KR20140093889A - Method for Discriminating Between Epinephelus bruneu and Epinephelus septemfasciatus and a Kit Therefor - Google Patents
Method for Discriminating Between Epinephelus bruneu and Epinephelus septemfasciatus and a Kit Therefor Download PDFInfo
- Publication number
- KR20140093889A KR20140093889A KR1020130038330A KR20130038330A KR20140093889A KR 20140093889 A KR20140093889 A KR 20140093889A KR 1020130038330 A KR1020130038330 A KR 1020130038330A KR 20130038330 A KR20130038330 A KR 20130038330A KR 20140093889 A KR20140093889 A KR 20140093889A
- Authority
- KR
- South Korea
- Prior art keywords
- primer
- sequence
- loop
- region
- loop region
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
본 발명은 자바리(Epinephelus bruneu)와 능성어(Epinephelus septemfasciatus)의 식별 방법 및 그 키트에 관한 것이다.
The invention relates to a method of identifying jabari (Epinephelus bruneu) and the grouper (Epinephelus septemfasciatus) and a kit.
자바리는 척삭동물문 조기강 농어목 바리과에 속하고 제주도에서는 일명 "다금바리"라 불리며 가격이 비싼 고급 어종에 속하나, 중국 등에서 수입되는 동속 이종 어종인 능성어와 그 외형이 매우 비슷하다. 자바리와 능성어는 어릴 때는 줄무늬가 달라 서로 간에 식별이 가능하나 성장하면서 그 줄무늬가 희미해져 육안상 식별이 매우 어렵기 때문에 일부 횟집 등에서나 유통 과정에서 능성어를 자바리로 속여 판매하는 문제가 종종 발생하고 있다.Javanese belongs to the early river barbarius, which is called "Dachumbari" in Jeju Island, and it belongs to high-priced high-end fish species, but its appearance is very similar to that of the native fish species which are imported from China. Although there is a tendency to distinguish between jabari and lanceolate in children, it is difficult to identify the naked eye because the stripes are blurred as it grows. .
본 발명은 이러한 문제점을 해결하고자 관점에서 완성된 것이다.
The present invention has been completed from the viewpoint of solving such a problem.
본 발명의 목적은 자바리와 능성어의 식별 방법을 제공하는 데 있다.It is an object of the present invention to provide a method for distinguishing between Jacobi and a linguistic word.
본 발명의 다른 목적은 자바리와 능성어의 식별 키트를 제공하는 데 있다.
It is another object of the present invention to provide an identification kit for a vagrant and a lyric word.
본 발명자들은 아래의 실시예에서 확인되는 바와 같이, 자바리와 능성어의 종 식별을 위하여 자바리와 능성어 각 12개체로부터 미토콘드리아 게놈 DNA를 분리하고 그 게놈 DNA 중 D-loop 부위를 증폭한 후에 D-loop 부위의 앞 부분에 위치하는 반복 서열 영역을 제외한 서열 즉 자바리의 경우 GTCTTGATTCAACATTATATTT 이후 영역의 서열, 능성어의 경우는 TATATCTTTATTCAACATTTA 이후 영역의 서열을 비교·정렬하였을 때, 동종의 개체 사이에서는 서열이 보존되어 있으면서 이종 간에서는 서열을 달리하는 여러 영역을 확인하였고, 이들 확인된 영역을 기초로 두 종 모두에게 공통적으로 사용 가능한 정방향 프라이머와 상기 두 종 사이에서 서로 다른 위치의 서열을 기초로 설계된 자바리와 능성어 각각에 특이적 역방향 프라이머를 설계한 후, 각 종의 총 12개체를 대상으로 그 각 개체의 해당 영역을 상기 정방향·역방향 프라이머로 증폭하였을 때, 각종의 12개체 모두에서 동일한 길이를 나타내지만 이종 사이에서는 예상한 서열의 길이 만큼 뚜렷한 길이 차이를 보이는 증폭 서열이 얻어짐을 확인할 수 있었다. 여기서 상기 정방향 프라이머는 동종 개체 사이에서 보존되어 있을 뿐만 아니라 자바리와 능성어 이종간에서도 서열이 보존된 부위를 기초로 설계되었으며, 상기 역방향 프라이머는 동종 개체 사이에서는 서열이 보존되어 있지만 이종간에서는 서열이 다른 부위를 기초로 설계되었다. 그렇게 함으로써 각 역방향 프라이머는 자바리와 능성어 중 어느 한 종의 D-loop 부위에만 특이적으로 결합하여 그 D-loop 부위를 증폭시킴으로써 서로 다른 길이의 증폭 산물을 만들게 된다. As shown in the following examples, the present inventors isolated mitochondrial genomic DNA from each of 12 individual strains of Avicelia and Lactobacillus, amplified the D-loop region of the genomic DNA, and then amplified the D-loop region , The sequence of the region after GTCTTGATTCAACATTATATTT in the case of the bivalvia and the region of the region after TATATCTTTATTCAACATTTA in the case of the lysiman were compared and sorted, , We identified several regions with different sequences, and based on these identified regions, a forward primer that can be commonly used for both species and a specific primer for each of the probes designed on the basis of sequences at different positions between the two species After designing the reverse primer, a total of 12 individuals of each species were selected When amplifying the region of the object in the forward direction, a reverse primer, in all of the
본 발명의 자바리와 능성어의 식별 방법은 이러한 실험 결과에 기초하여 제공되는 것으로서, (a) 자바리와 능성어로부터 생물학적 시료를 얻는 단계, (b) 그 생물학적 시료로부터 자바리와 능성어의 미토콘드리아의 게놈 DNA를 분리하는 단계, (c) 그 게놈 DNA의 D-loop 부위를 서로 다른 길이로 증폭할 수 있는 프라이머를 설계·제작하고 그 프라이머를 사용하여 D-loop 부위를 증폭하는 단계, 및 (d) 그 증폭 산물의 길이를 확인하는 단계를 포함하여 구성된다.The present invention provides a method for distinguishing between the vaginal and the lyophil, which is provided based on the results of the experiments, comprising the steps of: (a) obtaining a biological sample from bivalvia and lousefic, (b) isolating the genomic DNA of the albino mattock from the biological sample (C) designing and preparing a primer capable of amplifying the D-loop region of the genomic DNA to different lengths, and amplifying the D-loop region using the primer, and (d) And confirming the length of the antenna.
본 발명의 상기 (a) 단계의 생물학적 시료를 얻는 단계에 있어서, 생물학적 시료는 그것이 얻어진 그대로 직접 사용되거나, 다음 단계인 미토콘드리아 게놈 DNA의 분리를 용이하게 하기 위하여 상기 시료를 전처리한 후에 사용할 수 있다. 그러므로 상기 생물학적 시료는 예를 들면, 혈액으로부터 혈장 또는 혈청의 제조, 세포의 파괴, 고형 재료로부터 체액의 제조, 점액의 희석, 체액의 여과, 체액의 증류, 체액의 농축, 간섭 성분의 불활성화, 시약의 첨가 등에 의해 사용 전에 전처리될 수 있다. 상기 생물학적 시료란 미토콘드리아 DNA가 얻어질 수 있는 세포를 포함하는 조직, 세포 또는 체액을 말한다. 예컨대 자바리와 능성어의 지느러미, 혈액, 타액 등의 체액일 수 있다. In obtaining the biological sample of step (a) of the present invention, the biological sample may be directly used as it is obtained, or may be used after the sample is pretreated to facilitate separation of the next step, mitochondrial genomic DNA. Therefore, the biological sample can be used as a biological sample, for example, for the production of plasma or serum from blood, destruction of cells, preparation of body fluids from solid materials, dilution of mucus, filtration of body fluids, distillation of body fluids, Can be pretreated prior to use by adding reagents or the like. The biological sample refers to a tissue, a cell, or a body fluid containing cells from which mitochondrial DNA can be obtained. For example, it may be a bodily fluid such as fins, blood, saliva and the like of mussels and the like.
본 발명의 상기 (b) 단계의 자바리와 능성어의 미토콘드리아의 게놈 DNA를 분리하는 단계는 당업계에 공지된 방법을 이용하여 수행할 수 있다. 예컨대 에탄올 분리법, 페놀/클로로포름 추출법, SDS 추출법(Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB 분리법(Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), 이들을 혼합한 방법 등을 이용할 수 있으며, 또 예컨대 문헌「Current Protocols in Molecular Biology」(Ausubel et al., John Wiley & Sons, New York, 2007], 문헌[Doyle et al, Phytochem Bull 19: 11-15, 1987], 문헌[Want et al, Nucleic Acids Res 21: 4153-4154, 1993], 문헌[Lodhi et al., Plant Mol Biol Rep 12(1):6-13, 1994] 등에 개시된 방법을 이용·응용하여 수행할 수 있다. 통상은 생명공학회사에 제작·유통되는 DNA 추출용 키트를 이용하게 될 것이다. 그러한 DNA 추출용 키트로서는 예컨대 Macherey-Nagel 사(Germany), Epicenter Technology 사(WI), XTRANA 사(CO), Cepheid 사(CA), Qiagen 사(NL) 또는 Beckman Coulter 사(US)가 판매하는 키트 등을 들 수 있다. In the step (b) of the present invention, the step of isolating the genomic DNA of mitochondria of Jabari and the louse may be carried out using a method known in the art. For example, ethanol separation, phenol / chloroform extraction, SDS extraction (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB separation method (Murray et al., Nuc. Res. (Ausubel et al., John Wiley & Sons, New York, 2007), Doyle et < RTI ID = 0.0 > al , Phytochem Bull 19: 11-15, 1987], Want et al, Nucleic Acids Res 21: 4153-4154, 1993, Lodhi et al., Plant Mol Biol Rep 12 (1): 6-13, 1994], etc. Usually, a kit for DNA extraction produced and distributed by a biotechnology company will be used. Examples of such a DNA extraction kit include Macherey-Nagel (Germany) Kits sold by Epicenter Technology Corp. (WI), XTRANA Corp. (CO), Cepheid Inc. (CA), Qiagen Inc. (NL) or Beckman Coulter Inc. (US).
본 발명의 상기 (c) 단계에서, 자바리와 능성어의 D-loop 부위를 서로 다른 길이로 증폭하기 위해서, 정방향 프라이머 및/또는 역방향 프라이머는 D-loop 부위의 위치가 서로 다른 영역을 기초로 설계되되, 자바리와 능성어 각각에 특이적으로 설계될 필요가 있다. 즉 특이적 프라이머로 설계될 필요가 있는데 여기서 "특이적 프라이머"란 해당 종에 대해서만 미토콘드리아 게놈상 D-loop 부위의 해당 상보적 서열에 결합하여 해당 영역을 증폭시키고 타종에 대해서는 해당 영역을 증폭시키지 않는 프라이머를 말한다. 이러한 특이적 프라이머는 D-loop 부위 상에서 위치가 서로 다른 영역을 기초로 설계되되, D-loop 부위에서 두 종 사이의 서열이 서로 다른 영역(그러나 동일 종 내 개체 사이에서는 서열이 보존되어 있는 영역)을 기초로 설계되어 진다. 이러한 영역을 기초로 설계된 특이적 프라이머는 동일 종의 모든 개체에 대해서는 D-loop 부위의 동일한 영역에 특이적으로 결합하여 동일한 길이의 증폭 산물을 만들지만, 두 종 사이에서는 서로 다른 길이의 증폭 산물을 만들게 된다.In the step (c) of the present invention, the forward primer and / or the reverse primer are designed on the basis of regions having different positions of the D-loop region in order to amplify the D-loop region of the Jacobi and the lysate to different lengths , ≪ / RTI > respectively. That is, it needs to be designed as a specific primer. Here, "specific primer" means that only the corresponding species is bound to the corresponding complementary sequence of the D-loop region on the mitochondrial genome to amplify the corresponding region, It refers to primer. These specific primers are designed on the basis of regions having different positions on the D-loop region. In the D-loop region, the regions between the two species are different from each other (however, As shown in FIG. Specific primers designed on the basis of these regions specifically bind to the same region of the D-loop region for all individuals of the same species to produce amplified products of the same length, but amplified products of different lengths between the two species .
프라이머 설계 시 정방향 프라이머와 역방향 프라이머 모두 D-loop 부위의 위치가 서로 다른 영역을 기초로 하여 특이적인 프라이머로 설계될 수 있지만, 정방향 프라이머와 역방향 프라이머 중 어느 하나만 이러한 특이적 프라이머로 설계되고, 나머지 프라이머는 두 종 사이에서 서열이 보존된 영역을 기초로 공통적 프라이머로 설계되더라도 또한 무방하다. 여기서 "공통적 프라이머"란 두 종 모두에 대해서 미토콘드리아 게놈 D-loop 부위의 동일한 위치의 공통된 대응 영역에 결합하여 증폭 반응에 관여하는 프라이머를 말한다.In the design of the primer, both the forward primer and the reverse primer can be designed as a specific primer based on a region having a different position of the D-loop region. However, only one of the forward primer and the reverse primer is designed as such a specific primer, May also be designed as a common primer based on the conserved region between the two species. The term "common primer" refers to a primer that is involved in an amplification reaction by binding to a common corresponding region at the same position of the mitochondrial genome D-loop region for both species.
그것은 정방향 프라이머와 역방향 프라이머 모두 특이적으로 설계될 경우 당연히 증폭 산물이 길이 차이를 보이겠지만, 정방향 프라이머와 역방향 프라이머 중 어느 하나만 특이적으로 설계되고 나머지 프라이머는 공통적으로 설계되더라도 그 증폭 산물은 두 종 사이에서 길이 차이를 보일 것이기 때문이다.If both the forward primer and the reverse primer are designed specifically, the amplification product will have a difference in length. However, even if one of the forward primer and the reverse primer is specifically designed and the remaining primers are designed in common, Because they will show differences in length.
상기 특이적 프라이머 설계의 기초가 되는 영역이나 공통적 프라이머 설계의 기초가 되는 영역의 탐색·선택은 본 명세서가 서열목록에서 자바리와 능성어의 D-loop 부위 서열과 [도 1] 내지 [도 6]에서 이들 서열을 비교·정렬한 서열을 개시하고 있다는 점에서 당업자의 통상의 능력 범위에 속한다. The search and selection of the region serving as the basis of the specific primer design or the basis of the common primer design is based on the sequence listing of the D-loop region of the bivalvari and the lively word in [ And they are within the ordinary skill of those skilled in the art in terms of disclosing sequences that compare and align these sequences.
다만 아래의 실시예를 참조할 때 정방향 프라이머는 자바리와 능성어 모두에 대해서 서열번호 27의 서열로 이루어진 공통적인 프라이머인 것이 바람직하고, 역방향 프라이머는 자바리와 능성어 각각에 대해서 각각 서열번호 28 및 29의 서열로 이루어진 특이적 프라이머인 것이 바람직하다. However, it is preferable that the forward primer is a common primer consisting of the sequence of SEQ ID NO: 27 for both the jabari and the far-field language, and the reverse primer is the sequence of SEQ ID NOs: 28 and 29 Is a specific primer.
