KR20140069216A - Ngf aptamer and application thereof - Google Patents

Abstract

(상기 식에서, N은 A, G, C, U 및 T로 이루어진 군에서 선택되는 하나의 뉴클레오티드이고, N11∼N13, N21∼N23, N32∼N38 및 N42∼N48은, 각각 동일하거나 또는 상이하며, A, G, C, U 및 T로 이루어진 군에서 선택되는 1개 혹은 2개의 뉴클레오티드, 또는 결합이고, N14, N24, N31, N41, N39 및 N49는, 각각 동일하거나 또는 상이하며, A, G, C, U 및 T로 이루어진 군에서 선택되는 하나의 뉴클레오티드로서, N14와 N24, N31과 N41 및 N39와 N49는 상호 왓슨-크릭 염기쌍을 형성하고, N11-N12-N13-N14와 N21-N22-N23-N24의 조합으로 스템 구조를 형성할 수 있는 뉴클레오티드 서열이며, N31-N32-N33-N34-N35-N36-N37-N38-N39와 N41-N42-N43-N44-N45-N46-N47-N48-N49의 조합으로 스템 구조를 형성할 수 있는 뉴클레오티드 서열이다.)The present invention provides an abatumer that binds to NGF capable of forming a potential secondary structure represented by formula (I).

Wherein N is a single nucleotide selected from the group consisting of A, G, C, U and T, and N11 to N13, N21 to N23, N32 to N38 and N42 to N48 are the same or different, N14, N24, N31, N41, N39 and N49 are each the same or different and are A, G, C, U and T, Wherein N14 and N24, N31 and N41, and N39 and N49 form a mutual Watson-Crick base pair, and N11-N12-N13-N14 and N21-N22-N23 N24-N37-N38-N39 and N41-N42-N43-N44-N45-N46-N47-N48-N39, which are nucleotide sequences capable of forming a stem structure by a combination of N49 is a nucleotide sequence capable of forming a stem structure.)

Description

[0001] NGF APTAMER AND APPLICATION THEREOF [0002]

The present invention relates to an abtamer for NGF and its use.

Nerve growth factor NGF (nerve growth factor) is the first neurotrophin identified in 1951. It is an important secretory protein involved in the development and survival of peripheral and central neurons. It consists of 118 amino acids, has a molecular weight of 13 kDa, and has 3 S-S bonds in the molecule.

The receptors for NGF are known to be high-tyrosine tyrosine kinase receptor TrkA and p75 belonging to the low-affinity tumor necrosis factor receptor superfamily. These receptors act as homodimers or heterodimers and are deeply involved in the generation and maintenance of the nervous system. TrkA is a single transmembrane receptor with a tyrosine kinase structure in the intracellular domain. When NGF is bound, tyrosine phosphorylation occurs, and a signal is transmitted downstream to promote the differentiation and survival of the cell.

TrkB and TrkC are known as TrkA family receptors. TrkB binds to BDNF and NT-4/5, and TrkC binds to NT-3. p75 has low ligand specificity compared to TrkA and binds to BDNF, NT-3 and NT-4/5 in addition to NGF. p75 is a single transmembrane receptor but lacks the tyrosine kinase domain on the cytoplasmic side. Like TrkA, it is expressed in nerve cells as well as nerve cells. It is known that this receptor is involved in promoting differentiation or survival of cells as well as inducing apoptosis or cell migration. From the results of the crystal structure analysis, it was suggested that homodimeric NGF binds 2: 2 with TrkA but binds with p75 at 2: 1. Homodimeric NGF binds to a heterodimer of TrkA and p75 in some cases.

It is well known that NGF plays an important role in the nervous system. It is clear that it has an action to maintain the survival of cholinergic neurons and is thought to be related to Alzheimer's disease. In addition, administration of NGF in the brain of aged rats is expected to be effective as a remedy for senile dementia because improvement of memory impairment is recognized.

NGF is also associated with inflammation and increased expression of NGF is observed in patients with inflammatory diseases or in inflammatory animal models. For example, systemic lupus erythematosus, multiple sclerosis, psoriasis, arthritis, interstitial cystitis, asthma, and the like. It has been reported that the concentration of NGF in the bone fluid of rheumatoid arthritis patients is increasing. In addition, improvement of NGF expression of rheumatoid model rats, increase of mast cells in arthritic model mice, and improvement of NGF expression have been reported.

NGF is deeply involved in pain. When NGF is subcutaneously administered to humans, deep neck pain such as myalgia continues for many days and hyperalgesia of the injection site occurs. NGF knockout mice and TrkA knockout mice lose their anterior nerves and feel pain. Intraperitoneal administration of 1 mg / kg of NGF to mature rats results in hyperalgesia to invasive fever or mechanical irritation. NGF transgenic mice exhibit hyperalgesia without inflammatory symptoms. It is also known that abnormalities in the TrkA gene in patients with congenital painless infarction (CIPA) or abnormalities in the NGF gene cause a decrease in pain.

Thus, it can be understood that the NGF inhibitor can be used as a remedy for pain such as invasive water-soluble pain, inflammatory pain, neuropathic pain, cancer pain, and fibromuscular pain.

Recently, the application of the RNA tympanic drugs to therapeutic drugs, diagnostic reagents and reagents is attracting attention, and several RNA aptamers are in clinical or practical use. In December 2004, Macugen, the world's first RNA tamtamer, was approved in the US as a remedy for macular degeneration. RNA abatamer is an RNA that specifically binds to a target substance such as a protein, and can be produced using SELEX (Systematic Evolution of Ligands by Exponential Enrichment) (Patent Literatures 1 to 3). SELEX is a method of screening for RNA that specifically binds to a target substance in a pool of RNA having about 10 ¹⁴ different nucleotide sequences. The RNA used has a structure with a random sequence of about 40 residues interposed between the primer sequences. This RNA pool is associated with the target substance, and only the RNA bound to the target substance is recovered using a filter or the like. The recovered RNA is amplified by RT-PCR and used as a template for the next round. By repeating this operation about 10 times, it is sometimes possible to obtain an RNA plasmid that specifically binds to a target substance.

Although platameric drugs can target extracellular factors as well as antibody drugs, there is a possibility that in some respects, antibody medicines may be exceeded by reference to many already published academic papers. For example, aptamers often have higher binding and specificity than antibodies. In addition, immunosuppression is unlikely to occur and side effects such as antibody-specific antibody-dependent cell damage (ADCC) and complement dependent cell damage (CDC) do not occur. From the viewpoint of delivery, the aptamer is about one tenth the size of the antibody, so it is easier to deliver the drug to a desired site. Because aptamers are produced by chemical synthesis, various formulas can be easily inserted, and cost reduction by mass production is possible. On the other hand, the blood half-life of platamer is generally shorter than that of antibody. However, this viscosity may be advantageous when considering toxicity. In view of the above, even in the case of a drug targeting the same molecule, the platameric drug may be better than the antibody drug.

The inventors of the present invention have found that an oppressor which binds to NGF and inhibits binding of NGF to NGF receptor is produced, which inhibits neurite outgrowth activity by NGF (Patent Document 4). On the other hand, Patent Literature 5 discloses an aptamer for NGF obtained by automated SELEX, and Patent Document 6 describes an altered and modified form of an extruder obtained in Patent Document 4.

Patent Document 1: WO91 / 19813 Patent Document 2: International Publication No. WO94 / 08050 Patent Document 3: International Publication No. WO95 / 07364 Patent Document 4: International Publication No. WO2010 / 035725 Patent Document 5: International Publication No. WO02 / 077262 Patent Document 6: International Publication No. WO03 / 070984

It is an object of the present invention to provide an umbrella for NGF, a method of using the same, and the like. In particular, for the purpose of providing NGF antagonist suitable for pharmaceutical use, that is, a high-specificity NGF specificity for NGF activity (neurite outgrowth activity, TF-1 cell proliferation activity) inhibitory activity with a short-chain length do.

DISCLOSURE OF THE INVENTION The present inventors have intensively studied in order to solve the above problems and found that as compared with a conventionally known NGF antitumor having an IC ₅₀ value of 1 nM or less for neurite outgrowth inhibition, Of NGF < RTI ID = 0.0 > plamer, < / RTI > to complete the present invention.

That is, the present invention provides the following inventions and the like.

[1] Aptamers that bind to NGF capable of forming a potential secondary structure represented by formula (I).

Wherein N is a single nucleotide selected from the group consisting of A, G, C, U, and T,

N11 to N13, N21 to N23, N32 to N38 and N42 to N48 are the same or different and are one or two nucleotides or bonds selected from the group consisting of A, G, C, U and T,

N14, N24, N31, N41, N39 and N49 are each the same or different and are one nucleotide selected from the group consisting of A, G, C, U and T,

N14 and N24, N31 and N41, and N39 and N49 form a mutually Watson-Crick base pair,

A nucleotide sequence capable of forming a stem structure by a combination of N11-N12-N13-N14 and N21-N22-N23-N24,

N31-N32-N33-N34-N35-N36-N37-N38-N39 and N41-N42-N43-N44-N45-N46-N47-N48-N49 are nucleotide sequences capable of forming a stem structure.

[2] The nucleotide sequence according to [1] above, wherein N11 to N13, N21 to N23, N32 to N38 and N42 to N48 are the same or different and each is a single nucleotide selected from the group consisting of A, G, C, .

[3] The thermometer according to the above [1] or [2], wherein N14 is U, N24 is A, N31 is G, N41 is C, N39 is G,

[1] to [3] above, wherein at least four Watson-Creek base pairs are formed by N32-N33-N34-N35-N36-N37-N38 and N42-N43-N44- An abdominal as set forth in any one of claims 1 to 6.

[5] An abatumer according to [1], which is any one of the following (a) or (b):

(a) a nucleic acid comprising a nucleotide sequence selected from SEQ ID NO: 3, SEQ ID NOs: 9 to 13, SEQ ID NOs: 22 to 117 and SEQ ID NOs: 152 to 168, wherein uracil may be thymine;

(b) a nucleic acid consisting of a nucleotide sequence in which one or several nucleotides are substituted, deleted, inserted or added in the nucleotide sequence of (a), and which binds to NGF.

[6] The plaster according to any one of [1] to [5], wherein the base length is 50 or less.

[7] The plethora according to any one of [1] to [6], wherein at least one nucleotide is modified.

[8] An extender as described in [7], wherein the extender is modified with inverted dT or polyethylene glycol.

[9] The plaster according to the above [8], wherein the inverted dT or polyethylene glycol is bonded to the 5 'end or the 3' end of the plaster.

[10] The pharmaceutical composition according to any one of [1] to [10], wherein the hydroxyl group at the 2 'position of the ribosome of each pyrimidine nucleotide is the same or different and is either unsubstituted or substituted with an atom or group selected from the group consisting of a hydrogen atom, The plummeter according to any one of [7] to [9].

[11] The pharmaceutical composition according to any one of [1] to [6], wherein the hydroxyl group at the 2 'position of the ribose of each purine nucleotide is the same or different and is unsubstituted or substituted with an atom or group selected from the group consisting of hydrogen, 7] to [9].

[12] The plethora according to any one of [1] to [11], which inhibits neurite outgrowth activity and / or cell proliferation activity of NGF.

[13] A pharmaceutical composition comprising the compression tablet according to any one of [1] to [12] above.

[14] An antitumor control comprising the platemer according to any one of [1] to [12] above.

[15] An anti-inflammatory agent comprising the platematerial according to any one of [1] to [12] above.

