KR20140086742A - COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES COMPRISING SIRNA AGAINST HIF-1α AS AN ESSENTIAL COMPONENT - Google Patents

COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES COMPRISING SIRNA AGAINST HIF-1α AS AN ESSENTIAL COMPONENT Download PDF

Info

Publication number
KR20140086742A
KR20140086742A KR1020120157584A KR20120157584A KR20140086742A KR 20140086742 A KR20140086742 A KR 20140086742A KR 1020120157584 A KR1020120157584 A KR 1020120157584A KR 20120157584 A KR20120157584 A KR 20120157584A KR 20140086742 A KR20140086742 A KR 20140086742A
Authority
KR
South Korea
Prior art keywords
hif
tslp
expression
leu
sirna
Prior art date
Application number
KR1020120157584A
Other languages
Korean (ko)
Other versions
KR101492435B1 (en
Inventor
손상욱
장연수
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Priority to KR20120157584A priority Critical patent/KR101492435B1/en
Publication of KR20140086742A publication Critical patent/KR20140086742A/en
Application granted granted Critical
Publication of KR101492435B1 publication Critical patent/KR101492435B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/44—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material not provided for elsewhere, e.g. haptens, metals, DNA, RNA, amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2857—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against nuclear receptors, e.g. retinoic acid receptor [RAR], RXR, orphan receptor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/20—Dermatological disorders
    • G01N2800/202—Dermatitis

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • High Energy & Nuclear Physics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dermatology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a composition for preventing or treating diseases intermediated by thymic stromal lymphopoietin (TSLP) which contains an antibody, which specifically bonds to siRNA, antisense, shRNA, or HIF-1α of an HIF-1α gene, as an active ingredient. According to the present invention, a novel signal path which is an HIF-1α-dependent TSLP expression caused by the activation of JNK/ERK is blocked so that TSLP-mediated inflammatory diseases or allergic diseases can be effectively prevented or treated.

Description

ＨＩＦ­１α ｓｉＲＮＡ를 유효성분으로 함유하는 ＴＳＬＰ에 의해 매개되는 질환 예방 또는 치료용 약제학적 조성물{COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES COMPRISING siRNA AGAINST HIF-1α AS AN ESSENTIAL COMPONENT}TECHNICAL FIELD The present invention relates to a pharmaceutical composition for preventing or treating diseases mediated by TSLP containing HIF1? SiRNA as an active ingredient. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a pharmaceutical composition for preventing or treating diseases mediated by TSLP,

본 발명은 HIF-1α siRNA를 유효성분으로 함유하는 흉선 기질 림포포이에틴 (Thymic stromal lymphopoietin, TSLP)에 의해 매개되는 질환 예방 또는 치료용 약제학적 조성물에 관한 것이다. 더욱 상세하게, 본 발명은 HIF-1α가 TSLP 단백질 발현을 조절하는 인자임을 확인하고 HIF-1α 유전자를 표적화하는 작은간섭 RNA(siRNA)을 함유하는, TSLP에 의해 매개되는 염증질환 또는 알레르기질환을 예방 또는 치료할 수 있는 약제학적 조성물에 관한 것이다.
The present invention relates to a pharmaceutical composition for preventing or treating diseases mediated by thymic stromal lymphopoietin (TSLP) containing HIF-1α siRNA as an active ingredient. More specifically, the present invention relates to a method for preventing or ameliorating an inflammatory disease or an allergic disease mediated by TSLP, comprising a small interfering RNA (siRNA) targeting HIF-1α gene, confirming that HIF-1α is a factor controlling TSLP protein expression Or < / RTI >

최근 오존층의 손상과 기후변화로 인해 자외선에 대한 경각심이 더욱 증가되고 있는 추세이다. 자외선은 태양으로부터 방출되는 전자기파 스펙트럼에서 보이지 않는 영역으로 파장에 따라 A, B 그리고 C로 구별된다. 이중 파장이 가장 짧은 C는 오존층에서 흡수되며, A와 B는 각 320∼400, 280∼320nm 파장대로 대기층을 투과하여 지구상의 생명체에 영향을 미친다. Recently, there has been a growing awareness of ultraviolet rays due to damage to the ozone layer and climate change. Ultraviolet rays are distinguished from A, B and C according to their wavelengths by the invisible region in the electromagnetic wave spectrum emitted from the sun. C, which has the shortest double wavelength, is absorbed in the ozone layer, and A and B penetrate the atmosphere layer at wavelengths of 320 to 400 and 280 to 320 nm, respectively, and affect life on the earth.

사람의 피부는 지속적으로 자외선에 노출이 되기 때문에 자외선은 환경적 요소로써 위험성이 더욱 부각되고 있다. 피부는 이러한 외부의 유해한 요소들로부터 신체를 보호하는 첫 번째 방어벽 역할을 한다 (비특허문헌 1). 그렇기 때문에 피부각질세포는 면역세포로써의 기능을 갖는다. 따라서, 알레르겐 (allergen)의 접촉과 자외선 노출과 같은 외부 유해요소부터 유도되는 세포내 반응을 조절하고 개시함에 있어서 피부각질세포의 중요성은 더욱 높이 평가되고 있다. 자외선은 피부 세포에서 DNA의 화학적 구조의 변화와 산화적 스트레스를 일으키며 (비특허문헌 2,3), 세포손상을 비롯해 피부노화 (비특허문헌 4)와 피부암 (비특허문헌 5)을 일으키는 주범으로 많은 연구가 진행되어왔다. 특히, 자외선으로부터 유도된 다양한 사이토카인 (cytokine)들은 세포내 면역학적으로 염증성 반응을 일으키는 주된 매개체로써 피부에 그 이상의 손상을 초래한다 (비특허문헌 6). Since human skin is continuously exposed to ultraviolet rays, ultraviolet rays are more and more dangerous as an environmental factor. Skin acts as the first barrier to protect the body from these external harmful factors (Non-Patent Document 1). Therefore, keratinocytes function as immune cells. Thus, the importance of keratinocytes in regulating and initiating intracellular responses derived from external harmful factors such as allergen contact and ultraviolet exposure has been appreciated. Ultraviolet rays cause changes in the chemical structure of DNA and oxidative stress in skin cells (Non-Patent Documents 2 and 3), leading to cell damage, skin aging (non-patent document 4) and skin cancer (non-patent document 5) Many studies have been conducted. In particular, various cytokines derived from ultraviolet light cause further damage to the skin as the main mediator of the intracellular immunological inflammatory response (Non-Patent Document 6).

흉선 기질 림포포이에틴 (Thymic stromal lymphopoietin, TSLP)은 DC cell을 활성화 (activation) 시킴으로써 (비특허문헌 7) Th2 면역 반응 (Th2 immune response)을 야기하는 초기에 반응하는 사이토카인이다. TSLP는 면역에 관련된 질병에서 두드러지게 발현되어서 면역세포를 이용한 연구가 많이 진행되었고 (비특허문헌 8), 면역성 질병의 진행과 발달에 중요한 역할을 한다는 내용이 밝혀졌다 (비특허문헌 10). 게다가, 최근에는 암 (cancer) 진행에도 중요한 연관성이 있다는 연구결과들이 보고된바 있다 (비특허문헌 11). 일부 연구에선 각질세포에서 TSLP 발현에 관한 연구로는 TLRs 리간드 (TLRs ligand)나 바이러스성 감염과 같은 외부 알레르겐 (allergen)들이 TLR 경로를 통해서 TSLP를 유도함이 알려져 있고, 인간 기도 상피 세포주 (human airway epithelial cell line), BEAS-2B에서는 파파인 (papain)이 부분적으로 PAR-2 경로를 통해 TSLP의 발현을 증가시킨다는 연구가 보고되었지만 (비특허문헌 12), TSLP의 분비의 활성을 유도하는 인자는 아직 명백히 밝혀지지 않았다. 알레르기 질환 (allergic disease)의 발병과 TSLP에 의해 매개되는 질병의 치료와 예방을 위해서는 TSLP의 발현에 관한 조절인자를 찾는 것은 매우 중요하다고 할 것이다. 또한 자외선은 피부에 지속적 자극을 줄 수 있는 자연적 요소로써 세포내 많은 신호전달 분자들을 교란시키고 다양한 Th1 type의 사이토카인을 유도한다고 알려져 있으나, Th2 type의 사이토카인인 TSLP의 발현과의 관계는 알려진 바가 없다.
Thymic stromal lymphopoietin (TSLP) is an early-responding cytokine that induces a Th2 immune response by activating DC cells (Non-Patent Document 7). TSLP has been remarkably expressed in immune-related diseases and has been studied extensively in immune cells (Non-Patent Document 8) and has been found to play an important role in the progression and development of immune diseases (Non-Patent Document 10). In addition, studies have recently been reported that there is a significant association with cancer progression (Non-Patent Document 11). In some studies, studies on TSLP expression in keratinocytes have shown that external allergens, such as TLRs ligands or viral infections, induce TSLP through the TLR pathway, and human airway epithelial cells cell line. In BEAS-2B, papain partially increases the expression of TSLP through the PAR-2 pathway (Non-Patent Document 12). However, factors that induce the activity of TSLP secretion have not yet been clarified It was not revealed. Finding a regulator of TSLP expression is very important for the treatment and prevention of allergic disease and diseases mediated by TSLP. In addition, ultraviolet light is known to induce various Th1-type cytokines and disturb many signaling molecules in the cell as a natural factor that can continuously stimulate the skin. However, the relationship with the expression of TSLP, a Th2 type cytokine, none.

본 발명의 배경이 되는 기술로, 대한민국 등록특허 제10-1114506호 (2012.03.14)에 빈랑 열수 추출물 및 정향수피 열수 추출물을 유효성분으로 함유하는 TSLP 저해능에 의한 아토피 피부염 개선능을 가지는 한방 조성물이 기재되어 있고, 대한민국 공개특허 제10-2012-0081936호 (2012.07.20)에 Hif1a의 발현을 저해하는 siRNA 및 이를 포함하는 항암 조성물에 대해 기재되어 있다. 그러나, HIF-1α에 의한 TSLP 발현 조절 및 이를 이용한 아토피와 같은 피부염증질환을 포함한 TSLP에 의해 매개되는 질환 치료제에 대해서는 알려진 바가 없다.
As a background of the present invention, Korean Patent No. 10-1114506 (Mar. 14, 2012) discloses a herbal composition having an ability to ameliorate atopic dermatitis by inhibiting TSLP, , And Korean Patent Laid-Open No. 10-2012-0081936 (Jul. 20, 2012) describes an siRNA which inhibits the expression of Hif1a and an anticancer composition containing the same. However, there is no known therapeutic agent for diseases mediated by TSLP, including skin inflammatory diseases such as atopy, which are regulated by TSHP expression by HIF-1α.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

대한민국 등록특허 제10-1114506호 (2012.03.14)Korean Patent No. 10-1114506 (2012.03.14) 대한민국 공개특허 제10-2012-0081936호 (2012.07.20)Korean Patent Publication No. 10-2012-0081936 (July 20, 2012)

Nickoloff BJ, Naidu Y, Perturbation of epidermal barrier function correlates with initiation of cytokine cascade in human skin. (1994)J Am Acad Dermatol 30:535-46. Nickoloff BJ, Naidu Y, Perturbation of epidermal barrier function correlates with initiation of cytokine cascade in human skin. (1994) J Am Acad Dermatol 30: 535-46. Gilchrest and yaar, Ageing and photoageing of the skin: observations at the cellular and molecular level.(1992) 41:25-30Gilchrest and yaar, Aging and photoaging of the skin: observations at the cellular and molecular level. (1992) 41: 25-30 Scharffetter-kochanek et al.,UV-induced reactive oxygen species in photo carcinogenesis and photoagingBiol Chem. (1997) Nov;378(11):1247-57.Scharffetter-kochanek et al., UV-induced reactive oxygen species in photochromicogenesis and photoaging Biol Chem. (1997) Nov; 378 (11): 1247-57. Fisher GJ, Kang S, Vanrani J et al.,Mechanisms of photoaging and chronological skin aging. (2002) Arch Dermatol 138:1462-70Fisher GJ, Kang S, Vanrani J et al., Mechanisms of photoaging and chronological skin aging. (2002) Arch Dermatol 138: 1462-70 G.J. Fisher, S.C. Datta, H.S. Talwar, Z.Q. Wang, J. Varani, S. Kang, J.J. Voorhees, Molecular basis of sun-induced premature skin ageing and retinoid antagonism, Nature 379 (1996) 335-339.G.J. Fisher, S.C. Datta, H. S. Talwar, Z.Q. Wang, J. Varani, S. Kang, J.J. Voorhees, Molecular basis of sun-induced premature skin aging and retinoid antagonism, Nature 379 (1996) 335-339. Seiji Kondo, Takeshi Kono et al., IL-8 gene expression and production in human keratinocytes and their modulation by UVB.( 1993) J Invest Dermatol 101:690-694.Seiji Kondo, Takeshi Kono et al., IL-8 gene expression and production in human keratinocytes and their modulation by UVB (1993) J Invest Dermatol 101: 690-694. V. Soumelis, P.A. Reche, H. Kanzler, W. Yuan, G. Edward, B. Homey, M. Gilliet, S. Ho, S. Antonenko, A. Lauerma, K. Smith, D. Gorman, S. Zurawski, J. Abrams, S. Menon, T. McClanahan, R. de Waal-Malefyt Rd, F. Bazan, R.A. Kastelein, Y.J. Liu, Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP, Nat Immunol 3 (2002) 673-680.V. Soumelis, P.A. S. Lauerma, K. Smith, D. Gorman, S. Zurawski, J. Abrams, S. Kennedy, M. Gilliet, S. Ho, S. Antonenko, S. Menon, T. McClanahan, R. de Waal-Malefyt Rd, F. Bazan, RA Go ahead, Y.J. Liu, Human epithelial cells triggered dendritic cell mediated allergic inflammation by producing TSLP, Nat Immunol 3 (2002) 673-680. J.N. Barker, R.S. Mitra, C.E. Griffiths, V.M. Dixit, B.J. Nickoloff, Keratinocytes as initiators of inflammation, Lancet 337 (1991) 211-214.J.N. Barker, R.S. Mitra, C.E. Griffiths, V.M. Dixit, B.J. Nickoloff, Keratinocytes as initiators of inflammation, Lancet 337 (1991) 211-214. Y.J. Liu, Thymic stromal lymphopoietin: master switch for allergic inflammation, J Exp Med 203 (2006) 269-273.Y.J. Liu, Thymic stromal lymphopoietin: master switch for allergic inflammation, J Exp Med 203 (2006) 269-273. Y.H. Wang, Y.J. Liu, Thymic stromal lymphopoietin, OX40-ligand, and interleukin-25 in allergic responses, Clin Exp Allergy 39 (2009) 798-806.Y.H. Wang, Y.J. Liu, Thymic stromal lymphopoietin, OX40-ligand, and interleukin-25 in allergic responses, Clin Exp Allergy 39 (2009) 798-806. Purevdorj B. Olkhanud, Yrina Rochman et al., Thymic stromal lymphopoietin is a key mediator of breast cancer progression.(2011) 186:5656-5662.Purevdorj B. Olkhanud, Yrina Rochman et al., Thymic stromal lymphopoietin is a key mediator of breast cancer progression. (2011) 186: 5656-5662. Hideaki Kouzaki, Scott M O'Grady,et al., Proteases induce production of thymic stromal lymphopoietin by airway epithelial cells through protease-activated receptor-2.The Journal of Immunology (2009) 183:2: 1427-1434.Hideaki Kouzaki, Scott M O'Grady, et al., Proteases induce production of thymic stromal lymphopoietin by airway epithelial cells through protease-activated receptor-2.The Journal of Immunology (2009) 183: 2: 1427-1434. Briot A, Lacroix M, Robin A, Steinhoff M, Deraison C, Hovnanian A Par2 inactivation inhibits early production of TSLP, but not cutaneous inflammation, in Netherton syndrome adult mouse model.J Invest Dermatol. 2010 Dec;130(12):2736-42. Briota, Lacroix M, Robin A, Steinhoff M, Deraison C, Hovnanian A Par2 inactivation inhibits early production of TSLP, but not cutaneous inflammation, in adult mouse model N. Invest Dermatol. Dec 2010; 130 (12): 2736-42. Rezvani HR, Dedieu S, North S, Belloc F, Rossignol R, Letellier T, de Verneuil H, TaA, Mazurier F. Hypoxia-inducible factor-1alpha, a key factor in the keratinocyte response to UVB exposure.J Biol Chem. 2007 Jun 1;282(22):16413-22Rezvani HR, Dedieu S, North S, Belloc F, Rossignol R, Letellier T, de Verneuil H, TaA, Mazurier F. Hypoxia-inducible factor-1alpha, a key factor in the keratinocyte response to UVB exposure. J Biol Chem. 2007 Jun 1; 282 (22): 16413-22 DMA, Michaud MD, Richard DE. Hypoxia-inducible factor 1: regulation by hypoxic and non-hypoxic activators.Int J Biochem Cell Biol. 2005 Mar;37(3):535-40. ReviewDMA, Michaud MD, Richard DE. Hypoxia-inducible factor 1: regulation by hypoxic and non-hypoxic activators. Int J Biochem Cell Biol. 2005 Mar; 37 (3): 535-40. Review