본 명세서에서, "프라이머 (primer)"란 주형 DNA에 특이적으로 결합하여 DNA 합성의 시작점으로 작용할 수 있는 단일가닥 올리고뉴클레오티드를 말한다. 이러한 프라이머는 DNA 뿐만 아니라 RNA일 수 있으며, 또한 이들 프라이머는 여러 형태의 뉴클레오티드의 유사체가 배합된 것일 수도 있다. 뉴클레오티드의 유사체의 예로는 데옥시이노신 뉴클레오티드, 데옥시우라실 뉴클레오티드, 7-데아자구아닌과 같이 변형된 염기를 갖는 뉴클레오티드 유사체, 리보스 유사체를 갖는 뉴클레오티드 유사체 등을 들 수 있다.As used herein, the term "primer" refers to a single-stranded oligonucleotide capable of specifically binding to template DNA and serving as a starting point of DNA synthesis. Such primers may be RNA as well as RNA, and these primers may also be formulations of analogs of various types of nucleotides. Examples of nucleotide analogs include deoxyinosine nucleotides, deoxyurasyl nucleotides, nucleotide analogs with modified bases such as 7-deazaguanine, nucleotide analogs with ribose analogs, and the like.
상기 프라이머의 길이는 주형 DNA와 특이적으로 결합하여 안정한 상보적인 결합을 형성하고 DNA 합성의 시작점으로 작용할 수 있는 한 특별한 제한이 없다. 프라이머의 길이는 온도, 버퍼의 염 농도 등 증폭 조건을 고려하여 결정될 것이다. 통상은 10 이상의 뉴클레오티드의 길이를 가지도록 설계·제작될 것이나, 프라이머의 길이가 너무 짧거나 너무 길 경우에 주형 DNA와 비특이적 결합이 형성될 수 있으므로 15 내지 25 뉴클레오티드의 길이를 가지도록 설계되는 것이 바람직하다. The length of the primer is not particularly limited as long as it can specifically bind to the template DNA to form a stable complementary bond and serve as a starting point of DNA synthesis. The length of the primer will be determined in consideration of amplification conditions such as temperature, salt concentration of the buffer, and the like. Usually, it is designed and manufactured so as to have a length of 10 or more nucleotides, but it is preferable that the length is designed to have a length of 15 to 25 nucleotides because non-specific binding with the template DNA can occur when the length of the primer is too short or too long Do.
또 상기 프라이머의 서열은 주형 DNA와 완전히 상보적일 필요는 없으나 주형 DNA와 특이적 결합을 형성하여 원하는 증폭 산물을 얻기 위해서는 90% 서열 상보성을 가지도록 설계·제작되는 것이 바람직하며 특히 95% 이상의 서열 상보성을 가지도록 설계·제작되는 것이 바람직하다. The sequence of the primer does not need to be completely complementary to the template DNA, but it is preferably designed and constructed to have 90% sequence complementarity in order to form a specific binding with the template DNA to obtain a desired amplification product. In particular, It is preferable to design and manufacture such that it has.
또 본 발명의 상기 (c) 단계에서 전술한 바의 프라이머 서열을 이용한 DNA 서열의 증폭은 당업계에 공지된 임의의 방법을 사용할 수 있다. 통상은 생명공학회사에서 제작·유통되는 키트를 이용하게 될 것인데, 이러한 DNA의 증폭용 키트는 일반적인 PCR 방법뿐만 아니라, NASBA(Nucleic acid sequence based amplification)법, TMA(Transcription-mediated amplification)법, SDA(Strand Displacement Amplification)법, 중합효소 리가아제 체인 반응법, Gap-LCR(Gap-filling Ligase Chain Reaction)법, 리페어 체인 반응법과, Hot-start PCR, Nested PCR, Multiplex PCR, DOP(degenerate oligonucleotide primer) PCR, Quantitative RT-PCR, In-Situ PCR, Micro PCR, 또는 Lab-on a chip PCR 반응과 같은 변형된 PCR 반응법, RCA(rolling circle amplification) 등의 등온증폭(isothermal amplification) 방법 등을 이용한 키트일 수 있다(LCR, Wu, D.Y. et al., Genomics 4:560, 1989; Barany, PCR Methods and Applic., 1:5-16, 1991; WO 90/01069; EP 439,182; Kwoh et al., PNAS, USA, 86:1173, 1989; U.S. Pat. No. 5,130,238)The amplification of the DNA sequence using the primer sequence as described above in the step (c) of the present invention may be performed by any method known in the art. The kits for amplification of such DNA can be used not only in a general PCR method, but also in nucleic acid sequence based amplification (NASBA), transcription-mediated amplification (TMA), SDA (PCR), multiplex PCR, DOP (degenerate oligonucleotide primer), strand displacement amplification (PCR), polymerase chain reaction, Gap-filling Ligase Chain Reaction A modified PCR reaction method such as PCR, Quantitative RT-PCR, In-Situ PCR, Micro PCR, or Lab-on-a-chip PCR reaction, an isothermal amplification method such as RCA (rolling circle amplification) (LCR, Wu, DY et al., Genomics 4: 560, 1989; Barany, PCR Methods and Applic., 1: 5-16, 1991; WO 90/01069; EP 439,182; Kwoh et al., PNAS USA, 86: 1173, 1989, U.S. Pat. No. 5,130,238)
본 발명의 상기 (d) 단계의 증폭 산물의 길이를 확인하는 단계는 증폭 산물을 크기에 따라 분리할 수 있는 당업계에 공지된 방법을 이용하여 수행할 수 있다. 일반적으로는 아가로스 겔(agarose gel) 또는 폴리아크릴아미드 겔(polyacrylamide gel) 전기영동법, 모세관 전기영동 방법(예컨대 ABI 사의 DNA analyzer) 등을 이용하게 될 것이다.The step of confirming the length of the amplification product of step (d) of the present invention can be carried out by using methods known in the art which can separate the amplification products according to their sizes. Generally, an agarose gel or a polyacrylamide gel electrophoresis method, a capillary electrophoresis method (for example, a DNA analyzer of ABI Corp.) or the like will be used.
크기별로 분리된 증폭 산물은 인터칼레이터 예컨대 에티듐 브로마이드, 에티듐 호모다이머-1, 에티듐 호모다이머-2, 에티듐 유도체, 아크리딘, 아크리딘 오렌지, 아크리딘 유도체, 에티듐-아크리딘 헤테로다이머, 에티듐 모노아지드 등을 첨가하여 검출·확인할 수 있다. 구체적인 검출·확인 방법은 당업계에 잘 공지되어 있으며, 예컨대 문헌[Nucleic Acid Microarray and the Latest PCR Method, published by Shujunsha, Japan]에 기재된 방법 등을 참조할 수 있다. Amplification products separated by size include but are not limited to intercalators such as ethidium bromide, ethidium homodimer-1, ethidium homodimer-2, ethidium derivatives, acridine, acridine orange, acridine derivatives, Acridine heterodimer, ethidium monoazide, and the like can be added and detected. Specific detection and confirmation methods are well known in the art. For example, the method described in Nucleic Acid Microarray and the Latest PCR Method, published by Shujunsha, Japan can be referred to.
본 발명의 식별 방법은 어떤 어종이 적어도 자바리와 능성어 중 어느 한 종임을 확인하는 단계를 추가로 포함할 수 있다. 이는 바리과에 속하는 타 어종이 자바리와 능성어 중 어느 한 종인지의 여부를 식별하기 위하여 사용될 수 있다.The identification method of the present invention may further comprise the step of confirming that a species is at least one of jabari and linguistic. It can be used to identify whether the other species belonging to Barley is either javanese or not.
아래의 실시예는 자바리와 능성어의 미토콘드리아 게놈 서열을 비교 분석하여 증폭하였을 때 서열의 길이가 동일할 수 있고 증폭이 원활할 수 있는 부위로서 Cytochrome c oxidase subunit 2 (CO2) 유전자 서열과 이에 인접한 tRNA-Lys 유전자 서열을 확인하고 상기 서로 인접한 두 유전자를 증폭할 수 있는 정방향·역방향 프라이머를 설계·제작하여 증폭한 결과 증폭 산물이 자바리와 능성어 모두 동일한 크기를 보임을 확인할 수 있었다.In the following example, when the mitochondrial genomic sequence of the mangrove and albanese was compared and amplified, the length of the sequence could be the same and the amplification could be smoothly performed. As a result, the cytochrome c oxidase subunit 2 (CO2) gene sequence and the tRNA- Lys gene sequence and amplified the forward and reverse primers which amplify the two adjacent genes. The amplified product was found to have the same size in both the javanic and the luteal.
따라서 상기 어떤 어종이 적어도 자바리와 능성어 중 어느 한 종임을 확인하는 단계는 자바리의 Cytochrome c oxidase subunit 2 (CO2) 유전자 서열과 이에 인접한 tRNA-Lys 유전자 서열(서열번호 32) 그리고 능성어의 Cytochrome c oxidase subunit 2 (CO2) 유전자 서열과 이에 인접한 tRNA-Lys 유전자 서열(서열번호 33)을 비교·정렬하였을 때(비교·정렬한 서열은 [도 8] 참조) 서열이 일치하는 영역에 대해서 정방향·역방향 프라이머를 설계·제작하고 그 프라이머를 사용하여 증폭하는 단계와 그 증폭 산물의 길이를 비교하는 단계를 포함하여 이루어질 수 있다. Therefore, the step of confirming that the above-mentioned species is at least one of japonica and lobsters includes the step of tyrosine phosphorylation of the Cytochrome c oxidase subunit 2 (CO2) gene sequence, the tRNA-Lys gene sequence (SEQ ID NO: 32) and Cytochrome c oxidase subunit 2 (CO2) gene sequence and a neighboring tRNA-Lys gene sequence (SEQ ID NO: 33) were compared and aligned (see the comparison and alignment sequence [FIG. 8]), the forward and reverse primers Designing, constructing, amplifying using the primer, and comparing the length of the amplification product.
바람직하게는 그 정방향 프라이머 서열은 서열번호 30의 염기서열로 이루어진 것을 말하고 그 역방향 프라이머 서열은 서열번호 31의 염기서열로 이루어진 것을 말한다.Preferably, the forward primer sequence is composed of the nucleotide sequence of SEQ ID NO: 30, and the reverse primer sequence thereof is composed of the nucleotide sequence of SEQ ID NO: 31.
다른 측면에 있어서, 본 발명은 자바리와 능성어의 식별 키트에 관한 것이다.In another aspect, the present invention relates to an identification kit for vaginal and lobar.
본 발명의 자바리와 능성어의 식별 키트는 자바리와 능성어의 미토콘드리아의 게놈 DNA의 D-loop 부위를 서로 다른 길이로 증폭할 수 있는 프라이머를 포함함을 특징으로 한다.The identification kit of the present invention includes a primer capable of amplifying the D-loop region of the genomic DNA of the mitochondrion of Javalia and the lentigo, to different lengths.
바람직하게는 상기 프라이머는 자바리와 능성어에 공통적인 정방향 프라이머로서 서열번호 27의 서열로 이루어진 프라이머와 자바리와 능성어 각각에 특이적인프라이머로서 각각 서열번호 28 및 서열번호 29로 이루어진 역방향 프라이머인 것이 바람직하다. Preferably, the primer is a forward primer that is common to the bivalvia and the lentil, and is a reverse primer consisting of the sequence of SEQ ID NO: 27 and the reverse primer of SEQ ID NO: 28 and SEQ ID NO: 29, respectively.
본 발명의 자바리와 능성어의 식별 키트는 자바리와 능성어로부터의 미토콘드리아 게놈 DNA 분리 수단을 추가로 포함할 수 있으며, 그러한 분리 수단은 예컨대 앞서 설명한 DNA 추출용 시약·키트일 수 있다.The identification kit of the present invention may further include a means for separating mitochondrial genomic DNA from the mussels and the like, and the separation means may be, for example, a reagent kit for DNA extraction as described above.
본 발명의 자바리와 능성어의 식별 키트는 DNA 서열을 증폭하기 위한 수단을 추가로 포함할 수 있으며, 그러한 DNA 서열을 증폭하기 위한 수단은 전술한 바의 DNA 증폭용 키트일 수 있다.The identification kit of the present invention may further comprise a means for amplifying the DNA sequence, and the means for amplifying the DNA sequence may be a DNA amplification kit as described above.
본 발명의 자바리와 능성어의 키트는 자바리와 능성어로부터 생물학적 시료를 분리하기 위한 수단을 추가로 포함할 수 있으며, 상기 생물학적 시료를 전처리하기 위한 수단을 추가로 포함할 수 있다.The kit of the present invention may further comprise a means for separating the biological sample from the vodka and the fish, and may further comprise means for pretreating the biological sample.
또 본 발명의 자바리와 능성어의 키트는 본 발명의 키트의 사용 방법을 교시한 설명서를 추가로 포함할 수 있으며, 상기 설명서는 종이 형태나 CD, 디스크, DVD 등 컴퓨터 판독 가능한 형태일 수 있다.The kit of the present invention may further include a manual that teaches how to use the kit of the present invention. The manual may be in the form of a paper, a CD, a disk, a DVD, or the like.
또 본 발명의 자바리와 능성어의 키트는 증폭 산물의 길이를 검출·확인하기 위한 수단을 포함할 수 있다. 이러한 검출·확인하기 위한 수단은 앞서 설명한 인터칼레이터 등을 들 수 있다.In addition, the kit of the present invention can include means for detecting and confirming the length of the amplification product. The means for detecting and confirming the above may be the intercalator described above.
또 다른 측면에 있어서, 본 발명은 자바리와 능성어의 미토콘드리아 게놈의 D-loop 부위 서열을 이용한 자바리와 능성어의 식별 방법에 관한 것이다.In yet another aspect, the present invention relates to a method for distinguishing between albino and lysine using the D-loop region sequence of the mitochondrial genome of Fabricius and Lys.
본 발명의 자바리와 능성어의 미토콘드리아 게놈의 D-loop 부위 서열을 이용한 자바리와 능성어의 식별 방법은 (a) 자바리와 능성어로부터 생물학적 시료를 얻는 단계, (b) 그 생물학적 시료로부터, 자바리의 미토콘드리아 게놈의 D-loop 부위 서열과 능성어의 미토콘드리아 게놈의 D-loop 부위 서열에서 서로 간에 다형성을 보이는 부위를 포함하는 미토콘드리아 게놈의 D-loop 부위의 핵산 분자를 수득하는 단계, 및 (c) 그 수득한 핵산 분자에서 그 다형성을 보이는 부위를 확인하는 단계를 포함하여 구성된다.The method for distinguishing between the mussels and the mussels using the D-loop region sequence of the mitochondrial genome of the mussels of the present invention comprises the steps of: (a) obtaining a biological sample from the mussels and the bark; (b) Obtaining a nucleic acid molecule of the D-loop region of the mitochondrial genome comprising a site that shows a polymorphism between the D-loop site sequence and the D-loop site sequence of the mitochondrial genome of the progeny; and (c) And identifying the site showing the polymorphism in the polymorphism site.
본 명세서에서 상기 다형성 부위(polymorphism site)란 비교 대상 서열인 자바리와 능성어의 미토콘드리아 게놈의 D-loop 부위 서열을 비교 정렬하였을 때 자바리 개체 사이 및 능성어 개체 사이에서는 서열이 보존되어 있지만 종을 달리한 자바리와 능성어 사이에서는 하나 이상의 뉴클레오티드가 서열 차이를 보이는 부위를 말한다. 이러한 다형성 부위의 확인은 그 부위에서의 하나 이상의 뉴클레오티드의 결실 유무 또는 하나 이상의 뉴클레오티드의 염기 타입을 확인함으로써 이루어진다.In the present specification, the polymorphism site is a sequence of the D-loop region sequence of the mitochondrial genome of the mature codon, Javalli, which is a comparative sequence, And the region where one or more nucleotides show sequence differences. Identification of such polymorphic sites is accomplished by identifying the deletion of one or more nucleotides at that site or the base type of one or more nucleotides.