[16] A method for treating or preventing a disease associated with pain or inflammation, which comprises administering the depressant according to any one of [1] to [12] to a subject in need thereof.

[17] An abdominal as described in any one of [1] to [12] above, for the treatment or prevention of a disease accompanied by pain or inflammation.

Since the platemer or nucleic acid of the present invention exhibits excellent NGF inhibitory activity, particularly high neurite outgrowth inhibitory activity, by taking the above-described constitution, it can be useful as medicines for diseases such as pain and inflammatory diseases.

Fig. 1 is a schematic diagram of the predicted secondary structure of the NGF abbrutant represented by SEQ ID NO: 3. The upper left stem-loop structure corresponds to the consensus secondary structure 1.
2 is a schematic diagram showing a consensus secondary structure 1 represented by the nucleotide sequence of the NGF abbrutant represented by SEQ ID NO: 12.
FIG. 3 is a sensorgram showing that the NGF abortamer (modified construct) shown in SEQ ID NO: 82 (2) binds to NGF, NT-3 and NT-4. The RU on the vertical axis represents the Relative Unit, and Resp.Diff. Represents the Response Differences. The horizontal axis represents time (seconds) (Time (s)). These notations in the vertical and horizontal axes are the same in Figs. 4 to 5 below.
Fig. 4 is a sensorgram showing that the NGF-aptamer (modified construct) shown in SEQ ID NO: 82 (2) inhibits the binding of NGF to the NGF receptor TrkA.
Fig. 5 is a sensorgram showing that the NGF aptamer (modified construct) shown in SEQ ID NO: 82 (2) inhibits the binding of NGF to the NGF receptor p75.

The present invention relates to the potential secondary structure represented by formula (I)

Wherein N is a single nucleotide selected from the group consisting of A, G, C, U, and T,

N11 to N13, N21 to N23, N32 to N38 and N42 to N48 are the same or different and are one or two nucleotides or bonds selected from the group consisting of A, G, C, U and T,

N14, N24, N31, N41, N39 and N49 are each the same or different and are one nucleotide selected from the group consisting of A, G, C, U and T,

N14 and N24, N31 and N41, and N39 and N49 form a mutually Watson-Crick base pair,

A nucleotide sequence capable of forming a stem structure by a combination of N11-N12-N13-N14 and N21-N22-N23-N24,

N31-N32-N33-N34-N35-N36-N37-N38-N39 and N41-N42-N43-N44-N45-N46-N47-N48-N49 are nucleotide sequences capable of forming a stem structure. (Hereinafter, referred to as " the inventive platamer ") capable of forming NGF. The nucleotide sequence may be subjected to the following formula.

Abtammer refers to a nucleic acid molecule having binding activity to a given target molecule. The aptamer can inhibit the activity of a predetermined target molecule by binding to a predetermined target molecule. The aptamer of the present invention is an aptamer having binding activity to NGF. According to a preferred embodiment, the aptamer of the present invention binds to NGF and inhibits the binding of NGF to the NGF receptor, thereby inhibiting the activity of NGF.

The aptamer of the present invention may be a nucleic acid such as RNA, DNA, modified nucleic acid or a mixture thereof. Therefore, in the following, the aptamer of the present invention may be referred to as " the nucleic acid of the present invention "

Single-stranded nucleic acids can take on various secondary structures. Potential secondary structure " means a secondary structure that any one single-stranded nucleic acid can take thermodynamically from the primary structure, and in particular, the potential secondary structure in the squidramer of the present invention is the same as in Example 5 Is a secondary structure that can be predicted using the MFOLD program described in Fig. Therefore, nucleic acids that do not actually take the secondary structure are also included in the plethora of the present invention as long as they have a primary structure capable of taking the secondary structure represented by the above formula (I).

Therefore, the aptamer of the present invention is preferably a nucleic acid molecule capable of taking a secondary structure stably represented by the above formula (I) thermodynamically in view of its primary structure, and in this sense, (I). ≪ / RTI >

The potential secondary structure represented by the formula (I) is a so-called " stem-loop structure ", in particular, a stem structure which can be formed by a combination of N11-N12-N13-N14 and N21- N34-N47-N47-N49-N49-N32-N33-N34-N35-N36-N37-N38-N39 and N41-N42-N43- (Referred to as " internal loop 1 " in this specification) and also has a loop structure (referred to as " loop 2 " in this specification) between N39 and N49.

Refers to a structure in which a partial nucleotide sequence having complementarity in a nucleic acid molecule forms a Watson-Crick base pair (GC or AU / T). In this specification, N11-N12- N42-N24 and N31-N32-N33-N34-N35-N36-N37-N38-N39 and N41-N42-N43-N44-N45-N46-N47-N48-N49 need not be perfectly complementary, / / Allow wobbling of GU / T. That is, when nucleotides at both ends of a partial nucleotide sequence forming a stem structure form a Watson-Crick base pair, it is not necessarily required that all of the other nucleotides form a Watson-Crick base pair.

In the formula (I), "N" located at the loop 2 portion is a single nucleotide selected from the group consisting of A, G, C, U, and T. In one preferred embodiment, "N"

In the formula (I), N11 to N13, N21 to N23, N32 to N38 and N42 to N48 are the same or different and each represents one or two groups selected from the group consisting of A, G, C, U and T Nucleotides, or linkages. When Ni (i is an integer selected from 11 to 13, 21 to 23, 32 to 38, and 42 to 48) is "two nucleotides", these two nucleotides may be the same or different. When Ni is " two nucleotides " or " binding ", preferably, two or less, more preferably no more than one, of N11 to N13, N21 to N23, N32 to N38, . Therefore, N11 to N14 and N21 to N24 forming one stem structure preferably have a length of 2 to 6 nucleotides, more preferably 3 to 5 nucleotides, respectively, and N31 to N24, which form the other stem structure, N39 and N41 to N49 preferably have a length of 7 to 11 nucleotides, more preferably 8 to 10 nucleotides.

The term " binding " means a single bond, and when any Ni in the formula (I) is referred to as a " bond ", the nucleotides adjacent to the nucleotide are connected by a phosphodiester bond .

Particularly preferably, N11 to N13, N21 to N23, N32 to N38 and N42 to N48 are the same or different, and are one nucleotide selected from the group consisting of A, G, C, U and T. Therefore, the stem length of the stem structure including both ends of the portion forming the secondary structure is preferably 4 nucleotides or less, and the stem length of the internal stem structure sandwiched between the two loops is preferably 9 nucleotides .

In the formula (I), N14, N24, N31, N41, N39 and N49 are the same or different and each is a single nucleotide selected from the group consisting of A, G, C, U and T, N24, N31 and N41 and N39 and N49 form a Watson-Crick base pair (GC or AU / T). Therefore, the stem structure including both ends of the portion forming the secondary structure forms a base pair at least at the partial end of the inner loop 1, and the inner stem structure sandwiched between the two loops forms base pairs at both ends have. More preferably, N14 is U, N24 is A, N31 is G, N41 is C, N39 is G, and N49 is C.

N11-N12-N13 and N21-N22-N23 and N32-N33-N34-N35-N36-N37-N38 and N42-N43-N44-N45-N46 in the "stem structure" It is not necessary to be completely complementary with respect to -N47-N48 (not all need to form a Watson-Crick base pair), but the complementarity to form a stem structure (no loop (bubble) You need to have it. Specifically, since loops can be formed if three consecutive mismatches or GU / T wobbling are included in each stem structure, each stem structure will have three consecutive mismatches or wobbling of GU / T It is preferable not to include it. In each of N11-N12-N13 and N21-N22-N23, N32-N33-N34-N35-N36-N37-N38 and N42-N43-N44-N45- Preferably at least 60%, more preferably at least 70%, of nucleotides forming a Watson-Crick base pair.

The present invention also provides a nucleic acid comprising any of the following nucleotide sequences (a) or (b).

(a) a nucleotide sequence selected from SEQ ID NO: 3, SEQ ID NOs: 9 to 13, SEQ ID NOs: 22 to 117 and SEQ ID NOs: 152 to 168, provided that uracil may be thymine.

(b) a nucleotide sequence in which, in the nucleotide sequence of (a), one or several nucleotides are substituted, deleted, inserted or added, and bind to NGF.

These nucleic acids may form a latent secondary structure represented by the above formula (I).

On the other hand, the uracil or the thymine on the sequence can be substituted, but the uracil to be substituted is preferably selected so as to maintain the activity possessed by the aptamer of the present invention, preferably the internal loop 1 portion and the loop 2 portion It may be a uracil in other parts.

As used herein, the term "sequence number" means a nucleotide sequence of each plasmid or nucleic acid. For example, "a nucleic acid comprising the sequence of SEQ ID NO: 1" means a nucleic acid comprising a sequence of SEQ ID NO: , A modified nucleic acid, or a nucleic acid composed of both of them. The nucleotide sequence of each plasmid is shown in the sequence table.

In the above (b), the number of nucleotides to be substituted, deleted, inserted or added is, for example, about 1 to 10, preferably 1 to 6, more preferably 1 to 5, , And most preferably one or two.

In the above (b), the position of the nucleotide to be substituted, deleted, inserted or added is not particularly limited. However, in order to maintain the activity of the aptamer of the present invention, preferably the internal loop 1 And the nucleotide in the portion other than the loop 2 portion.

The length of the nucleotide of the plasmid or nucleic acid of the present invention is not particularly limited, but is usually 34 to about 200 nucleotides, preferably 34 to about 100 nucleotides, more preferably 36 to 60 nucleotides, 44 nucleotides. The base length of the plummeter or nucleic acid of the present invention is preferably 50 or less, and more preferably 44 or less. By reducing the total number of nucleotides in the range capable of forming the potential secondary structure represented by the above formula (I), the chemical synthesis and mass production of the platemer are facilitated, and the cost merit is also great. In addition, such aptamers are considered to be easily chemically modified, easy to improve in vivo stability, and low in toxicity.

The aptamer of the present invention may further comprise a plurality of ligands of the nucleic acid comprising the nucleotide sequence of (a), a plurality of ligands of the nucleic acid comprising the nucleotide sequence of (b), and a nucleic acid comprising the nucleotide sequence of (a) And a plurality of linkages of a nucleic acid comprising the nucleotide sequence of (b) above.

These linkages can also bind to NGF and / or inhibit the activity of NGF (such as binding activity with NGF receptors).

Here, the connection can be performed by tandem coupling. Further, a linker may be used when connecting. As the linker, nucleotide chains (e.g., 1 to about 20 nucleotides) and non-nucleotide chains (e.g., - (CH _{2) n} - _{linker, - (CH 2 CH 2 O} ) n - linker, hexaethylene glycol linker, TEG linker, A linker comprising a peptide, a linker comprising a -SS-bond, a linker comprising a -CONH- bond, and a linker comprising a -OPO ₃ - bond). The plural pieces in the plurality of connecting parts are not particularly limited as long as they are two or more, but may be, for example, two, three or four.

Each nucleotide included in the platemer of the present invention may be the same or different and may be a nucleotide including a hydroxyl group on the 2 'side of a ribose (for example, a ribosome of a pyrimidine nucleotide, a ribose of a purine nucleotide) Nucleotides), or nucleotides on the 2 'end of the ribose in which the hydroxyl group is replaced by any atom or group. Examples of such an arbitrary atom or group include a hydrogen atom, a fluorine atom or an -O-alkyl group (e.g., -O-Me group), an -O-acyl group (e.g., -O- NH ₂ group). Hereinafter, the case where the hydroxyl group is substituted with a hydrogen atom, a fluorine atom or an -O-Me group on the 2 'position of the ribose, respectively.

