KR20140093901A - A Biomarker for Diagnosing Rheumatoid Arthritis - Google Patents

Abstract

The present invention relates to a biomarker for diagnosing rheumatoid arthritis and the use thereof. The marker of the present invention is specifically increased in patients with rheumatoid arthritis. When antibodies or plasminogen are combined with the marker, production of inflammatory cytokines is stimulated. Accordingly, the condition of patients with rheumatoid arthritis is worsened. When the marker of the present invention is used, accurate diagnosis of rheumatoid arthritis can be performed. Also, a prognosis for patients with rheumatoid arthritis can be accurately assessed. When a screening method of the present invention is used, a medicine for preventing and treating rheumatoid arthritis can be quickly and effectively screened.

Description

A Biomarker for Diagnosing Rheumatoid Arthritis < RTI ID = 0.0 >

The present invention relates to a biomarker for the diagnosis of rheumatoid arthritis and its use.

Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by severe synovial inflammation of the joints with bone and cartilage destruction. Approximately 1% of the total population is estimated to be in the patient population. The etiologic agents causing rheumatoid arthritis include bacterial infections such as Mycoplasma, Staphylococcus or Streptococcus, Ebstein-Barr virus, Cytomegalovirus, Parvovirus Parvo virus and Rubella, or endogenous factors such as type 2 collagen, rheumatoid factor, and HLA-DR4 among MHC genes. It is still unclear.

Many types of cells are involved in tissue destruction associated with RA. Inflammatory cytokines such as TNF-α, IL-1, IL-6 and IL-18 produced by macrophages and lymphocytes are known to be associated with the development of RA (Brennan, F. et al. 2007. Curr Rheumatol 19: 296-301).

Functional loss of joints caused by rheumatoid arthritis is not only a serious social and economic loss such as disability of daily life, loss of social labor force and increase of medical expenditure, but also serious loss of lifespan and chronic complications It can cause problems. Therefore, a technique capable of accurately diagnosing rheumatoid arthritis is required.

On the other hand, α-enolase (enolase-1, ENO1) is the first multifunctional protein identified as a key component of the glycolytic pathway. ENO1 is ubiquitously expressed in the cell matrix and is also found on the cell surface as a plasminogen-binding receptor. In addition, antibodies to ENO1 have been found in autoimmune diseases such as lupus, RA, Crohn's disease and retinopathy (Pratesi, F. et al. 2000. J. Rheumatol. 27: 109-115; Saulot, V. et al., 2002. Arthritis Rheum. 46: 1196-1201). However, the pathological role of these autoantibodies has not yet been elucidated.

The present inventors have tried to find a novel biomarker capable of prompt and accurate molecular diagnosis of rheumatoid arthritis. As a result, cells derived from RA patients have more ENO1 on the cell surface than cells derived from osteoarthritis (OA) patients, and anti-ENO1 antibody stimulates the cells to induce p38 MAPK and NF-κB signal Confirming that the production of an inflammatory mediator is induced through a delivery pathway, thereby completing the present invention. Furthermore, the present inventors have completed the present invention by confirming that the level of anti-ENO1 antibody in the blood derived from RA patients is significantly increased as compared with the control sample. In addition, the present inventors have completed the present invention by confirming that the level of anti-ENO1 antibody varies depending on the degree of periodontitis in RA patients suffering from periodontitis.

Accordingly, it is an object of the present invention to provide a marker for the diagnosis or prognosis analysis of rheumatoid arthritis.

It is another object of the present invention to provide a kit for the diagnosis or prognosis of rheumatoid arthritis.

It is another object of the present invention to provide a method for screening a substance for preventing or treating rheumatoid arthritis.

It is another object of the present invention to provide a method for detecting a marker for the diagnosis or prognosis of periodontitis in patients with rheumatoid arthritis.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a method for detecting rheumatoid arthritis (RA) through the method of detecting ENO1 (alpha-enolase) present on the cell surface in a human biological sample to provide information necessary for diagnosis or prognosis analysis of rheumatoid arthritis And a marker for analyzing the diagnosis or prognosis of the cancer.

The present inventors have tried to find a novel biomarker capable of prompt and accurate molecular diagnosis of rheumatoid arthritis. As a result, cells derived from RA patients have more ENO1 on the cell surface than cells derived from osteoarthritis (OA) patients, and anti-ENO1 antibody stimulates the cells to induce p38 MAPK and NF-κB signal It was confirmed that the production of inflammatory mediators was induced through the delivery pathway. Furthermore, the present inventors confirmed that the level of anti-ENO1 antibody in the blood derived from RA patients was significantly increased as compared with the control sample. In addition, the present inventors confirmed that the level of anti-ENO1 antibody was different depending on the degree of periodontitis in RA patients suffering from periodontitis.

The present invention is a novel RA marker identified by identifying (i) a specifically increased protein in cells isolated from RA patients and (ii) a specifically elevated autoantibody in the blood of RA patients, wherein RA It has features that can diagnose and analyze the prognosis very accurately at an early stage.

As used herein, the term "diagnosis" is intended to include determining the susceptibility of an object to a particular disease or disorder, determining whether an object currently has a particular disease or disorder, Determining the prognosis of a stuck object (e.g., determining the stage of RA or determining responsiveness to treatment), or determining therametrics (e.g., monitoring the status of an object to provide information about the therapeutic efficacy) ).

As used herein, the term "diagnostic marker, marker or diagnostic marker for diagnosis" refers to a cell or tissue isolated from RA patients into a control cell or tissue (e.g., normal cells, OA patient cells, And includes organic biomolecules such as polypeptides, proteins, and glycoproteins that show an increase pattern in cells or tissues derived from RA patients as compared with the control group. For purposes of the present invention, the RA diagnostic marker is ENO1 present on the cell surface and is an increased protein in RA patients.

As used herein, the term "ENO1 present on the cell surface " means ENO1, which was present in the cytosol, translocated by internal / external stimuli and located on the cell surface. In this specification, the expression is used interchangeably or interchangeably with the expression "cell-surface expression of ENO1 "," cell surface ENO1 ", or "membrane- bound ENO1 & This is possible.

According to one embodiment of the present invention, the ENO1 present on the cell surface is a membrane-bound ENO1 (membrane-bound ENO1) in which the ENO1 present on the cell substrate translocates to the cell surface and is present on the cell surface )to be.

The method of the present invention for detecting markers for RA diagnosis or prognostic analysis involves measuring (verifying) the level of said cell-surface expressed ENO1 from a biological sample of a human and comparing the measured level to the level measured in the control sample . The control sample may be a biological sample (a normal control sample) taken from a subject that is not RA-bearing, a biological sample (OA patient sample) taken from a patient diagnosed with OA, or a biological sample RA patient sample).

According to one embodiment of the present invention, when the level of the cell-surface expressed ENO1 detected in the biological sample to be measured is increased compared to the value of the normal control sample or the OA patient sample, it can be determined as RA.

According to one embodiment of the present invention, peripheral blood mononuclear cells or synovial mononuclear cells in which ENO1 is present on the cell surface are detected and performed.

In one particular example, the mononuclear cell is a monocyte or macrophage.