자바리와 능성어의 미토콘드리아 게놈의 D-loop 부위 서열은 자바리에 대해서는 서열번호 3 내지 14, 능성어에 대해서는 서열번호 15 내지 26에 개시되어 있으며, 서로 간에 하나 이상의 뉴클레오티드에서 다형성을 보이는 부위는 자바리의 미토콘드리아 게놈의 D-loop 부위 서열과 능성어의 미토콘드리아 게놈의 D-loop 부위 서열을 비교·정렬한 [도 1] 내지 [도 6]에 기호(*)가 표시되지 아니한 서열 중에서 선택될 수 있다. The D-loop region sequences of the mitochondrial genomes of the javanic and its native language are shown in SEQ ID NOS: 3 to 14 for vaginism and SEQ ID NOS: 15 to 26 for the lengthened and the polymorphism at one or more nucleotides relative to each other is the mitochondrial genome Of SEQ ID NO: 1 or SEQ ID NO: 2, and the D-loop site sequence of the mitochondrial genome of the progeny are compared and aligned.
따라서 자바리와 능성어로부터 자바리의 미토콘드리아 게놈의 D-loop 부위 서열과 능성어의 미토콘드리아 게놈의 D-loop 부위 서열에서 하나 이상의 뉴클레오티드에서 다형성을 보이는 부위를 포함하는 핵산 분자를 수득하고, 그 수득한 핵산 분자에서 다형성을 보이는 부위의 뉴클레오티드의 결실 유무 또는 염기 타입을 결정하여 그 결정된 뉴클레오티드의 결실 유무 또는 염기 타입을 그 서열번호 3 내지 14와 서열번호 15 내지 26에 개시된 서열 그리고 [도 1] 내지 [도 6]에 개시된 서열과 비교함으로써, 자바리와 능성어의 판별이 가능하게 된다. Thus, a nucleic acid molecule comprising a D-loop site sequence of the mitochondrial genome of Javalia and a site showing at least one nucleotide sequence in the D-loop site sequence of the mitochondrial genome of the progeny from Javalia and its flanker is obtained, The presence or absence or base type of the nucleotide at the site showing the polymorphism is determined and the deletion or base type of the determined nucleotide is determined according to the sequences disclosed in SEQ ID NOS: 3 to 14, SEQ ID NOS: 15 to 26, , It is possible to distinguish between the vaginal and the lively word.
예컨대 [도 1] 내지 [도 6]에 개시된 서열을 참조할 때, 자바리의 미토콘드리아 게놈의 D-loop 부위 서열의 62번째 뉴클레오티드의 염기 타입은 A인 반면, 이에 상응하는 능성어의 미토콘드리아 게놈의 D-loop 부위 서열의 뉴클레오티드는 66번째 뉴클레오티드인데, 이 뉴클레오티드는 G이다. 따라서 자바리의 62번째 뉴클레오티드가 포함된 핵산 분자와 능성어의 66번째 뉴클레오티드가 포함되는 핵산 분자를 각각 자바리 또는 능성어로부터 수득하고 그 자바리의 62번째 뉴클레오티드와 능성어의 66번째 뉴클레오티드의 염기 타입을 결정하여 그 염기 타입이 A이면 자바리로 판별하게 되며, G이면 능성어로 판별하게 된다. For example, referring to the sequences disclosed in [Figure 1] to [Figure 6], the base type of the 62nd nucleotide of the D-loop region sequence of the mitochondrial genome of the bivalvari is A, while the corresponding base sequence of the D- The nucleotide in the loop region sequence is the 66th nucleotide, which is G. Therefore, a nucleic acid molecule containing the 62nd nucleotide of the mabrii and a nucleic acid molecule containing the 66th nucleotide of the ladybug are respectively obtained from the mabali or the ladybug, and the base type of the 62nd nucleotide of the mabari and the 66th nucleotide of the ladybird are determined, If the type is A, it is judged to be Jacobi. If G is G, it is judged to be a good word.
본 발명의 자바리와 능성어의 미토콘드리아 게놈의 D-loop 부위 서열을 이용한 자바리와 능성어의 식별 방법에 있어서, 상기 (b) 단계의 핵산 분자의 수득은 gDNA의 분리, gDNA의 분리 후 증폭, mRNA 분리 후 cDNA 합성 등을 통하여 수행된다. gDNA의 분리, 그것으로부터의 gDNA의 증폭 방법은 이미 전술한 바와 같이 공지되어 있으며, RNA의 분리 및 그 RNA로부터의 cDNA의 합성 방법 등도 당업계에 공지되어 있다(Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001); Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Willey & Sons(1987); 및 Chomczynski, P. et al., Anal. Biochem. 162:156(1987); PNAS USA, 85:8998(1988); Libert F, et al., Science, 244:569(1989); 및 Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)).In the method for distinguishing between Javanese and Lysaceae using the D-loop region sequence of the mitochondrial genome of the Javalia and the Fusarium spp. Of the present invention, the nucleic acid molecule of step (b) is obtained by separating gDNA, amplifying gDNA after isolation, cDNA synthesis or the like. Methods for isolation of gDNA and amplification of gDNA therefrom are already known, and methods for the isolation of RNA and the synthesis of cDNA from the RNA are also known in the art (Sambrook, J. et al., Molecular (1987); and Chomczynski, P. et al., Anal. Biochem., ≪ RTI ID = 0.0 > (1989), and Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, Vol. 22, pp. 162: 156 (1987); PNAS USA, 85: 8998 (1988); Libert F, et al., Science, 244: 3rd ed. Cold Spring Harbor Press (2001)).
또 본 발명의 자바리와 능성어의 미토콘드리아 게놈의 D-loop 부위 서열을 이용한 자바리와 능성어의 식별 방법에 있어서, 상기 (c) 단계 즉, 수득한 핵산에서 하나 이상의 뉴클레오티드에서 다형성 부위를 확인하는 단계도 당업계에 공지된 방법을 사용하여 수행할 수 있다.Further, in the method for distinguishing between the Vibrio and the lysostronga using the D-loop region sequence of the mitochondrial genome of the Javalia and the lentigo of the present invention, the step (c) of identifying the polymorphic site in one or more nucleotides in the obtained nucleic acid Can be carried out using methods known in the art.
그러한 공지된 방법의 예로서, 직접적인 서열 결정법, SNP(single nucleotide polymorphism) 유전자형 결정법(SNP genotyping) 등을 이용할 수 있는데, 이중 SNP 유전자형 결정법은 크게 전기영동 젤의 사용 유무에 따라 2가지로 대별된다.As an example of such a known method, direct sequence determination, single nucleotide polymorphism (SNP) genotyping and the like can be used. Two SNP genotyping methods are roughly divided into two types depending on whether or not electrophoresis gel is used.
전기영동 젤을 사용하는 방법으로서는 대표적으로 제한효소인식부위를 이용한 RFLP 분석법, SSCP(Single Stranded Conformation Polymorphism) 분석법과, tetra-primer ARMS-PCR 분석법, ddNTP(dideoxynucleotide)를 이용한 primer extension 법(예컨대 ABI 사의 SNaPshot 분석법) 등을 들 수 있으며(Orita et al., PNAS, USA 86:2776, 1989; Syvanen A.C. Nat Rev Genet. 2(12):930-42, 2001), 전기영동 젤을 사용하지 않은 방법으로서는 대립형 특이 혼성화 방법(alle-specific hybridization), 헤어핀(hairpin) 구조를 지닌 molecular beacon를 사용하는 방법, TaqMan probe를 사용하는 방법, 뉴클레오티드 미스매치를 인식하는 효소를 이용하는 방법(예컨대 Invader assay 법), 올리고뉴클레오티드 라이게이션 법(Oligonucleotide Ligation Assay) 등을 들 수 있다(Howell W. et al., Nat Biotechnol. 17(1):87-8, 1999; Abravaya K. et al., Clin Chem Lab Med. 41:468-474, 2003; Olivier M. Mutat Res. 573(1-2):103-10, 2005; McGuigan F.E. et al., Psychiatr Genet. 12(3):133-6, 2002; Modrich, Ann. Rev. Genet., 25:229-253(1991)).
Examples of the method of using the electrophoresis gel include RFLP analysis using restriction enzyme recognition sites, single stranded conformation polymorphism (SSCP) analysis, tetra-primer ARMS-PCR analysis, primer extension using ddNTP (dideoxynucleotide) SNaPshot assay) (Orita et al., PNAS, USA 86: 2776, 1989; Syvanen AC Nat Rev Genet. 2 (12): 930-42, 2001) A method using an alle-specific hybridization method, a method using a molecular beacon having a hairpin structure, a method using a TaqMan probe, a method using an enzyme recognizing a nucleotide mismatch (for example, an Invader assay method) Oligonucleotide Ligation Assay and the like (Howell W. et al., Nat Biotechnol. 17 (1): 87-8, 1999; Abravaya K. et al., Clin Chem Lab Med. 41 : 468-474, 2003; Olivier M. Mutat Rev. Genet., 25: 229-253 (2001), and McGuigan FE et al., Psychiatr Genet. 12 (3): 133-6, 1991).
전술한 바와 같이, 본 발명에 따르면 자바리와 능성어의 식별 방법 및 키트를 제공할 수 있다. 본 발명은 자바리와 능성어의 식별 방법 및 키트는 증폭 산물이 서열 길이 차이를 이용하거나 미토콘드리아 게놈 D-loop 부위의 다형성 부위를 이용함으로써 서로 간에 형태상 식별되지 않는 자바리와 능성어의 명확한 식별을 가능하게 한다.
As described above, according to the present invention, it is possible to provide a method and a kit for identifying a vagrant and a lively word. The present invention provides methods and kits for the identification and identification of the mussels from the bivalvia, allowing the amplification products to distinguish between the mussels and the rhizosphere which are not morphologically distinguishable from each other by utilizing the difference in sequence length or by using the polymorphic site of the mitochondrial genome D-loop site .
[도 1] 내지 [도 6]은 앞 부분의 반복 서열의 영역을 제외한 자바리와 능성어의 D-loop 나머지 서열을 비교·정렬한 것이다.
[도 7]은 미토콘드리아 게놈 DNA 상에서 자바리와 능성어의 종 식별을 위해 설계된 프라이머와 그 프라이머 설계의 기초가 된 유전자 등의 부위를 대응시켜 나타낸 모식도이다.
[도 8]은 프라이머 설계의 기초가 된 영역이 표시된 CO2 유전자 서열/tRNA-Lys 유전자 서열을 비교·정렬한 서열이다.
[도 9]은 자바리와 능성어의 종 식별을 위해 설계된 프라이머로 증폭한 증폭 산물의 전기영동 사진이다.[Fig. 1] to [Fig. 6] compares and rearranges the D-loop residual sequence of the Vabuli and the lengthened word except for the region of the repeat sequence in the former part.
[Fig. 7] is a schematic diagram showing a primer designed for identifying the species of the mangrove and lily of the genus in the mitochondrial genomic DNA, and the gene and the like, which are the basis of the primer design.
FIG. 8 is a sequence in which a region of the base of the primer design is compared and aligned with the indicated
[Figure 9] is an electrophoresis photograph of an amplification product amplified with a primer designed for the species identification of the japonica and the lentil.
이하 본 발명을 실시예를 참조하여 설명한다. 그러나 본 발명의 범위가 이러한 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described with reference to examples. However, the scope of the present invention is not limited to these embodiments.
<< 실시예Example 1> 1> 자바리와Javier and 능성어의Of 시료 확보 Sample collection
자바리와 능성어는 각각 12개의 시료를 사용하였고, 시료는 제주특별자치도 해양수산연구원으로부터 제공받았다.Twelve samples were used for each of the javanite and lily fish, and the samples were supplied by the Jeju Special Self - Governing Province, Korea Fisheries Research Institute.
<< 실시예Example 2> 2> 자바리와Javier and 능성어로부터From a louse D- D- looploop 서열의 분리 및 서열결정 Isolation and Sequencing of Sequences
자바리와 능성어 각 12개체의 지느러미에서 NucleoSpin® Tissue Kit (Macherey-Nagel, Germany)를 사용하여 제공된 매뉴얼에 따라 genomic DNA를 추출하였다. 추출된 DNA를 주형으로 하여 아래 [표 1]의 조건에 따라 PCR을 수행하였다. Genomic DNA was extracted according to the manual provided by NucleoSpin® Tissue Kit (Macherey-Nagel, Germany) from the fins of each of 12 individuals of the javanite and the lanceolate. Using the extracted DNA as a template, PCR was performed according to the conditions shown in Table 1 below.
PCR을 수행하기 위해 AccuPower® PCR PreMix(Bioneer, Korea)를 사용하였다. PCR premix에서 100ng의 genomic DNA가 주형으로 사용되었고, 반응액의 전체volume은 20㎕로 Primer(정방향 프라이머 및 역방향 프라이머 각각 서열번호 1 및 2로 특정됨), 각 0.5㎕, 3차 증류수는 최종 volume이 20㎕가 되게 넣어 혼합하였다.AccuPower® PCR PreMix (Bioneer, Korea) was used for PCR. 100 ng of genomic DNA was used as a template in the PCR premix, and the total volume of the reaction solution was 20 μl. Primer (specified as SEQ ID NOS: 1 and 2 respectively for forward primer and reverse primer), 0.5 μl each, Was added thereto and mixed.
증폭조건은 95℃에서 3분간 반응한 후, 95℃에서 30초, 55℃에서 30초, 72℃에서 30초간 반응시켰고, 총 35회 반복하였다. 35회의 반응이 끝난 후 72℃에서 10분간 반응한 후, 4℃에서 10분간 안정화시켰고, 증폭의 성공 여부를 확인하기 위해Loading buffer(0.25% Bromophenol Blue, 30% Sucrose)에 증폭 산물을 혼합하고, 1×TBE buffer에 담긴 2% Agarose gel에 Loading 하였다. 전기영동은 실온에서 약 20분간 수평전기영동장치에서 수행하였다. 전기영동이 끝난 후 gel을 0.5mg/ml 농도의 Etidium Bromide로 염색시킨후, UV Transilluminator를 이용하여 증폭된 밴드크기를 관찰하였다. PCR 산물은 High Pure PCR Product Purification Kit(Roche, Germany)를 사용하여 제조자의 매뉴얼에 따라 정제하였다. 정제된 PCR 산물은 ABI 3730XL genetic analyzer(Applied Biosystems, USA)를 사용하여 제공된 메뉴얼에 따라 시퀀싱하였다. The amplification conditions were 95 ° C for 3 minutes, followed by 30 seconds at 95 ° C, 30 seconds at 55 ° C, and 30 seconds at 72 ° C. After 35 reactions, the mixture was reacted at 72 ° C for 10 minutes and then stabilized at 4 ° C for 10 minutes. To confirm the success of the amplification, the amplification products were mixed in a loading buffer (0.25% Bromophenol Blue, 30% Sucrose) And then loaded on 2% agarose gel in 1 × TBE buffer. Electrophoresis was performed in a horizontal electrophoresis apparatus at room temperature for about 20 minutes. After electrophoresis, gel was stained with 0.5 mg / ml Etidium Bromide, and the amplified band size was observed using a UV Transilluminator. The PCR products were purified using the High Pure PCR Product Purification Kit (Roche, Germany) according to the manufacturer's instructions. Purified PCR products were sequenced using the ABI 3730 XL genetic analyzer (Applied Biosystems, USA) according to the manual provided.