본 발명은 상기 종래 기술의 문제점 등을 해결하기 위한 것으로, 본 발명자들은 피부각질세포를 이용하여 자외선에 의해 TSLP의 발현 양상을 평가하고 TSLP 프로모터 분석을 통해 TSLP의 발현을 증가시키는 전사조절인자를 선별하고 그에 따른 세포내 신호전달경로를 밝혀내고자 하였다.DISCLOSURE OF THE INVENTION The present invention has been made to solve the problems of the prior art described above. The present inventors evaluated the expression pattern of TSLP by ultraviolet rays using keratinocytes and selected transcription regulatory factors that increase the expression of TSLP through TSLP promoter analysis And to elucidate intracellular signal transduction pathways.

그 결과 본 발명자는 HIF-1α가 TSLP 프로모터에 결합하여 UVB에 의한 TSLP 발현을 조절하는 것을 확인하였고, JNK/ERK의 활성화로 인한 HIF-1α 의존적 TSLP 발현이라는 신호전달 경로를 규명하였고, 이러한 신호전달 기전이 UVB에 의한 피부염증반응에 중요한 기전 중 하나임을 밝혀내었다. As a result, the present inventors confirmed that HIF-1α binds to the TSLP promoter and regulates TSLP expression by UVB, and signal transduction pathway of HIF-1α-dependent TSLP expression due to activation of JNK / ERK was identified. And that the mechanism is one of the important mechanisms for skin inflammation response by UVB.

따라서, 본 발명은 JNK/ERK의 활성화로 인한 HIF-1α 의존적 TSLP 발현을 억제할 수 있는 HIF-1α의 발현을 저해하는 siRNA, 또는 항체를 포함하는 TSLP 매개되는 질환 예방 또는 치료용 약제학적 조성물을 제공하는 것을 목적으로 한다. Accordingly, the present invention provides a pharmaceutical composition for preventing or treating diseases mediated by TSLP, which comprises an siRNA or an antibody that inhibits expression of HIF-1? Capable of inhibiting HIF-1? -Independent TSLP expression due to activation of JNK / ERK The purpose is to provide.

본 발명의 다른 목적은 상기의 신호전달 활성화로 인해 유도되는 피부염증반응을 억제하는, 아토피를 포함하는 피부염증질환 예방 또는 치료용 약제학적 조성물을 제공하는 것을 목적으로 한다. It is another object of the present invention to provide a pharmaceutical composition for preventing or treating skin inflammation diseases, including atopy, which inhibits the skin inflammatory reaction induced by the signal transduction activation.

본 발명의 또 다른 목적은 새로운 TSLP 조절제로 선별된 HIF-1α 발현 증가를 계측함으로써 자외선에 의한 피부 염증성질환 진단용 키트를 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a kit for diagnosing skin inflammatory disease caused by ultraviolet rays by measuring the increase in expression of HIF-1α selected by a new TSLP regulator.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 더욱 명확하게 된다.
Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

본 발명의 일 양태에 의하면, 본 발명은 HIF-1α 유전자의 siRNA, 안티센스, shRNA, 또는 HIF-1α에 특이적으로 결합하는 항체를 유효성분으로 함유하는 흉선 기질 림포포이에틴 (Thymic stromal lymphopoietin, TSLP)에 의해 매개되는 질환 예방 또는 치료용 약제학적 조성물을 제공한다.According to one aspect of the present invention, there is provided a method for producing a thymic stromal lymphopoietin (HIF-1α) comprising an antibody that specifically binds to siRNA, antisense, shRNA, or HIF- Lt; RTI ID = 0.0 > (TSLP). ≪ / RTI >

본 발명의 다른 양태에 의하면, 본 발명은 JNK 억제제, ERK 억제제 또는 p38 억제제를 유효성분으로 함유하는 흉선 기질 림포포이에틴 (Thymic stromal lymphopoietin, TSLP)에 의해 매개되는 질환 예방 또는 치료용 약제학적 조성물을 제공한다.According to another aspect of the present invention, there is provided a pharmaceutical composition for preventing or treating diseases mediated by Thymic stromal lymphopoietin (TSLP), which comprises a JNK inhibitor, an ERK inhibitor or a p38 inhibitor as an active ingredient .

본 발명의 또 다른 양태에 의하면, 본 발명은 (i) HIF-1α 유전자의 뉴클레오타이드 서열, (ii) 상기 뉴클레오타이드의 단편, (iii) 상기 뉴클레오타이드 서열 또는 그 단편에 상보적인 서열, (iv) HIF-1α 유전자로부터 발현되는 단백질, 또는 (v) 그 단백질에 특이적인 결합제를 포함하는 것을 특징으로 하는 자외선에 의한 피부 염증성질환 진단용 키트를 제공한다.According to another aspect of the present invention, there is provided a method for producing a HIF-1 alpha gene, comprising: (i) a nucleotide sequence of a HIF-1 alpha gene; (ii) a fragment of the nucleotide; (iii) a sequence complementary to the nucleotide sequence or a fragment thereof; 1 alpha gene, or (v) a binding agent specific to the protein. The present invention also provides a kit for diagnosing skin inflammatory disease caused by ultraviolet radiation.

본 발명의 또 다른 양태에 의하면, 본 발명은 1) HIF-1a의 전사 조절에 관여하는 전사인자를 찾는 단계; 2) 상기 전사인자를 조절하는 물질을 선발(screening)하는 단계; 및 3) 상기 물질이 HIF-1a 유전자의 발현을 조절하는 활성을 나타내는지를 결정하는 단계를 포함하는 TSLP 매개되는 질환 치료제 스크리닝 방법을 제공한다.
According to another aspect of the present invention, the present invention provides a method for the treatment of HIF-1α, comprising: 1) searching for a transcription factor involved in transcriptional regulation of HIF-1a; 2) screening the substance that modulates the transcription factor; And 3) determining whether the substance exhibits an activity of regulating the expression of the HIF-1a gene. The present invention also provides a method for screening a TSLP mediated disease therapeutic agent.

이하, 본 발명에 대해서 상세하게 설명한다. Hereinafter, the present invention will be described in detail.

본 발명은 HIF-1α 유전자의 siRNA, 안티센스, shRNA, 또는 HIF-1α에 특이적으로 결합하는 항체를 유효성분으로 함유하는 흉선 기질 림포포이에틴 (Thymic stromal lymphopoietin, TSLP)에 의해 매개되는 질환 예방 또는 치료용 약제학적 조성물을 제공한다.The present invention relates to a method for preventing disease mediated by Thymic stromal lymphopoietin (TSLP), which comprises an siRNA, antisense, shRNA, or an antibody specifically binding to HIF-1α of the HIF-1α gene as an active ingredient Or a pharmaceutical composition for therapeutic use.

본 발명에서 용어 "siRNA”는 RNA 방해 또는 유전자 사일런싱을 매개할 수 있는 핵산 분자를 의미한다(참조: WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99/07409 및 WO 00/44914). siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운 방법으로서 또는 유전자치료 방법으로 제공된다. siRNA는 식물, 벌레, 초파리 및 기생충에서 처음으로 발견되었으나, 최근에 siRNA를 개발/이용하여 포유류 세포 연구에 응용되었다(Degot S, et al. 2002; Degot S, et al. 2004; Ballut L, et al. 2005).The term "siRNA " in the present invention means a nucleic acid molecule capable of mediating RNA interference or gene silencing (see WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99 / 07409 and WO 00/44914) siRNA is provided as an efficient gene knockdown method or as a gene therapy method because it can inhibit the expression of a target gene. SiRNA was first found in plants, insects, fruit flies and parasites, (Degot S, et al., 2004; Ballut L, et al., 2005).

본 발명에서 제시하는 siRNA는 표적 유전자의 mRNA 절단을 통해 RNA 간섭 현상을 유도하는 이중사슬 RNA를 의미하며, 표적 유전자의 mRNA와 같은 서열을 가지는 센스서열의 RNA 가닥과 이와 상보적인 서열을 가지는 안티센스 서열의 RNA 가닥으로 구성될 수 있다. The siRNA proposed in the present invention refers to double-stranded RNA which induces RNA interference phenomenon through mRNA cleavage of a target gene. The siRNA has an antisense sequence having a sequence complementary to the RNA strand of the sense sequence having the same sequence as the mRNA of the target gene ≪ / RTI >

바람직하게, 본 발명에서 제공하는 HIF-1α 작은간섭 RNA(siRNA)는 이중가닥 siRNA로서 HIF-1α의 상보적인 mRNA에 결합하여 발현을 억제하는 것이다. HIF-1α 유전자는 TSLP 발현을 증가시키는 전사인자로서 HIF-1α 작은간섭 RNA(siRNA)에 의해 TSLP로 매개되는 질환 치료효과를 증진시키는 화학적 조성물로서 제공된다. Preferably, the HIF-1α small interfering RNA (siRNA) provided in the present invention binds to complementary mRNA of HIF-1α as a double-stranded siRNA to inhibit expression. The HIF-1? Gene is provided as a chemical composition that enhances the therapeutic effect of TSLP mediated disease by HIF-1? Small interfering RNA (siRNA) as a transcription factor that increases TSLP expression.

본 발명의 siRNA의 경우 생체내 핵산 분해효소에 의한 기능상실을 막기 위해 화학적으로 변형된 siRNA를 포함하는 것으로 해석된다. In the case of the siRNA of the present invention, it is interpreted that siRNA is chemically modified to prevent the loss of function due to the nucleic acid degrading enzyme in vivo.

본 발명에 있어서, 상기 HIF-1α 유전자는 이에 한정되는 것은 아니나, 진 뱅크 등록번호 NM_001530(서열번호 1 및 서열번호 2) 및 진 뱅크 등록번호 NM_024359를 이용할 수 있다. In the present invention, the HIF-1 alpha gene includes, but is not limited to, Bank registration number NM_001530 (SEQ ID NO: 1 and SEQ ID NO: 2) and Gene Bank registration number NM_024359 can be used.

또한, 다른 구현 예에 따르면, 본 발명의 siRNA 분자는, 자기-상보성(self-complementary) 센스 및 안티센스 가닥을 가지는 단일쇄 구조를 가질 수 있다. siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 전체 길이는 10 내지 100 염기, 바람직하게는 15 내지 80 염기, 더욱 바람직하게는 20 내지 30 염기이다.Also, according to another embodiment, the siRNA molecules of the invention may have a single stranded structure with self-complementary sense and antisense strands. The siRNA is not limited to a complete pair of double-stranded RNA portions that are paired with each other, but is paired by a mismatch (the corresponding base is not complementary), a bulge (no base corresponding to one chain) May be included. The total length is 10 to 100 bases, preferably 15 to 80 bases, more preferably 20 to 30 bases.

siRNA 말단 구조는 HIF-1α 유전자 등의 발현을 RNAi(RNA interference) 효과에 의하여 억제할 수 있는 것이면 평활(blunt) 말단 혹은 점착(cohesive) 말단 모두 가능하다. 점착 말단 구조는 3'-말단 돌출 구조와 5'-말단 돌출 구조 모두 가능하다.The siRNA terminal structure is capable of blunt or cohesive termini as long as it can inhibit the expression of HIF-1α gene by RNA interference (RNA interference) effect. The sticky end structure can be a 3'-end protruding structure and a 5'-end protruding structure.

본 발명의 siRNA 분자는, 자기-상보성 센스 및 안티센스 가닥 사이에 짧은 뉴클레오타이드 서열(예컨대, 약 5-15 nt)이 삽입된 형태를 가질 수 있으며, 이 경우 뉴클레오타이드 서열의 발현에 의해 형성된 siRNA 분자는 분자내 혼성화에 의하여 헤어핀 구조를 형성하게 되며, 전체적으로는 스템-앤드-루프 구조를 형성하게 된다. 이스템-앤드-루프 구조는 인 비트로 또는 인 비보에서 프로세싱되어 RNAi를 매개할 수 있는 활성의 siRNA 분자를 생성한다.
SiRNA molecules of the present invention may have a form in which a short nucleotide sequence (e.g., about 5-15 nt) is inserted between the self-complementary sense and antisense strands, wherein the siRNA molecule formed by the expression of the nucleotide sequence is a molecule The hairpin structure is formed by hybridization, and the stem-and-loop structure as a whole is formed. The template-and-loop structure is processed in vitro or in vivo to produce siRNA molecules that are capable of mediating RNAi.