The aptamers of the present invention may also be modified so that at least one (e.g., 1, 2, 3 or 4) nucleotides are present on the 2'-end of the ribose with a hydroxyl group or any of the aforementioned atoms or groups, (E.g., 2, 3 or 4) groups selected from the group consisting of a fluorine atom, a hydroxyl group, and a -O-Me group.

The aptamers of the present invention may also be those in which all the pyrimidine nucleotides are the same or different and on the 2 ' of the ribosomes are nucleotides substituted with fluorine atoms, or any of the atoms or groups described above, preferably hydrogen atoms, And a nucleotide substituted with an atom or a group selected from the group consisting of a methoxy group, an ethoxy group and a methoxy group.

 The aptamers of the present invention may also be used in such a way that all the purine nucleotides are the same or different and on the 2 ' of the ribosomes are nucleotides that are substituted by hydroxyl groups, or any of the atoms or groups described above, preferably a hydrogen atom, And a nucleotide substituted with an atom or a group selected from the group consisting of a fluorine atom.

The aptamer of the present invention can also be produced by a method in which all the nucleotides have a hydroxyl group or a group consisting of any of the above-mentioned atoms or groups such as a hydrogen atom, a fluorine atom, a hydroxyl group, and a -O- Lt; RTI ID = 0.0 > of: < / RTI >

On the other hand, in the present specification, the nucleotide constituting the squid polymer is assumed to be RNA (that is, the sugar group is assumed to be ribose), and the expression in the nucleotide sequence is described. This does not mean that the DNA is excluded from the nucleotide, but can be appropriately read into the DNA. For example, when the nucleotide constituting the tympanic membrane is DNA, the substitution of the hydroxyl group at the 2 ' position of the ribose with X can be alternatively replaced with the substitution of one hydrogen atom at the 2 ' position of the deoxyribose with X. [

In addition, in the platemater of the present invention, by replacing uracil with thymine, the binding property to NGF, the binding inhibition activity between NGF and NGF receptor, the neurite outgrowth inhibitory activity of NGF, the cell proliferation inhibitory activity of NGF, Stability of drug delivery, stability in blood, and the like can be improved.

The NGF binding to the aptamer of the present invention is a known neurotrophin and is an important secretory protein involved in the development and survival of peripheral and central neurons. NGF in the present invention means, in particular, beta type NGF. The amino acid sequence of human β-NGF is represented by Accession Numbers NP002497, P01138, AAI26151, AAI26149, and CAB75625, and the amino acid sequence of human β-NGF may be a mutation, a functional domain thereof, or a peptide fragment. It is also possible to use not only monomers but also dimers or multimers. It is also to be understood that mammals other than humans such as primates (e.g., monkeys), rodents (e.g., mice, rats and marmots) and pets, livestock and ministry animals (e.g. dogs, cats, horses, cows, ) ≪ / RTI > derived from NGF.

The aptamers of the present invention inhibit the activity of NGF by binding to NGF and inhibiting the binding of NGF to the NGF receptor. As long as the binding of NGF to the NGF receptor can be inhibited, the aptamer of the present invention may be bound to any part of NGF.

As used herein, the term " inhibitory activity against NGF " means an inhibitory effect on any activity possessed by NGF. Inhibition of NGF receptor downstream signaling (Ras-MAP kinase pathway, PI3 kinase pathway) resulting from binding of NGF to NGF receptor, inhibition of TRPV1, SP, BDNF, etc. Inhibition of expression of HA, BK, PG, NGF, and other cytokines released from mast cells and the like, as well as differentiation and survival of neurons induced by NGF, neurite outgrowth, increase in vascular permeability, Inhibition of lymphocyte differentiation, inhibition of proliferation of various cells such as mast cells, leukemia cells, and cancer cells, reduction of pain and hyperalgesia induced by NGF, and the like.

The "inhibitory activity against NGF" of the aptamer of the present invention is an activity inhibiting the binding of NGF to the NGF receptor and is an activity inhibiting the neurite outgrowth activity induced by NGF, a cell proliferation induced by NGF And activity to inhibit the activity.

The aptamer of the present invention binds to NGF in a physiological buffer (e.g., Solution A: see Example 1). The aptamer of the present invention binds to NGF with an intensity that can be detected, for example, by the following test.

For the measurement, BIAcore 2000 manufactured by BIAcore is used. Fix the platemer on the sensor chip. The amount of immobilization is 1000 RU. NGF solution (0.5 μM) is prepared by physiological buffer containing 0.3 M NaCl (solution A: see Example 1). 20 μl of this NGF solution is injected to detect binding of NGF to the squamous cell. When an RNA containing a random nucleotide consisting of 40 nucleotides is used as a negative control and the NGF is significantly more strongly bound to the squamous cell than the control RNA, it is determined that the aptamer has binding ability to NGF.

As used herein, the term "NGF receptor" refers to a cell surface protein to which NGF binds. As NGF receptors, TrkA and p75 are known. The NGF receptor referred to in the present invention may be a protein containing a natural amino acid sequence or a mutant thereof. Herein, the "variant" refers to a protein or a peptide which has a plurality of amino acid substitutions of "NGF receptor" or a part of the amino acid sequence thereof and has a binding activity to NGF, and inhibits binding of NGF and NGF receptor .

The aptamer of the present invention is an alphamer which binds to NGF and inhibits binding of NGF to NGF receptor. Whether or not aptamers inhibit the binding of NGF to NGF receptors can be evaluated, for example, by the following test.

For the measurement, BIAcore 2000 manufactured by BIAcore is used. Fc fusion protein (e.g., TrkA-Fc (175-TK, R & D systems) or p75-Fc (R & D systems)) is immobilized on the CM5 sensor chip. The amount of immobilization is 500 to 700 RU. NGF (0.1 μM) and aptamer (0.2 μM) are mixed in a physiological buffer (solution A: see Example 1), and a mixed solution to be a sample is prepared for 30 minutes. This mixed solution is injected into BIAcore 2000 to detect the binding of NGF to the NGF receptor.

In one embodiment, the aptamer of the present invention can inhibit both NGF and TrkA binding and NGF and p75 binding.

The aptamer of the present invention is an extramammary inhibiting neurite outgrowth activity of NGF and / or cell proliferation activity of NGF. Whether or not the aptamers of the present invention inhibit the neurite outgrowth activity of NGF can be evaluated, for example, by the test described in Example 3. [ Whether or not the aptamers of the present invention inhibit the cell proliferative activity of NGF can be evaluated by the test described in Example 8, for example.

The aptamer of the present invention is characterized in that the concentration (IC ₅₀ or 50% inhibitory concentration) at which the neurite outgrowth activity of NGF is inhibited by 50% is 1 nM or less. Since the conventionally known NGF aptamer has an IC ₅₀ value of about nM to the neurite outgrowth activity of NGF, the aptamer of the present invention has more excellent properties with respect to the neurite outgrowth inhibitory activity.

Further, in a preferred embodiment, the aptamer of the present invention has an IC ₅₀ value for cell proliferation activity of NGF of 1 nM or less.

In contrast, when the aptamer of the present invention is used in combination with neurotrophins other than NGF, specifically brain-derived neurotrophic factor (BDNF), neurotrophin 3 (NT-3) and neurotrophin 4/5 ) Has an activity to inhibit the cell proliferative activity of the cells. Herein, the terms BDNF, NT-3 and NT-4/5 refer to BDNF, NT-3 and NT-4/5 of the total mammalian species, including human, respectively.

The degree of cell proliferation inhibitory activity of other neurotrophins (BDNF, NT-3, NT-4/5) can be evaluated by the test described in Example 16. Example 16 and Table 2 pressure cell proliferation inhibitory activity of Tamer of the invention described is for the IC ₅₀ value to not more than 0.1 nM with respect to NGF, IC ₅₀ values for BDNF is more than 1000 nM, apta of the invention dimmer It is said that it does not inhibit the cell proliferative activity of BDNF, but it is more than 10 nM at 0.97 nM for NT-3; 3 nM to 30 nM for NT-4; and NT-3 and NT-4 for cell proliferative activity.

The aptamer of the present invention can be used as an aptamer for the prevention and treatment of diseases such as the binding to NGF, the inhibition of binding of NGF to NGF receptor, the inhibition of neurite outgrowth of NGF, the inhibition of cell proliferation of NGF, (For example, ribose) of each nucleotide may be modified in order to increase the number of nucleotide residues of the nucleotide. Examples of sites to be modified in the sugar residue include those obtained by substituting oxygen atoms at the 2'-position, the 3'-position and / or the 4'-position of the sugar residue with other atoms. S-alkylation (e.g., S-methylation, S-ethylation), S-alkylation (e.g., O- Allylated, and aminated (e.g., -NH ₂ ). In addition, 4'-SRNA in which oxygen at the 4 'position is substituted with sulfur, LNA (Locked Nucleic Acid) bridged through methylene at the 2' position and 4 'position, 3'- N-phosphoroamidate nucleic acid, and the like. The modification of such sugar residues can be carried out by a known method (see, for example, Sproat et al., (1991) Nucle. Acid Res 19, 733-738; Cotton et al. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145).

The aptamer of the present invention can also be used as a medicament for inhibiting the binding to NGF, inhibiting the binding of NGF to NGF receptor, inhibiting neurite outgrowth of NGF, inhibiting cell proliferation of NGF, (E.g., chemical substitution) of the nucleic acid base (e.g., purine, pyrimidine) may be used to enhance the stability of the nucleic acid. Such modifications include, for example, 5-pyrimidine modification, 6 and / or 8-purine modification (O-methyl modification), modification with an external amine, substitution with 4-thioureidine, 5- Substitution by iodine-uracil, 5-amino acid type of formula, and 5-tryptophan side chain. In addition, the phosphate group contained in the platemater of the present invention may be modified so as to be resistant to nuclease and hydrolysis. For example, the phosphate portion of the aptamer, P (O) S (thio benzoate), P (S) S (dithio _{benzoate), P (O) NR 2} ( amidate), P (O) R, P (O ) OR ', CO or CH ₂ (formacetal), P (O) BH ₃ (boranophosphate) or 3'-amine (-NH-CH ₂ -CH ₂ - Or R 'is independently H or substituted or unsubstituted alkyl (e.g., methyl, ethyl).

As the linking group, -O-, -N- or -S- are exemplified, and they can be bonded to adjacent nucleotides through these linking groups.

The modification may also include modification of 3 'and 5', such as capping.

The modification may be carried out by using a mixture of polyethylene glycol (hereinafter sometimes referred to as " PEG "), amino acid, peptide, inverted dT, myristoyl, , Oleoyl, linoleoyl, other lipids, steroids, cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer agents, toxins, enzymes, radioactive substances, biotin and the like. See, for example, U.S. Patent No. 5,660,985 and U.S. Patent No. 5,756,703 for such modifications.

Particularly, when the modification is carried out by the terminal portion of PEG, the molecular weight of PEG is not particularly limited, but is preferably 1000 to 100000, more preferably 30000 to 90000. PEG may be linear or may be branched into two or more chains (multi-arm PEG).