자바리 12개체와 능성어 12개체로부터 분리·증폭한 D-loop 서열은, 자바리에 대해서는 서열번호 3 내지 14, 능성어에 대해서는 서열번호 15 내지 26에 개시되어 있다. The D-loop sequences isolated and amplified from the
증폭한 D-loop 서열은 그 앞 부분에 자바리의 경우 TGATATTACATATATGC 반복 서열을 가지고 있었고 능성어의 경우는 TATATGCACTCTAGTACA 반복 서열을 가지고 있었으며, 반복 서열의 반복 수는 개체마다 차이를 보였다. 이렇게 D-loop 서열에 반복 서열이 존재하고 그 반복 수가 개체에 따라 차이를 보이는 것은 대서양대구(Atlantic cod, Gadusmorhua)종에 대한 기존의 보고와 유사하다 할 수 있다(Arnason and Rand, 1992. Genetics, 132:211-220).The amplified D-loop sequence had a TGATATTACATATATGC repeat sequence in the front of the bacterium, and a repeat sequence of TATATGCACTCTAGTACA in the case of the lysimetric sequence. The presence of repeat sequences in the D-loop sequence and differences in the number of repetitions of the D-loop sequences is similar to that reported for Atlantic cod ( Gadusmorhua ) species (Arnason and Rand, 1992. Genetics, 132: 211-220).
반복 서열의 반복 수가 개체마다 차이를 보이기 때문에 그 반복 서열 영역을 제외한 D-loop 나머지 서열 즉 자바리의 경우 반복 서열 영역이 끝나는 GTCTTGATTCAACATTATATTT 이후의 서열, 능성어의 경우는 반복 서열 영역이 끝나는 TATATCTTTATTCAACATTTA 이후의 서열 [도 1] 내지 [도 6]에 비교·정렬하여 나타내었다. Since the number of repetition of the repetitive sequence is different for each individual, the sequence after GTCTTGATTCAACATTATATTT in which the D-loop remaining sequence except for the repetitive sequence region, that is, the repetitive sequence region ends in the case of Jabari, and the sequence after TATATCTTTATTCAACATTTA, 1] to [Fig. 6].
<< 실시예Example 3> 3> 자바리와Javier and 능성어의Of 식별을 위한 For identification 프라이머primer 설계 design
자바리와 능성어의 미토콘드리아 게놈 DNA를 이용하여 PCR을 통해 증폭되는 밴드 양상의 차이를 확인함으로써 두 종을 식별할 수 있는 분자 마커를 개발하고자, [도 1] 내지 [도 6]의 비교·정렬한 D-loop 서열을 기초로 동일 종 내의 개체 사이에서는 동일한 길이로 증폭되지만 이종 간에서는 서로 다른 길이로 증폭될 수 있도록 두 종 모두에게서 공통으로 사용이 가능한 Forward 프라이머(Epi-GM-F, 서열번호 27)와 두 종에서 서로 다른 서열을 기초로 설계된 Reverse 프라이머 (자바리에 대한 프라이머 Epi-bru-R(서열번호 28)와 능성어에 대한 프라이머 Epi-sep-R(서열번호 29))를 설계하였다.In order to develop a molecular marker capable of identifying two species by confirming the difference in band patterns amplified by PCR using the mitochondrial genomic DNA of Javanese and Lantus, the comparison and alignment of [D 1] to [Figure 6] (Epi-GM-F, SEQ ID NO: 27), which can be amplified to the same length among individuals within the same species but can be amplified to different lengths in different species based on the -loop sequence, And primer Epi-bru-R (SEQ ID NO: 28) for primitive Epi-sep-R (SEQ ID NO: 29) for the first primer designed on the basis of different sequences in both species.
두 종에서 공통적으로 증폭이 됨으로써 미지의 시료가 자바리 또는 능성어 중 한 종임을 확인할 수 있도록 두 종의 미토콘드리아 게놈 서열(자바리의 미토콘드리아 게놈 서열 GenBank accession no. FJ594964,, 능성어의 미토콘드리아 게놈 서열 GenBank accession no. FJ594966)을 비교·정렬하여 두 종 모두에게서 서열이 동일하면서 서열의 길이가 길지 않고 PCR 증폭이 원활히 될 수 있는 부분을 탐색하였고, 그 결과 미토콘드리아 Cytochrome c oxidase subunit 2 (CO2) 유전자 서열과 이에 인접한 미토콘드리아 게놈상에 존재하는 22개 tRNA 유전자 중 하나인 tRNA-Lys 유전자 서열을 기초로 각각 Forward 프라이머 (Epi-CR-F, 서열번호 30)와 Reverse 프라이머 (Epi-CR-R, 서열번호 31)를 설계하였다.Two species of mitochondrial genomes (GenBank accession no. FJ594964), the mitochondrial genomic sequence of albino, the genbank accession no. FJ594966) were searched and found to be able to amplify the PCR amplified sequence with the same sequence but with a long sequence. As a result, the sequence of the mitochondrial Cytochrome c oxidase subunit 2 (CO2) gene and the adjacent mitochondria (Epi-CR-F, SEQ ID NO: 30) and Reverse primer (Epi-CR-R, SEQ ID NO: 31) were designed based on the tRNA-Lys gene sequence which is one of the 22 tRNA genes existing on the genome. Respectively.
상기 설계된 프라이머와 그 프라이머 설계의 기초된 유전자 등의 부위를 대응시켜 [도 7]에 모식도로 나타내었으며, 두 종을 식별하기 위한 프라이머인 공통적 Forward 프라이머(Epi-GM-F)와 자바리에 대한 Reverse 프라이머 Epi-bru-R 그리고 능성어에 대한 Reverse 프라이머 Epi-sep-R를 [도 1] 내지 [도 6]에 표시하였다. 마지막으로 [도 8]에는 미지의 시료가 자바리 또는 능성어 중 한 종임을 확인하기 위한 목적으로 설계된 프라이머가 어떤 영역을 기초로 하였는지가 표시되어 있다. [Figure 7] is a schematic diagram showing the relationship between the designed primers and the regions of the primers used for the design of the primers. The common Forward primer (Epi-GM-F), which is a primer for identifying the two species, The primer Epi-bru-R and the reverse primer Epi-sep-R for the primate are shown in FIG. 1 to FIG. 6. Finally, FIG. 8 shows the area on which the primer designed for the purpose of confirming that the unknown sample is one of the bivalvia or the lily of the world.
상기 설계된 프라이머 서열을, 예상 증폭 길이와 함께 아래의 [표 2]에 나타내었다. The designed primer sequences are shown in Table 2 together with the expected amplification length.
<< 실시예Example 2> 2> DNADNA 추출 및 증폭 Extraction and Amplification
자바리와 능성어는 제주특별자치도 해양수산연구원 및 제주수산시장에서 각 12개체를 구입하여 실험에 사용하였다.Javanese and Lysaceae were purchased from Jeju Special Self - Governing Province, Marine Fisheries Research Institute and Jeju Fisheries Market.
자바리와 능성어 각 12개체의 지느러미에서 NucleoSpin Tissue Kit (Macherey-Nagel, Germany)를 사용하여 제공된 매뉴얼에 따라 genomic DNA를 추출하였다. 추출된 DNA를 주형으로 하고 AccuPower PCR PreMix (Bioneer, Korea)를 사용하여 PCR을 수행하였다.Genomic DNA was extracted according to the manual provided by using NucleoSpin Tissue Kit (Macherey-Nagel, Germany) in the fins of each of 12 individuals of Zabuli and Lambs. PCR was performed using AccuPower PCR PreMix (Bioneer, Korea) with the extracted DNA as a template.
PCR Premix는 PCR 반응시 필요한 Buffer와 dNTP, 그리고 중합효소 (Polymerase)가 동결건조되어 있는 상태로 주형으로 사용될 DNA와 프라이머, 그리고 증류수만 넣어주면 반응액이 제조되도록 만들어져 있는 제품이다.PCR Premix is a product designed to produce reaction liquid by adding only DNA, primer and distilled water to be used as a template in the state of freeze-dried Buffer, dNTP, and polymerase necessary for PCR reaction.
아래의 [표 3]과 같이 PCR premix에 100 ng의 genomic DNA가 주형으로 사용되었고, 반응액의 전체 volume은 20 ㎕로 프라이머 각 0.5 ㎕, 3차 증류수는 최종 volume이 20 ㎕가 되게 넣어 혼합하였다.As shown in [Table 3], 100 ng of genomic DNA was used as a template in the PCR premix, and 20 μl of the total volume of the reaction solution was mixed with 0.5 μl of the primer and 20 μl of the final volume of the third distilled water .
증폭조건은 95℃에서 3분간 반응 한 후, 95℃에서 30초, 55℃에서 30초, 72℃에서 30초간 반응시켰고, 총 35회 반복하였다. 35회의 반응이 끝난 후 72℃에서 10분간 반응한 후, 4℃에서 10분간 안정화시켰고, 증폭의 성공 여부를 확인하기 위해 Loading buffer (0.25% Bromophenol Blue, 30% Sucrose)에 증폭산물을 혼합하고, 1×TBE buffer에 담긴 2% Agarose gel에 Loading 하였다. 전기영동은 실온에서 약 20분간 수평전기영동장치에서 수행하였다. 전기영동이 끝난 후 gel을 0.5mg/ml 농도의 Ethidium Bromide로 염색시킨 후, UV Transilluminator를 이용하여 증폭된 밴드 크기를 관찰하였다.The amplification conditions were 95 ° C for 3 minutes, followed by 30 seconds at 95 ° C, 30 seconds at 55 ° C, and 30 seconds at 72 ° C. After 35 reactions, the mixture was reacted at 72 ° C for 10 minutes and then stabilized at 4 ° C for 10 minutes. To confirm the success of the amplification, the amplification products were mixed in a loading buffer (0.25% Bromophenol Blue, 30% Sucrose) And then loaded on 2% agarose gel in 1 × TBE buffer. Electrophoresis was performed in a horizontal electrophoresis apparatus at room temperature for about 20 minutes. After electrophoresis, gel was stained with 0.5 mg / ml Ethidium Bromide, and the amplified band size was observed using a UV Transilluminator.
결과를 [도 9]에 나타내었다. [도 9]을 참조하여 보면, 자바리와 능성어 모두에서 예상했던 대로 2개의 뚜렷한 밴드가 확인이 되는 것을 알 수 있다. 두 종에서 공통적으로 나타나는 744 bp의 밴드와 자바리에서만 확인이 되는 353 bp의 밴드, 그리고 능성어에서만 확인이 되는 229 bp의 밴드가 증폭이 됨을 알 수 있다.The results are shown in Fig. Referring to FIG. 9, it can be seen that two distinct bands are identified as expected in both the jabari and the loby. It can be seen that the band of 744 bp common in both species, the band of 353 bp which is confirmed only in jabari, and the band of 229 bp which is confirmed only in the ladder are amplified.
따라서, 자바리 또는 능성어 중 한 종으로 추정되는 미지의 시료가 두 종 중에서 어떤 종인지 확인하기 위해서 미지의 시료에서 추출한 genomic DNA를 상기 프라이머로 증폭할 경우 증폭된 서열의 밴드의 양상을 확인함으로써 해당 종이 자바리 또는 능성어 중 어떤 종인지를 확인할 수 있다.
Therefore, in order to confirm which of the two species is unknown, the genomic DNA extracted from an unknown sample is amplified with the above primer to confirm the band pattern of the amplified sequence, It can be confirmed whether it is a bivalvia or a fuzzy language.