In one particular example, the monocyte is a CD11b-positive monocyte or a CD14-positive monocyte.

According to one embodiment of the present invention, the biological sample includes tissues, cells, blood, plasma, serum, synovial fluid, and synovial membrane, and the biological sample Is not limited. In addition, the present invention can rapidly and accurately diagnose RA by detecting the cell-surface expressed ENO1 contained in blood, plasma, and serum collected from a human. That is, the present invention corresponds to a biomarker, and according to one specific example, the present invention is a blood biomarker.

According to one embodiment of the present invention, the present invention can be carried out by an immunoassay method, that is, an antigen-antibody reaction method. In this case, an antibody or an aptamer that specifically binds to the RA marker of the present invention described above is used.

The antibody used in the present invention is a polyclonal or monoclonal antibody, and in one specific example is a monoclonal antibody. Antibodies can be produced using methods commonly practiced in the art, such as the fusion method (Kohler and Milstein, European Journal of Immunology , 6: 511-519 (1976)), the recombinant DNA method (US Patent No. 4,816,56) Or phage antibody library methods (Clackson et al, Nature, 352: 624-628 (1991) and Marks et al. J. Mol. Biol . 222: 58, 1-597 (1991)). General procedures for antibody preparation are described in Harlow, E. and Lane, D. Using Antibodies: A Laboratory Manual , Cold Spring Harbor Press, New York, 1999; Zola, H. Monoclonal Antibodies: A Manual of Techniques , CRC Press, Inc. Boca Raton, Florida, 1984; And Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY , Wiley / Greene, NY, 1991, the disclosures of which are incorporated herein by reference. For example, the preparation of hybridoma cells producing monoclonal antibodies is accomplished by fusing an immortalized cell line with an antibody-producing lymphocyte, and the techniques necessary for this process are well known and readily practicable by those skilled in the art.

Polyclonal antibodies can be obtained by injecting a protein antigen into a suitable animal, collecting the antiserum from the animal, and then separating the antibody from the antiserum using a known affinity technique.

When the method of the present invention is carried out using an antibody or an aptamer, the present invention can be carried out according to a conventional immunoassay method and used to diagnose RA. Such immunoassays can be performed according to various quantitative or qualitative immunoassay protocols developed in the past. The immunoassay format may be selected from the group consisting of flow cytometry, immunofluorescence staining, radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, immunohistochemical staining, enzyme-linked immunosorbent assay, capture-ELISA, But are not limited to, sandwich assay and immunoaffinity purification. Methods of immunoassay or immunostaining are described in Enzyme Immunoassay , ET Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W. Enzymelinked immunosorbent assay (ELISA) , in Methods in Molecular Biology , Vol. 1, Walker, JM ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference. For example, if the method of the present invention is carried out according to the method radioactive immunoassay, radioactive isotope is an antibody labeled (e.g., C ^14, I ^125, P ³² and S ³⁵⁾ of detecting the marker molecules of the present invention .

According to one embodiment of the present invention, the present invention is carried out by flow cytometry analysis using an antibody against ENO1. The anti-ENO1 antibody is labeled with a signal generating label. Wherein the label is a chemical (e.g., biotin), an enzyme (alkaline phosphatase, β- galactosidase, horseradish peroxidase, and cytochrome P450), radioactive materials (e.g., ¹⁴ C, ¹²⁵ I, ³² P And S ³⁵ ), a fluorescent substance (e.g., fluorescein, fluorescein isothiocyanate, rhodamine, picoeriterine, picocyanin, allophycocyanin, o-phthaldehyde, fluorescamine) (Acridinium ester, luciferin, luciferase), chemiluminescent, and fluorescence resonance energy transfer (FRET). Various labels and labeling methods are described in Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press,

According to another embodiment of the present invention, the present invention is carried out by immunohistochemical staining using an antibody against the RA marker. Normal tissues, tissues of OA patients and / or suspected tissues of RA are harvested and fixed, and paraffin-embedded blocks are prepared by methods well known in the art. They are made into sections of several micrometers in thickness and affixed to a glass slide, and reacted with the above-described antibodies by a known method. Thereafter, the unreacted antibody is washed and labeled with one of the above-mentioned detection labels, and the labeling of the antibody is read on a microscope.

According to the present invention, an aptamer that specifically binds to the marker of the present invention can be used instead of the antibody. Aptamers are oligonucleic acid or peptide molecules, and the general contents of aptamers are described in Bock LC et al. Nature 355 (6360): 5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med . 78 (8): 42630 (2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA . 95 (24): 142727 (1998).

According to another aspect of the present invention, there is provided a kit for the diagnosis or prognosis of rheumatoid arthritis, which comprises an antibody or an aptamer binding to ENO1 present on the cell surface.

As used herein, the term "kit for analyzing the diagnosis or prognosis of rheumatoid arthritis" means a kit containing a composition for diagnosis or prognosis analysis of RA. Therefore, the expression "kit for diagnosis or prognosis analysis of RA" can be used in a cross or mixed manner with "composition for RA diagnosis or prognosis analysis ".

According to one embodiment of the present invention, the kit is a kit for immunoassay.

In one particular example, the kit may additionally include the essential elements necessary to perform an ELISA. ELISA kits contain antibodies specific for the marker protein. Antibodies are monoclonal antibodies, polyclonal antibodies or recombinant antibodies with high specificity and affinity for each marker protein and little cross reactivity to other proteins. Other ELISA kits can be used to detect antibodies that can bind a reagent capable of detecting the bound antibody, such as a labeled secondary antibody, chromophores, an enzyme (e. G., Conjugated to an antibody) Other materials, and the like.

In another specific example, the kit is a Luminex Assay Kit. The luminex assay is a high-throughput quantitative assay capable of simultaneously measuring up to 100 different analyte without pretreating small (10-20)) patient samples. (Pg units), which can be quantified in a short time (3-4 hours), and can be used as an alternative to conventional ELISA or ELISPOT. The Luminex assay is a multiplexed fluorescent microplate assay capable of simultaneously analyzing more than 100 biological samples (e.g., cells) in each well in a 96-well plate using two types of laser detectors (polystyrene beads) of more than 100 different color groups are distinguished and quantified by conducting signal transmission in real time using a laser detector. The 100 beads are configured to be distinguished in the following manner. Each bead has an antibody attached to the protein to be analyzed, so that the protein can be quantitated by the immunoassay using the antibody. The sample is analyzed using two lasers, one laser detects the bead's unique number and the other laser detects the protein in the sample reacted with the antibody attached to the bead. Therefore, 100 in vivo protein analysis is possible simultaneously in one well. This assay has the advantage of being detectable with as little as 15 μl of sample.

Luminex kits capable of carrying out the lumenx assays of the invention include antibodies specific for the marker protein. Antibodies are monoclonal antibodies, polyclonal antibodies or recombinant antibodies with high specificity and affinity for each marker protein and little cross reactivity to other proteins. Other luminex kits may also include reagents capable of detecting bound antibodies, such as labeled secondary antibodies, chromophores, enzymes (e.g., conjugated to antibodies) and other substrates capable of binding to the substrate or antibody . ≪ / RTI >

The kit of the present invention may further include other components in addition to the above components. In addition, the kit of the present invention can be made from a number of separate packaging or compartments containing the reagent components described above.