The PEG is not particularly limited, and a commercially available or known PEG can be suitably selected and used by those skilled in the art (see, for example, http://www.peg-drug.com/peg_product/branched.html) Specific examples of suitable examples of the PEG to be applied to the pressure tampers of the present invention include a 2-branch type GS PEG (SUNBRIGHT GL2-400GS2 Nichia-like product) having a molecular weight of 40000, a 2-branch TS type PEG having a molecular weight of 40000 (SUNBRIGHT GL2-400TS- TS type PEG (manufactured by SUNBRIGHT GL4-400TS Nichite) having a molecular weight of 40000, TS type PEG (manufactured by SUNBRIGHT GL4-400TS Nichite) having a molecular weight of 80,000, TS type PEG (manufactured by SUNBRIGHT GL2-800TS Nichi) Manufactured by Nichigo Co., Ltd.).

In this case, the aptamer of the present invention may be added directly to the end of the PEG, but a linker having a group capable of binding to PEG at the end thereof is added, and it is more preferable to add PEG to the plaster of the present invention through it .

The linker of PEG and the platemer of the present invention is not particularly limited, and the number of the carbon chain and the functional group can be appropriately selected depending on the binding site, the kind of the PEG, and the like. Examples of such a linker include a linker having an amino group. Specifically, when a 5'-end is added, a ssH linker (SAFC) or a DMS (O) MT-AMINO-MODIFIER (GLEN RESERCH) TFA Amino C-6 lcaa CPG (ChemGenes) and the like can be exemplified when it is added to the terminal. When this linker is selected, the PEG can be bound to the PEG through the linker by, for example, reacting the active group of the N-hydroxysuccinimide with the amino group on the linker side.

As the PEG or linker, commercially available ones can be preferably used. Reaction conditions and the like relating to the binding of the PEG, the linker and the plaster of the present invention can be appropriately set by those skilled in the art.

The aptamers of the present invention can be chemically synthesized by methods disclosed in this specification and known per se in the art. The aptamer binds to the target substance by various binding modes such as ionic bonding using a negative charge of a phosphate group, hydrophobic bonding using a ribose and hydrogen bonding, and hydrogen bonding or stacking bonding using a nucleic acid base. In particular, ionic bonding using the negative charge of the phosphate group, which exists as many as the number of constituent nucleotides, is strong and binds to the plus charge of lysine or arginine present on the surface of the protein. For this reason, nucleic acid bases not involved in direct binding with the target substance can be substituted. Particularly, since the stem portion of the stem has already been made into a base pair and is also directed toward the inside of the double helix structure, the nucleotide base is difficult to bind directly to the target material. Therefore, even if the base pair is replaced with another base pair, the activity of the squid polymer is not often decreased. Even in a structure in which a base pair is not formed, such as a loop structure, base substitution is possible when the nucleotide base does not participate in direct binding with the target molecule. Regarding the formula above 2 'of ribose, rarely the functional group on the 2' side of the ribose directly interacts with the target molecule, but in most cases it is irrelevant and can be replaced by another modifying molecule. Thus, the aptamer often retains its activity unless it substitutes or eliminates the functional group involved in direct bonding with the target molecule. It is also important that the entire three-dimensional structure does not change significantly.

The aptamer can be produced by using SELEX and its modification method (e.g., Ellington et al., (1990) Nature, 346, 818-822; Tuerk et al., (1990) Science, 249, 505-510). In SELEX, by increasing the number of rounds or by using a competitive material, a stronger aptamer for the target substance is concentrated and screened. Therefore, when the number of rounds of SELEX and / or the contention state is changed, it is possible to obtain a platamater having different binding force, a platamer having a different binding form, a platemer having the same binding force or binding form but different base sequence have. In addition, SELEX includes an amplification process by PCR. In this process, by using mutation by using manganese ion, it is possible to perform SELEX with more diversity.

The aptamer obtained from SELEX is a nucleic acid with high affinity for the target substance, which does not mean binding to the active site of the target substance. Therefore, the aptamer obtained from SELEX does not necessarily affect the function of the target substance. NGF is a basic protein, and it is considered that nucleic acids are likely to bind nonspecifically. An aptamer that does not bind to an active site does not affect the activity of the target material.

Based on the thus-selected active platemer, SELEX can be performed on the basis of the obtained platemer sequence in order to obtain a platemaker having higher activity. As a specific method, a template having a random sequence of a part of the plasmid in which a certain sequence is determined, or a template doped with a random sequence of about 10% to 30% is prepared and SELEX is performed again.

The aptamer obtained by SELEX has a length of about 80 nucleotides, and it is difficult to make this medicine as it is. Thus, it is necessary to repeat the trial and error to shorten the length to 60 nucleotides or less, preferably 50 nucleotides or less, and most preferably 45 nucleotides or less, which can easily be chemically synthesized. The aptamer obtained by SELEX changes its ease of subsequent minimization according to its primer design. If the primer is not well designed, even if SELEX can select an active platamer, subsequent development becomes impossible.

Aptamers are easy to modify because they can be synthesized chemically. Aptamer predicts a secondary structure by using the MFOLD program, predicts a three-dimensional structure by X-ray analysis or NMR analysis, and determines whether or not a nucleotide can be substituted or deleted, and also predicts where a new nucleotide can be inserted . The predicted new sequence aptamer can be readily chemically synthesized and can be identified by existing analytical methods to determine if the aptamer remains active.

When a part important for binding of the obtained tympanic membrane to the target substance can be identified by repeating trial and error as described above, even if a new sequence is added at both ends of the sequence, the activity does not change in most cases. The length of such a new sequence is not particularly limited.

Similar to the sequence, the formulas can be highly designed or modified.

As described above, the aptamer is highly designed or can be modified. The present invention also relates to a method for producing a nucleic acid comprising a step of amplifying a nucleic acid comprising a nucleic acid amplification step of amplifying a nucleic acid amplification product comprising a step A method of manufacturing an extruder capable of highly designing or modifying a tumbler.

For example, a method of manufacturing such an abatumer comprises:

(N) a represents a nucleotide chain consisting of a N, (N) b represents a nucleotide chain composed of b N, each N is the same or different, and A, G, C, U and T (preferably, A, G, C, and U). a and b may be the same or different and may be any number, for example, from 1 to about 100, preferably from 1 to about 50, more preferably from 1 to about 30, (For example, a library of nucleic acid molecules having different numbers of a, b, etc.) and a sequence for a primer (for example, a sequence of a nucleic acid molecule having a different number of a, b, or the like) (i) and (ii) using a primer pair corresponding to each of the primers (i) and (ii).

Preferred as the plumper of the present invention is an platamer which binds to NGF, which comprises a sequence represented by SEQ ID NO: 82 and has a base length of 50 or less.

The sequence shown in SEQ ID NO: 82 is an important part in functioning as an abtamer of the present invention such that the aptamer of the present invention binds to NGF and inhibits the activity of NGF, particularly neurite outgrowth activity and cell proliferation activity , And the addition of a new sequence to both ends of these sequences does not impair the function of the platemater of the present invention. These sequences may also be subjected to modification of the above-described sugar residue, modification of the nucleic acid base or phosphate group, and the like.

That is, as the compressor of the present invention,

82. A platemper binding to NGF characterized by having a nucleotide length of 50 or less,

(i) at least one kind of nucleotide is an urethromide in which the hydroxyl group is substituted on the 2 'side of the ribose with a hydrogen atom, a fluorine atom, an -O-alkyl group, an -O-acyl group or an amino group;

(ii) at least one compound selected from the group consisting of PEG, amino acid, peptide, inverted dT, myristoyl, lithoacyl-oleyl, docosyl, lauroyl, stearoyl, palmitoyl, oleoyl, linoleoyl, Cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer agents, toxins, enzymes, radioactive substances, or biotin;

(iii) an extruder satisfying the requirements of (i) and (ii);

And the like can be mentioned as preferable specific examples.

The present invention also provides a composite comprising the plaster of the present invention and the functional material bonded thereto. In the complex of the present invention, the bond between the plaster and the functional material may be a covalent bond or a noncovalent bond. The complex of the present invention may be a combination of one or more (e.g., two or three) homologous or heterogeneous functional materials with the platemater of the present invention. The functional material is not particularly limited as long as it is capable of newly adding a function to the plummeter of the present invention or changing (for example, improving) any properties that the platemer of the present invention can sustain. Examples of the functional substance include proteins, peptides, amino acids, lipids, saccharides, monosaccharides, polynucleotides, and nucleotides. The functional substance may also be, for example, an affinity substance (for example, biotin, streptavidin, a polynucleotide having affinity for a target complementary sequence, an antibody, glutathion sepharose, histidine), a labeling substance (For example, liposomes, microspheres, peptides, polyethylene glycols), drugs (for example, calicheamicin and / or the like), radioactive isotopes Such as cyclophosphamide, melphalan, isopramide or troposphamide, ethyleneimines such as thiotepa, nitrites such as camustine, and the like, Alkylating agents such as urea, temozolomide or takabazine, folate-like metabolism such as methotrexate or ralitriptycide Antibiotics, purine analogs such as thioguanine, cladribine or fludarabine, pyrimidine analogues such as fluorouracil, tegafur or gemcitabine, vinca alkaloids such as vinblastine, vincristine or vinorelbine and analogues thereof, A cytotoxic antibiotic such as anthracyclines and analogs such as doxorubicin, epirubicin, dirubicin, and mitoxantrone, bleomycin and mitomycin, antibiotics such as paclitaxel, etoposide, taxane, docetaxel or paclitaxel, (Such as cisplatin, carboplatin and oxaliplatin, pentostatin, miltefosine, estramermin, topotecan, irinotecan and bicalutamide), toxins (e.g., lysine toxin, rhinotoxin and verotoxin). These functional molecules may eventually be removed. Furthermore, it may be a polynucleotide capable of cleaving a nuclease or a restriction enzyme such as thrombin, a matrix-metalloprotease (MMP), a peptide capable of recognizing and cleaving enzymes such as Factor X, and the like.

The platemers and complexes of the present invention can be used, for example, as medicines or diagnostic agents, test drugs, reagents, additives in beverages or foods, enhancers, and emollients.

The tympanic complex and the complex of the present invention may have an activity of inhibiting the function of NGF by binding to NGF and inhibiting binding of NGF to NGF receptor. As described above, NGF is closely related to pain and inflammation. Accordingly, the platemers and complexes of the present invention are useful as medicaments (antitumor agents, anti-inflammatory agents, etc.) for treating or preventing diseases accompanied by pain or inflammation.

In this case, the pain may include infective and / or painful pain (muscular pain, abdominal pain, upper body pain, knee injury, arthralgia, deformity arthropathy, gout, chronic articular rheumatism, headache, migraine, tension headache, arm headache, secondary headache, Inflammatory pain, neuropathic pain (diabetic neuropathy, addictive neuropathy, post-operative pain, diabetic neuropathy, diabetic neuropathy, diabetic neuropathy, diabetic neuropathy, Pain caused by cancer infiltration into the internal organs, vascular occlusion caused by vascular infiltration of cancerous tissues, pain caused by vascular occlusion of cancerous tissues, Pain due to metastasis in the brain, pain due to peripheral nerve infiltration of cancerous tissue), and fibromyalgia.

Examples of diseases caused by inflammation include, but are not limited to, systemic lupus erythematosus, multiple sclerosis, psoriasis, deformed arthropathy, chronic joint rheumatism, interstitial cystitis, asthma and the like.