본 발명의 바람직한 구현 예에 따르면, 본 발명은 상기 siRNA은 서열번호 3의 염기서열을 갖는다. 본 발명에 따르면, UVB가 조사된 HaCaT 세포주에서 HIF-1α-siRNA를 처리함에 따라 TSLP mRNA가 발현이 감소됨을 확인하였다 (도 7 참조).According to a preferred embodiment of the present invention, the siRNA of the present invention has the nucleotide sequence of SEQ ID NO: 3. According to the present invention, it was confirmed that the expression of TSLP mRNA was reduced by treating HIF-1α-siRNA in the UVB-irradiated HaCaT cell line (see FIG. 7).

또한, 본 발명의 siRNA는 재조합 바이러스 벡터로부터 세포내에서 발현될 수 있다. 본 발명의 재조합 바이러스 벡터는 본 발명의 siRNA을 암호화하는 서열 및 siRNA 서열을 발현하는데 적합한 임의의 프로모터를 포함한다. 적합한 프로모터에는, 예를 들어 U6 또는 H1 RNA pol III 프로모터 서열 및 사이토메갈로바이러스프로모터가 포함된다. 당 분야의 숙련가라면 다른 적합한 프로모터를 선택할 수 있을 것이다. 또한 본 발명의 재조합 바이러스 벡터는 특정 조직 또는 특정 세포내 환경에서 siRNA를 발현시키기 위한 유도성 또는 조절성 프로모터를 포함할 수 있다. In addition, the siRNA of the present invention can be expressed in cells from a recombinant viral vector. The recombinant viral vectors of the invention include sequences encoding the siRNA of the invention and any promoter suitable for expressing siRNA sequences. Suitable promoters include, for example, U6 or H1 RNA pol III promoter sequences and cytomegalovirus promoters. Those of skill in the art will be able to select other suitable promoters. The recombinant viral vectors of the invention may also include inducible or regulatable promoters for expressing siRNA in a particular tissue or particular intracellular environment.

발현될 siRNA 분자에 대한 암호화 서열을 수용할 수 있는 어떠한 바이러스 벡터도 사용할 수 있는데, 예를 들어 아데노바이러스(AV), 아데노바이러스-수반 바이러스(AAV), 레트로바이러스(예: 렌티바이러스(LV), 라브도바이러스, 쥐 백혈병바이러스), 헤르페스 바이러스 등으로부터 유래된 벡터가 있다. 또한, 바이러스 벡터의 친화성은, 다른 바이러스의 외피 단백질 또는 기타 표면 항원으로 벡터를 가성형태화시킴으로써 변형시킬 수 있다. 예를 들어, 본 발명의 AAV 벡터는 소수포구내염 바이러스(VSV), 광견병 바이러스, 에볼라 바이러스, 모콜라 바이러스 등의 표면 단백질로 가성형태화시킬 수 있다.Any viral vector capable of accepting the coding sequence for the siRNA molecule to be expressed can be used, for example, adenovirus (AV), adenovirus-associated virus (AAV), retrovirus (e.g., lentivirus (LV) Rabbit virus, murine leukemia virus), herpes virus, and the like. In addition, the affinity of the viral vector can be modified by pseudotyping the vector to the envelope protein or other surface antigen of another virus. For example, the AAV vector of the present invention can be phosporally formed into a surface protein such as a small intestinal stomatitis virus (VSV), a rabies virus, an Ebola virus, or a Mokola virus.

본 발명에 사용하기에 적합한 재조합 바이러스 벡터, siRNA을 발현시키기 위해 핵산 서열을 벡터에 삽입하는 방법 및 목적하는 세포에 바이러스 벡터를 전달하는 방법의 선택은 당분야의 숙련가에게 공지되어 있다. 예를 들어, 전문이 본원에서 참조문헌으로 인용되는 다음 문헌들을 참조한다[참조문헌: Dornburg R (1995), Gene Therap. 2: 301-310; Eglitis MA(1988), Biotechniques 6: 608-614; Miller AD (1990), Hum Gene Therap. 1: 5-14; and Anderson WF (1998Nature 392: 25-30] .Selection of a recombinant viral vector suitable for use in the present invention, a method for inserting a nucleic acid sequence into a vector to express the siRNA, and a method for delivering a viral vector to a desired cell is known to those skilled in the art. See, for example, the following references, which are incorporated herein by reference in their entirety: Dornburg R (1995), Gene Therap. 2: 301-310; Eglitis MA (1988), Biotechniques 6: 608-614; Miller AD (1990), Hum Gene Therap. 1: 5-14; and Anderson WF (1998 Nature 392: 25-30).

본 발명에 있어, 항체는 본원발명이 속하는 기술분야의 통상의 기술을 이용하여 당업자가 용이하게 제조할 수 있다. 본 발명의 항체는, 본 발명의 상기 단백질에 결합하는 한 특별히 제한은 없으며, 폴리클론 항체, 단일클론항체 외에 인간 항체, 유전자 재조합에 의한 인간화 항체, 또한 그 항체 단편이나 변형된 항체도 포함된다.
In the present invention, antibodies can be easily produced by those skilled in the art using conventional techniques in the art to which the present invention belongs. The antibody of the present invention is not particularly limited as long as it binds to the protein of the present invention. In addition to a polyclonal antibody and a monoclonal antibody, a human antibody, a humanized antibody by genetic recombination, and an antibody fragment or a modified antibody are also included.

본 발명에 있어, TSLP 매개되는 질환은 염증성질환, 알레르기질환, 또는 암으로 구성되는 군에서 선택되는 하나 이상일 수 있다. 이에 한정되는 것은 아니나,바람직하게 상기 질환은 자외선에 의한 피부 염증성질환 또는 아토피성 피부염일 수 있다.
In the present invention, the TSLP mediated diseases may be one or more selected from the group consisting of inflammatory diseases, allergic diseases, or cancers. Preferably, the disease is a skin inflammatory disease caused by ultraviolet light or an atopic dermatitis.

본 발명의 또 다른 양태에 의하면, 본 발명은 JNK 억제제, ERK 억제제 또는 p38 억제제를 함유하는 TSLP에 의해 매개되는 질환 예방 또는 치료용 약제학적 조성물을 제공한다. 이에 한정되는 것은 아니나, 본 발명에 있어 JNK 억제제는 SP600125이고, ERK 억제제는 U0126, 또는 PD-98059이고, p38 억제제는 SB239063일 수 있다.
According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating diseases mediated by TSLP containing a JNK inhibitor, an ERK inhibitor or a p38 inhibitor. The JNK inhibitor may be SP600125, the ERK inhibitor may be U0126, or PD-98059, and the p38 inhibitor may be SB239063.

본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함한다. 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.The pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 바람직하게는 비경구 투여이고, 비경구 투여인 경우에는 정맥내 주입, 피하 주입, 국소 주입, 근육 주입 등으로 투여할 수 있다.The pharmaceutical composition of the present invention can be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, local injection, muscle injection or the like.

본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 한편, 본 발명의 약제학적 조성물의 투여량은 바람직하게는 1일 당 0.0001-100 mg/kg(체중)이다.The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . On the other hand, the dosage of the pharmaceutical composition of the present invention is preferably 0.0001-100 mg / kg (body weight) per day.

본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

본 발명의 또 다른 양태에 의하면, 본 발명은 TSLP 프로모터에 결합하여 TSLP 발현을 조절하는 HIF-1α를 발굴하고, 이를 근거로 HIF-1α의 발현 증가를 TSLP로 매개되는 질환 진단용 키트 내지 DNA 칩, 단백질 칩 등에서의 소재로 이용될 수 있다.According to another aspect of the present invention, there is provided a method for detecting HIF-1α, which binds to a TSLP promoter and regulates TSLP expression, thereby increasing the expression of HIF-1α by a TSLP- Protein chips and the like.

바람직하게, 본 발명은 HIF-1α와 반응하는 하나 이상의 물질 및 반응 생성물 검출용 시약을 포함하는 피부 염증성질환 진단용 키트 및 진단방법을 제공한다. Preferably, the present invention provides a kit for the diagnosis of skin inflammatory diseases and a diagnostic method, comprising at least one substance which reacts with HIF-1 alpha and a reagent for detecting reaction products.

본 발명에 있어서, 예를 들어, HIF-1α와 반응하는 하나 이상의 물질은 HIF-1α의 RNA 또는 DNA에 상보적인 RNA 또는 DNA 및 HIF-1α 단백질에 결합하는 항체일 수 있고, 반응 생성물 검출용 시약은 핵산 또는 단백질 표지 및 발색시약일 수 있다.In the present invention, for example, one or more substances which react with HIF-1 alpha may be an antibody binding to RNA or DNA complementary to HIF-1 alpha RNA or DNA and an HIF-1 alpha protein, May be nucleic acid or protein labeling and chromogenic reagents.

보다 구체적으로, 본 발명에 의한 진단용 키트 또는 진단 마커를 검출하는 방법은 HIF-1α 유전자나 그의 단편 또는 그의 상보적인 서열과 대상체로부터 얻은 시료 간의 반응을 확인하여 진단하는 원리를 이용한다. 상기 HIF-1α 유전자 등과 대상체로부터 얻은 시료 간의 반응의 확인은 DNA-DNA, DNA-RNA, DNA-단백질 간의 반응 여부를 확인하는데 사용되는 통상적인 방법들, 예컨대 DNA 칩, 단백질 칩, 중합효소 연쇄반응(PCR), 노던 블롯팅, 서던 블롯팅, ELISA(Enzyme Linked Immunosorbent assay), 효모 이중 혼성법(yeast two-hybrid), 2-D 겔 분석 및 시험관 내 결합 에세이(in vitro binding assay) 등을 이용할 수 있다. 즉 상기 유전자의 전부 또는 일부를 프로브로 사용하여 대상자의 체액으로부터 분리한 핵산과 하이브리드화한 후 당 분야에 공지된 다양한 방법, 예컨대 역전사 중합효소 연쇄반응(reverse transcription polymerase chain reaction), 써던블로팅(Southern blotting), 노던 블롯팅(Northern blooting) 등으로 이를 검출함으로써 대상자에서 상기 유전자가 고발현된 상태인지 또는 저발현된 상태인지 조사하면 TSLP 매개되는 질환 발생 여부를 판단할 수 있다.
More specifically, the method for detecting a diagnostic kit or diagnostic marker according to the present invention uses a principle of detecting and diagnosing a reaction between a HIF-1? Gene or a fragment thereof or a complementary sequence thereof and a sample obtained from a subject. Confirmation of the reaction between the HIF-1 alpha gene and the sample obtained from the subject can be carried out by a conventional method used for confirming the reaction between DNA-DNA, DNA-RNA, and DNA-protein such as DNA chip, protein chip, (PCR), northern blotting, Southern blotting, ELISA (enzyme linked immunosorbent assay), yeast two-hybrid, 2-D gel analysis and in vitro binding assay . That is, all or a part of the gene may be used as a probe and hybridized with a nucleic acid separated from a body fluid of a subject. Thereafter, various methods known in the art such as reverse transcription polymerase chain reaction, Southern blotting Southern blotting, northern blotting, or the like to determine whether the gene is highly expressed or underexpressed in the subject.

본 발명의 또 다른 양태에 의하면, 본 발명은 HIF-1α 유전자를 포함하는 TSLP 매개되는 질환 치료제 스크리닝용 조성물 및 스크리닝 방법을 제공한다.According to still another aspect of the present invention, there is provided a screening composition and screening method for screening a TSLP mediated disease comprising the HIF-1α gene.

본 발명은 TSLP 매개되는 질환에서 관찰되는 HIF-1α를 발굴하고, 이를 근거로 HIF-1α의 발현 증가를 확인하여 TSLP 매개되는 질환 치료제 스크리닝에 이용할 수 있다.The present invention can be used for the screening of a therapeutic agent for TSLP-mediated diseases by identifying HIF-1α which is observed in TSLP-mediated diseases and confirming an increase in expression of HIF-1α based thereon.

보다 스크리닝 방법은 구체적으로, 1) HIF-1α의 전사 조절에 관여하는 전사인자를 찾는 단계; 2) 상기 전사인자를 조절하는 물질을 선발(screening)하는 단계; 및 3) 상기 물질이 HIF-1α 유전자의 발현을 조절하는 활성을 나타내는지를 결정하는 단계로 구성된 HIF-1α 활성 조절제(활성 억제제 혹은 증가제)를 스크리닝하는 방법을 제공한다. 상기 스크리닝 방법에서 HIF-1α 활성 조절 후보물질이 HIF-1α 유전자의 발현 또는 단백질 활성을 억제 혹은 증가하는지를 결정하는 단계에서 RNA-RNA, DNA-DNA, DNA-RNA, RNA-단백질, RNA-화합물, DNA-단백질, DNA-화합물, 단백질-단백질 또는 단백질-화합물 간의 반응 여부를 확인하는데 사용되는 통상적인 방법들을 사용할 수 있다.
Specifically, the screening method comprises: 1) searching for a transcription factor involved in transcriptional regulation of HIF-1?; 2) screening the substance that modulates the transcription factor; And 3) determining whether the substance exhibits an activity of regulating the expression of the HIF-1 alpha gene. The present invention also provides a method of screening for HIF-1 alpha activity modulator (activity inhibitor or enhancer). DNA-DNA, DNA-RNA, RNA-protein, RNA-compound, and the like in the step of determining whether the HIF-1α activity-regulating candidate substance inhibits or increases the expression or protein activity of the HIF- DNA-protein, DNA-compound, protein-protein or protein-compound.

상술한 바와 같이, 본 발명에 의하면 JNK/ERK의 활성화로 인한 HIF-1α 의존적 TSLP 발현이라는 새로운 신호경로를 차단할 수 있는 HIF-1α의 발현을 저해하는 siRNA, 또는 항체를 이용하여 TSLP 매개되는 질환을 효과적으로 예방 또는 치료할 수 있다. 특히, 자외선에 의한 피부 염증성 질환 및 난치성 질환인 아토피성 피부염을 효과적으로 치료할 수 있다. As described above, according to the present invention, an siRNA that inhibits the expression of HIF-1α, which can block a new signal pathway of HIF-1α-dependent TSLP expression due to activation of JNK / ERK, or a TSLP- Can be effectively prevented or treated. In particular, skin inflammatory diseases caused by ultraviolet rays and atopic dermatitis which is a refractory disease can be effectively treated.