According to another aspect of the present invention, the present invention provides a method for screening a substance for preventing or treating rheumatoid arthritis comprising the steps of:

(a) contacting a test substance with a cell in which ENO1 is present on the cell surface; And

(b) determining the level of ENO1 present on the surface of the cell contacted with the test material of step (a), wherein the level of ENO1 present on the cell surface is reduced compared to the untreated control The test substance is judged to be a substance for preventing or treating rheumatoid arthritis.

According to another aspect of the present invention, the present invention provides a method for screening a substance for preventing or treating rheumatoid arthritis comprising the steps of:

(a) inducing production of an inflammation-inducing cytokine by treating an ENO1-presenting cell with an anti-ENO1 antibody or plasminogen;

(b) contacting the cell of step (a) with a test substance; And

(c) analyzing the effect of the test substance on the production of an anti-ENO1 antibody or plasminogen-induced inflammation-inducing cytokine, wherein the amount of the inflammatory cytokine When production is inhibited, the test substance is judged to be a substance for preventing or treating rheumatoid arthritis.

The present inventors have found that the level of cell-surface expressed ENO1 is significantly increased in RA patients, and the production of inflammatory cytokines in cells is more active when the anti-ENO1 antibody or plasminogen binds to ENO1 expressed on the cell surface Respectively. Thus, a substance that inhibits cell-surface expression ENO1 can be used as a therapeutic agent for RA, which is useful for the fundamental treatment of RA by inducing inhibition of the production of inflammatory cytokines.

As used herein, the term "inhibition of cell-surface expressed ENO1" refers to (i) inhibiting the translocation of ENO1 to the cell surface present in the cell substrate, (ii) Binding ENO1 to a non-membrane bound ENO1, and / or to a membrane-bound ENO1 with its ligand (e.g., an anti-ENO1 antibody, Plasminogen) is inhibited from binding.

The term "test substance" used in reference to the screening method of the present invention means an unknown substance used in screening to test whether it affects the production of cell-surface ENO1 or inflammatory cytokines of cells. Test substances used in the present invention include, but are not limited to, compound libraries, natural product libraries, proteins, polypeptides, aptamers, and nucleic acids.

In one specific example, the test substance is a compound library.

In the screening method of the present invention, substances for preventing or treating RA are screened by using cells having ENO1 on the cell surface. Cells with ENO1 on the cell surface can be obtained by treating cells with LPS, CON A or proinflammatory cytokines to translocate ENO1, which was present in the cell matrix, to the cell surface. The inflammatory cytokines include TNF-α, IL-1α / β, IL-6, IL-18, IFN-γ and PGE _2.

In one embodiment of the present invention, the effect of the test substance on the cell surface expression of ENO1 after the contact of the test substance is analyzed to screen for RA preventive or therapeutic substances. Specifically, when the level of ENO1 present on the cell surface measured in the experimental group is decreased as compared with the data obtained in the control group in which the test substance is not treated, the test substance is judged to be a substance for prevention or treatment of RA. The data of the control group can be obtained by measuring the level of ENO1 present on the surface of cells after inducing cell-surface expression of ENO1 in the cells using the method described above.

In another embodiment of the present invention, the cells in which ENO1 is present on the cell surface are treated with an anti-ENO1 antibody or plasminogen to induce the production of an inflammation-inducing cytokine, and then the test substance is treated with an anti-ENO1 antibody or plasminogen To examine the effect of RA on the production of inflammatory cytokines to screen for RA preventive or therapeutic agents. Specifically, when the production of the inflammation-inducing cytokine is inhibited in the experimental group as compared with the control group in which the test substance is not treated, the test substance is judged to be a substance for prevention or treatment of RA. The screened test substance can prevent and treat RA ultimately by inhibiting the production of an inflammatory cytokine produced by the binding of anti-ENO1 antibody or plasminogen to ENO1 present on the cell surface.

In one specific example, and the proinflammatory cytokines including TNF-α, IL-1α / β, IL-6, IL-18, IFN-γ and PGE _2.

According to one embodiment of the present invention, the cell in which ENO1 is present on the cell surface is PBMC, SFMC or FLS collected from RA patients. In one particular example, the PBMC or SFMC is a monocyte or macrophage, and in other specific examples is a CD11b-positive monocyte, CD14 monocyte or macrophage.

According to one embodiment of the present invention, the anti-ENO1 antibody and plasminogen do not share a site binding to ENO1.

According to another aspect of the present invention, the present invention provides a method for detecting an anti-ENO1 (alpha-enolase) antibody in a human biological sample to provide information necessary for diagnosis or prognosis analysis of rheumatoid arthritis. A method for detecting a marker for diagnostic or prognostic analysis is provided.

Hereinafter, the description overlapping with the above description will be omitted in order to avoid the excessive complexity of the present specification.

As used herein, the term "diagnostic marker, marker for diagnosis or diagnosis marker" refers to a substance that can be separated from a control sample in a sample isolated from a RA patient, And organic biomolecules such as polypeptides, proteins, and glycoproteins that exhibit an increased pattern. For purposes of the present invention, the RA diagnostic marker is an anti-ENO1 magnetic antibody and is an increased protein in RA patients.

The methods of the invention for detecting markers for RA diagnosis or prognostic analysis are performed by measuring the level of the anti-ENO1 antibody from a biological sample of a human and comparing the measured levels to the levels measured in the control samples . The control sample refers to a biological sample (a normal control sample) taken from a subject not suffering from RA or a biological sample (RA patient sample) taken from a patient diagnosed with RA.

According to one embodiment of the present invention, when the level of anti-ENO1 antibody detected in the biological sample to be measured is increased compared to the value of the normal control sample, it can be determined as RA.

According to one embodiment of the present invention, the biological sample includes blood, plasma, and serum, and the range of the biological sample usable in the present invention is not limited due to its description. Therefore, the present invention can rapidly and accurately diagnose RA by detecting anti-ENO1 antibodies contained in blood, plasma and serum collected from human. That is, the present invention corresponds to a biomarker, and according to one specific example, the present invention is a blood biomarker.

According to one embodiment of the present invention, the present invention can be carried out by an immunoassay method, that is, an antigen-antibody reaction method. In this case, the ENO1 protein is used. Such immunoassays can be performed according to various quantitative or qualitative immunoassay protocols developed in the past. The immunoassay format may be selected from the group consisting of flow cytometry, immunofluorescence staining, radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, immunohistochemical staining, enzyme-linked immunosorbent assay, capture-ELISA, But are not limited to, sandwich assay and immunoaffinity purification. Methods of immunoassay or immunostaining are described in Enzyme Immunoassay , ET Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W. Enzymelinked immunosorbent assay (ELISA) , in Methods in Molecular Biology , Vol. 1, Walker, JM ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference. For example, if the method of the present invention is carried out according to the method radioactive immunoassay, radioactive isotope is an ENO1 protein labeling (e. G., C ^14, I ^125, P ³² and S ³⁵⁾ detects the marker molecule of the invention . ≪ / RTI >

According to an embodiment of the present invention, the immunoassay comprises the steps of: (a) adding an antibody-antibody-containing sample to a solid body coated with ENO1 protein; (b) detecting the antigen-antibody reactant produced in step (a) using a secondary antibody conjugate and a chromogenic substrate solution; And (c) determining that the detected amount of the anti-ENO1 antibody is greater than that of a normal subject, as rheumatoid arthritis.