Examples of the cancer include, but are not limited to, esophageal cancer, thyroid cancer, bladder cancer, colon cancer, stomach cancer, pancreatic cancer, chest cancer, liver cancer, lung cancer, non-small cell lung cancer, breast cancer, neuroblastoma, glioblastoma, uterine cancer, Cancer, Wilms' tumor, prostate cancer, and the like.

When NGF binds to its receptor TrkA, it activates tyrosine phosphorylation of TrkA and Ras-MAPK, PLC-γ and PI3K downstream of TrkA, and exerts physiological functions such as survival and differentiation of neurons. On the other hand, it induces cell death in the signal pathway through the p75 receptor. Accordingly, the platemers and complexes of the present invention can be used as medicines or diagnostic drugs, test drugs, and reagents of diseases related to the activation of these signal transduction pathways. Diseases related to the activation of these signal transduction pathways include the above-mentioned pain, inflammatory diseases and cancer.

When the platamer and the complex of the present invention are used as medicines, diagnostic drugs, test drugs, reagents and the like, the subject to which it is administered is not particularly limited, but examples thereof include primates (such as humans and monkeys) Cat, horse, cow, goat, sheep, pig), and the like.

The indomethacin and the complex of the present invention can specifically bind to NGF. Therefore, the plumbers and complexes of the present invention are useful as probes for NGF detection. This probe is useful for invisible imaging of NGF, blood concentration measurement, tissue staining, ELISA, and the like. This probe is also useful as a diagnostic agent, a test drug, a reagent, and the like for a disease (NGF-associated disease) (a disease accompanied by pain or inflammation).

Further, based on the specific binding to the NGF, the indomethacin and the complex of the present invention can be used as a ligand for the separation and purification of NGF.

The platemer and the complex of the present invention can also be used as medicines, mediators, enhancers, and emollients for examining mental states such as love or mental condition.

The platemers and complexes of the present invention can also be used as a drug delivery agent.

The medicament of the present invention may be one containing a pharmaceutically acceptable carrier. Examples of the pharmaceutically acceptable carrier include excipients such as sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate and calcium carbonate, cellulose, methylcellulose, hydroxypropylcellulose, A disintegrating agent such as starch, carboxymethylcellulose, hydroxypropyl starch, sodium-glycol-starch, sodium hydrogen carbonate, calcium phosphate, calcium citrate, etc., a binder such as gelatin, gum arabic, polyethylene glycol, sucrose and starch, A preservative such as sodium benzoate, sodium hydrogensulfite, methylparaben, propylparaben, citric acid, sodium citrate, sodium benzoate, sodium benzoate, , Stabilizers such as acetic acid, methylcellulose, polyvinylpyrrolidone, stearic acid alum There can be a suspending agent, a dispersing agent such as a surfactant, water, saline, diluent, such as orange juice, cacao butter, polyethylene glycol, wax base such as baekdeungyu such as titanium, is not limited to these.

Formulations suitable for oral administration include liquid solutions in which an effective amount of a ligand is dissolved in a diluent such as water, physiological saline, or orange juice, capsules, sachets or tablets containing an effective amount of the ligand as a solid or granules, A suspension in which an effective amount of the active ingredient is suspended in an effective amount, and an emulsion in which a solution in which an effective amount of an effective ingredient is dissolved is dispersed and emulsified in a suitable dispersion medium.

In addition, the medicament of the present invention can be coated by a known method for purposes such as taste masking, enteric activity, or persistence, if necessary. Examples of the coating agent used for the coating include hydroxypropylmethylcellulose, ethylcellulose, hydroxymethylcellulose, hydroxypropylcellulose, polyoxyethylene glycol, Tween 80, Pluronic F68, cellulose acetate phthalate, hydroxypropylmethylcellulose Phthalate, hydroxymethylcellulose acetate succinate, Eudragit (manufactured by Rohm & Co., Germany, methacrylic acid-acrylic acid copolymer) and a pigment (e.g., Bengala, titanium dioxide, etc.). This medicament may be either an immediate release preparation or a sustained release preparation. Examples of the western base include liposomes, atelocollagen, gelatin, hydroxyapatite, PLGA and the like.

Suitable formulations for parenteral administration (e.g., intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intrathecal, transpulmonary, etc.) include aqueous and non-aqueous sterile injectable solutions, An antioxidant, a buffer, a bactericide, an isotonic agent, and the like. Aqueous and non-aqueous aseptic suspensions may also be used. These may contain suspending agents, solubilizing agents, thickening agents, stabilizers, preservatives and the like. The formulation may be packaged in a unit dose or multiple doses, such as an ampoule or vial. The active ingredient and the pharmaceutically acceptable carrier may be lyophilized and stored in a state in which they are dissolved or suspended in a suitable sterile solvent immediately before use. Surfactants may also be mentioned as suitable agents. Surfactants include sustained release formulations such as artificial bone, biodegradable or non-degradable sponges, bags, pharmaceutical pumps, osmotic pumps, etc., sustained release from carriers or containers embedded in the body, or continuous or intermittent delivery Devices and the like. Examples of the biodegradable substrate include liposomes, cationic liposomes, poly (lactic acid-co-glycolic acid) (PLGA), atelocollagen, gelatin, hydroxyapatite and polysaccharide syzopyran. Furthermore, in addition to an injection solution or a sustained-release preparation, an inhalant and an ointment agent are also possible. In the case of an inhalant, the active ingredient in the freeze-dried state is made fine and inhaled using an appropriate inhalation device. A surfactant, an oil, a seasoning, a cyclodextrin or a derivative thereof, which have been conventionally used as needed, may be further appropriately added to the inhalant.

Examples of the surfactant include oleic acid, lecithin, diethylene glycol diolate, tetrahydrofurfuryl oleate, ethyl oleate, isopropyl myristate, glyceryl trioleate, glyceryl monolaurate, glyceryl monooleate (Trade name: Span 85), sorbitan monooleate (trade name: Span 80), glyceryl monostearate, glyceryl monolysinoate, cetyl alcohol, stearyl alcohol, polyethylene glycol 400, cetylpyridinium chloride, sorbitan trioleate ), Sorbitan monolaurate (trade name: Span 20), polyoxyethylene hydrogenated castor oil (trade name HCO-60), polyoxyethylene (20) sorbitan monolaurate (trade name Tween 20), polyoxyethylene (Trade name: TWIN 80), natural resource-derived lecithin (trade name: Epiclon), oleyl polyoxyethylene (2) ether (trade name: Bridge 92), stearyl polyoxyethylene (2) ether (trade name: BRIDGE 72), lauryl polyoxyethylene (4) ether (trade name: BRIDGE 30), oleyl polyoxyethylene (Trade name: Genapol 0-020), and a block copolymer of oxyethylene and oxypropylene (trade name: Shinferronic). Examples of the oil include corn oil, olive oil, cottonseed oil, sunflower oil and the like. In the case of ointments, suitable medicinally acceptable bases such as yellow petrolatum, white petrolatum, paraffin, plastic base, silicone, white ointment, beeswax, oil, vegetable oil, hydrophilic ointment, hydrophilic petrolatum, refined lanolin, , Hydrophilic plastid base, macro-osseous ointment, etc.) and mixed with the active ingredient to formulate it.

The inhalant may be prepared by a conventional method. That is, the composition of the present invention can be prepared by preparing the compressed tablets and the complexes of the present invention in powder or liquid form, mixing them into an inhalation injecting agent and / or a carrier, and filling the appropriate inhalation container. In addition, in the case where the compressors and the complexes of the present invention are powders, a conventional mechanical powder inhaler may be used, and in the case of a liquid, an inhaler such as a nebulizer may be used. Conventionally known ones can be widely used as the propellant. Examples of the propellant include fulon-11, furon-12, furon-21, furon-22, furon-113, furon-114, furon-123, furon-142c, furon- -227, Prone-C318 and 1,1,1,2-tetrafluoroethane, hydrocarbons such as propane, isobutane, and n-butane, ethers such as diethyl ether, nitrogen gas, And a compressed gas such as a gas.

The dosage of the medicament of the present invention varies depending on the kind and activity of the active ingredient, the severity of the disease, the species of the animal to be administered, the water solubility of the drug to be administered, About 100 mg / kg, such as about 0.0001 to about 10 mg / kg, preferably about 0.005 to about 1 mg / kg.

The present invention also provides a solid support on which the compressors and complexes of the present invention are immobilized. Examples of the solid carrier include a substrate, a resin, a plate (for example, a multi-well plate), a filter, a cartridge, a column, and a porous material. The substrate may be a material used for a DNA chip, a protein chip, or the like. Examples of the substrate include a nickel-PTFE (polytetrafluoroethylene) substrate, a glass substrate, an apatite substrate, a silicon substrate and an alumina substrate. Coating. Examples of the resin include agarose particles, silica particles, copolymers of acrylamide and N, N'-methylenebisacrylamide, polystyrene crosslinked divinylbenzene particles, particles obtained by crosslinking dextran with epichlorohydrin, cellulose fibers, A cross-linked polymer of allyldextran and N, N'-methylenebisacrylamide, a monodispersed synthetic polymer, a monodispersed hydrophilic polymer, Sepharose, Toyopearl, and the like. . The solid carrier of the present invention may be useful for, for example, purification of NGF and detection and quantification of NGF.

The compressors and composites of the present invention can be fixed to a solid support by a known method. For example, a method of introducing an affinity substance (for example, the one described above) or a predetermined functional group into the platemer and the complex of the present invention and subsequently immobilizing the affinity substance or the predetermined functional group on the solid carrier . The present invention also provides such a method. The predetermined functional group may be a functional group capable of providing a coupling reaction, and examples thereof include an amino group, a thiol group, a hydroxyl group, and a carboxyl group. The present invention also provides an abatumer into which such a functional group is introduced.

The present invention also provides a method of purifying and enriching NGF. In particular, the present invention makes it possible to separate NGF from other family proteins. The purification and concentration method of the present invention may include adsorbing NGF on the solid support of the present invention and eluting the adsorbed NGF by the eluent. The adsorption of NGF to the solid carrier of the present invention can be carried out by a known method. For example, a sample containing NGF (e.g., a culture of a bacterium or a cell or a culture supernatant, blood) is introduced into the solid carrier or the content thereof of the present invention. Elution of NGF can be performed using an eluent such as a neutral solution. The neutral eluent may be, for example, a pH of about 6 to about 9, preferably about pH 6.5 to about 8.5, and more preferably about 7 to about 8, although it is not particularly limited. Neutral solution can also, for example, urea, a chelating agent (e.g., EDTA), a potassium salt (e.g., KCl), a magnesium salt (e.g., MgCl _2), surfactants (e.g., Tween 20, Triton, NP40), including glycerin . The purification and concentration method of the present invention may also include cleaning the solid carrier using adsorbent after adsorption of NGF. Examples of the cleaning liquid include surfactants such as urea, a chelating agent (for example, EDTA), Tris, acid, alkali, Transfer RNA, DNA, Tween 20, and salts such as NaCl. The purification and concentration method of the present invention may also include heat treatment of the solid support. By such a process, it is possible to regenerate and sterilize the solid carrier.

The present invention also provides a method for detecting and quantifying NGF. In particular, the present invention can detect and quantify NGF differentially from other family proteins. The detection and quantification method of the present invention can include measuring NGF using the inventive platemer (e.g., by using the complexes and solid supports of the present invention). The detection and quantification method of NGF can be carried out by the same method as the immunological method except that the platemater of the present invention is used instead of the antibody. Thus, the enzyme immunoassay (EIA) (e.g., direct competition ELISA, indirect competition ELISA, sandwich ELISA), radioimmunoassay (RIA), fluorescent immunoassay (FIA) , Western blotting method, immunohistochemical staining method, cell sorting method, and the like. It can also be used as a molecular probe such as PET. Such a method may be useful, for example, for determining the amount of NGF in a living body or a biological sample, and for diagnosing a disease in which NGF is involved.