<110> JEJU Technopark <120> Method for Discriminating Between Epinephelus bruneu and Epinephelus septemfasciatus and a Kit Therefor <130> PP13-000-Jejutp-bruneu <160> 31 <170> KopatentIn 2.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ctcccaaagc taggattct 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ggaaagtcag gaccaagcct 20 <210> 3 <211> 991 <212> DNA <213> Epinephelus bruneu <400> 3 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgcgtcttg attcaacatt atatttgata acaaataaac tgcacaataa 420 gaacctacca acaagagtta ggtaatgcat acggttattg ataatgaggg acaataactg 480 tgagggtctc acttagtgaa ttattcctgg catttggttc ctacttcagg gccatgactt 540 gattatattc ctcacacttt cattaacgct ggcataagtt aatagtgtta accattaggt 600 tcattaccca gcaagccgag ccttcattcc agggggtggg gggttccctt ttattttttt 660 cctttcaaca gacatttcag agtgtaagaa aaggctgaaa gtttgaaggt ggtacatcac 720 tttgcagctg aacacaaggt tatgcaggct aaaaagacat tcttttagaa ataattacat 780 aactgatttc aagaacataa atatacttat cctactcaga gcacccccct aatattagga 840 tgcccggtct ggtggttttt atccgtttaa accccctacc ccctaaaccc tgagattcct 900 aacaccctgt aaacccccgg aaacagggct aaactcaagt aataagtttt aactaaaatg 960 tgtttattac actaatgtaa tttttaattt g 991 <210> 4 <211> 983 <212> DNA <213> Epinephelus bruneu <400> 4 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgcgtc 360 ttgattcaac attatatttg ataacaaata aactgcacag taagaaccta ccaacaagag 420 ttaagtaatg catacggtta ttgataatga gggacaataa ctgtgagggt ctcactcagt 480 gaattattcc tggcatttgg ttcctacttc agggccatga cttgattata ttcctcacac 540 tttcattaac gctggcataa gttaatagtg ttaaccatta ggttcattac ccagcaagcc 600 gagccttcat tccagggggt ggggggttcc cttttatttt tttcctttca acaggcattt 660 cagagtgtaa gaaaaggctg aaagtttgaa ggtagtacaa cactttgcag ctgaacacaa 720 ggttatgcag gctaaaaaga cattctttta gaaataatta cataactgat ttcaagaaca 780 taaatatact tatcctactc agagcacccc cctaatatta ggatgcccgg tctggtggtt 840 ttttatccgt ttaaaccccc ctacccccct aaacccctga gattcctaac acccctgtaa 900 accccccgga aacagggcta aacctcaagt aataagtttt taacctaaaa tgtgtttatt 960 acactaatgt aatttttaat ttg 983 <210> 5 <211> 1033 <212> DNA <213> Epinephelus bruneu <400> 5 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgcgt cttgattcaa 420 cattatattt gataacaaat aaactgcaca gtaagaacct accaacaaga gttaagtaat 480 gcatacggtt attgataatg agggacaata actgtgaggg tctcactcag tgaattattc 540 ctggcatttg gttcctactt cagggccatg acttgattat attcctcaca ctttcattaa 600 cgctggcata agttaatagt gttaaccatt aggttcatta cccagcaagc cgagccttca 660 ttccaggggg tggggggttc ccttttattt ttttcctttc aacaggcatt tcagagtgta 720 agaaaaggct gaaagtttga aggtagtaca tcactttgca gctgaacaca aggttatgca 780 ggctaaaaag acattctttt agaaatagtt acataactga tttcaagaac ataaatatac 840 ttatcctact cagagcaccc ccctaatatt aggatgcccg gtctggtggt ttttatccgt 900 ttaaaccccc ctacccccct aaacccctga gattcctaac acccctgtaa accccccgga 960 aacagggcta aacctcaagt aataagtttt taacctaaaa tgtgtttatt acactaatgt 1020 aatttttaat ttg 1033 <210> 6 <211> 1017 <212> DNA <213> Epinephelus bruneu <400> 6 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg cgtcttgatt caacattata tttgataaca 420 aataaactgc acagtaagaa cctaccaaca agagttaagt gatgcatacg gttattgata 480 atgagggaca ataactgtga gggtttcact cagtgaatta ttcctggcat ttggttccta 540 cttcagggcc atgacttgat tatattcctc acactttcat taacgctggc ataagttaat 600 agtgttaacc attaggttca ttacccagca agccgagcct tcattccagg gggtgggggg 660 ttccctttta tttttttcct ttcaacaggc atttcagagt gtaagaaaag gctggaaagt 720 ttgaaggtgg tacatcactt tgcagctgaa cacaaggtta tgcaggctaa aaagacattc 780 ttttagaaat gattacataa ctgatttcaa gaacataaat atacttatcc tactcagagc 840 acccccctaa tattaggatg tccggtctgg tggtttttat ccgtttaaac ccccctaccc 900 ccctaaaccc ctgagattcc taacacccct gtaaaccccc cggaaacagg gctaaacctc 960 aagtaataag tttttaacct aaaatgtgtt tattacacta atgtaatttt taatttg 1017 <210> 7 <211> 1186 <212> DNA <213> Epinephelus bruneu <400> 7 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgctgat 480 attacatata tgctgatatt acatatatgc tgatattaca tatatgctga tattacatat 540 atgctgatat tacatatata tgtcttgatt caacattata tttgataaca aataaactgc 600 acagtaagaa cctaccaaca agagttaagt aatgcatacg gttattgata atgagggaca 660 ataattgtga gggtctcact cagtgaatta ttcctggcat ttggttccta cttcagggcc 720 atgacttgat tatattcctc acactttcat taacgctggc ataagttaat agtgttaacc 780 attaggttca ttacccagca agccgagcct tcattccagg gggtgggggg ttccctttta 840 tttttttcct ttcaacagac atttcagagt gtaagaaaag gctgaaagtt tgaaggtagt 900 acatcacttt gcagctgaac acaaggttat gcaggctaaa aagacattct tttagaaata 960 attacataac tgatttcaag aacataaata tacttatcct actcagagca cccccctaat 1020 attaagatga ccggtctggt ggtttttatc cgtttaaacc cccctacccc cctaaacccc 1080 tgagattcct aacacccctg taaacccccc ggaaacaggg ctaaacctca agtaataagt 1140 ttttaaccta aaatgtgttt attacactaa tgtaattttt aatttg 1186 <210> 8 <211> 1017 <212> DNA <213> Epinephelus bruneu <400> 8 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg cgtcttgatt caacattata tttgataaca 420 aataaactgc acagtaagaa cctaccaaca agagttaagt gatgcatacg gttattgata 480 atgagggaca ataactgtga gggtttcact cagtgaatta ttcctggcat ttggttccta 540 cttcagggcc atgacttgat tatattcctc acactttcat taacgctggc ataagttaat 600 agtgttaacc attaggttca ttacccagca agccgagcct tcattccagg gggtgggggg 660 ttccctttta tttttttcct ttcaacaggc atttcagagt gtaagaaaag gctggaaagt 720 ttgaaggtgg tacatcactt tgcagctgaa cacaaggtta tgcaggctaa aaagacattc 780 ttttagaaat gattacataa ctgatttcaa gaacataaat atacttatcc tactcagagc 840 acccccctaa tattaggatg tccggtctgg tggtttttat ccgtttaaac ccccctaccc 900 ccctaaaccc ctgagattcc taacacccct gtaaaccccc cggaaacagg gctaaacctc 960 aagtaataag tttttaacct aaaatgtgtt tattacacta atgtaatttt taatttg 1017 <210> 9 <211> 1000 <212> DNA <213> Epinephelus bruneu <400> 9 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgcgtcttg attcaacatt atatttgata acaaataaac tgcacagtaa 420 gaacctacca acaagagtta agtgatgcat acggttattg ataatgaggg acaataactg 480 tgagggtttc actcagtgaa ttattcctgg catttggttc ctacttcagg gccatgactt 540 gattatattc ctcacacttt cattaacgct ggcataagtt aatagtgtta accattaggt 600 tcattaccca gcaagccgag ccttcattcc agggggtggg gggttccctt ttattttttt 660 cctttcaaca ggcatttcag agtgtaagaa aaggctggaa agtttgaagg tggtacatca 720 ctttgcagct gaacacaagg ttatgcaggc taaaaagaca ttcttttaga aatgattaca 780 taactgattt caagaacata aatatactta tcctactcag agcacccccc taatattagg 840 atgtccggtc tggtggtttt tatccgttta aaccccccta cccccctaaa cccctgagat 900 tcctaacacc cctgtaaacc ccccggaaac agggctaaac ctcaagtaat aagtttttaa 960 cctaaaatgt gtttattaca ctaatgtaat ttttaatttg 1000 <210> 10 <211> 1050 <212> DNA <213> Epinephelus bruneu <400> 10 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgcgtctt gattcaacat tatatttgay aacaaataaa ctgcacagta agaacctacc 480 aacaagagtt aagtratgca tacggttatt gataatgagg gacaataact gtgrgggtct 540 cactcagtga attattcctg gcatttggtt cctacttcag ggccatgact tgattatatt 600 cctcacactt tcattaacgc tggcataagt taatagtgtt aaccattagg ttcattaccc 660 agcaagccga gccttcattc cagggggtgg ggggttccct tttatttttt tcctttcaac 720 aggcatttca gagtgtaaga aaaggctgaa agtttgaagg tagtacatca ctttgcagct 780 gaacacaagg ttatgcaggc taaaaagaca ttcttttaga aatarttaca taactgattt 840 caagaacata aatatactta tcctactcag agcacccccc taatattagg atgcccggtc 900 tggtggtttt tatccgttta aaccccccta cccccctaaa cccctgagat tcctaacacc 960 cctgtaaacc ccccggaaac agggctaaac ctcaagtaat aagtttttaa cctaaaatgt 1020 gtttattaca ctaatgtaat ttttaatttg 1050 <210> 11 <211> 1101 <212> DNA <213> Epinephelus bruneu <400> 11 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgcgtct 480 tgattcaaca ttatatttga caacaaataa actgcacagt aagaacctac caacaagagt 540 taagtratgc atacggttat tgataatgag ggacaataac tgtgrgggtc tcactcagtg 600 aattattcct ggcatttggt tcctacttca gggccatgac ttgattatat tcctcacact 660 ttcattaacg ctggcataag ttaatagtgt taaccattag gttcattacc cagcaagccg 720 agccttcatt ccagggggtg gggggttccc ttttattttt ttcctttcaa yaggcatttc 780 agagtgtaag aaaaggctga aagtttgaag gtagtacatc actttgcagc tgaacacaag 840 gttatgcagg ctaaaaagac attcttttag aaataattac ataactgatt tcaagaacat 900 aaatatactt atcctactca gagcaccccc ctaatattag gatgcccggt ctggtggttt 960 ttatccgttt aaacccccct acccccctaa acccctgaga ttcctaacac ccctgtaaac 1020 cccccggaaa cagggctaaa cctcaagtaa taagttttta acctaaaatg tgtttattac 1080 actaatgtaa tttttaattt g 1101 <210> 12 <211> 1206 <212> DNA <213> Epinephelus bruneu <400> 12 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgctgat 480 attacatata tgctgatatt acatatatgc tgatattaca tatatgctga tattacatat 540 atgctgatat tacatatatg ctgatattac atatatgctg atattacata tatgcgtctt 600 gattcaacat tatatttgat aacaaataaa ctgcacagta agaacctacc aacaagagtt 660 aagtaatgca tacggttatt gataatgagg gacaataact gtgagggtct cactcagtga 720 attattcctg gcatttggtt cctacttcag ggccatgact tgattatatt cctcacactt 780 tcattaacgc tggcataagt taatagtgtt aaccattagg ttcattaccc agcaagccga 840 gccttcattc cagggggtgg ggggttccct tttatttttt tcctttcaac aggcatttca 900 gagtgtaaga aaaggctgaa agtttgaagg tagtacatta ctttgcagct gaacacaagg 960 ttatgcaggc taaaaagaca ttcttttaga aataattaca taactgattt caagaacata 1020 aatatactta tcctactcag agcacccccc taatattagg atgcccggtc tggtggtttt 1080 tatccgttta aaccccccta cccccctaaa cccctgagat tcctaacacc cctgtaaacc 1140 ccccggaaac agggctaaac ctcaagtaat aagtttttaa cctaaaatgt gtttattaca 1200 ctaatg 1206 <210> 13 <211> 1172 <212> DNA <213> Epinephelus bruneu <400> 13 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgctgat 480 attacatata tgctgatatt acatatatgc tgatattaca tatatgctga tattacatat 540 atgctgatat tacatatatg cgtcttgatt caacattata tttgataaca aataaactgc 600 acagtaagaa cctaccaaca agagttaagt aatgcatacg gttattgata atgagggaca 660 ataactgtga gggtctcact cagtgaatta ttcctggcat ttggttccta cttcagggcc 720 atgacttgat tatattcctc acactttcat taacgctggc ataagttaat agtgttaacc 780 attaggttca ttacccagca agccgagcct tcattccagg gggtgggggg ttccctttta 840 tttttttcct ttcaacaggc atttcagagt gtaagaaaag gctgaaagtt tgaaggtagt 900 acattacttt gcagctgaac acaaggttat gcaggctaaa aagacattct tttagaaata 960 attacataac tgatttcaag aacataaata tacttatcct actcagagca cccccctaat 1020 attaggatgc ccggtctggt ggtttttatc cgtttaaacc cccctacccc cctaaacccc 1080 tgagattcct aacacccctg taaacccccc ggaaacaggg ctaaacctca agtaataagt 1140 ttttaaccta aaatgtgttt attacactaa tg 1172 <210> 14 <211> 1169 <212> DNA <213> Epinephelus bruneu <400> 14 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgctgat 480 attacatata tgctgatatt acatatatgc tgatattaca tatatgctga tattacatat 540 atgcgtcttg attcaacatt atatttaata acaaataaac tgcacagtaa gaacctacca 600 acaagagtta agcgatgcat acggttattg ataatgaggg acaataactg tgagggtctc 660 actcagtgaa ttattcctgg catttggttc ctacttcagg gccatgactt gattatattc 720 ctcacacttt cattaacgct ggcataagtt aatagtgtta accattaagt tcattaccca 780 gcaagccgag ccttcattcc agggggtggg gggttccctt ttattttttt cctttcaaca 840 ggcatttcag agtgtaagaa aaggctgaaa gtttgaaggt ggtacatcac tttgcagctg 900 aacacaaggt tatgcaggct aaaaagacat tcttttagag ataattacat aactgatttc 960 aagaacataa atatacttat cctactcaga gcacccccct aatattagga tgcccggtct 1020 ggtggttttt atccgtttaa acccccctac ccccctaaac ccctgagatt cctaacaccc 1080 ctgtaaaccc cccggaaaca gggctaaacc tcaagtaata agtttttaac ctaaaatgtg 1140 tttattacac taatgtaatt tttaatttg 1169 <210> 15 <211> 850 <212> DNA <213> Epinephelus septemfasciatus <400> 15 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atgcactcta gtacatatat ctttattcaa 240 catttatatt aaaatcaaat agactgcaca gtaagaaccg accaacaaat gatttcttaa 300 tacatactct tattgaaggt gagggacaag atactgtgag ggttacactt aatgaattat 360 tcctggcatt tggttcctac ttcagggcca taaattgata ttactcctca cactttcatt 420 aacgcttaca taagttaata gtgttaatca tttaattcat tactcaacaa gccgagcgtt 480 tattccagag ggtagggggt ttttcttttt ttcctctatt tcattagaca tttcacagtg 540 taaagaatca taataataaa ggtggtactc attttctgct caccaataag aaatatatgt 600 ctgtaaaaaa gataatctta taaataaatt gcataagtga tttcaagagc ataaataatt 660 tattttactc gaaacttatc tacaagtaat accccacgaa ttttttgaat tttttcgtta 720 aaccccccta cccccctaaa ctcctgagat cactaacaac ccctgtaagc cccccggaaa 780 caggaaaacc tcagatagta aatttattag cccaaaatgt gttcatttac attattataa 840 tatttaaatt 850 <210> 16 <211> 922 <212> DNA <213> Epinephelus septemfasciatus <400> 16 aaacatcatt atatgtactc tagtgcatat atgtactcta gtgcatatat gtactctagt 60 gcatatatgt actctagtgc atatatgtac tctagtgcat atatgtactc tagtgcatat 120 atgtactcta gtgcatatat gtactctagt gcatatatgt actctagtgc atatatgtac 180 tctagtgcat atatgtactc tagtgcatat atgtactcta gtgcatatat gtactctagt 240 gcatatatgt actctagtac atatatgtac tctagtgcat atatgcactc tagtacatat 300 atctttattc aacatttata ttaaaatcaa atagactgca cagtaagaac cgaccaacaa 360 atgatttctt aatacatact cttattgaag gtgagggaca agatactgtg agggttacac 420 ttaatgaatt attcctggca tttggttcct acttcagggc cataaattga tattactcct 480 cacactttca ttaacgctta cataagttaa tagtgttaat catttaattc