According to another aspect of the present invention, there is provided a kit for the diagnosis or prognosis of rheumatoid arthritis for detecting a magnetic antibody against ENO1 protein, which comprises an ENO1 (alpha-enolase) protein.

Hereinafter, the description overlapping with the above description will be omitted in order to avoid the excessive complexity of the present specification.

According to one embodiment of the present invention, the kit is a kit for immunoassay.

In one particular example, the kit is a kit for an enzyme linked immunosorbent assay (ELISA). The kit additionally contains the essential elements necessary to perform the ELISA. The kit may further include a secondary antibody that is specific to a magnetic antibody specifically bound to ENO1 protein and has a marker bound thereto by reaction with a substrate. Examples of the markers include fluorescent materials such as HRP (Horseradish peroxidase), alkaline phosphatase, colloidal gold, FITC (Poly L-lysine-fluorescein isothiocyanate) and RITC (Rhodamine-B-isothiocyanate) Fluorescein and Dye may be used. The kit comprises a chromogenic substrate (eg, TMB (3,3 ', 5,5'-tetramethylbezidine), ABTS [2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid )] And OPD (ophenylenediamine)).

According to another aspect of the present invention, there is provided a method of detecting an anti-ENO1 (alpha-enolase) antibody in a biological sample of a rheumatoid arthritis patient to provide information necessary for diagnosis of periodontitis in a rheumatoid arthritis patient The present invention provides a method for detecting a marker for the diagnosis or prognosis of periodontitis in patients with rheumatoid arthritis.

According to one embodiment of the present invention, the level of anti-ENO1 antibody in a biological sample of a patient with rheumatoid arthritis who has moderate to severe periodontitis, the level of anti-ENO1 antibody in the biological sample of the rheumatoid arthritis patient, The rheumatoid arthritis patient is judged to be suffering from Slight Periodontitis.

According to another embodiment of the present invention, when the level of the anti-ENO1 antibody in the biological sample of the rheumatoid arthritis patient is higher than the level of the anti-ENO1 antibody in the biological sample of the rheumatoid arthritis patient suffering from the periodontitis, Patients with rheumatoid arthritis are classified as patients with moderate to severe periodontitis.

The features and advantages of the present invention are summarized as follows:

(i) The present invention provides novel molecular markers for rheumatoid arthritis.

(ii) The markers of the present invention are specifically increased in patients with rheumatoid arthritis, and the binding of antibodies or plasminogen to the markers leads to the production of inflammatory cytokines, thereby exacerbating rheumatoid arthritis.

(iii) Using the marker of the present invention, it is possible to accurately diagnose and prognose rheumatoid arthritis, and in the case of using the screening method of the present invention, a preventive and therapeutic agent for rheumatoid arthritis can be rapidly and efficiently screened.

1A-1D show cell-surface expression of ENO1 in monocytes and macrophages isolated from RA patients. [1A] shows cell-surface expression of ENO1 in PBMC and SFMC from OA or RA patients. Shows the proportion of ENO1-positive cells in total PBMCs from [1B] OA (n = 14) and RA (n = 42) patients and SFMC from n = 20 patients (n = 20). Expression of CD3, CD11b, CD14, CD19 and CD56 in ENO1-positive cells of [1C] RA PBMC and SFMC. The left panel is the data for the RA PBMC and the values on the right panel are means ± SD of independent experiments for 12 RA patients. ** p < 0.01, *** p < 0.001.
Figure 2 shows the expression of ENO1 in the ankle tissues of the CIA mouse model (A) and ST (B) of RA and OA patients.
Figure 3 shows IL-6 production of RA FLS by ENO1 stimulation.
Figure 4A shows the increased production of ENO1 after stimulation by anti--ENO1 mAb, TNF-α, IL -1α / β, IFN-γ and PGE ₂ in the PBMC of patients with RA. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 4B shows the increased production of ENO1 after stimulation by anti--ENO1 mAb, TNF-α, IL -1α / β, IFN-γ and PGE ₂ in SFMC of patients with RA. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figures 5A-5F show increased production of TNF-a in PBMC and SFMC in RA patients following ENO1 stimulation with plasminogen. [5A and 5B] RA PBMCs and SFMCs were stimulated with varying concentrations of plasminogen for 12 hours and incubated, followed by ELISA to determine the level of TNF-a. [5C and 5D] RA PBMCs were stimulated with plasminogen (50 μg / ml) for 12 hours in the presence or absence of 10 mM TXA or 12.5 or 25 μM VPLCK. After incubation, levels of TNF-a and IL-l [beta] were measured by ELISA. [5E and 5F] This is a competitive assay result between plasminogen and anti-ENO1 mAb to confirm the binding site of plasminogen and anti-ENO1 mAb. RA PBMCs were pretreated with plasminogen (1 or 4 μg / ml) for 30 min and washed, stained with FITC-conjugated anti-ENO1 mAb and analyzed by flow cytometry (5E). RA PBMCs were simultaneously stimulated with plasminogen (12.5 μg / ml) and / or anti-ENO1 mAb (1 μg / ml) and incubated for 12 hours. The level of TNF-α in the culture supernatant was measured by ELISA (5F). ** p < 0.01, *** p < 0.001.
Figures 6A-6D show the production of inflammatory cytokines via p38 MAPK and NF-kB pathways following ENO1 stimulation by anti-ENO1 mAb. Lt; RTI ID = 0.0 &gt; TNF-a &lt; / RTI &gt; and IL-lβ by specific inhibitors of P38 MAPK and NF-kB. *** p &lt; 0.001.
Figure 7 shows the serum IgG titer for ENO1 in normal control and RA patients.
FIG. 8 shows the normal control group and the RA patient group as mild periodontitis according to the degree of periodontitis and moderate to severe periodontitis, and the serum IgG titer for ENO1 in these subgroups.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

EXAMPLES Example 1 Cell surface expression of ENO1 as a rheumatoid arthritis diagnostic marker

Materials and Experiments

Patients and samples

Heparinized peripheral blood was obtained from healthy persons (n = 10), RA patients (n = 35) and OA patients (n = 14). Synovial fluid was collected from RA patients (n = 18). Synovial tissue (ST) samples were obtained from patients who underwent total knee replacement surgery or arthroscopy. PBMC and synovial fluid mononuclear cells (SFMC) were purified using a Ficoll-Hypaque gradient (GE Healthcare Biosciences, Uppsala, Sweden). Samples were mixed with an equal volume of PBS (pH 7.4) and applied to Ficoll-Hypaque. After 20 minutes of centrifugation at 2000 rpm, buffy coats were carefully collected and washed twice with PBS. Purified cells were cultured in RPMI 1640 containing 2 mM L-glutamine, 100 U / ml penicillin, 100 [mu] g / ml streptomycin and 10% heat-activated FBS (Invitrogen, Carlsbad, CA). To induce cell surface expression of ENO1, PBMCs from healthy human were cultured for 24 hours in the presence of Con A (Calbiochem, Darmstadt, Germany) (2 μg / ml / 10 ⁶ cells) or IL- -6, PGE _2, or TNF-α; and incubated for 48 hours in the presence of (50 ng / ml R & D Systems, Minneapolis, MN).