The contents of all publications, including exemplary patents and patent application specifications herein, are hereby incorporated by reference in their entirety to the same extent as if fully set forth herein.

Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited to the following examples and the like.

Example

Example 1: Preparation of NGF-platamer 1

The RNA overtamers specifically binding to NGF were prepared using the SELEX method. SELEX was performed according to the method of Ellington et al. (Ellington and Szostak, Nature 346, 818-822, 1990) and the method of Tuerk et al. (Tuerk and Gold, Science 249, 505-510, 1990). Human NGF (manufactured by R & D Systems) was used as a target substance.

The first RNA using the round (40N) is obtained by transferring the DNA obtained by chemical synthesis using a T7 Transcription Kit ^TM DuraScribe (Epicentre Company). Among the NTPs contained in the kit, 2'-OHATP was replaced with 2'-deoxyadenosine-5'-triphosphate (2'-H ATP or dATP, manufactured by GE Healthcare) Respectively. The RNA obtained by this method is fluorinated at the 2'-position of the ribosome of the pyrimidine nucleotide, G is the purine nucleotide, and A is the DNA type. DNA having a length of 83 nucleotides having a primer sequence at both ends of a random sequence of 40 nucleotides shown below was used as a DNA template. The DNA template and the primer were prepared by chemical synthesis.

DNA template 1:

5'-gaggatccatgtatgcgcacata-40 n-cttctggtcgaagttctccc-3 '(SEQ ID NO: 118)

Primer Fwd1:

5'-cggaattctaatacgactcactatagggagaacttcgaccagaag-3 '(SEQ ID NO: 119)

Primer Rev1:

5'-gaggatccatgtatgcgcacata-3 '(SEQ ID NO: 120)

In the above sequence, n represents any of a, g, c or t. The primer Fwd1 contains the promoter sequence of the T7 RNA polymerase. The variation of RNA pool used in the first round was theoretically 10 ¹⁴ .

After performing SELEX for 10 rounds, the PCR product was cloned into pGEM-T Easy vector (Promega) and transfected into Escherichia coli strain DH5α (Toyobo). After the plasmid was extracted from the single colony, the base sequence was determined with a DNA sequencer (ABI PRISM3100, ABI). By examining 48 clones, 45 sequences could be determined. Among them, 7 sequences were the same in two sequences, and the remaining 31 sequences were single sequences. When SELEX was added three more rounds and examined the sequence again, more procedures were observed.

10 and 13 rounds and several single sequences were evaluated for their binding activity to NGF by surface plasmon resonance.

As the measuring device, BIAcore2000 manufactured by BIAcore was used, and CM5, which reacts with an amino group, was used as a sensor chip. Human NGF was dissolved in immobilized solution (10 mM sodium acetate, pH 6) to 25 to 40 占 퐂 / ml. For the reaction between the amino group on the protein side and the carboxyl group on the chip side, ethyl-3-carbodiimide hydrochloride and N-hydroxysuccinimide were used. After the reaction, blocking with ethanolamine-HCl was carried out. The immobilized amount of NGF was 3000 to 4000 RU. The aptamers for analytes were prepared at 0.15 μM to 0.5 μM. Solution A was used in the running buffer. Here, Solution A is a mixed solution of 145 mM sodium chloride, 5.4 mM potassium chloride, 1.8 mM calcium chloride, 0.8 mM magnesium chloride, 20 mM Tris (pH 7.6), and 0.05% Tween 20. A mixed solution of 1 M NaCl and 50 mM NaOH was used as a regeneration solution. NGF was immobilized on FC2 and the final sensorgram was obtained by subtracting the result of FC1.

34 sequence, it was found that all the RNAs bind NGF significantly more than the control 40N. Here, 40N refers to the RNA pool used in the first round, which includes a random sequence of 40 nucleotides. From the above, it was revealed that these RNAs are platamers binding to NGF.

Example 2: Aptamer inhibiting the binding of NGF and NGF receptor

Whether the aptamers obtained in Example 1 inhibited the binding of NGF and NGF receptors (TrkA and p75) was examined using surface plasmon resonance.

Protein A (21181, PIERCE) was immobilized on the CM5 sensor chip according to the protocol of BIAcore. In addition, about 700 to 1200 RU of human TrkA-Fc (175-TK, R & D systems) or human P75 (367-NR, R & D systems) fused with the Fc portion of IgG was immobilized. NGF (0.1 [mu] M) and aptamer (0.3 [mu] M) were mixed as an analyte and kept for 30 minutes. If the aptamer inhibits the binding of NGF to TrkA or p75, the signal of the sensorgram is not elevated, but if it does not inhibit it, it is expected that the signal will rise by forming a tridentate complex. In addition, when NGF binds strongly to the receptor rather than to the platemater, the aptamer is lost and the NGF binds to the receptor. We confirmed that NGF binds to TrkA or p75 before starting the inhibition experiment.

34 sequence, it was found that all aptamers inhibited the binding of NGF to TrkA or p75. In particular, the aptamers represented by SEQ ID NOS: 1, 2, 3, 4, 5 and 7 showed strong inhibitory activity. From these results, it was revealed that these RNAs are platamants which inhibit the binding of NGF to NGF receptors.

Example 3: Neurite outgrowth inhibitory activity of platamer

The neurite outgrowth inhibitory activity of the squamous cell obtained in Example 1 was evaluated using Neuroscreen-1 cells, which are subclones of PC12 cells.

2500 cells / well were cultured on a 96-well flat plate coated with collagen type IV for 1 day in RPMI-1640 medium containing 2.5% horse serum and 1.25% fetal bovine serum. Thereafter, a mixed solution of human NGF (final concentration 0.38 nM or 1.14 nM) and platemer (final concentration 500 to 0.01 nM) previously reacted in a serum-free RPMI-1640 medium for 1 hour at room temperature or 37 ° C for 30 minutes . Two days later, cytoplasm and nuclei were stained using Cellomics Neurite Outgrowth Kit (manufactured by Thermo Scientific), and the length of neurite per cell was measured by Cellomics ArrayScan VTI (manufactured by Thermo Scientific). When neurite length per cell obtained at the time of addition of NGF alone was set to 0%, the neurite length per cell obtained by culturing for 2 days with no addition of NGF was 100%, and when NGF and platemer were mixedly added The inhibitory activity of platamer was determined from the obtained neurite length per cell.

Examination of the inhibitory activity of the 34 tympanic membranes obtained in Example 1 revealed that addition of 10 nM of aptamer represented by SEQ ID NOS: 1 to 8 strongly inhibited neurite outgrowth. Other aptamers showed no significant inhibition at 10 nM.

The actual nucleotide sequences corresponding to the respective SEQ ID NOs are shown below. The upper case is RNA, the lower case is DNA, the parenthesis in the nucleotide is the formula 2 'above, and F is fluorine atom (the same applies hereinafter).

SEQ ID NO: 1:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GaC F) C (F) GU (F) C (F) U (F) C (F) U (F) GU (F) GC (F) aU (F) aC (F) aU (F) GGaU (F) F) C (F) C (F) U (F) C (F)

SEQ ID NO: 2:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) C (F) C (F) aaaC (F) GGGaC F) U (F) aU (F) aC (F) C (F) U (F) C (F) U (F) GaGU (F) aC (F) GC (F) GC (F) aU (F) aC (F) aU (F) F) GGaU (F) C (F) C (F) U (F) C (F)

SEQ ID NO: 3:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) U (F) GC (F) GU (F) aGU (F) U (F) U (F) U (F) CG (F) CG (F) CG (F) CG (F) CG (F) GU (F) GGC F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 4:

AG (F) aC (F) aC (F) aG (F) aG (F) aG (F) (F) U (F) U (F) GC (F) aU (F) aU (F) aC (F) aU (F) aC (F) GaU (F) aC (F) aG (F) aGaU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 5:

(F) GC (F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) aGaaGaGGaC (F) U (F) aaU (F) GC (F) C (F) C (F) U (F) GGU (F) U (F) aU (F) aU (F) GU (F) GC (F) aU (F) aC (F) aU (F) GGaU (F) F) C (F)

SEQ ID NO: 6:

G (F) U (F) U (F) U (F) U (F) U (F) GC (F) GC (F) GC (F) CG (F) GGC (F) aU (F) aU (F) aC (F) aU (F) GGaU (F) C (F) aC (F) F) C (F) U (F) C (F)

SEQ ID NO: 7:

(F) U (F) U (F) U (F) U (F) U (F) G (C) (F) aU (F) aU (F) aC (F) aC (F) aU (F) GC (F) GU (F) (F) aU (F) aU (F) aU (F) aU (F) GU (F) F) C (F) C (F) U (F) C (F)

SEQ ID NO: 8:

GGGaGaaC (F) U (F) U (F) C (F) GaC (F) C (F) aGaaGaU (F) C (F) (F) aG (F) aaU (F) C (F) aC (F) aG (F) AU (F) aU (F) aU (F) GC (F) GC (F) aU (F) F) C (F) C (F) U (F) C (F)

Example 4: Shortening of plaster

The plumbers represented by SEQ ID NOS: 3 and 6 were subjected to shortening. The secondary structure of the RNA was predicted using the MFOLD program (Zuker, Nucleic Acids Res. 31, 3406-3415, 2003) and single stranded with reference to its structure. The short-chain product was obtained by preparing a DNA of desired sequence by chemical synthesis and transferring it using a DuraScribe T7 Transcription Kit (manufactured by Epicenter). After the DNase treatment, the protein was removed by treatment with phenol / chloroform, and the product was recovered by ethanol precipitation. The purity of the recovered RNA was confirmed by polyacrylamide electrophoresis and the amount was confirmed by absorbance measurement. The sequence of the short-chain product actually produced is as follows.

