purchased from Santa Cruze) was used.

As a result, as shown in Figure 10, by TNF-α treatment, it was observed that the protein expression of MMP9 and NRP1 increased, depending on the NRP1 siRNA treatment concentration, both the protein expression of MMP9 and NRP1 significantly decreased. It could be observed (Fig. 10).

<Experimental Example 8> Measurement of changes in MMP9 enzyme activity by NRP1 siRNA

After treatment with NRP1 siRNA in HT1080 cells, it was observed that the expression of MMP9, which was increased by TNF-α, was significantly reduced. Accordingly, the present inventors measured the enzyme activity of MMP9 using a gelatin zymography method to confirm that not only the expression of MMP9, but also its function is reduced. HT1080 cells were treated with NRP siRNA and siNC, a negative control thereof, at a concentration of 5, 10, and 20 nM, followed by treatment with 5 ng/ml of TNF-α for 24 hours. The conditional medium obtained from HT1080 cell culture was re-diluted in a buffer solution [62.5mM Tris-HCl (pH 6.8), 10% glycerol, 2% SDS and 0.00625% (w/v) bromophenol blue]. Was used, and the step was carried out in the same manner as in the zymography test method.

As a result, as shown in FIG. 11, it was observed that the enzyme activity of MMP9 induced by TNF-α in HT1080 cells decreased in a concentration-dependent manner by concentration-dependent treatment of NRP1 siRNA (FIG. 11).

<Experimental Example 9> Measurement of change in MMP9 promoter activity by NRP1 siRNA

In order to measure the change in the activity of the MMP9 promoter due to NRP1 expression or inhibition of activity, a pGL-MMP9 vector capable of measuring the activity of the MMP9 promoter was constructed, and the activity of the MMP9 promoter was measured using an HT1080 cell line containing the same. (Fig. 12). The HT1080 cell line hygromycin B containing the pGL4.14-pMMP9 (--670/+3) vector made in Example 3 was cultured in DMEM medium containing 0.1 mg/ml, and then the cells were removed with a trypsin solution. Adjust the number of cells to 3×10 ⁴ cells/ml, add 100 μl each to a 96-well white with-clear bottom plate (purchased from Costar), and incubate at 37°C for 24 hours in a _{CO 2 incubator.} Cultured. Thereafter, after washing with PBS and changing to DMEM medium to which FBS is not added, the untreated control group, the negative control group treated with siNC, and the group treated with NRP1 siRNA 5, 10, and 20 nM were divided into siRNA and siNC, which is a control siRNA. After 1 hour treatment, 5ng/ml TNF-a treatment, and cultured for 24 hours. After removing the culture supernatant and washing the cells with PBS, 40 µl of a luciferase lysis buffer (purchased from Promega) was added to lyse the cells. A 96-well plate containing the cell lysate was measured with a luminometer using a luciferase assay reagent (purchased from Promega), and the results were shown.

As a result, as shown in FIG. 13, the activity of the MMP9 promoter is similar to the expression of MMP9 mRNA and protein, and the activity of the MMP9 promoter, which is increased by TNF-a, is a concentration-dependent treatment of 5, 10, 20 nM NRP1 siRNA. It could be observed that it decreases accordingly (FIG. 13).

Hereinafter, a preparation example for the composition of the present invention is presented.

<Production Example 1> Preparation of pharmaceutical formulation

<1-1> Preparation of powder

NRP1 expression or activity inhibitor 2 g

1 g lactose

The above ingredients were mixed and filled in an airtight cloth to prepare a powder.

<1-2> Preparation of tablets

NRP1 expression or activity inhibitor 100 mg

Corn starch 100 mg

100 mg lactose

2 mg of magnesium stearate

After mixing the above ingredients, tablets were prepared by tableting according to a conventional tablet preparation method.

<1-3> Preparation of capsules

NRP1 expression or activity inhibitor 100 mg

Corn starch 100 mg

100 mg lactose

2 mg of magnesium stearate

After mixing the above ingredients, a gelatin capsule was filled according to a conventional capsule preparation method to prepare a capsule formulation.

<1-4> Preparation of ring

NRP1 expression or activity inhibitor 1 g

1.5 g lactose

1 g glycerin

0.5 g xylitol

After mixing the above components, it was prepared so as to be 4 g per pill according to a conventional method.

<1-5> Preparation of granules

NRP1 expression or activity inhibitor 150 mg

50 mg of soybean extract

200 mg of glucose

Starch 600 mg

After mixing the above ingredients, 100 mg of 30% ethanol was added, dried at 60°C to form granules, and then filled into a cloth.