Synovial fibroblasts (fibroblast - like synoviocyte , FLS ) and culture

ST samples were transferred into small pieces and incubated in DMEM with 1 mg / ml type I collagenase (Sigma-Aldrich, St. Louis, Mo.) for 2 hours at 37 ° C. Cells were then collected and washed and then incubated in a humidified 5% CO ₂ 10% incubator with FCS (Life Technologies, Grand Island, NY), 2 mM L-glutamine, 100 U / ml penicillin and 100 μg / ml streptomycin And cultured in DMEM (complete high glucose DMEM). The synovial fibroblasts of passage 4-6 were stimulated with 50 ng / ml rTNF-a (R & D Systems) for 48 hours.

Collagen-induced arthritis animal model

Bovine type II collagen (CII) was dissolved in 0.05 M acetic acid (2 mg / ml), emulsified with CFA (1: 1 ratio) and then immunized with male DBM / 1J mice (8-9 weeks old). As a primary immunization, 0.1 ml of emulsion containing 100 μg of CII was administered at the tail end of the mouse. After 3 weeks of primary immunization, reinforcement was inoculated by the same method. The extent and severity of arthritis were confirmed by visual inspection. After primary immunization, the status of the mice was observed for 2 or 3 times per week for 10 weeks to confirm the onset, duration and severity of joint inflammation. The mice were sacrificed, the joints were collected, fixed with 4% paraformaldehyde, and the calcareous material was removed and embedded in paraffin.

Anti-human ENO1 mAb  Produce

Anti-ENO1 mAb was produced and purified from the ascites of mice injected with F6 (anti-ENO1 mAb producing hybridoma clone) using a protein A column. Anti-ENO1 polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.) Was used for immunohistochemical staining of ST. To confirm the specificity of the anti-ENO1 mAb, tandem mass spectrometry of peptides obtained by in-gel digestion was performed using a nano-ESI or Q-TOF mass spectrometer (AB Sciex Instruments). The sequence of the ENO1 peptide is RGNPTVEVDLFTSKG (SEQ ID No. 1) and RYISPDQLADLYKS (SEQ ID No. 2).

Flow cell  analysis( Flow cytometry )

Single-cell suspensions were prepared from various RA or OA patients. Cells were resuspended in FACS buffer containing 0.5% BSA and blocked with Fc Blocking reagent (Miltenyi Biotec, Bergisch Gladbach, Germany) for 10 min at 4 ° C. Cell-surface ENO1 was then stained on ice for 30 minutes with the following antibodies: FITC-conjugated mAb and CD3, CD11b, CD14, CD19, and CD56 against ENO1 or PE-conjugated mAb to BDO biosciences , San Jose, CA). Cells were washed twice with FACS buffer and analyzed using FACSCalibur (BD Biosciences, San Jose, Calif.).

ENO1  Immunohistochemical analysis of the invention

Immobilized ST samples from human or mouse were embedded in paraffin and cut to size of 4 μm. After deparaffinization and hydration, Ag retrieval was performed with 0.1 M citrate buffer (pH 6) using microwave. Intrinsic peroxidase was blocked with H ₂ O ₂ and nonspecific signals were suppressed with 5% serum. The sections were incubated overnight with a goat anti-ENO1 Ab (1: 150; Santa Cruz Biotechnology) in a 4 ° C humidity chamber and incubated overnight with biotinylated rabbit anti-goat Ig (1: 200; Vector Laboratories, Burlingame, And incubated together at room temperature for 1 hour. Then, the ABC solution was treated for 30 minutes, and chromogenic elements were detected using DAB kits (Vector Laboratories). After contrast dyeing with hematocylline, tissue sections were observed under a microscope and pictures of representative sections were taken.

ENO1  stimulus

PBMCs and SFMCs (3 × 10 ⁶ / ml) derived from RA patients or FLSs were stimulated with anti-ENO1 mAb (1 μg / ml) or plasminogen (Molecular Innovations, Novi, MI) for 1 hour at room temperature. MOPC-21 (1 [mu] g / ml; Sigma-Aldrich) was used as an isotype control antibody. Cells were transferred to 24-well plates and incubated in a 5% CO ₂ humidity incubator at 37 ° C for 12 hours.

ELISA

ENO1 after stimulation by anti--ENO1 mAb or plasminogen, to collect the supernatant using the ELISA kit for TNF-α, IL-1α / β, IFN-γ, IL-18 and the PGE ₂ levels in accordance with the manufacturer's instructions Respectively. The human IL-18 ELISA kit was purchased from MBL (Nagoya, Japan), and the human PGE _{2 &lt; RTI ID = 0.0 &gt;} ELISA kits were purchased from Cayman Chemical (Minneapolis, MN). To evaluate the role of plasminogen in the production of inflammatory mediators, lysine analogue tranexamic acid (TXA; Sigma-Aldrich) and a plasmin specific inhibitor (D-Val-Phe-Lys chloromethyl ketone, VPLCK; Calbiochem) was used. RA PBMCs were stimulated with plasminogen for 12 hours in the presence or absence of TXA or VPLCK. TNF-α and IL-1β levels in the supernatants were measured by ELISA.

Investigation of signal transduction pathways associated with cytokine production

Specific inhibitors of NF-κB (BAY11-7082), PI3K (LY294002), ERK (PD98059), p38 MAPK (SB203580) and JNK (SP600125) were purchased from Sigma-Aldrich. The inhibitors were used to identify signaling pathways associated with cytokine induction by ENO1 stimulation with anti-ENO1 mAb. PBMCs or SFMCs were pretreated with the inhibitor or DMSO for 1 hour and washed twice. Subsequently, cells were stimulated with anti-ENO1 mAb (1 [mu] g / ml) and further incubated for 12 hours. TNF-α and IL-1β levels in supernatants were measured by ELISA. Additional studies were performed using the p38 MAPK inhibitor (SB203580) and its control compound (SB202474) to rule out the nonspecific effects of inhibitors.

Western Blat  analysis

After stimulation with ENO1 with anti-ENO1 mAb, cells were homogenized with lysis buffer and total protein concentration was measured using Bio-Rad Protein Assay Kits (Bio-Rad, Hercules, Calif.). The same amount of protein was separated using 10-12% polyacrylamide-SDS gel, transferred to a nitrocellulose membrane, blocked with 5% skim milk for 1 hour, washed with 0.05% Tween-20 in PBS, Lt; / RTI &gt; with the primary antibody. The primary antibodies against phospho-p38 MAPK (Cell Signaling Technology, Danvers, MA), p38 MAPK (Santa Cruz Biotechnology) and β-actin (Sigma-Aldrich) were diluted 1: 1000, 1: : &Lt; / RTI &gt; 2000 and 1: 4000. Membranes were washed, incubated with HRP-conjugated secondary antibody (1: 5000; Cell Signaling Technology) and confirmed with an ECL detection kit (GE Healthcare, Buckinghamshire, UK).