SEQ ID NO: 9: An alteration of the plasmid represented by SEQ ID NO: 3 was used to amplify 73 nucleotides in length of RNA

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) U (F) GC (F) GU (F) aGU (F) U (F) U (F) U (F) CG (F) CG (F) CG (F) CG (F) CG (F) GU (F) GGC F) aC (F)

SEQ ID NO: 10: An alteration of the squamous cell of SEQ ID NO: 3 with 68 nucleotides in length of RNA

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) U (F) GC (F) GU (F) aGU (F) U (F) U (F) GU (F) G (F) G (F) GU (F) GU (F) GU (F)

SEQ ID NO: 11: An alteration of the squamometer represented by SEQ ID NO: 3, and a 46-nucleotide-long RNA

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) F) C (F) C (F) GU (F) C (F) U (F) C (F) C (F) GU (F) GGC (F) aU (F) GU (F) GC (F)

SEQ ID NO: 12: An alteration of the squamous cell of SEQ ID NO: 3 with a length of 40 nucleotides

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) U (F) C (F) C (F) GU (F) GG C (F) ) C (F)

SEQ ID NO: 13: An alteration of the squamometer represented by SEQ ID NO: 3 with a length of 42 nucleotides

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) U (F) C (F) C (F) GU (F) GGC (F) C (F) C (F)

SEQ ID NO: 121: RNA obtained by removing one base pair from stem 2 with an alterator of squamometer represented by SEQ ID NO: 11

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) (F) GU (F) U (F) AU (F) GU (F) U (F) GU (F) GC (F)

SEQ ID NO: 122: RNA obtained by removing one base pair from stem 2 with an alterator of squamometer represented by SEQ ID NO: 11

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) F) GU (F) C (F) U (F) GU (F) GU (F) GU (F) ) GC (F)

SEQ ID NO: 123: RNA obtained by removing one base pair from stem 2 with an alterator of squamometer represented by SEQ ID NO: 11

G (F) aC (F) aU (F) C (F) C (F) U (F) (F) GU (F) U (F) AU (F) GU (F) U (F) GU (F) GC (F)

SEQ ID NO: 124: RNA obtained by removing one base pair from stem 2 with an alterator of squamometer represented by SEQ ID NO: 11

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) U (F) GGU (F) GU (F) U (F) aU (F) GU (F) U (F) C (F) U (F) GGC GU (F) GC (F)

SEQ ID NO: 125: RNA obtained by removing one base pair from stem 2 with an alterator of squamometer represented by SEQ ID NO: 11

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) U (F) F) C (F) GU (F) C (F) U (F) GU (F) GGC (F) GU (F) GC (F)

SEQ ID NO: 126: RNA obtained by removing one base pair from stem 2 with an alterator of squamometer represented by SEQ ID NO: 11

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) U (F) F) C (F) GU (F) C (F) C (F) C (F) GU (F) GGC (F) GU (F) GC (F)

SEQ ID NO: 127: An alteration of the squamometer represented by SEQ ID NO: 13, RNA with one base pair removed from stem 2

G (F) C (F) U (F) U (F) U (F) U (F) F) GU (F) C (F) C (F) C (F) GU (F) GGU (F) GU (F) C (F)

SEQ ID NO: 128: An alteration of the squamometer represented by SEQ ID NO: 13, RNA with one base pair removed from stem 2

G (F) C (F) U (F) U (F) U (F) U (F) F F) GU (F) U (F) C (F) C (F) GU (F) GGC (F) C (F)

SEQ ID NO: 129: An alteration of the squamometer represented by SEQ ID NO: 13, RNA with one base pair removed from stem 1

GU (F) U (F) U (F) C (F) C (F) GU (F) F) C (F) U (F) C (F) C (F) GU (F) GGC (F) U (F) GU (F) C (F)

SEQ ID NO: 130: An alteration of the squamometer represented by SEQ ID NO: 11, RNA

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) F) GU (F) C (F) U (F) C (F) C (F) GU (F) GGC (F) GU (F) GC (F)

SEQ ID NO: 131: An alteration of the squamometer represented by SEQ ID NO: 11, RNA with two C's removed from loop 2

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) F) GU (F) U (F) C (F) C (F) GU (F) GGC (F) GC (F)

SEQ ID NO: 132: An alteration of the squamometer represented by SEQ ID NO: 11, RNA

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) F) C (F) U (F) C (F) U (F) C (F) C (F) GU (F) GGC (F) aU (F) GU (F) GC (F)

SEQ ID NO: 133: An alteration of the squid polymer of SEQ ID NO: 13, RNA

G (F) C (F) C (F) U (F) GC (F) U (F) F F CG F F F C F F G F G F F U F a C F F F C F G F F F F U F F F C F F C F F F F F F F C F F C F F G F F U F F F C F F C F F F F F U F F F C F F F F F F F F C F F C F F F F F F F F F C F F C F F F F U F C (F)

SEQ ID NO: 134: An altered version of the plasmid represented by SEQ ID NO: 11, RNA

G (F) aC (F) aU (F) C (F) C (F) U (F) GC (F) F) GU (F) C (F) U (F) C (F) GU (F) GU (F) GU (F) GC (F)

SEQ ID NO: 135: An alteration of the squamometer represented by SEQ ID NO: 13, RNA with one C removed from internal loop 1

GU (F) U (F) U (F) C (F) C (F) GU (F) F) C (F) U (F) C (F) C (F) GU (F) GGC (F) U (F) GU (F) C (F)

SEQ ID NO: 136: An alteration of the squamometer represented by SEQ ID NO: 13, RNA with one U removed from internal loop 1

GU (F) U (F) U (F) C (F) C (F) GU (F) F) C (F) U (F) C (F) C (F) GU (F) GGC (F) U (F) GU (F) C (F)

SEQ ID NO: 137: An alteration of squamometer represented by SEQ ID NO: 13, RNA

GU (F) U (F) U (F) C (F) C (F) GU (F) F) C (F) U (F) C (F) C (F) GU (F) GGC (F) U (F) GU (F) aC (F)

SEQ ID NO: 138: An alteration of the plasmid represented by SEQ ID NO: 13, in which C and G were removed one by one from internal loop 1

GU (F) U (F) U (F) C (F) C (F) GU (F) F) C (F) U (F) C (F) C (F) GU (F) GGC (F) U (F) U (F) C (F)

SEQ ID NO: 139: Amplification of squamometer represented by SEQ ID NO: 13, RNA with two U removed from internal loop 1

GU (F) U (F) U (F) C (F) C (F) GU (F) F) C (F) U (F) C (F) C (F) GU (F) GGC (F) GU (F)

SEQ ID NO: 140: An alteration of the squamometer represented by SEQ ID NO: 13, in which U and G were removed one by one from internal loop 1

GU (F) U (F) U (F) C (F) C (F) GU (F) F) C (F) U (F) C (F) C (F) GU (F) GGC (F) U (F) U (F) C (F)

SEQ ID NO: 141: Amplification of squamometer represented by SEQ ID NO: 13, RNA with two U removed from internal loop 1

GU (F) U (F) U (F) C (F) C (F) GU (F) F) C (F) U (F) C (F) C (F) GU (F) GGC (F) U (F) GU (F) aC (F)

SEQ ID NO: 14: An alteration of the extramammary represented by SEQ ID NO: 6 with a length of 78 nucleotides

G (F) U (F) U (F) U (F) U (F) U (F) GC (F) GC (F) GC (F) CG (F) GGC (F) aU (F) aU AU (F) G (F) aC (F) aC (F) aC (F)

SEQ ID NO: 15: An alteration of the squamometer represented by SEQ ID NO: 6, and a 73-nucleotide-

G (F) U (F) U (F) U (F) U (F) U (F) GC (F) GC (F) GC (F) CG (F) GGC (F) aU (F) aU (F) aC (F) aC (F) aC (F) aC (F)

SEQ ID NO: 16: An alteration of the extramammary represented by SEQ ID NO: 6 was carried out using a 63-

C (F) GC (F) GGC (F) A (F) U (F) U (F) F) aU (F) aU (F) GC (F) aaaC (F) C (F) U (F) AU (F) aC (F) aU (F) aU (F)

SEQ ID NO: 17: An alteration of the extramammary represented by SEQ ID NO: 6 with a length of 58 nucleotides

aU (F) aU (F) U (F) U (F) UG (F) GC (F) F) GC (F) aAaC (F) C (F) U (F) U (F) GC (F) aC (F) GC (F) GC (F) aU (F) aC (F)

SEQ ID NO: 18: An alteration of the squibamer represented by SEQ ID NO: 6 with a length of 48 nucleotides

U F F F U F F U F F F CG F G F F F aU F F F F U F F U F F F F A F F F F U F F F F F F F F F F F F F U F F F F F F F U F F F U F F U F F U F F F U F F F F U F F) GC (F) aAaC (F) C (F) U (F) U (F) GC (F) aC (F) GC (F) G

SEQ ID NO: 19: An alteration of the extramammary represented by SEQ ID NO: 6 with a length of 46 nucleotides

GC (F) aAU (F) aC (F) U (F) U (F) U (F) GC (F) GGC (F) (F) GC (F) GC (F) GC (F) GC (F) GC (F)

SEQ ID NO: 20: An alteration of the extramammary represented by SEQ ID NO: 6 with a 50-nucleotide-long extramamer

GU (F) GC (F) aAU (F) aC (F) U (F) U (F) F) GC (F) aAaC (F) C (F) U (F) U (F) GC (F) aC (F) GC (F) GC (F)

SEQ ID NO: 21: An alteration of the extramammary represented by SEQ ID NO: 6 with a length of 48 nucleotides

GC (F) U (F) U (F) U (F) U (F) C (F) GC (F) GGC (F) C (F) U (F) U (F) GC (F) C (F) aC (F) GaC (F) C (F)

The binding activity of these tympanic amines to NGF was evaluated by surface plasmon resonance method as in Example 1. As a result, it was found that the RNAs of SEQ ID NOS: 9 to 21 bind NGF significantly more than the control 40N. On the other hand, the RNAs represented by SEQ ID NOS: 121 to 141 exhibited a greatly decreased binding amount as compared with the platemater of SEQ ID NO: 11 or 13.

The inhibition of binding between NGF and its receptors (TrkA and p75) was evaluated by the surface plasmon resonance method as in Example 2, and it was found that the aptamers represented by SEQ ID NOs: 9 to 16 had a high inhibitory activity.

When the neurite outgrowth inhibitory activity was examined in the same manner as in Example 3, it was found that the aptamer represented by SEQ ID NOS: 9 to 21 exhibited a high inhibitory activity at a concentration of 10 nM. On the other hand, the aptamers represented by SEQ ID NOS: 127, 128, 131, 133, 135 and 141 showed no inhibitory activity at 10 nM.

Example 5: Prediction of the secondary structure of the squamometer and its short-chain substance shown in SEQ ID NO: 3

The secondary structure of the RNAs shown in SEQ ID NOS: 3, 9-13 and SEQ ID NOS: 121 to 141 was predicted using the MFOLD program. All of the aptamers having the activity contained the secondary structure of the plummeter represented by SEQ ID NO: 12 (Fig. 1). This secondary structure was characterized by the structure of stem 1, internal loop 1, stem 2, and loop 2 from the 5 'end (FIG. 2). Stem 1 consists of four base pairs, internal loop 1 consists of three nucleotides and four nucleotides, stem 2 consists of nine base pairs, and loop 2 consists of seven nucleotides.

The RNAs represented by SEQ ID NOS: 121 to 128 were obtained by removing one base pair from stem 2, and all of the activities were greatly decreased. Thus, it was suggested that stem 2 requires 9 base pairs.

The abscissa represented by SEQ ID NOS: 12 and 13 is an arbitrary variant of the squamometer represented by SEQ ID NO: 11, and the stem 1 is substituted with a G-C pair. The aptamers represented by SEQ ID NOS: 12 and 13 showed neurite outgrowth inhibitory activity equivalent to that of SEQ ID NO: 11. Therefore, it was suggested that stem 1 does not significantly affect the activity of any base pair as long as it is a stem structure. On the other hand, the RNA represented by SEQ ID NO: 129 was obtained by removing the U-a base pair from the stem 1 of the squamometer shown in SEQ ID NO: 13, but the activity was greatly decreased. Therefore, it can be seen that the fourth base pair of stem 1 needs to be Ua.

The RNAs represented by SEQ ID NOS: 130 to 133 were RNAs which had been removed from the loop 2 by one nucleotide, all of which were greatly decreased in activity. Thus, it was suggested that loop 2 needs to consist of 7 nucleotides.

The RNAs shown in SEQ ID NOs: 134 to 141 were RNAs in which one or two nucleotides of internal loop 1 had been removed, all of which greatly decreased in activity. Therefore, it was suggested that internal loop 1 needs to be composed of 7 nucleotides as a whole.