나아가, 본 발명에 의하면, TSLP에 의해 매개되는 질환의 진단에 상기 신호 전달에 중심에 있는 HIF-1α를 진단 마커로 사용할 수 있다.
Furthermore, according to the present invention, HIF-1 alpha, which is central to the signal transduction, can be used as a diagnostic marker in the diagnosis of diseases mediated by TSLP.

도 1은 3차원 인공 피부 모델을 나타낸 도면이다.
도 2는 인간 유래 각질세포에서의 자외선에 의한 TSLP 발현 유도를 보인 도면이다.
도 3은 인간 3차원 피부모델에서의 자외선에 의한 TSLP 발현 유도를 보인 도면이다.
도 4는 인간 유래 각질세포에서 자외선에 의한 HIF-1α 발현을 확인한 결과를 보여주는 도면이다.
도 5는 인간 유래 각질 세포에서 JNK 와 Erk 1/2의 인산화(phosphorylation)가 UVB 조사에 의한 HIF-1α 발현을 매개하는 것을 보여주는 도면이다.
도 6은 HIF-1α 결합부위를 포함하는 TSLP 프로모터의 개략적 도면이다.
도 7은 인간 유래 각질 세포에서 HIF-1α에 의한 TSLP 발현 조절을 보여주는 도면이다.
도 8은 인간 유래 각질 세포에서 HIF-1α가 TSLP 프로모터에 결합하여 TSLP 발현을 조절하는 것을 보여주는 도면이다.1 is a view showing a three-dimensional artificial skin model.
2 is a diagram showing induction of TSLP expression by ultraviolet light in human-derived keratinocytes.
3 is a diagram showing induction of TSLP expression by ultraviolet light in a human three-dimensional skin model.
FIG. 4 is a graph showing the results of confirming HIF-1α expression by ultraviolet light in human-derived keratinocytes. FIG.
FIG. 5 is a diagram showing that phosphorylation of JNK and Erk 1/2 in human keratinocytes mediates expression of HIF-1α by UVB irradiation. FIG.
Figure 6 is a schematic illustration of a TSLP promoter comprising a HIF-l [alpha] binding site.
FIG. 7 is a graph showing the regulation of TSLP expression by HIF-1α in human-derived keratinocytes.
8 is a diagram showing that HIF-1 alpha binds to the TSLP promoter and regulates TSLP expression in human-derived keratinocytes.

이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

방법Way

1. 세포배양 1. Cell culture

인간 유래 피부각질세포주, HaCaT 세포를 cell lines service(CLS; Cell lines Service, Eppelheim, Germany)에서 얻어 10% FBS와 penicillin 100 IU/ml, and streptomycin 100 μg/ml(GIBCO)를 첨가한 Dulbecco’s modified Eagle’s medium(DMEM; HyClone, Logan, UT, USA)로 5% CO2가 포함된 37℃ 배양기에서 키웠다.
Dulbecco's modified Eagle's (GIBCO) supplemented with 10% FBS, penicillin 100 IU / ml, and streptomycin 100 μg / ml (GIBCO) was obtained from human lineage keratinocyte, HaCaT cells from cell lines service (CLS; Cell lines Service, Eppelheim, Germany) medium (DMEM; HyClone, Logan, UT, USA) in a 37 ° C incubator containing 5% CO 2 .

2.2. 3차원 인공피부모델, Three-dimensional artificial skin model, EpiDermEpiDerm ™ ™ modelsmodels (( EPIEPI -200)-200)

EpiDerm™ models(EPI-200), 3차원 인공피부모델은 MatTek Corporation (Ashland, MA, USA)로부터 구입하였다. 3차원 인공피부모델, HSEMs는 인간 정상피부조직과 유사하게 기저층 (basal), 유극층 (spinous), 과립층 (granular)과 각질층 (cornified layer)을 포함하여 여러 층 구조로 구성되어있다. HSEMs는 assay medium를 이용하여 37℃, 5% CO2 조건에서 배양하였다.
EpiDerm ™ models (EPI-200) and 3D artificial skin models were purchased from MatTek Corporation (Ashland, MA, USA). Three-dimensional artificial skin models, HSEMs, are composed of several layered structures, including basal, spinous, granular and cornified layers, similar to human normal skin tissue. HSEMs were cultured in assay medium at 37 ° C and 5% CO 2 .

3. 자외선 조사 (UV Irradiation) 3. Ultraviolet irradiation ( UV Irradiation)

세포는 PBS (phosphate-buffered saline)로 세척 (washing)하여 UVB 범위 (280∼320nm)를 방출하는 자외선 B램프를 이용하여 자외선에 노출하였다. 자외선에 노출 후, FBS가 없는 배양배지를 넣어주고 목표하는 시간까지 배양하였다. 대조군 세포는 자외선에 노출 없이 모든 과정을 동일하게 수행하였다.
Cells were washed with PBS (phosphate-buffered saline) and exposed to ultraviolet light using an ultraviolet B lamp emitting UVB range (280-320 nm). After exposure to ultraviolet light, the culture medium without FBS was added and cultured until the target time. Control cells were subjected to the same procedure without exposure to ultraviolet light.

4. 화학 시약 (4. Chemical reagents ( ChemicalChemical reagentsreagents ))

각 키나제 신호전달 (Kinase pathway)의 억제를 위해 JNK의 억제제로써 SP600125 (calbichem), ERK의 억제제로써 U0126 (Santa Cruz Biotechnology), p38의 억제제로써 SB239063 (calbichem)이 사용되었다.
SP600125 (calbichem) as an inhibitor of JNK, U0126 (Santa Cruz Biotechnology) as an inhibitor of ERK, and SB239063 (calbichem) as an inhibitor of p38 were used for inhibition of each kinase pathway.

5. 5. DNADNA 구조물 및  Structures and siRNAsiRNA 트랜스펙션Transfection ( ( DNADNA constructsconstructs andand siRNAsiRNA transfectiontransfection ))

인간 HIF-1α DNA 구조물을 만들기 위해 wild HIF-1α를 주형으로 degradation의 target이 되는 아미노산 서열을 P402A, P564A로 치환하는 돌연변이 DNA 단편 (mutant DNA fragment)을 다음의 프라이머 (primer)로 증폭하여 pcDNA3/HIF-1α P402A, P564A를 만들었다. primers : sense; 5’-GCAGATCTATGCCGACGG TGGAGGAGC-3’, antisense; 5’-GCGAATTCGTATTTCCCCTGAAGGCTC-3’. HIF-1α 발현을 억제하기 위하여 HIF-1α를 위한 작은 간섭 RNA (siRNA)를 합성하였다. HIF-1α siRNA 서열 : ccuaucccaauggaugaug(dtdt)(서열번호 3). 대조군으로는 scrambled siRNA를 사용하였다. siRNA를 처리하기 위해 6 well plate에 1x105 HaCaT 세포를 배양 후 Lipofectamine 2000(Invitrogen, Carlsbad, CA)을 이용하여 제조사의 방법에 따라 20 nM의 siRNA를 transfection 시킨다. 세포는 실험에 이용되기 전 48시간동안 안정화 되었고, siRNA에 의한 gene-silencing 효과는 PCR을 이용하여 HIF-1α mRNA 발현량을 확인하였다.
To construct human HIF-1α DNA construct, a mutant DNA fragment (mutant DNA fragment) substituting P402A and P564A for amino acid sequence which is the target of degradation with wild HIF-1α was amplified with the following primer to obtain pcDNA3 / HIF-1 alpha P402A, and P564A. primers: sense; 5'-GC AGATCT ATGCCGACGG TGGAGGAGC-3 ', antisense; 5'-GC GAATTC GTATTTCCCCTGAAGGCTC-3 '. Small interfering RNA (siRNA) for HIF-1α was synthesized to inhibit HIF-1α expression. HIF-1? SiRNA sequence: ccuaucccaauggaugaug (dtdt) (SEQ ID NO: 3). Scrambled siRNA was used as a control. To treat siRNA, 1 × 10 5 HaCaT cells are cultured on a 6-well plate and 20 nM siRNA is transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, Calif.) according to manufacturer's instructions. Cells were stabilized for 48 hours before being used in the experiment, and gene-silencing effect of siRNA was confirmed by PCR using HIF-1α mRNA expression level.

6. 6. 반정량Semi-quantitative PCRPCR ( ( SemiquintitativeSemiquintitative PCRPCR ))

피부각질세포에 자외선에 조사 후 FBS가 없는 배양배지를 넣어 목표하는 시간까지 배양하였다. TRIzol Reagent를 이용하여 제조사의 방법에 따라 RNA를 추출하였다. RNA 1ug을 이용하여 cDNA를 합성하였고, 다음 primer를 이용해 RT-PCR을 수행하였다. TSLP: sense 5’-TAGCAATCG GCCACATTGCCT-3’, antisense 5’-GAAGCGACGCCACAATCCTTG-3’, HIF-1α: sence 5'-GATTTTGGC AGCAACGACAC-3', antisense 5'-TGAATCTGGGGCATGGTAAA-3', β-actin: sense 5′-ACAGGAAGTCCC TTGCCATC-3′; antisense 5′-AGGGAGACCAAAAGCCTTCA-3′. PCR은 MyCyclerTM Thermal Cycler (Bio-Rad, Hercules, CA, USA)를 이용하여 수행하였다.
After keratinocytes were irradiated with ultraviolet light, culture medium without FBS was added and cultured until the target time. RNA was extracted by TRIzol Reagent according to the manufacturer's method. CDNA was synthesized using 1 ug of RNA and RT-PCR was performed using the following primers. 5'-TAGCAATCG GCCACATTGCCT-3 ', antisense 5'-GAAGCGACGCCACAATCCTTG-3', HIF-1.alpha.: Sence 5'-GATTTTGGC AGCAACGACAC-3 ', antisense 5'-TGAATCTGGGGCATGGTAAA-3', .beta.-actin: sense 5 '-ACAGGAAGTCCC TTGCCATC-3'; antisense 5'-AGGGAGACCAAAAGCCTTCA-3 '. PCR was performed using MyCycler ™ Thermal Cycler (Bio-Rad, Hercules, Calif., USA).

7. 7. 웨스턴Western 블러팅Blotting ( ( WesternWestern blotting)blotting)

세포를 20 mM Tris, 100 mM NaCl, 5 mM MgCl2, 1% NP40, 0.5% sodium deoxychlolate, 10 mM glycerophosphate, 0.1 mM orthovanadate, protease inhibitor가 포함된 lysis buffer로 30분간 lysis시킨 후 13000 rpm에서 20분간 원심분리 하여 단백질을 분리하였다. 분리된 단백질은 BCA method를 이용해 정량하여 시료 당 동일한 단백질량을 10∼12% SDS-PAGE로 전기영동 하여 분리한 후 PVDF membrane으로 이동시킨다. Membrane은 5% skim milk로 blocking 시킨 후 HIF-1α, TSLP, MAPKs, Lamin A/C, α-tubulin 과 β-actin specific antibody로 blotting 후 ECL kit로 검출하였다.
Cells were lysed with lysis buffer containing 20 mM Tris, 100 mM NaCl, 5 mM MgCl 2 , 1% NP40, 0.5% sodium deoxychlolate, 10 mM glycerophosphate, 0.1 mM orthovanadate and protease inhibitor for 30 minutes and incubated at 13000 rpm for 20 minutes The proteins were separated by centrifugation. The separated proteins were quantified using the BCA method, and the same amount of protein per sample was separated by electrophoresis on 10-12% SDS-PAGE and then transferred to the PVDF membrane. Membrane was blocked with 5% skim milk and then blotted with HIF-1α, TSLP, MAPKs, Lamin A / C, α-tubulin and β-actin specific antibody and detected with ECL kit.

8. 8. ELISAELISA

세포를 UVB에 노출한 후 FBS가 없는 배양배지로 24시간 배양한 후 배양배지를 모아 1500 rpm에서 7분간 원심 분리한 후 사용하기 전까지 -80℃에 보관하였다. 배양배지에 분비된 TSLP의 염역반응은 ELISA kits (DuoSet; R&D System, Minneapolis, MN)를 이용하여 제조사의 방법에 따라 측정되었다. 96 well plate에 TSLP capture 항체로 16시간 코팅한 후, plate를 3번 씻어내고 blocking solution을 이용하여 blocking한다. 1시간 후, washing buffer로 plate를 3번 씻어내고 TSLP recombinant를 이용하여 농도별 standard를 만들어 standard와 시료를 각 well에 넣고 2시간 반응시킨다. 반응이 끝난 후, 3회 plate를 씻어내고 TSLP detection 항체를 넣어 2시간 반응시킨다. 그 후 plate를 3회 씻어내고 HRP가 붙은 항체를 넣어주고 20분간 반응시킨다. 그 다음, plate를 3회 씻어준 후 TMB solution을 넣어주고 20분간 반응 시킨 후, stop solution을 넣어주고 ELISA reader기로 흡광도를 읽었다.
Cells were exposed to UVB and cultured in FBS-free culture medium for 24 hours. The culture medium was collected, centrifuged at 1500 rpm for 7 minutes, and stored at -80 ° C until use. The salt reversal of secreted TSLP in the culture medium was measured by ELISA kits (DuoSet; R & D System, Minneapolis, MN) according to the manufacturer's method. The plate is coated with TSLP capture antibody for 16 hours on a 96 well plate. The plate is washed 3 times and blocked with blocking solution. After 1 hour, wash the plate 3 times with washing buffer, make a standard for each concentration using TSLP recombinant, add standard and sample to each well and react for 2 hours. After the reaction is completed, the plate is washed three times and TSLP detection antibody is added for 2 hours. The plate is then washed three times and HRP-conjugated antibody is added and reacted for 20 minutes. After washing the plate 3 times, TMB solution was added and incubated for 20 minutes. Then stop solution was added and the absorbance was read with an ELISA reader.