Chromatin Immune sedimentation  analysis( Chromatin immunoprecipitation assay )

Chromatin immunoprecipitation assay (ChIP) is described in Agata, Y. et al . 2001. J. Exp . Med . 193: 873-880). Briefly, ENO1 stimulated cells with anti-ENO1 mAb were fixed with formaldehyde and homogenized with lysis buffer. The chromatin was sheared by sonication and the sheared chromatin fragment (1%) was placed as input DNA on one side. DNA samples were immunoprecipitated with rabbit anti-p65 Ab (Santa Cruz Biotechnology) overnight at 4 ° C. Rabbit IgG (Santa Cruz Biotechnology) was used as an isotype control of rabbit anti-p65 Ab. Immunoconjugates were collected using salmon sperm DNA-agarose A slurry and eluted with elution buffer. The protein-DNA cross-linkage was cleaved by heating at 65 DEG C for 4 hours. After RNase and protease K digestion, DNA was isolated by phenol / chloroform extraction. The same set of input DNA and ChIP DNA was subjected to semi-quantitative PCR. The TNF- [alpha] promoter-specific primers for the region containing the NF- [kappa] B binding motif are: CCCTCCAGTTCTAGTTCTATC (forward; SEQ ID NO: 3 sequence) and GGGGAAAGAATCATTCAACCAG (reverse; SEQ ID NO: 4 sequence). The IL-1? Promoter-specific primers for the region containing the NF-kB binding motif are: CACTCTTCCACTCCCTCC (forward; SEQ ID NO: 5 sequence) and AGCCTCAAACCCTTCCTC (reverse sequence; SEQ ID NO: 6 sequence).

Statistical analysis

Data were expressed as means ± SD. One-way ANOVA followed by Newman-Keuls multiple comparison test was used to compare three or more groups. <0.05 p value was considered as statistically significant value. Statistical analysis was performed using GraphPad InStat version 5.01 (GraphPad, La Jolla, Calif.).

Experiment result

RA  Patient-derived In mononuclear cells ENO1 Of cell-surface expression

The cell surface expression of ENO1 was confirmed in mononuclear cells by flow cytometry analysis. Cell-surface expression of ENO1 was very low in PBMCs isolated from healthy humans, but increased by CON A stimulation (Figure 1A). On the other hand, RA PBMC and SFMC expressed ENO1 on their cell surface (Fig. IA). The frequency of ENO1-positive cells was significantly higher in RA PBMC (n = 14) than in OA PBMC (n = 14; 11.71 ± 5.35%) (RA PBMC and RA SFMC versus OA PBMC: p <0.01, p < (Mean ± SD, 24.42 ± 13.19%) and RA SFMC (n = 20; 42.15 ± 18.69%), respectively. In addition, the frequency of ENO1-positive cells was higher in RA SFMC than in RA PBMC ( p <0.001; Fig. 1B). These results indicate that ENO1 is easily expressed on the surface of mononuclear cells of blood and inflamed joint tissues of RA patients.

Since PBMC and SFMC are composed of various types of immune cells, they were stained with immunocyte-specific markers for CD3, CD11b, CD14, CD19 and CD56 to investigate which cell subset had the major effect on ENO1 expression. As a result, the major cells expressing ENO1 in RBMCs and SFMCs from RA patients were identified as CD11b-positive monocytes, CD14-positive monocytes and macrophages (RA PBMCs, 91.17 ± 6.23%; RA SFMCs, 67.46 ± 29.05%; FIG. 1C).

Arthritis of collagen-induced arthritis mouse model ENO1 expression in ST of ankle tissue and RA patients

The expression of ENO1 in arthritic ankle tissues of mice with collagen-induced arthritis (CIA) was investigated. CIA is widely used as a model of RA and chronic erosive inflammatory disease. As shown by the flow cytometry analysis shown in Fig. 1, ENO1-positive cells were found in arthritic ankle tissue (n = 5) but not in normal control mice (n = 4) (Fig. ENO1 was also expressed in RA ST (n = 34) but not in OA (n = 32) (FIG. 2B) as a result of confirming the expression of ENO1 in ST derived from OA and RA patients.

FLS plays an important role in the development of RA (Firestein, GS 1996. Arthritis Rheum. 39: 1781-790; Tolboom, TC et al . 2005. Arthritis Rheum . 52: 1999-2002). Therefore, surface expression of ENO1 was examined in FLS derived from RA patients. As a result, IL-6 production was increased by anti-ENO1 antibody stimulation in TNF-a treated FLS as compared to the control (Fig. 3).

Term - ENO1 Induction of TNF- α, IL- 1α / β, IL- 18, IFN- γ and PGE ₂ production by ENO1 stimulation by mAb

In RA PBMC and SFMC, most ENO1-positive cells were monocytes and macrophages (Fig. 1C). Monocytes and macrophages represent a dominant cellular lineage in the pannus and play an important role in chronic inflammation (Zekanecz, Z. et al., 2007. Curr . Opin . Rheumatol . 19: 289-295). Furthermore, it is known that the core inflammatory cytokines in RA, such as TNF-a and IL-1, are produced by activated monocytes and macrophages. Therefore, we examined whether the cell-surface expression of ENO1 could mediate the production of inflammatory mediators such as TNF-α, IL-1α / β, IL-18, IFN-γ and PGE ₂ in PBMC and SFMC. When PBMCs and SFMCs derived from RA patients were stimulated with anti-ENO1 mAb, TNF-α (anti-ENO1 versus control, RA PBMCs, 9780.0 ± 520.5 versus 46.7 ± 20.2 pg / ml; p <0.001; RA SFMCs, 12760.0 ± 193.5 versus 1715.0 ± 257.3 pg / ml ; p <0.001), IL-1α (anti-ENO1 versus control, RA PBMCs, 2535.2 ± 52.6 versus 2.0 ± 1.0 pg / ml; p <0.001; RA SFMCs, 2756.2 ± 92.0 versus 2.0 ± 1.0 pg / ml; p < 0.001), IL-1β (anti-ENO1 versus control, RA PBMCs, 7604.2 ± 157.4 versus 166.7 ± 10.4 pg / ml; p <0.001; RA SFMCs, 9240.0 ± 485.4 versus 805.0 ± 225.2 pg / ml; p <0.001), IL-18 (anti-ENO1 versus control, RA PBMCs, 104.8 ± 20.4 versus 1.4 ± 0.1 pg / ml; p <0.001; RA SFMCs, 54.7 ± 5.0 versus 12.9 ± 1.8 pg / ml; p <0.001), and IFN-γ (anti-ENO1 versus control, RA PBMCs, 190.0 ± 10.0 versus 80.0 ± 26.5 pg / ml; p <0.01; RA SFMCs, 530.0 ± 105.4 versus 313.3 ± 32.1 pg / ml; p <0.05 ) Significantly increased (Figs. 4A and 4B). In addition, PGE ₂ production (anti-ENO1 versus control, RA PBMCs, 10935.1 ± 314.3 versus 743.1 ± 66.9 pg / ml; p <0.001; RA SFMCs, 12003.3 ± 607.0 versus 343.9 ± 60.9 pg / ml; p <0.001) also ENO1 Significantly increased by stimulation (Figures 4A and 4B). CD14-positive cells were isolated from PBMCs derived from RA patients to confirm that the cells responsible for cytokine production were mainly monocytes and macrophages. As a result, positive cells that were not CD14-negative cells produced a significant amount of TNF-α according to ENO1 stimulation with anti-ENO1 mAb (mean ± SD, 1828.7 ± 148.2 versus 39.6 ± 9.9 pg / ml; p <0.001). The same results were also obtained in SFMC derived from RA patients (2715.6 ± 203.7 versus 126.1 ± 4.8 pg / ml; p <0.001). To preclude the possibility that increased cytokine production could be caused by endotoxin contamination, endotoxin concentrations of the reagents used for stimulation with anti-ENO1 mAb were determined by Limulus amebocyte lysate assay under endotoxin-free conditions . The level of endogenous intoxication in the buffer used for stimulation was 0.9728 EU / ml. It is known that Limulus amebocyte lysate reacts with LPS or endotoxin, a membrane component of Gram-negative strains. (1 EU / ml LPS versus control, 446.4 ± 41.4 versus 525.5 ± 23.9 pg / ml) in the RA PBMCs, indicating that 1 EU / ml LPS can not induce TNF-α production. These results indicate that all results from ENO1 stimulation were specifically induced by ligation of anti-ENO1 antibody.