attactcaac 540 aagccgagcg tttattccag agggtagggg gtttttcttt ttttcctcta tttcattaga 600 catttcacag tgtaaagaat cataataata aaggtggtac tcattttctg ctcaccaata 660 agaaatatat gtctgtaaaa aagataatct tataaataaa ttgcataagt gatttcaaga 720 gcataaataa tttattttac tcgaaactta tctataagta ataccccacg aattttttga 780 attttttcgt taaacccccc taccccccta aactcctgag atcactaaca acccctgtaa 840 accccccgga aacaggaaaa cctcagatag taaatttatt agcccaaaat gtgttcattt 900 acattattat aatatttaaa tt 922 <210> 17 <211> 833 <212> DNA <213> Epinephelus septemfasciatus <400> 17 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtaggga 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aaagataatc 600 ttataaataa attgcataag tgatttcaag agcataaata atttatttta ctcgaaactt 660 atctataagt aataccccac gaattttttg aattttttcg ttaaaccccc ctacccccct 720 aaactcctga gatcactaac aacccctgta aaccccccgg aaacaggaaa acctcagata 780 gtaaatttat tagcccaaaa tgtgttcatt tacattatta taatatttaa att 833 <210> 18 <211> 833 <212> DNA <213> Epinephelus septemfasciatus <400> 18 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtaggga 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aaagataatc 600 ttataaataa attgcataag tgatttcaag agcataaata atttatttta ctcgaaactt 660 atctataagt aataccccac gaattttttg aattttttcg ttaaaccccc ctacccccct 720 aaactcctga gatcactaac aacccctgta aaccccccgg aaacaggaaa acctcagata 780 gtaaatttat tagcccaaaa tgtgttcatt tacattatta taatatttaa att 833 <210> 19 <211> 850 <212> DNA <213> Epinephelus septemfasciatus <400> 19 aaacatcatt atatgyactc tagtgcatat atgtactcta gtgcatatat gtactctagt 60 gcatatatgt actctagtgc atatatgtac tctagtgcat atatgtactc tagtgcatat 120 atgtactcta gtgcatatat gtactctagt gcatatatgt actctagtgc atatatgtac 180 tctagtgcat atatgtactc tagtgcatat atgcactcta gtacatatat ctttattcaa 240 catttatatt aaaatcaaat agactgcaca gtaagaaccg accaacaaat gatttcttaa 300 tacatactct tattgaaggt gagggacaag atactgtgag ggttacactt aatgaattat 360 tcctggcatt tggttcctac ttcagggcca taaattgata ttactcctca cactttcatt 420 aacgcttaca taagttaata gtgttaatca tttaattcat tactcaacaa gccgagcgtt 480 tattccagag ggtagggggt ttttcttttt ttcctctatt tcattagaca tttcacagtg 540 taaagaatca taataataaa ggtggtactc attttctgct caccaataag aaatatatgt 600 ctgtaaaaaa gataatctta taaataaatt gcataagtga tttcaagagc ataaataatt 660 tattttactc gaaacttatc tataagtaat accccacgaa ttttttgaat tttttcgtta 720 aaccccccta cccccctaaa ctcctgagat cactaacaac ccctgtaaac cccccggaaa 780 caggaaaacc tcagatagta aatttattag cccaaaatgt gttcatttac attattataa 840 tatttaaatt 850 <210> 20 <211> 832 <212> DNA <213> Epinephelus septemfasciatus <400> 20 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtagggg 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aagataatct 600 tataaataaa ttgcataagt gatttcaaga gcataaataa tttattttac tcgaaactta 660 tctataagta ataccccacg aattttttga attttttcgt taaacccccc taccccccta 720 aactcctgag atcactaaca acccctgtaa accccccgga aacaggaaaa cctcagatag 780 taaatttatt agcccaaaat gtgttcattt acattattat aatatttaaa tt 832 <210> 21 <211> 832 <212> DNA <213> Epinephelus septemfasciatus <400> 21 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgyactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtagggg 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aagataatct 600 tataaataaa ttgcataagt gatttcaaga gcataaataa tttattttac tcgaaactta 660 tctataagta ataccccacg aattttttga attttttcgt taaacccccc taccccccta 720 aactcctgag atcactaaca acccctgtaa accccccgga aacaggaaaa cctcagatag 780 taaatttatt agcccaaaat gtgttcattt acattattat aatatttaaa tt 832 <210> 22 <211> 813 <212> DNA <213> Epinephelus septemfasciatus <400> 22 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatctttat tcaacattta tattaaaatc aaatagactg cacagtaaga 240 accgaccaac aaatgatttc ttaatacata ctcttattga aggtgaggga caagatactg 300 tgagggttac acttaatgaa ttattcctgg catttggttc ctacttcagg gccataaatt 360 gatattactc ctcacacttt cactaacgct tacataagtt aatagtgtta atcatttaat 420 tcattactca acaagccgag cgtttattcc agagggtagg gggtttttct tttttcctct 480 atttcattag acatttcaca gtgtaaagaa tcataataat aaaggtggta ctcattttct 540 gctcaccaat aagaaatata tgtctgtaaa aaagataatc ttataaataa attgcataag 600 tgatttcaag agcataaata atttatttta ctcgaaactt atctataagt aataccccac 660 gaattttttg aattttttcg ttaaaccccc ctacccccct aaactcctga gatcactaac 720 aacccctgta aaccccccgg aaacaggaaa acctcagata gtaaatttat tagcccaaaa 780 tgtgttcatt tacattatta taatatttaa att 813 <210> 23 <211> 833 <212> DNA <213> Epinephelus septemfasciatus <400> 23 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtaggga 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aaagataatc 600 ttataaataa attgcataag tgatttcaag agcataaata atttatttta ctcgaaactt 660 atctataagt aataccccac gaattttttg aattttttcg ttaaaccccc ctacccccct 720 aaactcctga gatcactaac aacccctgta aaccccccgg aaacaggaaa acctcagata 780 gtaaatttat tagcccaaaa tgtgttcatt tacattatta taatatttaa att 833 <210> 24 <211> 814 <212> DNA <213> Epinephelus septemfasciatus <400> 24 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatctttat tcaacattta tattaaaatc aaatagactg cacagtaaga 240 accgaccaac aaatgatttc ttaatacata ctcttattga aggtgaggga caagatactg 300 tgagggttac acttaatgaa ttattcctgg catttggttc ctacttcagg gccataaatt 360 gatattactc ctcacacttt cattaacgct tacataagtt aatagtgtta atcatttaat 420 tcattactca acaagccgag cgtttattcc agagggtagg gggtttttct ttttttcctc 480 tatttcatta gacatttcac agtgtaaaga atcataataa taaaggtggt actcattttc 540 tgctcaccaa taagaaatat atgtctgtaa aaaagataat cttataaata aattgcataa 600 gtgatttcaa gagcataaat aatttatttt actcgaaact tatctataag taatacccca 660 cgaatttttt gaattttttc gttaaacccc cctacccccc taaactcctg agatcactaa 720 caacccctgt aaaccccccg gaaacaggaa aacctcagat agtaaattta ttagcccaaa 780 atgtgttcat ttacattatt ataatattta aatt 814 <210> 25 <211> 814 <212> DNA <213> Epinephelus septemfasciatus <400> 25 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatctttat tcaacattta tattaaaatc aaatagactg cacagtaaga 240 accgaccaac aaatgatttc ttaatacata ctcttattga aggtgaggga caagatactg 300 tgagggttac acttaatgaa ttattcctgg catttggttc ctacttcagg gccataaatt 360 gatattactc ctcacacttt cattaacgct tacataagtt aatagtgtta atcatttaat 420 tcattactca acaagccgag cgtttattcc agagggtagg gggtttttct ttttttcctc 480 tatttcatta gacatttcac agtgtaaaga atcataataa taaaggtggt actcattttc 540 tgctcaccaa taagaaatat atgtctgtaa aaaagataat cttataaata aattgcataa 600 gtgatttcaa gagcataaat aatttatttt actcgaaact tatctataag taatacccca 660 cgaatttttt gaattttttc gttaaacccc cctacccccc taaactcctg agatcactaa 720 caacccctgt aaaccccccg gaaacaggaa aacctcagat agtaaattta ttagcccaaa 780 atgtgttcat ttacattatt ataatattta aatt 814 <210> 26 <211> 814 <212> DNA <213> Epinephelus septemfasciatus <400> 26 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatctttat tcaacattta tattaaaatc aaatagactg cacagtaaga 240 accgaccaac aaatgatttc ttaatacata ctcttattga aggtgaggga caagatactg 300 tgagggttac acttaatgaa ttattcctgg catttggttc ctacttcagg gccataaatt 360 gatattactc ctcacacttt cattaacgct tacataagtt aatagtgtta atcatttaat 420 tcattactca acaagccgag cgtttattcc agagggtagg gggtttttct ttttttcctc 480 tatttcatta gacatttcac agtgtaaaga atcataataa taaaggtggt actcattttc 540 tgctcaccaa taagaaatat atgtctgtaa aaaagataat cttataaata aattgcataa 600 gtgatttcaa gagcataaat aatttatttt actcgaaact tatctataag taatacccca 660 cgaatttttt gaattttttc gttaaacccc cctacccccc taaactcctg agatcactaa 720 caacccctgt aaaccccccg gaaacaggaa aacctcagat agtaaattta ttagcccaaa 780 atgtgttcat ttacattatt ataatattta aatt 814 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 attattcctg gcatttggtt cc 22 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 ccagaccggg catcctaata 20 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 ggtgagcaga aaatgagtac cac 23 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 atcccacaca actaggttta caag 24 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 cggtagtcac caatctctag ctt 23 <110> JEJU Technopark <120> Method for Discriminating Between Epinephelus bruneu and Epinephelus septemfasciatus and a Kit Therefor <130> PP13-000-Jejutp-bruneu <160> 31 <170> Kopatentin 2.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ctcccaaagc taggattct 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ggaaagtcag gaccaagcct 20 <210> 3 <211> 991 <212> DNA <213> Epinephelus bruneu <400> 3 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgcgtcttg attcaacatt atatttgata acaaataaac tgcacaataa 420 gaacctacca acaagagtta ggtaatgcat acggttattg ataatgaggg acaataactg 480 tgagggtctc acttagtgaa ttattcctgg catttggttc ctacttcagg gccatgactt 540 gattatattc ctcacacttt cattaacgct ggcataagtt aatagtgtta accattaggt 600 tcattaccca gcaagccgag ccttcattcc agggggtggg gggttccctt ttattttttt 660 cctttcaaca gacatttcag agtgtaagaa aaggctgaaa gtttgaaggt ggtacatcac 720 tttgcagctg aacacaaggt tatgcaggct aaaaagacat tcttttagaa ataattacat 780 aactgatttc aagaacataa atatacttat cctactcaga gcacccccct aatattagga 840 tgcccggtct ggtggttttt atccgtttaa accccctacc ccctaaaccc tgagattcct 900 aacaccctgt aaacccccgg aaacagggct aaactcaagt aataagtttt aactaaaatg 960 tgtttattac actaatgtaa tttttaattt g 991 <210> 4 <211> 983 <212> DNA <213> Epinephelus bruneu <400> 4 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgcgtc 360 ttgattcaac attatatttg ataacaaata aactgcacag taagaaccta ccaacaagag 420 ttaagtaatg catacggtta ttgataatga gggacaataa ctgtgagggt ctcactcagt 480 gaattattcc tggcatttgg ttcctacttc agggccatga cttgattata ttcctcacac 540 tttcattaac gctggcataa gttaatagtg ttaaccatta ggttcattac ccagcaagcc 600 gagccttcat tccagggggt ggggggttcc cttttatttt tttcctttca acaggcattt 660 cagagtgtaa gaaaaggctg aaagtttgaa ggtagtacaa cactttgcag ctgaacacaa 720 ggttatgcag gctaaaaaga cattctttta gaaataatta cataactgat ttcaagaaca 780 taaatatact tatcctactc agagcacccc cctaatatta ggatgcccgg tctggtggtt 840 ttttatccgt ttaaaccccc ctacccccct aaacccctga gattcctaac acccctgtaa 900 accccccgga aacagggcta aacctcaagt aataagtttt taacctaaaa tgtgtttatt 960 acactaatgt aatttttaat ttg 983 <210> 5 <211> 1033 <212> DNA <213> Epinephelus bruneu <400> 5 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgcgt cttgattcaa 420 cattatattt gataacaaat aaactgcaca gtaagaacct accaacaaga gttaagtaat 480 gcatacggtt attgataatg agggacaata actgtgaggg tctcactcag tgaattattc 540 ctggcatttg gttcctactt cagggccatg acttgattat attcctcaca ctttcattaa 600 cgctggcata agttaatagt gttaaccatt aggttcatta cccagcaagc cgagccttca 660 ttccaggggg tggggggttc ccttttattt ttttcctttc aacaggcatt tcagagtgta 720 agaaaaggct gaaagtttga aggtagtaca tcactttgca gctgaacaca aggttatgca 780 ggctaaaaag acattctttt agaaatagtt acataactga tttcaagaac ataaatatac 840 ttatcctact cagagcaccc ccctaatatt aggatgcccg gtctggtggt ttttatccgt 900 ttaaaccccc ctacccccct aaacccctga gattcctaac acccctgtaa accccccgga 960 aacagggcta aacctcaagt aataagtttt taacctaaaa tgtgtttatt acactaatgt 1020 aatttttaat ttg 1033 <210> 6 <211> 1017 <212> DNA <213> Epinephelus bruneu <400> 6 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg cgtcttgatt caacattata tttgataaca 420 aataaactgc acagtaagaa cctaccaaca agagttaagt gatgcatacg gttattgata 480 atgagggaca ataactgtga gggtttcact cagtgaatta ttcctggcat ttggttccta 540 cttcagggcc atgacttgat tatattcctc acactttcat taacgctggc ataagttaat 600 agtgttaacc attaggttca ttacccagca agccgagcct tcattccagg gggtgggggg 660 ttccctttta tttttttcct ttcaacaggc atttcagagt gtaagaaaag gctggaaagt 720 ttgaaggtgg tacatcactt tgcagctgaa cacaaggtta tgcaggctaa aaagacattc 780 ttttagaaat gattacataa ctgatttcaa gaacataaat atacttatcc tactcagagc 840 acccccctaa tattaggatg tccggtctgg tggtttttat ccgtttaaac ccccctaccc 900 ccctaaaccc ctgagattcc taacacccct gtaaaccccc cggaaacagg gctaaacctc 960 aagtaataag tttttaacct aaaatgtgtt tattacacta atgtaatttt taatttg 1017 <210> 7 <211> 1186 <212> DNA <213> Epinephelus bruneu <400> 7 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgctgat 480 attacatata tgctgatatt acatatatgc tgatattaca tatatgctga tattacatat 540 atgctgatat tacatatata tgtcttgatt caacattata tttgataaca aataaactgc 600 acagtaagaa cctaccaaca agagttaagt aatgcatacg gttattgata atgagggaca 660 ataattgtga gggtctcact cagtgaatta ttcctggcat ttggttccta cttcagggcc 720 atgacttgat tatattcctc acactttcat taacgctggc ataagttaat agtgttaacc 780 attaggttca ttacccagca agccgagcct tcattccagg gggtgggggg ttccctttta 840 tttttttcct ttcaacagac atttcagagt gtaagaaaag gctgaaagtt tgaaggtagt 900 acatcacttt gcagctgaac acaaggttat gcaggctaaa aagacattct tttagaaata 960 attacataac tgatttcaag aacataaata tacttatcct actcagagca cccccctaat 1020 attaagatga ccggtctggt ggtttttatc cgtttaaacc cccctacccc cctaaacccc 1080 tgagattcct aacacccctg taaacccccc ggaaacaggg ctaaacctca agtaataagt 1140 ttttaaccta aaatgtgttt attacactaa tgtaattttt aatttg 1186 <210> 8 <211> 1017 <212> DNA <213> Epinephelus bruneu <400> 8 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg cgtcttgatt caacattata tttgataaca 420 aataaactgc acagtaagaa cctaccaaca agagttaagt gatgcatacg gttattgata 480 atgagggaca ataactgtga gggtttcact cagtgaatta ttcctggcat ttggttccta 540 cttcagggcc atgacttgat tatattcctc acactttcat taacgctggc ataagttaat 600 agtgttaacc attaggttca ttacccagca agccgagcct tcattccagg gggtgggggg 660 ttccctttta tttttttcct ttcaacaggc atttcagagt gtaagaaaag gctggaaagt 720 ttgaaggtgg tacatcactt tgcagctgaa cacaaggtta tgcaggctaa aaagacattc 780 ttttagaaat gattacataa ctgatttcaa gaacataaat atacttatcc tactcagagc 840 acccccctaa tattaggatg tccggtctgg tggtttttat ccgtttaaac ccccctaccc 900 ccctaaaccc ctgagattcc taacacccct gtaaaccccc cggaaacagg gctaaacctc 960 aagtaataag tttttaacct aaaatgtgtt tattacacta atgtaatttt taatttg 1017 <210> 9 <211> 1000 <212> DNA <213> Epinephelus bruneu <400> 9 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgcgtcttg attcaacatt atatttgata acaaataaac tgcacagtaa 420 gaacctacca acaagagtta agtgatgcat acggttattg ataatgaggg acaataactg 480 tgagggtttc actcagtgaa ttattcctgg catttggttc ctacttcagg gccatgactt 540 gattatattc ctcacacttt cattaacgct ggcataagtt aatagtgtta accattaggt 600 tcattaccca gcaagccgag ccttcattcc agggggtggg gggttccctt ttattttttt 660 cctttcaaca ggcatttcag agtgtaagaa aaggctggaa agtttgaagg tggtacatca 720 ctttgcagct gaacacaagg ttatgcaggc taaaaagaca ttcttttaga aatgattaca 780 taactgattt caagaacata aatatactta tcctactcag agcacccccc taatattagg 840 atgtccggtc tggtggtttt tatccgttta aaccccccta cccccctaaa cccctgagat 900 tcctaacacc cctgtaaacc ccccggaaac agggctaaac ctcaagtaat aagtttttaa 960 cctaaaatgt gtttattaca ctaatgtaat ttttaatttg 1000 <210> 10 <211> 1050 <212> DNA <213> Epinephelus bruneu <400> 10 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgcgtctt gattcaacat tatatttgay aacaaataaa ctgcacagta agaacctacc 480 aacaagagtt aagtratgca tacggttatt gataatgagg gacaataact gtgrgggtct 540 cactcagtga attattcctg gcatttggtt cctacttcag ggccatgact tgattatatt 600 cctcacactt tcattaacgc tggcataagt taatagtgtt aaccattagg ttcattaccc 660 agcaagccga gccttcattc cagggggtgg ggggttccct tttatttttt tcctttcaac 720 aggcatttca gagtgtaaga aaaggctgaa agtttgaagg tagtacatca ctttgcagct 780 gaacacaagg ttatgcaggc taaaaagaca ttcttttaga aatarttaca taactgattt 840 caagaacata aatatactta tcctactcag agcacccccc taatattagg atgcccggtc 900 tggtggtttt tatccgttta aaccccccta cccccctaaa cccctgagat tcctaacacc 960 cctgtaaacc ccccggaaac agggctaaac ctcaagtaat aagtttttaa cctaaaatgt 1020 gtttattaca ctaatgtaat ttttaatttg 1050 <210> 11 <211> 1101 <212> DNA <213> Epinephelus bruneu <400> 11 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgcgtct 480 tgattcaaca ttatatttga caacaaataa actgcacagt aagaacctac caacaagagt 540 taagtratgc atacggttat tgataatgag ggacaataac tgtgrgggtc tcactcagtg 600 aattattcct ggcatttggt tcctacttca gggccatgac ttgattatat tcctcacact 660 ttcattaacg ctggcataag ttaatagtgt taaccattag gttcattacc cagcaagccg 720 agccttcatt ccagggggtg gggggttccc ttttattttt ttcctttcaa yaggcatttc 780 agagtgtaag aaaaggctga aagtttgaag gtagtacatc actttgcagc tgaacacaag 840 gttatgcagg ctaaaaagac attcttttag aaataattac ataactgatt tcaagaacat 900 aaatatactt atcctactca gagcaccccc ctaatattag gatgcccggt ctggtggttt 960 ttatccgttt aaacccccct acccccctaa acccctgaga ttcctaacac ccctgtaaac 1020 cccccggaaa cagggctaaa cctcaagtaa taagttttta acctaaaatg tgtttattac 1080 actaatgtaa tttttaattt g 1101 <210> 12 <211> 1206 <212> DNA <213> Epinephelus bruneu <400> 12 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgctgat 480 attacatata tgctgatatt acatatatgc tgatattaca tatatgctga tattacatat 540 atgctgatat tacatatatg ctgatattac atatatgctg atattacata tatgcgtctt 600 gattcaacat tatatttgat aacaaataaa ctgcacagta agaacctacc aacaagagtt 660 aagtaatgca tacggttatt gataatgagg gacaataact gtgagggtct cactcagtga 720 attattcctg gcatttggtt cctacttcag ggccatgact tgattatatt cctcacactt 780 tcattaacgc tggcataagt taatagtgtt aaccattagg ttcattaccc agcaagccga 840 gccttcattc cagggggtgg ggggttccct tttatttttt tcctttcaac aggcatttca 900 gagtgtaaga aaaggctgaa agtttgaagg tagtacatta ctttgcagct gaacacaagg 960 ttatgcaggc taaaaagaca ttcttttaga aataattaca taactgattt caagaacata 1020 aatatactta tcctactcag agcacccccc taatattagg atgcccggtc tggtggtttt 1080 tatccgttta aaccccccta cccccctaaa cccctgagat tcctaacacc cctgtaaacc 1140 ccccggaaac agggctaaac ctcaagtaat aagtttttaa cctaaaatgt gtttattaca 1200 ctaatg 1206 <210> 13 <211> 1172 <212> DNA <213> Epinephelus bruneu <400> 13 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgctgat 480 attacatata tgctgatatt acatatatgc tgatattaca tatatgctga tattacatat 540 atgctgatat tacatatatg cgtcttgatt caacattata tttgataaca aataaactgc 600 acagtaagaa cctaccaaca agagttaagt aatgcatacg gttattgata atgagggaca 660 ataactgtga gggtctcact cagtgaatta ttcctggcat ttggttccta cttcagggcc 720 atgacttgat tatattcctc acactttcat taacgctggc ataagttaat agtgttaacc 780 attaggttca ttacccagca agccgagcct tcattccagg gggtgggggg ttccctttta 840 tttttttcct ttcaacaggc atttcagagt gtaagaaaag gctgaaagtt tgaaggtagt 900 acattacttt gcagctgaac acaaggttat gcaggctaaa aagacattct tttagaaata 960 attacataac tgatttcaag aacataaata tacttatcct actcagagca cccccctaat 1020 attaggatgc ccggtctggt ggtttttatc cgtttaaacc cccctacccc cctaaacccc 1080 tgagattcct aacacccctg taaacccccc ggaaacaggg ctaaacctca agtaataagt 1140 ttttaaccta aaatgtgttt attacactaa tg 1172 <210> 14 <211> 1169 <212> DNA <213> Epinephelus bruneu <400> 14 tgatattaca tatatgctga tattacatat atgctgatat tacatatatg ctgatattac 60 atatatgctg atattacata tatgctgata ttacatatat gctgatatta catatatgct 120 gatattacat atatgctgat attacatata tgctgatatt acatatatgc tgatattaca 180 tatatgctga tattacatat atgctgatat tacatatatg ctgatattac atatatgctg 240 atattacata tatgctgata ttacatatat gctgatatta catatatgct gatattacat 300 atatgctgat attacatata tgctgatatt acatatatgc tgatattaca tatatgctga 360 tattacatat atgctgatat tacatatatg ctgatattac atatatgctg atattacata 420 tatgctgata ttacatatat gctgatatta catatatgct gatattacat atatgctgat 480 attacatata tgctgatatt acatatatgc tgatattaca tatatgctga tattacatat 540 atgggtcttg attcaacatt atatttaata acaaataaac tgcacagtaa gaacctacca 600 acaagagtta agcgatgcat acggttattg ataatgaggg acaataactg tgagggtctc 660 actcagtgaa ttattcctgg catttggttc ctacttcagg gccatgactt gattatattc 720 ctcacacttt cattaacgct ggcataagtt aatagtgtta accattaagt tcattaccca 780 gcaagccgag ccttcattcc agggggtggg gggttccctt ttattttttt cctttcaaca 840 ggcatttcag agtgtaagaa aaggctgaaa gtttgaaggt ggtacatcac tttgcagctg 900 aacacaaggt tatgcaggct aaaaagacat tcttttagag ataattacat aactgatttc 960 aagaacataa atatacttat cctactcaga gcacccccct aatattagga tgcccggtct 1020 ggtggttttt atccgtttaa acccccctac ccccctaaac ccctgagatt cctaacaccc 1080 ctgtaaaccc cccggaaaca gggctaaacc tcaagtaata agtttttaac ctaaaatgtg 1140 tttattacac taatgtaatt tttaatttg 1169 <210> 15 <211> 850 <212> DNA <213> Epinephelus septemfasciatus <400> 15 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atgcactcta gtacatatat ctttattcaa 240 catttatatt aaaatcaaat agactgcaca gtaagaaccg accaacaaat gatttcttaa 300 tacatactct tattgaaggt gagggacaag atactgtgag ggttacactt aatgaattat 360 tcctggcatt tggttcctac ttcagggcca taaattgata ttactcctca cactttcatt 420 aacgcttaca taagttaata gtgttaatca tttaattcat tactcaacaa gccgagcgtt 480 tattccagag ggtagggggt ttttcttttt ttcctctatt tcattagaca tttcacagtg 540 taaagaatca taataataaa ggtggtactc attttctgct caccaataag aaatatatgt 600 ctgtaaaaaa gataatctta taaataaatt gcataagtga tttcaagagc ataaataatt 660 tattttactc gaaacttatc tacaagtaat accccacgaa ttttttgaat tttttcgtta 720 aaccccccta cccccctaaa ctcctgagat cactaacaac ccctgtaagc cccccggaaa 780 caggaaaacc tcagatagta aatttattag cccaaaatgt gttcatttac attattataa 840 tatttaaatt 850 <210> 16 <211> 922 <212> DNA <213> Epinephelus septemfasciatus <400> 16 aaacatcatt atatgtactc tagtgcatat atgtactcta gtgcatatat gtactctagt 60 gcatatatgt actctagtgc atatatgtac tctagtgcat atatgtactc tagtgcatat 120 atgtactcta gtgcatatat gtactctagt gcatatatgt actctagtgc atatatgtac 180 tctagtgcat atatgtactc tagtgcatat atgtactcta gtgcatatat gtactctagt 240 gcatatatgt actctagtac atatatgtac tctagtgcat atatgcactc tagtacatat 300 atctttattc aacatttata ttaaaatcaa atagactgca cagtaagaac cgaccaacaa 360 atgatttctt aatacatact cttattgaag gtgagggaca agatactgtg agggttacac 420 ttaatgaatt attcctggca tttggttcct acttcagggc cataaattga tattactcct 480 cacactttca ttaacgctta cataagttaa tagtgttaat catttaattc attactcaac 540 aagccgagcg tttattccag agggtagggg gtttttcttt ttttcctcta tttcattaga 600 catttcacag tgtaaagaat cataataata aaggtggtac tcattttctg ctcaccaata 660 agaaatatat gtctgtaaaa aagataatct tataaataaa ttgcataagt gatttcaaga 720 gcataaataa tttattttac tcgaaactta tctataagta ataccccacg aattttttga 780 attttttcgt taaacccccc taccccccta aactcctgag atcactaaca acccctgtaa 840 accccccgga aacaggaaaa cctcagatag taaatttatt agcccaaaat gtgttcattt 900 acattattat aatatttaaa tt 922 <210> 17 <211> 833 <212> DNA <213> Epinephelus septemfasciatus <400> 17 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtaggga 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aaagataatc 600 ttataaataa attgcataag tgatttcaag agcataaata atttatttta ctcgaaactt 660 atctataagt aataccccac gaattttttg aattttttcg ttaaaccccc ctacccccct 720 aaactcctga gatcactaac aacccctgta aaccccccgg aaacaggaaa acctcagata 780 gtaaatttat tagcccaaaa tgtgttcatt tacattatta taatatttaa att 833 <210> 18 <211> 833 <212> DNA <213> Epinephelus septemfasciatus <400> 18 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtaggga 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aaagataatc 600 ttataaataa attgcataag tgatttcaag agcataaata atttatttta ctcgaaactt 660 atctataagt aataccccac gaattttttg aattttttcg ttaaaccccc ctacccccct 720 aaactcctga gatcactaac aacccctgta aaccccccgg aaacaggaaa acctcagata 780 gtaaatttat tagcccaaaa tgtgttcatt tacattatta taatatttaa att 833 <210> 19 <211> 850 <212> DNA <213> Epinephelus septemfasciatus <400> 19 aaacatcatt atatgyactc tagtgcatat atgtactcta gtgcatatat gtactctagt 60 gcatatatgt actctagtgc atatatgtac tctagtgcat atatgtactc tagtgcatat 120 atgtactcta gtgcatatat gtactctagt gcatatatgt actctagtgc atatatgtac 180 tctagtgcat atatgtactc tagtgcatat atgcactcta gtacatatat ctttattcaa 240 catttatatt aaaatcaaat agactgcaca gtaagaaccg accaacaaat gatttcttaa 300 tacatactct tattgaaggt gagggacaag atactgtgag ggttacactt aatgaattat 360 tcctggcatt tggttcctac ttcagggcca taaattgata ttactcctca cactttcatt 420 aacgcttaca taagttaata gtgttaatca tttaattcat tactcaacaa gccgagcgtt 480 tattccagag ggtagggggt ttttcttttt ttcctctatt tcattagaca tttcacagtg 540 taaagaatca taataataaa ggtggtactc attttctgct caccaataag aaatatatgt 600 ctgtaaaaaa gataatctta taaataaatt gcataagtga tttcaagagc ataaataatt 660 tattttactc gaaacttatc tataagtaat accccacgaa ttttttgaat tttttcgtta 720 aaccccccta cccccctaaa ctcctgagat cactaacaac ccctgtaaac cccccggaaa 780 caggaaaacc tcagatagta aatttattag cccaaaatgt gttcatttac attattataa 840 tatttaaatt 850 <210> 20 <211> 832 <212> DNA <213> Epinephelus septemfasciatus <400> 20 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtagggg 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aagataatct 600 tataaataaa ttgcataagt gatttcaaga gcataaataa tttattttac tcgaaactta 660 tttataagta ataccccacg aattttttga attttttcgt taaacccccc taccccccta 720 aactcctgag atcactaaca acccctgtaa accccccgga aacaggaaaa cctcagatag 780 taaatttatt agcccaaaat gtgttcattt acattattat aatatttaaa tt 832 <210> 21 <211> 832 <212> DNA <213> Epinephelus septemfasciatus <400> 21 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgyactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtagggg 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aagataatct 600 tataaataaa ttgcataagt gatttcaaga gcataaataa tttattttac tcgaaactta 660 tttataagta ataccccacg aattttttga attttttcgt taaacccccc taccccccta 720 aactcctgag atcactaaca acccctgtaa accccccgga aacaggaaaa cctcagatag 780 taaatttatt agcccaaaat gtgttcattt acattattat aatatttaaa tt 832 <210> 22 <211> 813 <212> DNA <213> Epinephelus septemfasciatus <400> 22 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatctttat tcaacattta tattaaaatc aaatagactg cacagtaaga 240 accgaccaac aaatgatttc ttaatacata ctcttattga aggtgaggga caagatactg 300 tgagggttac acttaatgaa ttattcctgg catttggttc ctacttcagg gccataaatt 360 gatattactc ctcacacttt cactaacgct tacataagtt aatagtgtta atcatttaat 420 tcattactca acaagccgag cgtttattcc agagggtagg gggtttttct tttttcctct 480 atttcattag acatttcaca gtgtaaagaa tcataataat aaaggtggta ctcattttct 540 gctcaccaat aagaaatata tgtctgtaaa aaagataatc ttataaataa attgcataag 600 tgatttcaag agcataaata atttatttta ctcgaaactt atctataagt aataccccac 660 gaattttttg aattttttcg ttaaaccccc ctacccccct aaactcctga gatcactaac 720 aacccctgta aaccccccgg aaacaggaaa