9. 9. 면역조직화학법Immunohistochemistry ( ( ImmunohistochemistryImmunohistochemistry ))

3차원 인공피부모델을 UVB에 노출한 다음 24시간 후에 4% paraformaldehyde으로 고정시킨 후 파라핀 블록을 만들었다. 블록 내 조직을 4 um의 두께로 section 하고 탈 파라핀 한 뒤 탈수 과정 후 두 번 세척하였다. endogenous peroxidase에 의한 nonspecific background staining을 줄이기 위해 슬라이드를 10분간 Hydrogen Peroxide로 반응시킨 후 4 회 세척하였다. primary TSLP 항체를 이용하여 반응 후 4 회 세척하였다. 그 후, Primary Antibody Enhancer를 이용하여 상온에서 20분간 반응시킨 후 4 회 세척하였다. HRP polymer로 30분간 상온에서 반응시킨 후 4 회 세척 후 hematoxylin으로 반응시킨 후 증류수로 4 회 세척한 후 counterstaining한다.
The 3D artificial skin model was exposed to UVB and fixed with 4% paraformaldehyde for 24 hours before making a paraffin block. The tissue in the block was sectioned to a thickness of 4 μm and deparaffinized and washed twice after dehydration. To reduce nonspecific background staining by endogenous peroxidase, the slides were reacted with Hydrogen Peroxide for 10 minutes and then washed 4 times. Primary TSLP antibody was used and washed 4 times after the reaction. After that, the cells were reacted with Primary Antibody Enhancer at room temperature for 20 minutes and then washed four times. HRP polymer for 30 minutes at room temperature, washed 4 times, then reacted with hematoxylin, washed 4 times with distilled water and counterstained.

10. 10. 루시페아제Luciferase 분석 ( analysis ( LuciferaseLuciferase assayassay ))

TSLP promoter(-2056/-123) construct는 TSLP 유전자의 시작코돈으로부터 upstream -2kb 까지의 서열을 포함하였다. 인간 게놈 DNA를 다음의 프라이머를 이용하여 PCR을 진행하여 증폭시킨 후 pGL3 벡터를 이용하여 클로닝 (cloning)을 하였다. primers: 5’-AGTGGTACCACTCTCTGGCCCTACAG CAA-3’(forward, KpnⅠsite was underlined) and 5’-AGTAAGCTTCCACAGGAAGCCCTTATTCA -3’(reverse, HindⅢ site was underlined). PCR로 DNA 절편을 증폭시킨 후 제한효소 KpnⅠ과 HindⅢ로 자르고 pGL3.0 luciferase reporter vector (Promega, Madison, WI)와 ligation 한다. cloning 된 DNA는 서열분석으로 검증하였다. HaCaT 세포(인간 유래 각질 세포)는 6 well plate 에 배양 후 TSLP/pGL3-Luc plasmid와 control vector pRL-TK(Promega)를 Lipofectamine 2000 transfection regent(Invitrogen)를 이용하여 동시에 트랜스펙션 (transfection)시켰다. pRL-TK의 발현은 transfection 효율을 보정하기 위해 internal control로써 사용되었다. Transfection 후 5시간 경과 후 세포는 배양배지로 교체 한 후 16시간 동안 안정화시킨 뒤, UVB를 조사하였다. 세포는 PBS로 2회 씻어낸 후 lysis buffer를 이용하여 단백질을 추출하고 luciferase assay reagent를 넣고 luminometer로 luciferase activity를 측정하였다.
The TSLP promoter (-2056 / -123) construct contained sequences upstream to -2 kb from the start codon of the TSLP gene. The human genomic DNA was amplified by PCR using the following primers, followed by cloning using pGL3 vector. primers: 5'-AGT GGTACC ACTCTCTGGCCCTACAG CAA-3 '(forward, KpnIsite was underlined) and 5'-AGT AAGCTT CCACAGGAAGCCCTTATTCA -3' (reverse, HindIII site was underlined). The DNA fragment is amplified by PCR and then digested with restriction enzymes KpnI and HindIII and ligated with pGL3.0 luciferase reporter vector (Promega, Madison, WI). The cloned DNA was verified by sequencing. HaCaT cells (human keratinocytes) were transfected with TSLP / pGL3-Luc plasmid and control vector pRL-TK (Promega) using a Lipofectamine 2000 transfection regimen (Invitrogen) at the same time. Expression of pRL-TK was used as an internal control to correct transfection efficiency. After 5 hours of transfection, the cells were replaced with culture medium and stabilized for 16 hours before UVB irradiation. Cells were rinsed twice with PBS, and luciferase activity was measured by luminometer using lysis buffer.

실시예Example 1. One. 인간 유래 각질세포에서 자외선에 의한 In human-derived keratinocytes, TSLPTSLP 발현 유도 Induction of expression

인간 유래 각질 세포 HaCaT에서 UVB가 TSLP의 발현을 조절하는지를 알아보기 위해, UVB 조사에 따른 TSLP 발현량을 조사하였다. TSLP mRNA와 단백질 발현량의 확인은 각각 RT-PCR, western blot 그리고 ELISA를 이용하여 수행되었다. TSLP mRNA 발현량은 UVB 조사량에 따라 증가하였으며, 100mJ/cm2 조사량부터 1.5배 이상 증가하는 것을 확인하였다(도 2의 a). 따라서, 이후 실험에 사용될 UVB 조사량을 결정하기 위해, cell viability assay를 수행하였고, 결과를 바탕으로 세포에 viability 손상이 10% 미만이면서 TSLP의 발현량이 1.5배 이상 증가하는 100mJ/cm2로 UVB 조사량을 결정하였다. TSLP 단밸질의 세포내 발현이 증가하는 시간을 확인하기 위해, UVB 100mJ/cm2을 조사한 후 시간대별로 TSLP 단백질 발현량을 확인하였을 때, 24 시간 후에 의미 있게 증가함을 확인하였다(도 2의 b). ELISA 실험을 이용해 TSLP 단백질 분비량 또한 UVB 조사량에 따라 증가하였음을 검증하였다(도 2의 c).
To investigate whether UVB regulates the expression of TSLP in human keratinocyte HaCaT, the amount of TSLP expression by UVB irradiation was examined. TSLP mRNA and protein expression were confirmed by RT-PCR, western blot and ELISA, respectively. The amount of TSLP mRNA expression was increased with UVB irradiation and increased from 1.5 to 100mJ / cm 2 (Fig. 2 (a)). Therefore, the cell viability assay was performed to determine the UVB dose to be used in the subsequent experiments. Based on the results, the UVB irradiation dose was 100 mJ / cm 2 , in which the viability of the cells was less than 10% and the expression level of TSLP was increased 1.5 times or more . In order to confirm the increase time of intracellular expression of TSLP protein, it was confirmed that the amount of TSLP protein expression was significantly increased after 24 hours after UVB 100 mJ / cm 2 was irradiated (FIG. 2 b) . Using ELISA, the amount of TSLP secretion was also increased with UVB irradiation (Fig. 2c).

실시예Example 2. 인간 3차원 피부모델에서 자외선에 의한  2. In a human three-dimensional skin model, TSLPTSLP 발현 유도 Induction of expression

실제 피부에서 UVB에 의해 TSLP 발현이 증가하는지를 조사하기 위해, 동물실험을 대신하여 인간 3차원 피부모델을 이용하여 실험을 수행하였다. 인간 3차원 피부모델은 정상 인간 각질세포로 기저층 (basal), 유극층 (spinous), 과립층 (granular) 및 각질층 (cornified layer)을 포함하여 분화된 조직으로 여러 층 구조로 구성되어있으며 정상 인간 표피와 유사하게 제작되었다. 인간 3차원 피부모델은 UVB 100mJ/cm2로 조사 후 24 시간 동안 배양하였으며, 이 조직을 이용하여 TSLP 발현량을 확인하기 위해 TSLP 항체를 이용하여 면역조직화학법 (immunohistochemistry)을 수행하였다. TSLP 발현은 UVB를 조사하지 않은 조직에 비해 UVB를 조사한 조직에서 증가하였다. 이 결과는 인간 각질세포에서 UVB가 TSLP 발현을 증가시킨다는 것을 보여준다(도 3).
In order to investigate whether TSLP expression is increased by UVB in actual skin, experiments were conducted using a human three-dimensional skin model instead of an animal experiment. Human three-dimensional skin model is normal human keratinocyte. It is differentiated tissue including basal, spinous, granular and cornified layer. It is composed of several layered structure and normal human epidermis It was produced similarly. Human 3D skin model was irradiated with UVB 100mJ / cm 2 and cultured for 24 hours. Immunohistochemistry was performed using TSLP antibody to confirm TSLP expression level using this tissue. TSLP expression was increased in tissues irradiated with UVB compared to tissues not irradiated with UVB. This result shows that UVB enhances TSLP expression in human keratinocytes (Fig. 3).

실시예Example 3. 각질 세포에서의 자외선에 의한  3. Ultraviolet light from keratinocytes HIFHIF -1α 축적 (-1α accumulation accumulationaccumulation ) 유도) Judo

이전 실험에서 UVB에 의한 TSLP mRNA 발현이 증가한 것을 확인하였다. 따라서 UVB에 의한 TSLP 발현 조절은 전사조절 단계를 통한 발현 조절이 추정된다. HIF-1α는 transcription factor로서 UVB에 의해 HIF-1α의 단백질 량이 증가한다는 것은 잘 알려져 있고 (비특허문헌 14), 각질 세포에서 UVB에 의해 발현량이 증가하는 HIF-1α를 확인하였다. HIF-1α는 산소정상상태 (normoxia)에서 일정량이 발현되지만 곧 ubiquitination-mediated proteasome에 의해 분해되어지는 단백질로써 UVB에 의해 HIF-1α의 mRNA 발현량은 증가하지 않았지만(도 4의 a), 단백질 량은 UVB 조사 후 16 시간 이후에 차츰 증가하는 것이 확인 되었다(도 4의 b). 또한 UVB에 의해 증가된 HIF-1α는 핵으로 이동하여 transcription factor로써의 기능을 할 가능성을 확인하였다(도 4의 c).
Previous experiments have shown that UVB-induced TSLP mRNA expression is increased. Therefore, regulation of TSLP expression by UVB is presumed to be regulated through transcriptional regulation. HIF-1α is a transcription factor and it is well known that the amount of HIF-1α protein is increased by UVB (Non-Patent Document 14), and HIF-1α which is expressed by UVB in keratinocytes is confirmed. HIF-1α is a protein that is expressed by a normoxia but is degraded by a ubiquitination-mediated proteasome. The amount of HIF-1α mRNA expression is not increased by UVB (FIG. 4 a) Was gradually increased after 16 hours from UVB irradiation (Fig. 4 (b)). In addition, HIF-1α increased by UVB migrated to the nucleus, confirming the possibility of functioning as a transcription factor (FIG. 4C).

실시예Example 4. 인간 각질 세포에서  4. In human keratinocytes JNKJNK 와  Wow ErkErk 1/2의 인산화 ( 1/2 phosphorylation ( phosphorylationphosphorylation )에 의한 )On by UVBUVB 조사에 의한  By investigation HIFHIF -1α 발현 매개-1α expression mediator

MAPKs는 인간각질세포에서 세포내 많은 신호전달 기전에 주된 역할을 하는 것으로 잘 알려져 있으며 또한 UVB에 의해 활성화된다 (비특허문헌 13). 기존의 연구들에서 UVB에 의해 유도된 MAPK 활성이 HIF-1α 단백질의 축적에 연관되어 있음이 보고된바 있다. 기존의 연구에서와 같이 UVB 조사에 따른 HIF-1α 발현량에 MAPKs의 연관성을 확인하기 위해 MAPKs의 활성을 평가하였다. 이미 보고된 연구결과들과 일치하게 (비특허문헌 13) HaCaT 세포에서 UVB에 의해 Erk1/2, JNK 그리고 p38 MAPK의 인산화가 UVB 조사 후 2시간 내에 관찰되었다(도 5의 a). 특히 JNK 인산화는 UVB에 의해 2시간 내에 가장 많이 증가하였고, ERK 인산화와 p-38 인산화 또한 UVB에 의해 증가하였음이 확인되었다. 이들 MAPKs의 인산화가 HIF-1α의 발현에 관련이 있는지를 확인하기 위해, 각 MAPKs의 억제제를 이용하여 HIF-1α 발현을 조사하였다. HaCaT 세포는 UVB 조사 전에 MAPKs 각각의 억제제들로 전 처리 하였고, 각 inhibitor는 JNK의 inhibitor로써 SP600125, ERK의 inhibitor로써 U0126, p38의 inhibitor로써 SB239063이 사용되었다. 실험 결과 UVB에 의해 증가된 HIF-1α의 발현량은 SP600125와 U0126를 처리하였을 때 감소하였고, 이와 유사하게 UVB에 의해 증가된 TSLP 발현량 또한 SP600125와 U0126를 처리하였을 때 가장 많이 감소되었음이 확인 되었다(도 5의 b). 이 결과로 UVB에 의한 HIF-1α와 TSLP 발현증가에 JNK와 ERK가 연관이 되었음을 확인하였다.
MAPKs are well known to play a major role in many cellular signaling mechanisms in human keratinocytes and are also activated by UVB (Non-Patent Document 13). Previous studies have reported that UVB-induced MAPK activity is involved in the accumulation of HIF-1α protein. As in previous studies, the activity of MAPKs was evaluated to confirm the association of MAPKs with HIF-1α expression by UVB irradiation. In accordance with previously reported studies (Non-Patent Document 13), phosphorylation of Erk1 / 2, JNK and p38 MAPK by HaBaT cells in HaCaT cells was observed within 2 hours after UVB irradiation (Fig. In particular, JNK phosphorylation was the most increased by UVB within 2 hours, and ERK phosphorylation and p-38 phosphorylation were also increased by UVB. To determine whether the phosphorylation of these MAPKs is involved in the expression of HIF-1α, HIF-1α expression was examined using inhibitors of MAPKs. HaCaT cells were pretreated with inhibitors of MAPKs before UVB irradiation. Each inhibitor used SP600125 as an inhibitor of JNK, U0126 as an inhibitor of ERK, and SB239063 as an inhibitor of p38. As a result, the expression level of HIF-1α increased by UVB was decreased when SP600125 and U0126 were treated, and similarly, the amount of TSLP increased by UVB was also decreased most when SP600125 and U0126 were treated (Fig. 5 (b)). As a result, it was confirmed that JNK and ERK were associated with increased HIF-1α and TSLP expression by UVB.

실시예Example 5.  5. HIFHIF -1α에 의한 By -1α HaCaTHaCaT 세포에서의  In the cell UVBUVB 에 의한 On by TSLPTSLP 발현 조절 Regulation of expression

HIF1 complexes(HIF1α/β)는 VEGF를 포함하여 많은 표적 유전자 (target gene)의 HRE와 작용한다. 따라서 HIF-1α가 UVB에 의한 TSLP 발현조절에 관여하는지를 확인하기 위해, transcription factor binding sites prediction program(GeneCards)을 이용해 TSLP 프로모터 서열분석을 수행하였고, 서열분석결과 TSLP의 프로모터 부위에 HIF-1α 결합부위 (binding site)가 있음을 확인하였다 (도 6).HIF1 complexes (HIF1α / β) interact with HREs of many target genes, including VEGF. Therefore, TSLP promoter sequence analysis was carried out using the transcription factor binding site prediction program (GeneCards) in order to confirm whether HIF-1α is involved in the regulation of TSLP expression by UVB. Sequence analysis revealed that HIF-1α binding site (Fig. 6).