On plasminogen  by ENO1  Stimulation TNF -α and IL -1β production increase

ENO1 is known as one of the plasminogen receptors, and plasminogen is known as an important mediator of inflammation of the joints in RA (Belch, JJ et al . 1984. Ann . Rheum. Dis . 43: 774-777). The interaction of plasminogen with ENO1 was mediated by the binding of the plasminogen Kringle domain to the C-terminal lysine residue of ENO1. Subsequently, activation of plasminogen by plasminogen activator into plasmin and localization of the protein hydrolyzing activity of plasmin at the cell surface was enhanced by the interaction between plasminogen and ENO1 (Miles, LA et al . 1991. Biochemistry 30: 1682-1691). To assess whether the binding of plasminogen to ENO1 could lead to the production of inflammatory mediators such as antibodies to ENO1, ENO1-positive cells were stimulated with plasminogen. After plasminogen treatment, levels of TNF-a were dose-dependently increased in RA PBMC and SFMC (plasminogen treatment versus control, p <0.001, respectively; Figs. 5A and 5B), indicating that ENO1 stimulation by anti- (Anti-ENO1 versus plasminogen 50 μg / ml treatment, RA PBMCs, 1444.8 ± 123.8 versus 1784.2 ± 52.5 pg / ml; RA SFMCs, 5111.3 ± 120.6 versus 4504.7 ± 358.0 pg / ml). The plasminogen that binds to the C-terminal lysine residue of a plasminogen receptor containing ENO1 has been reported to be inhibited by lysine analogues such as TXA (Wygrecka, M. et al . 2009. Blood 113: 5588-5598). Plasminogen-induced TNF- [alpha] and IL-beta production was inhibited by TXA treatment (Fig. 5C). In addition, VPLCK, which blocks the catalytic center of the plasmin, was used to inhibit plasminogen-induced TNF- alpha and IL-beta production by VPLCK (Figure 5D). These results indicate that binding of plasminogen to ENO1 and activation of plasminogen to plasmin play an important role in the production of plasminogen-mediated cytokines.

We examined whether plasminogen and anti-ENO1 mAbs share a membrane-bound ENO1 binding site. When cells were pretreated with plasminogen and stained with anti-ENO1 mAb, there was no change in binding activity to ENO1 located in the membrane of ENO1 mAb (FIG. 5E). In addition, simultaneous treatment of cells with plasminogen and anti-ENO1 mAb resulted in an additional increase in TNF-a production (Fig. 5E). These results indicate that plasminogen and anti-ENO1 mAbs do not share binding sites on ENO1 bound to the membrane.

Term - ENO1 p38 induced by ENO1 stimulation by mAb Induction of TNF - α and IL-1β through MAPK and NF- κB pathways

In order to identify signaling pathways responsible for the production of inflammatory mediators by ENO1 stimulation with anti-ENO1 mAbs, inhibitors for several signaling pathways were used. Cell-surface expressed ENO1 of PBMC and SFMC isolated from RA patients was stimulated with anti-ENO1 mAb after pretreatment with inhibitor. The production of TNF- [alpha] and IL-1 [beta] was enhanced by pretreatment with anti-ENO1 versus SB203580 treatment ( p < versus BAY11-7082 treatment, p <0.001, respectively). However, the ERK1 / 2 inhibitor PD98059, the JNK inhibitor SP600125 or the PI3K activation inhibitor LY294002 did not affect the production of TNF-α or IL-1β (FIGS. 6A and 6B). Cytotoxicity of each inhibitor was assessed by trypan blue dye exclusion analysis. Cell viability and number were not affected by inhibitor treatment. Production of TNF- [alpha] and IL-l [beta] was not inhibited by SB202474 pretreatment (control compound of SB203580, 40 [mu] M, the same concentration as SB203580) in RA PBMC. These results indicate that ENO1 regulates the production of inflammatory cytokines through the p38 MAPK and NF-κB pathways. Following ENO1 stimulation with anti-ENO1 mAb, p38 MAPK phosphorylation was time-dependent in PBMC and SFMC from RA patients (Fig. 6C). Furthermore, the binding of NF-κB to the promoter region of TNF-α or IL-1β following stimulation of ENO1 by anti-ENO1 mAb was confirmed by ChIP analysis of chromatin samples. As a result, according to the stimulation of ENO1 by the anti-ENO1 mAb, the binding activity of NF-κB p65 was increased in the consensus binding motif of NF-κB on the promoter region of TNF-α or IL-1β ( 6D).

Example 2. Anti-ENO1 antibody as a rheumatoid arthritis diagnostic marker

Materials and Experiments

Control and RA patients

- Control group - sPD: 57, msPD: 28, total: 85

- RA patient - sPD: 88, msPD: 160, total: 248

- PD classification criteria: sPD (CAL <3 mm) and msPD (CAL ≥ 3 mm)

- PD Classification Note: American Academy of Periodontal 2004 Classification (Min: CAL 1-2 mm, Medium: CAL 3-4 mm, Severity: CAL ≥ 5 mm).

The control and RA patient groups participating in the experiment were as follows.

ELISA for anti-ENO1 antibody

96-well microtiter plates (NUNC, Roskilde, Denmark) were coated overnight at 4 째 C with 1 ug / ml ENO1 (Prospec, Ness-Ziona, Israel) in sodium carbonate coating buffer (pH 9.6). After washing three times with PBS containing 0.05% Tween 20 (PBST, pH 7.4), the cells were blocked with PBS containing 1% BSA, and then double serum diluted with patient or normal subjects and control (first dilution 1: 200) Was added to the plate and bound human IgG was detected with HRP-conjugated human IgG specific antibody (Millipore, Billerica, MA, USA, 1/6000 dilution) and then developed. The anti-ENO1 titer was defined as the inverse value of the largest series dilution in which the detection antibody was observed.