As shown above, the present invention revealed the relationship between the Nrp-1 gene and asthma for the first time, and since the inhibitor of the expression or activity of the Nrp-1 gene shows the effect of reducing the expression of inflammatory cytokines and the activity of MMP9, It can be usefully used as a kit for diagnosing and screening asthma, and a screening method for treating asthma using the same.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Method for diagnosing and screening asthma using Neuropilin 1 <130> 14p-07-50 <160> 11 <170> KopatentIn 1.71 <210> 1 <211> 572 <212> DNA <213> Homo sapiens <400> 1 ctttgaactt gtggatggtg tgaagttgaa aaaagacaaa ctgaatacac agagtactta 60 ttcggaggca tgaaggcaga cagagatgaa aagacagtca aaggacggaa gtggaaggac 120 gggagtgagc tggggagctg ttgatctttc actatacagg ctgggaagtg tgttgatgac 180 cactgagcca ggcttttctc aggagcttca atgagtatgg ccgacagaca tggacaagga 240 gctgtgttca ccatcggact catgtgcagt cagctttttt cctgttggtt tcatttgaat 300 aatcagatgc tggtgttgag accaagtatg attgacataa tcattcattt cgacccctcc 360 tgcccctctc tctctctctc ctctcccctt tgtggattct ttttggaaac tgagcgaaat 420 ccaagatgct ggcaccaagc gtattccgtg tggccctttg gatggacatg ctacctgaaa 480 cccagtgccc agaatatact agaatcaccg catttcagtg gactcctgaa gttgtacttg 540 tgtataattg cccgcgtcgt gcataggcaa ag 572 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NRP1 forward primer <400> 2 ccacagtgga acaggtgatg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NRP1 reward primer <400> 3 gcacgtgatt gtcatgttcc 20 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> MMP9 forward primer for promoter cloning <400> 4 gatcctcgag ctagaggctg ctacttgc 28 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> MMP9 reward primer for promoter cloning <400> 5 gatcaagctt tctgactgca gctgctgt 28 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 6 ctgcacaaat ctctgaaact a 21 <210> 7 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for NRP1 siRNA <400> 7 gatcccgtag tttcagagat ttgtgcagtt gatatccgct gcacaaatct ctgaaactat 60 tttttccaaa 70 <210> 8 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Reward primer for NRP1 siRNA <400> 8 agcttttgga aaaaatagtt tcagagattt gtgcagcgga tatcaactgc acaaatctct 60 gaaactacgg 70 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 9 ggcgcgcttt gtaggattcg 20 <210> 10 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for scrambled RNA <400> 10 gatcccgcga atcctacaaa gcgcgcttga tatccggcgc gctttgtagg attcgttttt 60 tccaaa 66 <210> 11 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Reward primer for scrambled RNA <400> 11 agcttttgga aaaaacgaat cctacaaagc gcgccggata tcaagcgcgc tttgtaggat 60 tcgcgg 66

Claims (11)

A DNA microarray for asthma diagnosis comprising a neurophilin 1 (NRP1) gene or a complementary strand molecule thereof.
The DNA microarray for asthma diagnosis according to claim 1, wherein the NRP1 gene has the nucleotide sequence of SEQ ID NO: 1.
An asthma diagnostic kit comprising the DNA microarray of claim 1.
A kit for asthma diagnosis comprising a primer set complementary to the NRP1 gene, the primer set comprising a forward primer capable of amplifying the gene and a reverse primer.
5. The kit for asthma diagnosis according to claim 4, wherein the primer set has the nucleotide sequence of SEQ ID NO: 2 for the forward primer and the nucleotide sequence of SEQ ID NO: 3 for the reverse primer.
1) measuring the expression level of NRP1 in a sample separated from a subject as an experimental group;
2) comparing the amount of NRP1 expression in step 1) with the expression level of NRP1 in a sample isolated from normal individuals as a control; And
3) determining that the risk of asthma is high if the amount of NRP1 expression is increased as compared to the control.
The method according to claim 6, wherein the sample is selected from the group consisting of blood, plasma, serum, urine, tears, saliva, sputum, secretion, bronchial secretion, bronchial washing solution, lung secretion, A protein detection method for providing information.
The method according to claim 6, wherein the expression level of NRP1 in step 1) is selected from the group consisting of Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemical staining, immunoprecipitation ) And immunofluorescence. &Lt; RTI ID = 0.0 &gt; 21. &lt; / RTI &gt;
1) treating the test compound or composition with a cell line expressing NRP1 or NRP1 and Matrix metallopeptidase 9 (MMP9);
2) measuring the expression level of NRP1 or NRP1 and MMP9 in the treated cell line of step 1); And
3) screening for a reduced test compound or composition as compared to a control cell line in which the expression level of NRP1 or NRP1 and MMP9 in step 2) is untreated.
1) treating the test compound or composition with the asthma diagnostic kit of claim 3 or 4;
2) measuring the expression level of NRP1 in the treated kit of step 1); And
3) selecting the test compound or composition in which the amount of NRP1 expression in step 2) is reduced compared to the control.
NRP1 A pharmaceutical composition for treating asthma, which comprises as an active ingredient any one selected from the group consisting of an antisense nucleotide complementarily binding to mRNA of a gene, a short interfering RNA (short interfering RNA), and a short hairpin RNA (short hairpin RNA).

Images