또한, HIF-1α의 TSLP 발현에 대한 직접적인 효과를 확인하기 위해 HIF-1α 과발현 벡터 (overexpression vector)를 이용하여 TSLP mRNA 발현량과 단백질 발현량을 조사하였다. HIF-1α 과발현 벡터를 트랜스펙션시킨 세포에서 벡터만을 형질전환시킨 세포에 비해 HIF-1α의 mRNA 발현량이 증가하였음을 RT-PCR을 이용해 확인하였고, 그에 따른 TSLP mRNA 발현량도 증가하였음이 확인 되었다(도 7의 a). TSLP 단백질 발현량을 확인하기 위해 동일하게 HIF-1α 과발현 벡터를 트랜스펙션시킨 세포에서 웨스턴 블럿 (western blot)을 수행한 결과 HIF-1α 과발현 벡터를 트랜스펙션시킨 세포에서 벡터만을 트랜스펙션시킨 세포에 비해 TSLP의 발현량이 증가하였다(도 7의 b). 또한, UVB에 의한 TSLP 발현에 HIF-1α의 역할을 확인하기 위해, siRNA를 이용한 HIF-1α 유전자 발현의 넉다운 (knockdown)을 진행하였다. HIF-1α의 발현을 감소시키기 위해 HIF-1α siRNA와 대조구 (control)로써 scrambled siRNA를 HaCaT 세포에 각각 transfection 시킨 후 24 시간 안정화 후 UVB를 조사하고 무혈청 배지 (serum free media)로 교체한 후 24 시간 후에 RNA를 추출하였다. HIF-1α와 TSLP 발현량의 확인은 RT-PCR을 이용하여 수행되었다. UVB에 의해 증가하였던 TSLP mRNA 발현량이 HIF-1α siRNA를 처리한 세포에서 대조구 수준 (control level)까지 감소하였음이 확인 되었다(도 7의 c). 이 결과는 UVB에 의한 TSLP 발현은 HIF-1α에 의해 조절되는 것을 확인하였다.
In order to confirm the direct effect of HIF-1α on TSLP expression, TSLP mRNA expression level and protein expression level were examined using HIF-1α overexpression vector. It was confirmed by RT-PCR that mRNA expression of HIF-1α was increased compared with cells transfected with HIF-1α over-expressing vector and that TSLP mRNA expression level was also increased (Fig. 7A). In order to confirm TSLP expression level, Western blot was performed on cells transfected with HIF-1.alpha. Over-expression vector. As a result, only the vector was transfected with cells transfected with HIF-1.alpha. The expression level of TSLP was increased compared with that of the cells (Fig. 7 (b)). In order to confirm the role of HIF-1α in the expression of TSLP by UVB, knockdown of HIF-1α gene expression using siRNA was performed. To reduce HIF-1α expression, scrambled siRNAs were transfected with HIF-1α siRNA and control, respectively. After 24-hour stabilization, UVB was irradiated and replaced with serum-free medium. RNA was extracted afterwards. Identification of HIF-1α and TSLP expression was performed using RT-PCR. It was confirmed that the amount of TSLP mRNA expression increased by UVB decreased to the control level in cells treated with HIF-1α siRNA (FIG. 7C). These results confirm that TSLP expression by UVB is regulated by HIF-1α.

실시예Example 6. 6. HIFHIF -1α에 의한 By -1α TSLPTSLP 프로모터 결합에 의한 By promoter binding TSLPTSLP 의 발현 조절Modulation of

UVB에 의한 TSLP 발현증가에 HIF-1α의 transcriptional activation이 관여하는지를 확인하기 위해, Luciferase assay를 이용하여 TSLP 프로모터 활성 (promoter activity)을 측정하였다. TSLP 프로모터는 앞서 설명하였듯이 TSLP upstream 2kb 내의 서열을 포함하고 있으며 HIF-1α가 결합할 수 있는 Hypoxia-response element(HRE)을 가지고 있다. 우선, UVB에 의해 TSLP 프로모터가 활성을 갖는지 확인 한 결과 UVB를 조사한 세포에서 UVB를 조사하지 않은 세포에 비해 TSLP 프로모터 활성이 약 3 배 증가하였음이 확인 되었고(도 8의 a), HIF-1α가 직접적으로 관여하는지 확인하기 위해 벡터와 HIF-1α 과발현 벡터를 각각 트랜스펙션시킨 세포에서 TSLP 프로모터 활성을 측정한 결과 HIF-1α 과발현 벡터를 트랜스펙션시킨 세포에서 벡터만 트랜스펙션시킨 세포에서보다 TSLP 프로모터 활성이 2 배정도 증가하였음을 확인 하였다(도 8의 b). 또한 HIF-1α가 TSLP 프로모터에 직접적으로 결합하는지를 확인하기 위해 ChIP assay를 수행하였다. 인간 각질세포에 HIF-1α의 단백질 발현량을 증가시키는 CoCl2를 처리한 후 6시간 배양 후 HIF-1α 항체를 이용하여 크로마틴 복합체 (chromatin complex)를 면역침강 하였다. 면역 침강된 크로마틴 복합체 (chromatin complex)로부터 DNA를 추출한 후 TSLP 프로모터에 특이적인 프라이머를 이용하여 PCR을 수행하였다. 그 결과, HIF-1α와 결합한 TSLP 프로모터 부위는 HIF-1α 항체에 의해 면역침강 되었고, PCR을 통해 TSLP 프로모터가 검출된 것이 확인되었다. 결과적으로 UVB에 의해 TSLP 발현증가는 HIF-1α의 발현이 TSLP 프로모터 조절에 관여함을 보여 준다.
TSLP promoter activity was measured using the Luciferase assay in order to confirm whether transcriptional activation of HIF-1α was involved in the increase of TSLP expression by UVB. As described above, the TSLP promoter contains a sequence within 2 kb of TSLP upstream and has a Hypoxia-response element (HRE) capable of binding to HIF-1α. First, it was confirmed that the TSLP promoter was activated by UVB. As a result, it was confirmed that TSLP promoter activity was about 3 times higher than UVB-irradiated cells in UVB-irradiated cells (FIG. 8 a) TSLP promoter activity was measured in cells transfected with vectors and HIF-1α overexpressing vectors in order to confirm whether they were involved directly. In the cells transfected with vectors transfected with HIF-1α overexpressing vectors, It was confirmed that TSLP promoter activity was increased twice as much (Fig. 8 (b)). ChIP assay was also performed to confirm whether HIF-1α directly binds to the TSLP promoter. CoCl 2 , which increases the amount of HIF-1α expression in human keratinocytes, was incubated for 6 hours, and the chromatin complex was immunoprecipitated using HIF-1α antibody. DNA was extracted from the immunoprecipitated chromatin complex and PCR was performed using a TSLP promoter specific primer. As a result, it was confirmed that the TSLP promoter region bound to HIF-1α was immunoprecipitated by HIF-1α antibody and the TSLP promoter was detected by PCR. As a result, the increase in TSLP expression by UVB indicates that the expression of HIF-1α is involved in the regulation of the TSLP promoter.

TSLP의 발현이 알레르기 질환 (allergic disease) 및 염증성 질병의 발병에 직접적 영향을 가지고 있기 때문에 TSLP에 의해 매개되는 질병의 치료와 예방을 위해서는 TSLP의 발현에 관한 조절인자 찾는 것은 매우 중요하다고 할 것이다. 따라서 본 발명에서는 피부각질세포를 이용하여 자외선에 의해 Thymic stromal lymphopoietin (TSLP)의 발현 양상을 평가하고 TSLP 프로모터 분석을 통해 TSLP의 발현을 증가시키는 전사조절인자를 선별하고 그에 따른 세포내 신호전달경로를 연구하여 TSLP 관련 질병의 치료법과 예방법을 연구하는데 기초를 마련하고자 하였다. Since the expression of TSLP has a direct effect on the development of allergic diseases and inflammatory diseases, it is very important to find a regulator of TSLP expression for the treatment and prevention of diseases mediated by TSLP. Therefore, in the present invention, the expression pattern of Thymic stromal lymphopoietin (TSLP) is assessed by ultraviolet light using keratinocytes and a transcriptional regulatory factor that increases the expression of TSLP through TSLP promoter analysis is selected, And to provide a basis for studying the treatment and prevention of TSLP related diseases.

자외선은 피부에 지속적 자극을 줄 수 있는 자연적 요소로써 세포내 많은 신호전달 분자들을 교란시키고 염증성 질병을 초래하기 때문에 TSLP의 발현에 관련이 있을 가능성이 높다고 판단되었고, 본 발명을 통해, 인간 유래 각질 세포와 인간의 피부와 가장 유사한 인간 3차원 피부모델에 UVB를 조사하였을 때 UVB가 조사량과 시간에 따라 TSLP 발현을 유도함을 확인하였다. It has been determined that ultraviolet rays are likely to be involved in the expression of TSLP because it is a natural factor that can give sustained stimulation to the skin, disturbing many signaling molecules in the cell and causing inflammatory diseases. Through the present invention, And 3-dimensional skin model most similar to human skin, UVB irradiation induced TSLP expression by irradiation dose and time.

인간 각질 세포에서 UVB에 의한 TSLP 발현증가에 관련된 세포내 신호전달 경로를 파악하기 위해 신호전달경로를 확인한 결과 UVB에 의해 MAPKs가 활성화되는 을 확인하였고, 각각의 억제제를 처리한 실험에서 이들 중 JNK 와 Erk1/2의 인산화가 UVB 조사에 의한 TSLP 발현을 매개한다는 것이 확인되었다. 또한 TSLP의 전사단계에서의 발현을 조절할 가능성이 있는 HIF-1α를 찾았으며 HIF-1α 발현의 증가가 UVB에 의해 활성화된 MAPKs에 의해 조절되는 것을 확인하였다. HIF-1α의 과발현 벡터와 siRNA를 이용하여 HIF-1α가 TSLP 발현 조절에 직접적 관련이 있음을 검증 하였고, 이는 TSLP 프로모터 활성 분석 (TSLP promoter activity assay)을 통해서 HIF-1α가 TSLP 프로모터의 활성을 조절한다는 결과를 얻었다.In order to understand the intracellular signal transduction pathway involved in the increase of TSLP expression by UVB in human keratinocytes, activation of MAPKs was confirmed by UVB signaling pathway. In each of these inhibitors, JNK It was confirmed that phosphorylation of Erk1 / 2 mediates TSLP expression by UVB irradiation. We also found HIF-1α, a potent regulator of TSLP expression in the transcriptional stage, and confirmed that the increased expression of HIF-1α was regulated by UVB-activated MAPKs. Using HIF-1α overexpression vector and siRNA, HIF-1α was directly correlated with TSLP expression regulation, and TSLP promoter activity assay (TSLP promoter activity assay) showed that HIF-1α regulated TSLP promoter activity .

지금까지 UVB에 의해 유도된 사이토카인들이 많이 보고가 되었지만, 본 발명을 통해 밝혀진 UVB에 의해 TSLP의 발현증가는 보고된 바 없었으며, 기존의 보고된 사이토카인들이 Th1 type의 사이토카인인 반면에 TSLP는 Th2 type의 염증반응을 일으키는 사이토카인으로써 UVB에 의한 새로운 효과를 확인하였다. 또한, 인간 각질세포를 이용하여 TSLP를 조절하는 몇몇 연구결과들이 보고되고 있지만, 본 발명에서는 TSLP를 조절하는 새로운 전사조절인자, HIF-1α와 이에 관여하는 MAPKs의 신호전달 경로를 밝힘으로써 UVB에 의한 TSLP의 발현조절 메카니즘을 제공하였다.Although UVB-induced cytokines have been reported so far, no increase in the expression of TSLP by UVB has been reported by the present invention, and the previously reported cytokines are Th1 type cytokines, whereas TSLP Is a cytokine that induces the Th2 type of inflammatory response. In addition, although several studies have been reported to regulate TSLP using human keratinocytes, the present invention discloses signal transduction pathways of HIF-1α and MAPKs, a novel transcription regulator that regulates TSLP, Lt; RTI ID = 0.0 > TSLP < / RTI >

결과적으로 UVB에 노출된 피부각질세포에서 JNK/ERK → HIF-1α 의존적으로 TSLP가 발현됨을 규명하였고 이러한 신호전달 기전이 UVB에 의한 피부염증반응에 중요한 기전 중의 하나라는 것을 확인하고, TSLP에 의해 매개되는 질환의 예방 및 치료에 기여할 수 있게 되었다.
As a result, we confirmed that JNK / ERK → HIF-1α-dependent TSLP expression is expressed in keratinocytes exposed to UVB, and that this signal transduction mechanism is one of the important mechanisms for UVB-induced skin inflammation and is mediated by TSLP Thereby contributing to the prevention and treatment of the diseases.

이상으로 본 발명의 특정한 부분을 상세히 기술하였으나, 당업계의 통상의 지식을 가진 자에게 있어 이러한 구체적인 기술은 단지 바람직한 구현의 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 균등물에 의하여 정의된다고 할 것이다.Although specific portions of the present invention have been described in detail, those skilled in the art will appreciate that these specific embodiments are merely examples of preferred embodiments and that the scope of the present invention is not limited thereto. It is therefore intended that the scope of the present invention be defined by the appended claims and their equivalents.