Statistical analysis

Serum levels of IgG titer against ENO1 antibody between RA and non-RA groups were compared by non-parametric Mann-Whitney U test (non-parametric Mann-Whitney U test). The correlation between serum levels of IgG titers for ENO1 antibodies and RA characteristics or periodontal indices was investigated by calculating the Spearman correlation coefficient. All recorded p-values were double-sided and p <0.05 was considered statistically significant. Analysis was performed using IBM SPSS statistics version 19.0 (Chicago, IL, USA).

Experiment result

The association of anti-ENO1 antibody with RA

Anti-En1 antibody levels were measured in serum from 85 normal controls and 247 RA patients. In RA patients, P < 0.0001, a statistically significantly higher level of anti-En1 antibody was observed than in the control (Table 2 and Fig. 7).

We analyzed the correlation between anti-En1 antibody and RA clinical parameters in RA patients. As a result, as shown in the following Table 2, anti-En1 antibody levels showed a significant correlation with ESR (erythrocyte sedimentation rate), DAS28-ESR and anti-CCP antibody titer. These correlations were independent of PD severity (Table 3).

The association of anti-En1 antibodies with periodontitis in patients with RA

The normal control group and the RA group were classified as mild periodontitis (sPD) and moderate to severe PD (msPD) according to the severity of periodontitis (PD) The levels were compared. As a result, as shown in Table 3 below, there was no difference in the anti-En1 antibody level in the control group regardless of the PD level, but the anti-En1 antibody level in the RA patient group was higher than that of the sPD in the msPD 8). These results demonstrate the applicability of the anti-En1 antibody as a tool (diagnostic marker) to determine the severity of PD in place of the cumbersome periodontal examinations in RA patients.

In addition, the correlation between anti-ENO1 antibody and PD clinical parameters was examined in each of the control and RA patients. As shown in Table 5, no significant correlation was observed in the control group, whereas in the RA patient group, anti-ENO1 antibody and PPD (probing pocket depth, periodontal depth), bleeding on probing, ) And clinical attachment level (CAL) (Table 5).

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> SNU R & DB FOUNDATION <120> A Biomarker for Diagnosing Rheumatoid Arthritis <130> PN140002 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> ENO1 peptide sequence <400> 1 Arg Gly Asn Pro Thr Val Glu Val Asp Leu Phe Thr Ser Lys Gly   1 5 10 15 <210> 2 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> ENO1 peptide sequence <400> 2 Arg Tyr Ile Ser Pro Asp Gln Leu Ala Asp Leu Tyr Lys Ser   1 5 10 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for TNF-a-specific promotor <400> 3 ccctccagtt ctagttctat c 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for TNF-a-specific promotor <400> 4 ggggaaagaa tcattcaacc ag 22 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer for NFkB-specific promotor <400> 5 cactcttcca ctccctcc 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for NFkB-specific promotor <400> 6 agcctcaaac ccttcctc 18

Claims (20)

A method for detecting a marker for the diagnosis or prognosis of rheumatoid arthritis by detecting ENO1 (alpha-enolase) present on the cell surface in a biological sample to provide information necessary for diagnosis or prognosis analysis of rheumatoid arthritis .
The method according to claim 1, wherein the ENO1 present on the surface of the cell is a membrane-bound ENO1 (ENO1) in which the ENO1 present in the cytosol is translocated to the cell surface, ). &Lt; / RTI &gt;
The method according to claim 1, wherein, when the human is a rheumatoid arthritis patient, the level of ENO1 present on the surface of the detected cell is increased compared to a normal human or degenerative arthritis patient.
2. The method of claim 1, wherein the method detects ENO1 present on the surface of peripheral blood mononuclear cells or synovial mononuclear cells.
5. The method of claim 4, wherein said mononuclear cells are monocytes or macrophages.
6. The method of claim 5, wherein the monocyte is a CD11b-positive monocyte or a CD14-positive monocyte.
The method of claim 1, wherein the biological sample is a tissue, a cell, a blood, a plasma, a serum, a synovial fluid, or a synovial membrane.
A kit for analyzing the diagnosis or prognosis of rheumatoid arthritis, comprising an antibody or an aptamer binding to ENO1 present on a cell surface.
A method for screening a substance for the prevention or treatment of rheumatoid arthritis comprising the steps of:
(a) contacting a test substance with a cell in which ENO1 is present on the cell surface; And
(b) determining the level of ENO1 present on the surface of the cell contacted with the test material of step (a), wherein the level of ENO1 present on the cell surface is reduced compared to the untreated control The test substance is judged to be a substance for preventing or treating rheumatoid arthritis.
A method for screening a substance for the prevention or treatment of rheumatoid arthritis comprising the steps of:
(a) inducing production of an inflammation-inducing cytokine by treating an ENO1-presenting cell with an anti-ENO1 antibody or plasminogen;
(b) contacting the test substance to the cell of step (a); And
(c) analyzing the effect of the test substance on the production of an anti-ENO1 antibody or plasminogen-induced inflammation-inducing cytokine, wherein the amount of the inflammatory cytokine When production is inhibited, the test substance is judged to be a substance for preventing or treating rheumatoid arthritis.
11. The method according to claim 9 or 10, wherein ENO1 is present on the surface of the cell, wherein ENO1 is translocated to the cell surface by treatment with LPS, CON A or proinflammatory cytokines Screening method.
11. The screening method according to claim 9 or 10, wherein said cells are peripheral blood mononuclear cells, synovial mononuclear cells, or synovial fibroblasts obtained from a patient suffering from rheumatoid arthritis.
11. The method according to claim 9 or 10, wherein the test substance is TNF-a, IL-1 alpha / beta, IL-6, IL-18, IFN-y, and PGE2.
A method for detecting a marker for the diagnosis or prognosis of rheumatoid arthritis by detecting an anti-ENO1 antibody in a biological sample of a human to provide information necessary for diagnosis or prognosis analysis of rheumatoid arthritis.
15. The method according to claim 14, wherein when the human is a rheumatoid arthritis patient, the level of the detected anti-ENO1 antibody is increased as compared to a normal person.
15. The method of claim 14, wherein the biological sample is blood, plasma or serum.
A kit for the diagnosis or prognosis of rheumatoid arthritis for detecting a magnetic antibody against ENO1 protein, comprising an ENO1 (alpha-enolase) protein.
18. The kit according to claim 17, wherein the kit further comprises a secondary antibody specific to a magnetic antibody specifically bound to the ENO1 protein and having a label bound thereto by reaction with a substrate.
18. The kit according to claim 17, wherein the kit is an ELISA (Enzyme linked immunosorbent assay) kit.
Diagnosis or prognosis of periodontitis in patients with rheumatoid arthritis by detecting anti-ENO1 (α-enolase) antibodies in biological samples of patients with rheumatoid arthritis to provide information for diagnosis of periodontitis in patients with rheumatoid arthritis And detecting the marker for use.

Images