acctcagata gtaaatttat tagcccaaaa 780 tgtgttcatt tacattatta taatatttaa att 813 <210> 23 <211> 833 <212> DNA <213> Epinephelus septemfasciatus <400> 23 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatgcactc tagtacatat atctttattc aacatttata ttaaaatcaa 240 atagactgca cagtaagaac cgaccaacaa atgatttctt aatacatact cttattgaag 300 gtgagggaca agatactgtg agggttacac ttaatgaatt attcctggca tttggttcct 360 acttcagggc cataaattga tattactcct cacactttca ttaacgctta cataagttaa 420 tagtgttaat catttaattc attactcaac aagccgagcg tttattccag agggtaggga 480 gtttttcttt ttttcctcta tttcattaga catttcacag tgtaaagaat cataataata 540 aaggtggtac tcattttctg ctcaccaata agaaatatat gtctgtaaaa aaagataatc 600 ttataaataa attgcataag tgatttcaag agcataaata atttatttta ctcgaaactt 660 atctataagt aataccccac gaattttttg aattttttcg ttaaaccccc ctacccccct 720 aaactcctga gatcactaac aacccctgta aaccccccgg aaacaggaaa acctcagata 780 gtaaatttat tagcccaaaa tgtgttcatt tacattatta taatatttaa att 833 <210> 24 <211> 814 <212> DNA <213> Epinephelus septemfasciatus <400> 24 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatctttat tcaacattta tattaaaatc aaatagactg cacagtaaga 240 accgaccaac aaatgatttc ttaatacata ctcttattga aggtgaggga caagatactg 300 tgagggttac acttaatgaa ttattcctgg catttggttc ctacttcagg gccataaatt 360 gatattactc ctcacacttt cattaacgct tacataagtt aatagtgtta atcatttaat 420 tcattactca acaagccgag cgtttattcc agagggtagg gggtttttct ttttttcctc 480 tatttcatta gacatttcac agtgtaaaga atcataataa taaaggtggt actcattttc 540 tgctcaccaa taagaaatat atgtctgtaa aaaagataat cttataaata aattgcataa 600 gtgatttcaa gagcataaat aatttatttt actcgaaact tatctataag taatacccca 660 cgaatttttt gaattttttc gttaaacccc cctacccccc taaactcctg agatcactaa 720 caacccctgt aaaccccccg gaaacaggaa aacctcagat agtaaattta ttagcccaaa 780 atgtgttcat ttacattatt ataatattta aatt 814 <210> 25 <211> 814 <212> DNA <213> Epinephelus septemfasciatus <400> 25 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatctttat tcaacattta tattaaaatc aaatagactg cacagtaaga 240 accgaccaac aaatgatttc ttaatacata ctcttattga aggtgaggga caagatactg 300 tgagggttac acttaatgaa ttattcctgg catttggttc ctacttcagg gccataaatt 360 gatattactc ctcacacttt cattaacgct tacataagtt aatagtgtta atcatttaat 420 tcattactca acaagccgag cgtttattcc agagggtagg gggtttttct ttttttcctc 480 tatttcatta gacatttcac agtgtaaaga atcataataa taaaggtggt actcattttc 540 tgctcaccaa taagaaatat atgtctgtaa aaaagataat cttataaata aattgcataa 600 gtgatttcaa gagcataaat aatttatttt actcgaaact tatctataag taatacccca 660 cgaatttttt gaattttttc gttaaacccc cctacccccc taaactcctg agatcactaa 720 caacccctgt aaaccccccg gaaacaggaa aacctcagat agtaaattta ttagcccaaa 780 atgtgttcat ttacattatt ataatattta aatt 814 <210> 26 <211> 814 <212> DNA <213> Epinephelus septemfasciatus <400> 26 aaacatcatt atatgcactc tagtacatat atgcactcta gtacatatat gcactctagt 60 acatatatgc actctagtac atatatgcac tctagtacat atatgcactc tagtacatat 120 atgcactcta gtacatatat gcactctagt acatatatgc actctagtac atatatgcac 180 tctagtacat atatctttat tcaacattta tattaaaatc aaatagactg cacagtaaga 240 accgaccaac aaatgatttc ttaatacata ctcttattga aggtgaggga caagatactg 300 tgagggttac acttaatgaa ttattcctgg catttggttc ctacttcagg gccataaatt 360 gatattactc ctcacacttt cattaacgct tacataagtt aatagtgtta atcatttaat 420 tcattactca acaagccgag cgtttattcc agagggtagg gggtttttct ttttttcctc 480 tatttcatta gacatttcac agtgtaaaga atcataataa taaaggtggt actcattttc 540 tgctcaccaa taagaaatat atgtctgtaa aaaagataat cttataaata aattgcataa 600 gtgatttcaa gagcataaat aatttatttt actcgaaact tatctataag taatacccca 660 cgaatttttt gaattttttc gttaaacccc cctacccccc taaactcctg agatcactaa 720 caacccctgt aaaccccccg gaaacaggaa aacctcagat agtaaattta ttagcccaaa 780 atgtgttcat ttacattatt ataatattta aatt 814 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 attattcctg gcatttggtt cc 22 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 ccagaccggg catcctaata 20 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 ggtgagcaga aaatgagtac cac 23 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 atcccacaca actaggttta caag 24 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 cggtagtcac caatctctag ctt 23
Claims (8)
(b) separating the genomic DNA of the mitochondria of the albino buds from the biological sample; (c) amplifying the D-loop region of the genomic DNA to different lengths; Amplifying the D-loop region using the primer; and (d) identifying the length of the amplification product.
상기 자바리와 능성어의 D-loop 부위를 서로 다른 길이로 증폭하기 위한 프라이머는 D-loop 부위의 위치가 서로 다른 영역을 기초로 설계되되, 자바리와 능성어 각각에 특이적으로 설계됨으로써 해당 종에 대해서만 D-loop 부위의 해당 상보적 서열에 결합하여 해당 영역을 증폭시키고 타종에 대해서는 해당 영역을 증폭시키지 않는 프라이머인 것을 특징으로 하는 자바리와 능성어의 식별 방법.
The method according to claim 1,
The primer for amplifying the D-loop region of the Fabry-Perot and the lady's tail is designed on the basis of different regions of the D-loop region, wherein the primer is a primer that binds to a corresponding complementary sequence at the -loop site and amplifies the corresponding region and does not amplify the corresponding region of the other species.
상기 자바리와 능성어의 D-loop 부위를 서로 다른 길이로 증폭하기 위한 프라이머는 그 정방향 프라이머가 자바리와 능성어 모두에 대해서 서열번호 27의 서열로 이루어진 공통적인 프라이머이고, 그 역방향 프라이머는 자바리와 능성어 각각에 대해서 각각 서열번호 28 및 29의 서열로 이루어진 특이적 프라이머인 것을 특징으로 하는 자바리와 능성어의 식별 방법.
The method according to claim 1,
The primer for amplifying the D-loop region of the Fabricius and the Fusarium spp. With different lengths is a common primer having the sequence of SEQ ID NO: 27 for both the forward primer and the wild-type primer, and the reverse primer has a 28 and 29, respectively, with respect to the wild-type and the wild-type.
A kit for identification of mussels and albatrosses comprising primers capable of amplifying the D-loop region of genomic DNA of mitochondria of mussels and rhizome with different lengths.
상기 자바리와 능성어의 D-loop 부위를 서로 다른 길이로 증폭하기 위한 프라이머는 D-loop 부위의 위치가 서로 다른 영역을 기초로 설계되되, 자바리와 능성어 각각에 특이적으로 설계됨으로써 해당 종에 대해서만 D-loop 부위의 해당 상보적 서열에 결합하여 해당 영역을 증폭시키고 타종에 대해서는 해당 영역을 증폭시키지 않는 프라이머인 것을 특징으로 하는 자바리와 능성어의 식별 키트.
5. The method of claim 4,
The primer for amplifying the D-loop region of the Fabry-Perot and the lady's tail is designed on the basis of different regions of the D-loop region, wherein the primer is a primer that binds to the complementary sequence at the -loop site to amplify the corresponding region and does not amplify the corresponding region in the other species.
상기 자바리와 능성어의 D-loop 부위를 서로 다른 길이로 증폭하기 위한 프라이머는 그 정방향 프라이머가 자바리와 능성어 모두에 대해서 서열번호 27의 서열로 이루어진 공통적인 프라이머이고, 그 역방향 프라이머는 자바리와 능성어 각각에 대해서 각각 서열번호 28 및 29의 서열로 이루어진 특이적 프라이머인 것을 특징으로 하는 자바리와 능성어의 식별 키트.
5. The method of claim 4,
The primer for amplifying the D-loop region of the Fabricius and the Fusarium spp. With different lengths is a common primer having the sequence of SEQ ID NO: 27 for both the forward primer and the wild-type primer, and the reverse primer has a 28 and 29, respectively, with respect to the first and second primers.
상기 자바리와 능성어의 식별 키트는 자바리와 능성어로부터의 미토콘드리아 게놈 DNA 분리 수단, DNA 서열을 증폭하기 위한 수단, 자바리와 능성어로부터 생물학적 시료를 분리하기 위한 수단, 및 키트의 사용 방법을 교시한 설명서를 추가로 포함하는 자바리와 능성어의 식별 키트.
5. The method of claim 4,
The kit for identification of the mangabi and the ladybug includes a means for separating the mitochondrial genomic DNA from the mangabi and the ladybug, a means for amplifying the DNA sequence, a means for separating the biological sample from the mangabi and the ladybug, and a manual for teaching how to use the kit Identification kits for the jabari and lyme containing as.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020130005416 | 2013-01-17 | ||
| KR20130005416 | 2013-01-17 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20140093889A true KR20140093889A (en) | 2014-07-29 |
| KR101515449B1 KR101515449B1 (en) | 2015-06-03 |
Family
ID=51739860
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020130038330A KR101515449B1 (en) | 2013-01-17 | 2013-04-08 | Method for Discriminating Between Epinephelus bruneu and Epinephelus septemfasciatus and a Kit Therefor |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101515449B1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101499695B1 (en) * | 2014-09-18 | 2015-03-16 | 대한민국 | Genetic markers and methods for identifying Epinephelus septemfasciatus and Epinephelus akaara among family Serranidae |
| CN116837117A (en) * | 2023-09-01 | 2023-10-03 | 海南热带海洋学院崖州湾创新研究院 | SNP (Single nucleotide polymorphism) marker related to growth traits of hybrid spots of fir tiger and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4958019B2 (en) * | 2008-11-27 | 2012-06-20 | 有限会社ジェノテックス | Method for labeling and discrimination of aquatic seafood with mitochondrial DNA variable region base sequences |
-
2013
- 2013-04-08 KR KR1020130038330A patent/KR101515449B1/en active IP Right Grant
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101499695B1 (en) * | 2014-09-18 | 2015-03-16 | 대한민국 | Genetic markers and methods for identifying Epinephelus septemfasciatus and Epinephelus akaara among family Serranidae |
| CN116837117A (en) * | 2023-09-01 | 2023-10-03 | 海南热带海洋学院崖州湾创新研究院 | SNP (Single nucleotide polymorphism) marker related to growth traits of hybrid spots of fir tiger and application |
| CN116837117B (en) * | 2023-09-01 | 2023-11-14 | 海南热带海洋学院崖州湾创新研究院 | SNP (Single nucleotide polymorphism) marker related to growth traits of tiger spots and application of SNP marker |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101515449B1 (en) | 2015-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101834565B1 (en) | CAPS Marker for Differentiation of Shiitake Mushroom Cultivar Sanmaru-1 and use thereof | |
| KR101232878B1 (en) | PCR Primer For Amplifying 5′End Region of Mitochondrial Cytochrome Oxidase Subunit I Gene Used For DNA Barcoding of Scale Insect | |
| KR101997679B1 (en) | CAPS Marker for Identification of Lentinula edodes Cultivar Sanmaru 2ho and use thereof | |
| KR101906037B1 (en) | CAPS Marker for Differentiation of Shiitake Mushroom Cultivar Chunjang-3 and use thereof | |
| CN104845967A (en) | Oligonucleotide fragment, method for selectively amplifying target nucleotide sequence variant by use of oligonucleotide fragment and application of oligonucleotide fragment | |
| KR101503511B1 (en) | Primer set for diagnosing white spot syndrom virus, composition and kit comprising the same | |
| US9365904B2 (en) | Ion torrent genomic sequencing | |
| EP2235208B1 (en) | A method of detecting cryptosporidium | |
| KR101515449B1 (en) | Method for Discriminating Between Epinephelus bruneu and Epinephelus septemfasciatus and a Kit Therefor | |
| KR101525495B1 (en) | Dumbbell structure oligonucleotide, primer for amplificating nucleic acid having the same and method for amplificating nucleic acid using the same | |
| KR101300845B1 (en) | Method for Discriminating Between Cynanchum wilfordii and Cynanchum auriculatum and a Kit Therefor | |
| KR101292169B1 (en) | Method for Discriminating Between Branchiostegus japonicus and Branchiostegus albus and a Kit Therefor | |
| KR101955074B1 (en) | Snp markers for discrimination of raphanus sativus | |
| EP0860503A1 (en) | Material and method for detecting fungi | |
| KR101326159B1 (en) | Method for Discriminating Between Seriola quinqueradiata and Seriola lalandi and a Kit Therefor | |
| KR101292168B1 (en) | A Method and a Kit for Discriminating Between Oreorchis patens and Oreorchis coreana | |
| KR100874378B1 (en) | Method for identifying hanwoo meat by using single nucleotide polymorphisms | |
| JP2003159100A (en) | Method for detecting mutation of improved gene | |
| JP2004344065A (en) | Oligonucleotide and method for detecting mycobacterium tuberculosis group using the same | |
| CN110452894B (en) | High-temperature-resistant II-type restriction enzyme targeting AGCT (accelerated glycation-associated computed tomography) site and application thereof | |
| KR101955073B1 (en) | Snp markers for discrimination of raphanus sativus | |
| US20110076689A1 (en) | PRIMER FOR DETECTING TYROSINASE mRNA | |
| US20020098487A1 (en) | Materials and methods for detecting fungi | |
| CN107250357A (en) | The sick repellence associated flag thing of the powdery mildew of strawberry plants and its utilization | |
| JP2006158220A (en) | Oligonucleotide primer for detecting mycoplasma pneumoniae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| N231 | Notification of change of applicant | ||
| E701 | Decision to grant or registration of patent right | ||
| FPAY | Annual fee payment |
Payment date: 20180226 Year of fee payment: 4 |
|
| FPAY | Annual fee payment |
Payment date: 20190401 Year of fee payment: 5 |