<110> KOREA UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES COMPRISING siRNA AGAINST HIF-1a AS AN ESSENTIAL COMPONENT <130> P11-121203-02 <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 2481 <212> DNA <213> Homo sapience <400> 1 atggagggcg ccggcggcgc gaacgacaag aaaaagataa gttctgaacg tcgaaaagaa 60 aagtctcgag atgcagccag atctcggcga agtaaagaat ctgaagtttt ttatgagctt 120 gctcatcagt tgccacttcc acataatgtg agttcgcatc ttgataaggc ctctgtgatg 180 aggcttacca tcagctattt gcgtgtgagg aaacttctgg atgctggtga tttggatatt 240 gaagatgaca tgaaagcaca gatgaattgc ttttatttga aagccttgga tggttttgtt 300 atggttctca cagatgatgg tgacatgatt tacatttctg ataatgtgaa caaatacatg 360 ggattaactc agtttgaact aactggacac agtgtgtttg attttactca tccatgtgac 420 catgaggaaa tgagagaaat gcttacacac agaaatggcc ttgtgaaaaa gggtaaagaa 480 caaaacacac agcgaagctt ttttctcaga atgaagtgta ccctaactag ccgaggaaga 540 actatgaaca taaagtctgc aacatggaag gtattgcact gcacaggcca cattcacgta 600 tatgatacca acagtaacca acctcagtgt gggtataaga aaccacctat gacctgcttg 660 gtgctgattt gtgaacccat tcctcaccca tcaaatattg aaattccttt agatagcaag 720 actttcctca gtcgacacag cctggatatg aaattttctt attgtgatga aagaattacc 780 gaattgatgg gatatgagcc agaagaactt ttaggccgct caatttatga atattatcat 840 gctttggact ctgatcatct gaccaaaact catcatgata tgtttactaa aggacaagtc 900 accacaggac agtacaggat gcttgccaaa agaggtggat atgtctgggt tgaaactcaa 960 gcaactgtca tatataacac caagaattct caaccacagt gcattgtatg tgtgaattac 1020 gttgtgagtg gtattattca gcacgacttg attttctccc ttcaacaaac agaatgtgtc 1080 cttaaaccgg ttgaatcttc agatatgaaa atgactcagc tattcaccaa agttgaatca 1140 gaagatacaa gtagcctctt tgacaaactt aagaaggaac ctgatgcttt aactttgctg 1200 gccccagccg ctggagacac aatcatatct ttagattttg gcagcaacga cacagaaact 1260 gatgaccagc aacttgagga agtaccatta tataatgatg taatgctccc ctcacccaac 1320 gaaaaattac agaatataaa tttggcaatg tctccattac ccaccgctga aacgccaaag 1380 ccacttcgaa gtagtgctga ccctgcactc aatcaagaag ttgcattaaa attagaacca 1440 aatccagagt cactggaact ttcttttacc atgccccaga ttcaggatca gacacctagt 1500 ccttccgatg gaagcactag acaaagttca cctgagccta atagtcccag tgaatattgt 1560 ttttatgtgg atagtgatat ggtcaatgaa ttcaagttgg aattggtaga aaaacttttt 1620 gctgaagaca cagaagcaaa gaacccattt tctactcagg acacagattt agacttggag 1680 atgttagctc cctatatccc aatggatgat gacttccagt tacgttcctt cgatcagttg 1740 tcaccattag aaagcagttc cgcaagccct gaaagcgcaa gtcctcaaag cacagttaca 1800 gtattccagc agactcaaat acaagaacct actgctaatg ccaccactac cactgccacc 1860 actgatgaat taaaaacagt gacaaaagac cgtatggaag acattaaaat attgattgca 1920 tctccatctc ctacccacat acataaagaa actactagtg ccacatcatc accatataga 1980 gatactcaaa gtcggacagc ctcaccaaac agagcaggaa aaggagtcat agaacagaca 2040 gaaaaatctc atccaagaag ccctaacgtg ttatctgtcg ctttgagtca aagaactaca 2100 gttcctgagg aagaactaaa tccaaagata ctagctttgc agaatgctca gagaaagcga 2160 aaaatggaac atgatggttc actttttcaa gcagtaggaa ttggaacatt attacagcag 2220 ccagacgatc atgcagctac tacatcactt tcttggaaac gtgtaaaagg atgcaaatct 2280 agtgaacaga atggaatgga gcaaaagaca attattttaa taccctctga tttagcatgt 2340 agactgctgg ggcaatcaat ggatgaaagt ggattaccac agctgaccag ttatgattgt 2400 gaagttaatg ctcctataca aggcagcaga aacctactgc agggtgaaga attactcaga 2460 gctttggatc aagttaactg a 2481 <210> 2 <211> 826 <212> PRT <213> Homo sapience <400> 2 Met Glu Gly Ala Gly Gly Ala Asn Asp Lys Lys Lys Ile Ser Ser Glu 1 5 10 15 Arg Arg Lys Glu Lys Ser Arg Asp Ala Ala Arg Ser Arg Arg Ser Lys 20 25 30 Glu Ser Glu Val Phe Tyr Glu Leu Ala His Gln Leu Pro Leu Pro His 35 40 45 Asn Val Ser Ser His Leu Asp Lys Ala Ser Val Met Arg Leu Thr Ile 50 55 60 Ser Tyr Leu Arg Val Arg Lys Leu Leu Asp Ala Gly Asp Leu Asp Ile 65 70 75 80 Glu Asp Asp Met Lys Ala Gln Met Asn Cys Phe Tyr Leu Lys Ala Leu 85 90 95 Asp Gly Phe Val Met Val Leu Thr Asp Asp Gly Asp Met Ile Tyr Ile 100 105 110 Ser Asp Asn Val Asn Lys Tyr Met Gly Leu Thr Gln Phe Glu Leu Thr 115 120 125 Gly His Ser Val Phe Asp Phe Thr His Pro Cys Asp His Glu Glu Met 130 135 140 Arg Glu Met Leu Thr His Arg Asn Gly Leu Val Lys Lys Gly Lys Glu 145 150 155 160 Gln Asn Thr Gln Arg Ser Phe Phe Leu Arg Met Lys Cys Thr Leu Thr 165 170 175 Ser Arg Gly Arg Thr Met Asn Ile Lys Ser Ala Thr Trp Lys Val Leu 180 185 190 His Cys Thr Gly His Ile His Val Tyr Asp Thr Asn Ser Asn Gln Pro 195 200 205 Gln Cys Gly Tyr Lys Lys Pro Pro Met Thr Cys Leu Val Leu Ile Cys 210 215 220 Glu Pro Ile Pro His Pro Ser Asn Ile Glu Ile Pro Leu Asp Ser Lys 225 230 235 240 Thr Phe Leu Ser Arg His Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp 245 250 255 Glu Arg Ile Thr Glu Leu Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly 260 265 270 Arg Ser Ile Tyr Glu Tyr Tyr His Ala Leu Asp Ser Asp His Leu Thr 275 280 285 Lys Thr His His Asp Met Phe Thr Lys Gly Gln Val Thr Thr Gly Gln 290 295 300 Tyr Arg Met Leu Ala Lys Arg Gly Gly Tyr Val Trp Val Glu Thr Gln 305 310 315 320 Ala Thr Val Ile Tyr Asn Thr Lys Asn Ser Gln Pro Gln Cys Ile Val 325 330 335 Cys Val Asn Tyr Val Val Ser Gly Ile Ile Gln His Asp Leu Ile Phe 340 345 350 Ser Leu Gln Gln Thr Glu Cys Val Leu Lys Pro Val Glu Ser Ser Asp 355 360 365 Met Lys Met Thr Gln Leu Phe Thr Lys Val Glu Ser Glu Asp Thr Ser 370 375 380 Ser Leu Phe Asp Lys Leu Lys Lys Glu Pro Asp Ala Leu Thr Leu Leu 385 390 395 400 Ala Pro Ala Ala Gly Asp Thr Ile Ile Ser Leu Asp Phe Gly Ser Asn 405 410 415 Asp Thr Glu Thr Asp Asp Gln Gln Leu Glu Glu Val Pro Leu Tyr Asn 420 425 430 Asp Val Met Leu Pro Ser Pro Asn Glu Lys Leu Gln Asn Ile Asn Leu 435 440 445 Ala Met Ser Pro Leu Pro Thr Ala Glu Thr Pro Lys Pro Leu Arg Ser 450 455 460 Ser Ala Asp Pro Ala Leu Asn Gln Glu Val Ala Leu Lys Leu Glu Pro 465 470 475 480 Asn Pro Glu Ser Leu Glu Leu Ser Phe Thr Met Pro Gln Ile Gln Asp 485 490 495 Gln Thr Pro Ser Pro Ser Asp Gly Ser Thr Arg Gln Ser Ser Pro Glu 500 505 510 Pro Asn Ser Pro Ser Glu Tyr Cys Phe Tyr Val Asp Ser Asp Met Val 515 520 525 Asn Glu Phe Lys Leu Glu Leu Val Glu Lys Leu Phe Ala Glu Asp Thr 530 535 540 Glu Ala Lys Asn Pro Phe Ser Thr Gln Asp Thr Asp Leu Asp Leu Glu 545 550 555 560 Met Leu Ala Pro Tyr Ile Pro Met Asp Asp Asp Phe Gln Leu Arg Ser 565 570 575 Phe Asp Gln Leu Ser Pro Leu Glu Ser Ser Ser Ala Ser Pro Glu Ser 580 585 590 Ala Ser Pro Gln Ser Thr Val Thr Val Phe Gln Gln Thr Gln Ile Gln 595 600 605 Glu Pro Thr Ala Asn Ala Thr Thr Thr Thr Ala Thr Thr Asp Glu Leu 610 615 620 Lys Thr Val Thr Lys Asp Arg Met Glu Asp Ile Lys Ile Leu Ile Ala 625 630 635 640 Ser Pro Ser Pro Thr His Ile His Lys Glu Thr Thr Ser Ala Thr Ser 645 650 655 Ser Pro Tyr Arg Asp Thr Gln Ser Arg Thr Ala Ser Pro Asn Arg Ala 660 665 670 Gly Lys Gly Val Ile Glu Gln Thr Glu Lys Ser His Pro Arg Ser Pro 675 680 685 Asn Val Leu Ser Val Ala Leu Ser Gln Arg Thr Thr Val Pro Glu Glu 690 695 700 Glu Leu Asn Pro Lys Ile Leu Ala Leu Gln Asn Ala Gln Arg Lys Arg 705 710 715 720 Lys Met Glu His Asp Gly Ser Leu Phe Gln Ala Val Gly Ile Gly Thr 725 730 735 Leu Leu Gln Gln Pro Asp Asp His Ala Ala Thr Thr Ser Leu Ser Trp 740 745 750 Lys Arg Val Lys Gly Cys Lys Ser Ser Glu Gln Asn Gly Met Glu Gln 755 760 765 Lys Thr Ile Ile Leu Ile Pro Ser Asp Leu Ala Cys Arg Leu Leu Gly 770 775 780 Gln Ser Met Asp Glu Ser Gly Leu Pro Gln Leu Thr Ser Tyr Asp Cys 785 790 795 800 Glu Val Asn Ala Pro Ile Gln Gly Ser Arg Asn Leu Leu Gln Gly Glu 805 810 815 Glu Leu Leu Arg Ala Leu Asp Gln Val Asn 820 825 <210> 3 <211> 23 <212> DNA <213> HIF-1a siRNA <400> 3 ccuaucccaa uggaugaugd tdt 23 <110> KOREAN UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES          COMPRISING siRNA AGAINST HIF-1a AS AN ESSENTIAL COMPONENT <130> P11-121203-02 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 2481 <212> DNA <213> Homo sapience <400> 1 atggagggcg ccggcggcgc gaacgacaag aaaaagataa gttctgaacg tcgaaaagaa 60 aagtctcgag atgcagccag atctcggcga agtaaagaat ctgaagtttt ttatgagctt 120 gctcatcagt tgccacttcc acataatgtg agttcgcatc ttgataaggc ctctgtgatg 180 aggcttacca tcagctattt gcgtgtgagg aaacttctgg atgctggtga tttggatatt 240 gaagatgaca tgaaagcaca gatgaattgc ttttatttga aagccttgga tggttttgtt 300 atggttctca cagatgatgg tgacatgatt tacatttctg ataatgtgaa caaatacatg 360 ggattaactc agtttgaact aactggacac agtgtgtttg attttactca tccatgtgac 420 catgaggaaa tgagagaaat gcttacacac agaaatggcc ttgtgaaaaa gggtaaagaa 480 caaaacacac agcgaagctt ttttctcaga atgaagtgta ccctaactag ccgaggaaga 540 actatgaaca taaagtctgc aacatggaag gtattgcact gcacaggcca cattcacgta 600 tatgatacca acagtaacca acctcagtgt gggtataaga aaccacctat gacctgcttg 660 gtgctgattt gtgaacccat tcctcaccca tcaaatattg aaattccttt agatagcaag 720 actttcctca gtcgacacag cctggatatg aaattttctt attgtgatga aagaattacc 780 gaattgatgg gatatgagcc agaagaactt ttaggccgct caatttatga atattatcat 840 gctttggact ctgatcatct gaccaaaact catcatgata tgtttactaa aggacaagtc 900 accacaggac agtacaggat gcttgccaaa agaggtggat atgtctgggt tgaaactcaa 960 gcaactgtca tatataacac caagaattct caaccacagt gcattgtatg tgtgaattac 1020 gttgtgagtg gtattattca gcacgacttg attttctccc ttcaacaaac agaatgtgtc 1080 cttaaaccgg ttgaatcttc agatatgaaa atgactcagc tattcaccaa agttgaatca 1140 gaagatacaa gtagcctctt tgacaaactt aagaaggaac ctgatgcttt aactttgctg 1200 gccccagccg ctggagacac aatcatatct ttagattttg gcagcaacga cacagaaact 1260 gatgaccagc aacttgagga agtaccatta tataatgatg taatgctccc ctcacccaac 1320 gaaaaattac agaatataaa tttggcaatg tctccattac ccaccgctga aacgccaaag 1380 ccacttcgaa gtagtgctga ccctgcactc aatcaagaag ttgcattaaa attagaacca 1440 aatccagagt cactggaact ttcttttacc atgccccaga ttcaggatca gacacctagt 1500 ccttccgatg gaagcactag acaaagttca cctgagccta atagtcccag tgaatattgt 1560 ttttatgtgg atagtgatat ggtcaatgaa ttcaagttgg aattggtaga aaaacttttt 1620 gctgaagaca cagaagcaaa gaacccattt tctactcagg acacagattt agacttggag 1680 atgttagctc cctatatccc aatggatgat gacttccagt tacgttcctt cgatcagttg 1740 tcaccattag aaagcagttc cgcaagccct gaaagcgcaa gtcctcaaag cacagttaca 1800 gtattccagc agactcaaat acaagaacct actgctaatg ccaccactac cactgccacc 1860 actgatgaat taaaaacagt gacaaaagac cgtatggaag acattaaaat attgattgca 1920 tctccatctc ctacccacat acataaagaa actactagtg ccacatcatc accatataga 1980 gatactcaaa gtcggacagc ctcaccaaac agagcaggaa aaggagtcat agaacagaca 2040 gaaaaatctc atccaagaag ccctaacgtg ttatctgtcg ctttgagtca aagaactaca 2100 gttcctgagg aagaactaaa tccaaagata ctagctttgc agaatgctca gagaaagcga 2160 aaaatggaac atgatggttc actttttcaa gcagtaggaa ttggaacatt attacagcag 2220 ccagacgatc atgcagctac tacatcactt tcttggaaac gtgtaaaagg atgcaaatct 2280 agtgaacaga atggaatgga gcaaaagaca attattttaa taccctctga tttagcatgt 2340 agactgctgg ggcaatcaat ggatgaaagt ggattaccac agctgaccag ttatgattgt 2400 gaagttaatg ctcctataca aggcagcaga aacctactgc agggtgaaga attactcaga 2460 gctttggatc aagttaactg a 2481 <210> 2 <211> 826 <212> PRT <213> Homo sapience <400> 2 Met Glu Gly Ala Gly Gly Ala Asn Asp Lys Lys Lys Ile Ser Ser Glu   1 5 10 15 Arg Arg Lys Glu Lys Ser Arg Asp Ala Ala Arg Ser Arg Arg Ser Lys              20 25 30 Glu Ser Glu Val Phe Tyr Glu Leu Ala His Gln Leu Pro Leu Pro His          35 40 45 Asn Val Ser Ser His Leu Asp Lys Ala Ser Val Met Arg Leu Thr Ile      50 55 60 Ser Tyr Leu Arg Val Lys Leu Leu Asp Ala Gly Asp Leu Asp Ile  65 70 75 80 Glu Asp Asp Met Lys Ala Gln Met Asn Cys Phe Tyr Leu Lys Ala Leu                  85 90 95 Asp Gly Phe Val Met Val Leu Thr Asp Asp Gly Asp Met Ile Tyr Ile             100 105 110 Ser Asp Asn Val Asn Lys Tyr Met Gly Leu Thr Gln Phe Glu Leu Thr         115 120 125 Gly His Ser Val Phe Asp Phe Thr His Pro Cys Asp His Glu Glu Met     130 135 140 Arg Glu Met Leu Thr His Arg Asn Gly Leu Val Lys Lys Gly Lys Glu 145 150 155 160 Gln Asn Thr Gln Arg Ser Phe Phe Leu Arg Met Lys Cys Thr Leu Thr                 165 170 175 Ser Arg Gly Arg Thr Met Asn Ile Lys Ser Ala Thr Trp Lys Val Leu             180 185 190 His Cys Thr Gly His Ile His Val Tyr Asp Thr Asn Ser Asn Gln Pro         195 200 205 Gln Cys Gly Tyr Lys Lys Pro Pro Met Thr Cys Leu Val Leu Ile Cys     210 215 220 Glu Pro Ile Pro His Pro Ser Asn Ile Glu Ile Pro Leu Asp Ser Lys 225 230 235 240 Thr Phe Leu Ser Arg His Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp                 245 250 255 Glu Arg Ile Thr Glu Leu Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly             260 265 270 Arg Ser Ile Tyr Glu Tyr Tyr His Ala Leu Asp Ser Asp His Leu Thr         275 280 285 Lys Thr His His Asp Met Phe Thr Lys Gly Gln Val Thr Thr Gly Gln     290 295 300 Tyr Arg Met Leu Ala Lys Arg Gly Gly Tyr Val Trp Val Glu Thr Gln 305 310 315 320 Ala Thr Val Ile Tyr Asn Thr Lys Asn Ser Gln Pro Gln Cys Ile Val                 325 330 335 Cys Val Asn Tyr Val Val Ser Gly Ile Ile Gln His Asp Leu Ile Phe             340 345 350 Ser Leu Gln Gln Thr Glu Cys Val Leu Lys Pro Val Glu Ser Ser Asp         355 360 365 Met Lys Met Thr Gln Leu Phe Thr Lys Val Glu Ser Glu Asp Thr Ser     370 375 380 Ser Leu Phe Asp Lys Leu Lys Lys Glu Pro Asp Ala Leu Thr Leu Leu 385 390 395 400 Ala Pro Ala Ala Gly Asp Thr Ile Ile Ser Leu Asp Phe Gly Ser Asn                 405 410 415 Asp Thr Glu Thr Asp Asp Gln Gln Leu Glu Glu Val Pro Leu Tyr Asn             420 425 430 Asp Val Met Leu Pro Ser Pro Asn Glu Lys Leu Gln Asn Ile Asn Leu         435 440 445 Ala Met Ser Pro Leu Pro Thr Ala Glu Thr Pro Lys Pro Leu Arg Ser     450 455 460 Ser Ala Asp Pro Ala Leu Asn Gln Glu Val Ala Leu Lys Leu Glu Pro 465 470 475 480 Asn Pro Glu Ser Leu Glu Leu Ser Phe Thr Met Pro Gln Ile Gln Asp                 485 490 495 Gln Thr Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser G             500 505 510 Pro Asn Ser Ser Ser Glu Tyr Cys Phe Tyr Val Asp Ser Asp Met Val         515 520 525 Asn Glu Phe Lys Leu Glu Leu Val Glu Lys Leu Phe Ala Glu Asp Thr     530 535 540 Glu Ala Lys Asn Pro Phe Ser Thr Gln Asp Thr Asp Leu Asp Leu Glu 545 550 555 560 Met Leu Ala Pro Tyr Ile Pro Met Asp Asp Asp Phe Gln Leu Arg Ser                 565 570 575 Phe Asp Gln Leu Ser Pro Leu Glu Ser Ser Ser Ala Ser Pro Glu Ser             580 585 590 Ala Ser Pro Gln Ser Thr Val Thr Val Phe Gln Gln Thr Gln Ile Gln         595 600 605 Glu Pro Thr Ala Asn Ala Thr Thr Thr Thr Ala Thr Thr Asp Glu Leu     610 615 620 Lys Thr Val Thr Lys Asp Arg Met Glu Asp Ile Lys Ile Leu Ile Ala 625 630 635 640 Ser Pro Ser Pro Thr His Ile His Lys Glu Thr Thr Ser Ala Thr Ser                 645 650 655 Ser Pro Tyr Arg Asp Thr Gln Ser Arg Thr Ala Ser Pro Asn Arg Ala             660 665 670 Gly Lys Gly Val Ile Glu Gln Thr Glu Lys Ser His Pro Arg Ser Pro         675 680 685 Asn Val Leu Ser Val Ala Leu Ser Gln Arg Thr Thr Val Pro Glu Glu     690 695 700 Glu Leu Asn Pro Lys Ile Leu Ala Leu Gln Asn Ala Gln Arg Lys Arg 705 710 715 720 Lys Met Glu His Asp Gly Ser Leu Phe Gln Ala Val Gly Ile Gly Thr                 725 730 735 Leu Leu Gln Gln Pro Asp Asp His Ala Ala Thr Thr Ser Leu Ser Trp             740 745 750 Lys Arg Val Lys Gly Cys Lys Ser Ser Glu Gln Asn Gly Met Glu Gln         755 760 765 Lys Thr Ile Ile Leu Ile Pro Ser Asp Leu Ala Cys Arg Leu Leu Gly     770 775 780 Gln Ser Met Asp Glu Ser Gly Leu Pro Gln Leu Thr Ser Tyr Asp Cys 785 790 795 800 Glu Val Asn Ala Pro Ile Gln Gly Ser Arg Asn Leu Leu Gln Gly Glu                 805 810 815 Glu Leu Leu Arg Ala Leu Asp Gln Val Asn             820 825 <210> 3 <211> 23 <212> DNA <213> HIF-1a siRNA <400> 3 ccuaucccaa uggaugaugd tdt 23

Claims (7)

HIF-1α 유전자의 siRNA, 안티센스, shRNA, 또는 HIF-1α에 특이적으로 결합하는 항체를 유효성분으로 함유하는 흉선 기질 림포포이에틴 (Thymic stromal lymphopoietin, TSLP)에 의해 매개되는 질환 예방 또는 치료용 약제학적 조성물.For the prophylaxis or treatment of diseases mediated by thymic stromal lymphopoietin (TSLP) containing an siRNA, antisense, shRNA, or an antibody specifically binding to HIF-1α of the HIF-1α gene as an active ingredient A pharmaceutical composition. 제1항에 있어서, 상기 siRNA은 서열번호 3으로 표시되는 염기서열을 갖는 것은 특징으로 하는 약제학적 조성물.2. The pharmaceutical composition according to claim 1, wherein the siRNA has the nucleotide sequence of SEQ ID NO: 3. JNK 억제제, ERK 억제제 또는 p38 억제제를 유효성분으로 함유하는 흉선 기질 림포포이에틴 (Thymic stromal lymphopoietin, TSLP)에 의해 매개되는 질환 예방 또는 치료용 약제학적 조성물.A pharmaceutical composition for preventing or treating a disease mediated by Thymic stromal lymphopoietin (TSLP), which comprises a JNK inhibitor, an ERK inhibitor or a p38 inhibitor as an active ingredient. 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 질환은 염증성질환, 또는 알레르기질환인 약제학적 조성물.4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the disease is an inflammatory disease or an allergic disease. 제4항에 있어서, 상기 질환은 자외선에 의한 피부염증성질환 또는 아토피성 피부염인 약제학적 조성물.The pharmaceutical composition according to claim 4, wherein the disease is skin inflammatory disease or atopic dermatitis due to ultraviolet light. (i) HIF-1α 유전자의 뉴클레오타이드 서열, (ii) 상기 뉴클레오타이드의 단편, (iii) 상기 뉴클레오타이드 서열 또는 그 단편에 상보적인 서열, (iv) HIF-1α 유전자로부터 발현되는 단백질, 또는 (v) 그 단백질에 특이적인 결합제를 포함하는 것을 특징으로 하는 피부 염증성질환 진단용 키트.(i) a nucleotide sequence of the HIF-1 alpha gene, (ii) a fragment of the nucleotide, (iii) a sequence complementary to the nucleotide sequence or a fragment thereof, (iv) a protein expressed from the HIF- A kit for diagnosing skin inflammatory disease, comprising a protein-specific binding agent. 1) HIF-1a의 전사 조절에 관여하는 전사인자를 찾는 단계;
2) 상기 전사인자를 조절하는 물질을 선발(screening)하는 단계; 및
3) 상기 물질이 HIF-1a 유전자의 발현을 조절하는 활성을 나타내는지를 결정하는 단계를 포함하는 TSLP 매개되는 질환 치료제 스크리닝 방법.1) searching for transcription factors involved in transcriptional regulation of HIF-1a;
2) screening the substance that modulates the transcription factor; And
3) determining whether the substance exhibits an activity of regulating the expression of the HIF-1a gene.
KR20120157584A 2012-12-28 2012-12-28 COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES COMPRISING siRNA AGAINST HIF-1α AS AN ESSENTIAL COMPONENT KR101492435B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR20120157584A KR101492435B1 (en) 2012-12-28 2012-12-28 COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES COMPRISING siRNA AGAINST HIF-1α AS AN ESSENTIAL COMPONENT

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR20120157584A KR101492435B1 (en) 2012-12-28 2012-12-28 COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES COMPRISING siRNA AGAINST HIF-1α AS AN ESSENTIAL COMPONENT

Publications (2)

Publication Number Publication Date
KR20140086742A true KR20140086742A (en) 2014-07-08
KR101492435B1 KR101492435B1 (en) 2015-02-10

Family

ID=51735932

Family Applications (1)

Application Number Title Priority Date Filing Date
KR20120157584A KR101492435B1 (en) 2012-12-28 2012-12-28 COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES COMPRISING siRNA AGAINST HIF-1α AS AN ESSENTIAL COMPONENT

Country Status (1)

Country Link
KR (1) KR101492435B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9564469B2 (en) 2014-08-21 2017-02-07 Samsung Electronics Co., Ltd. Image sensor comprising a color separation device separating incident light into plural of colors for having improved light utilization efficiency and method of manufacturing the same

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NZ540779A (en) * 2002-11-01 2008-05-30 Univ Pennsylvania Compositions and methods for siRNA inhibition of HIF-1 alpha
JP5688370B2 (en) * 2008-10-22 2015-03-25 リバルシオ コーポレイション Compositions and methods for treating thymic stromal lymphogenic factor (TSLP) mediated conditions

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9564469B2 (en) 2014-08-21 2017-02-07 Samsung Electronics Co., Ltd. Image sensor comprising a color separation device separating incident light into plural of colors for having improved light utilization efficiency and method of manufacturing the same

Also Published As

Publication number Publication date
KR101492435B1 (en) 2015-02-10

Similar Documents

Publication Publication Date Title
Magenta et al. Nitric oxide, oxidative stress, and p66Shc interplay in diabetic endothelial dysfunction
Essafi-Benkhadir et al. Tristetraprolin inhibits Ras-dependent tumor vascularization by inducing vascular endothelial growth factor mRNA degradation
Chen et al. The role of cytochrome c oxidase subunit Va in non-small cell lung carcinoma cells: association with migration, invasion and prediction of distant metastasis
Tapparel et al. The TPTE gene family: cellular expression, subcellular localization and alternative splicing
Talwar et al. Caspase-mediated cleavage of RNA-binding protein HuR regulates c-Myc protein expression after hypoxic stress
Gudey et al. Pro-invasive properties of Snail1 are regulated by sumoylation in response to TGFβ stimulation in cancer
Valente et al. TRAF3IP2 mediates interleukin-18-induced cardiac fibroblast migration and differentiation
KR20100077160A (en) Use of trim72 as a target for muscle and heart enhancer
KR20120085593A (en) Use of a novel transmembrane protein of Lrig-1 in a regulatory T cell
Santra et al. Ectopic decorin expression up‐regulates VEGF expression in mouse cerebral endothelial cells via activation of the transcription factors Sp1, HIF1α, and Stat3
Chen et al. EphA1 receptor silencing by small interfering RNA has antiangiogenic and antitumor efficacy in hepatocellular carcinoma
AU2013252159B2 (en) Inhibitors of thioredoxin-interacting protein (TXNIP) for therapy
KR101492435B1 (en) COMPOSITION FOR PREVENTING OR TREATING TSLP-MEDIATED DISEASES COMPRISING siRNA AGAINST HIF-1α AS AN ESSENTIAL COMPONENT
US9068984B2 (en) Compositions and methods for treatment of neuropathic pain
KR20200121844A (en) VRAC protein LRRC8A for use in altering the differentiation of epidermal keratinocytes
US20130095169A1 (en) Compositions and Methods for Reduced Scarring and for Treatment of Fibrosis
WO2005111213A1 (en) Target gene mimitin of myc
KR20170083313A (en) miR-122 regulates allergic reactions
Wegrzyn et al. Mimitin–a novel cytokine-regulated mitochondrial protein
US7510708B2 (en) Disruption of the REG pathway
US20040087480A1 (en) Calcium channel target for controlling epidermal keratinocyte growth in psoriasis, and basal and squamous cell carcinomas
EP2670772B1 (en) Antagonists of grasp55 for use as a medicament
US20210052598A1 (en) Compositions and methods for treating cancer
KR101062167B1 (en) A composition for treating cancer comprising a Vir 2.2 inhibitor
US10036015B2 (en) Composition and methods for reduced scarring and treatment of fibrosis

Legal Events

Date Code Title Description
A201 Request for examination
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180112

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20200203

Year of fee payment: 6