Hereinafter, the structure defined in FIG. 2 is referred to as a consensus secondary structure 1.

Example 6: Fabrication of NGF abtamer 2

SELEX was performed using a primer different from that of Example 1 to examine whether or not an extruder having a consensus secondary structure 1 could be obtained. The following DNA template and primer sequences are shown below.

DNA template 2:

5'-ccagttgttggtgacaatgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngcagctccacaggcttccc (SEQ ID NO: 142)

Primer Fwd2:

5'-taatacgactcactatagggaagcctgtggagctgc (SEQ ID NO: 143)

Primer Rev2:

5'-gcattgtcaccaacaactgg (SEQ ID NO: 144)

In the above sequence, n represents any of a, g, c or t. Primer Fwd2 contains a promoter sequence of T7 RNA polymerase. The variation of the RNA pool used in the first round was theoretically 10 ¹⁴ .

SELEX was carried out in the same manner as in Example 1. After performing 10 rounds of SELEX, 48 clones were examined and 46 sequences were determined. Among them, 5 clones were 1 sequence, 3 clones were 4 sequences, 2 clones were 3 sequences, and System 8 sequences were processed. The remaining 23 sequences were single-stranded.

8 sequencing sequences were selected and the binding activity to NGF was evaluated by surface plasmon resonance method. The measurement method was the same as in Example 1. As a result, all of the sequences bound only slightly to NGF.

The secondary structure of all sequences, including single sequences, was predicted using the MFOLD program and no sequence containing consensus secondary structure 1 was present.

Example 7: Fabrication of NGF-platamer 3

The sequence shown in SEQ ID NO: 12 was subjected to SELEX using an RNA pool doped with a random sequence of 15% and to which the same primer sequence as in Example 1 was added. The SELEX was carried out in substantially the same manner as in Example 1. The sequence of the template is shown below.

Template 3:

5'-gaggatccatgtatgcgcacata- acagccacggagacggaaactacgcagcaggatgtgccaa -cttctggtcgaagttctccc-3 '(SEQ ID NO: 145)

Among them, the underlined nucleotide sequence is as follows.

a : a (85%), g (5%), c (5%), t (5%

g : a (5%), g (85%), c (5%), t (5%

c : a (5%), g (5%), c (85%), t (5%

t : a (5%), g (5%), c (5%), t (85%

After the end of the fourth round, 48 clones were identified, about half of which was the sequence containing SEQ ID NO: 12 and the remainder was the sequence containing the mutations in several places. To eliminate the sequence identical to SEQ ID NO: 12, the antisense oligos of SEQ ID NO: 12 was added to the pool of RNA and additional three rounds of SELEX were added. The sequence of the antisense oligos is as follows.

5'-agacggaaactacgcagcagga-3 '- (SEQ ID NO: 146)

Antisense oligo was added 10-fold to the RNA pool. As a result of confirming the sequence of the obtained RNA, about half of the sequences were found to contain several mutations in the sequence shown in SEQ ID NO: 12 and the rest were sequences completely different from the sequence shown in SEQ ID NO:

From the 4th and 7th rounds, the sequence 16 sequences shown in SEQ ID NOS: 22 to 37 were selected and the binding activity to NGF and the binding inhibitory activity of NGF and NGF receptor were examined. The surface plasmon resonance method was used as shown in Examples 1 and 2. As a result of the measurement, it was found that all the sequences significantly inhibited the binding of NGF to the NGF receptor by binding to NGF significantly more than 40 N of the control. In addition, neurite outgrowth inhibitory activity was measured in the same manner as in Example 3. As a result, all the sequences showed high inhibitory activity at a concentration of 10 nM. The actual nucleotide sequences corresponding to the respective SEQ ID NOs are shown below.

SEQ ID NO: 22:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) U (F) GC (F) GU (F) aGU (F) U (F) U (F) U (F) UU (F) GU (F) GC (F) aU (F) U (F) GU (F) GGC F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 23:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) GGC (F) aC F) GC (F) U (F) GC (F) GU (F) aGU (F) U (F) U (F) C (F) GC (F) GC (F) aU (F) aC (F) aU (F) GU (F) GU (F) GU (F) F) GGaU (F) C (F) C (F) U (F) C (F)

SEQ ID NO: 24:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) U (F) GC (F) GaaGU (F) U (F) U (F) C (F) (F) GC (F) aU (F) aC (F) GU (F) GU (F) GU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 25:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) U (F) GC (F) GC (F) aGU (F) U (F) U (F) AU (F) aC (F) GU (F) GGC (F) U (F) aU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 26:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) GGC (F) aC F) GC (F) U (F) GC (F) GU (F) aGU (F) U (F) U (F) C (F) (F) GC (F) GC (F) aU (F) aC (F) GC (F) GGC (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 27:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) U (F) GC (F) GC (F) aGU (F) U (F) U (F) (F) GC (F) GC (F) aU (F) aC (F) GU (F) GU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 28:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC (F) U (F) U (F) U (F) CG (F) GU (F) aGU (F) U (F) (F) GC (F) GC (F) aU (F) aC (F) GU (F) GU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 29:

(F) U (F) U (F) C (F) C (F) GaC (F) C (F) aGaaGU (F) (F) U (F) GC (F) GC (F) GaaGU (F) U (F) U (F) C (F) U (F) UU (F) GU (F) GC (F) aU (F) U (F) GU (F) GGC F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 30:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) U (F) GC (F) GaaGGU (F) U (F) C (F) AU (F) aU (F) GU (F) GC (F) GC (F) aU (F) aC (F) GU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 31:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) U (F) GC (F) GC (F) aGU (F) U (F) U (F) CG (F) GC (F) aU (F) GU (F) GU (F) GU (F) F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 32:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) GC (F) GGaGU (F) U (F) U (F) C (F) U (F) UU (F) GU (F) GC (F) aU (F) U (F) GU (F) GGC F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 33:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) C (F) GC (F) GU (F) aGU (F) U (F) U (F) AU (F) GGU (F) aU (F) aU (F) aU (F) aU (F) F) C (F) C (F) U (F) C (F)

SEQ ID NO: 34:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) C (F) GC (F) GU (F) aGU (F) U (F) U (F) (F) GC (F) GC (F) aU (F) aC (F) GU (F) GU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 35:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GU (F) U (F) CG (F) GU (F) aGU (F) U (F) U (F) GC (F) aU (F) GU (F) GU (F) GU (F) U (F) F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 36:

GU (F) U (F) aGU (F) aC (F) GU (F) U (F) C (F) GaC (F) C (F) aGaaGGU (F) U (F) U (F) GC (F) aU (F) aU (F) aC (F) aU (F) aC (F) GaU (F) aC (F) GU (F) aGGU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 37:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC (F) U (F) U (F) U (F) F (U) F (U) GC (F) GC (F) U (F) U (F) CG (F) GU (F) GGC F) aU (F) aC (F) aU (F) GGaU (F) C (F)

The secondary structure of the squamometer represented by SEQ ID NOS: 22 to 37 was predicted using the MFOLD program. As a result, it was found that all the aptamers other than the platemer represented by SEQ ID NOS: 30, 33, and 36 contained the consensus secondary structure 1. The sequences of these internal loops 1 were CCU on the 5 'side and UGUU on the 3' side (FIG. 2). Also, loop 2 contained a consensus sequence represented by 5'-UUUCCXU-3 '. Where X is either A, G, C, or U. The last base pair of stem 1 was all U-a. The first, fifth, sixth, eighth and ninth base pairs of stem 2 were G-C, C-G, G-C, a-U and G-C, respectively. There were several different base pairs at 2-4 and 7th.

Example 8: Antiproliferative activity of cell proliferation inhibitor (TF-1 assay)

The inhibitory activity of the platemer of SEQ ID NOS: 22 to 37 was evaluated by a proliferation inhibition evaluation system using TF-1 cells.

Two NGF receptors (human TrkA and human p75) genes were introduced into TF-1 cells (ATCC Number: CRL-2003), a human leukemia cell line, using a retroviral vector, and two receptors were simultaneously stably and highly expressed Cells were prepared. The cells were suspended in RPMI-1640 medium containing 20% fetal bovine serum, and 1000 cells (50 쨉 l) were seeded per well in a white 96-well flat plate. Then, 50 μl of a mixed solution of human NGF (final concentration: 0.076 nM) and platemer (final concentration: 30 to 0.01 nM) previously reacted in a serum-free RPMI-1640 medium for 30 minutes at room temperature was added and after 3 days CellTiter 100 μl of the CellTiter-Glo reagent of Glu Luminescent Cell Viability Assay (Promega) was added to each well, and the chemiluminescence was measured by a microplate reader to evaluate the proliferation of TF-1 cells by NGF stimulation . When the amount of luminescence per well obtained by culturing the cells for 3 days with the addition of NGF alone was 0% with no inhibitory activity and the amount of luminescence per well obtained by culturing for 3 days with no NGF was 100%, and when NGF and platemer were mixedly added , The inhibitory activity of platemer was determined from the amount of luminescence per well obtained. As a result, it was found that all of these aptamers had a high inhibitory activity at a concentration of 10 nM.

The inhibitory activities of platemers of SEQ ID NOS: 62 and 68 described in WO2010 / 035725A1 were investigated for comparison. As a result, the respective IC _50s were 6.1 and 7.5 nM.

Example 9: Shortening of platemaster 2

23, 25, 26, 27, 28, 29, 31, 32, 34 and 35 showing high inhibitory activity were performed with reference to the consensus secondary structure 1. The binding activity to NGF was measured by surface plasmon resonance method in the same manner as in Example 1, and all the short-chain substances were strongly bound to NGF. In addition, the neurite outgrowth inhibitory activity and TF-1 cell proliferation inhibitory activity were measured by the same method as in Examples 3 and 8, and showed strong inhibitory activity at a concentration of 10 nM. Hereinafter, these actually obtained nucleotide sequences are shown.

SEQ ID NO: 38: (a short-chain form of SEQ ID NO: 26)

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) U (F) U (F) C (F) GC (F) GGC (F) C (F)

SEQ ID NO: 39: (a short-chain form of SEQ ID NO: 27)

G (F) C (F) C (F) U (F) GC (F) U (F) GC (F) F) GU (F) CG (F) CG (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 40 (SEQ ID NO: 28)

G (F) C (F) C (F) U (F) GC (F) U (F) F) aU (F) C (F) U (F) GC (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 41:

G (F) C (F) C (F) U (F) GC (F) U (F) (F) U (F) U (F) U (F) C (F) GU (F) GGC (F) C (F)

SEQ ID NO: 42:

G (F) C (F) C (F) U (F) GC (F) U (F) GC (F) F) C (F) U (F) C (F) U (F) GC (F) GU (F) GGC (F) C (F)

SEQ ID NO: 43:

G (F) C (F) C (F) U (F) GC (F) U (F) GC (F) GGaGU (F) U (F) U (F) U (F) U (F) C (F) GU (F) GGC (F) C (F)

SEQ ID NO: 44:

G (F) C (F) C (F) U (F) GC (F) C (F) F) GU (F) CG (F) CG (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 45:

G (F) C (F) C (F) U (F) GU (F) U (F) (F) U (F) U (F) C (F) U (F) aC (F) GU (F) GGC (F) C (F)

SEQ ID NO: 46: (short stranded product of SEQ ID NO: 23)

G (F) C (F) C (F) U (F) GC (F) U (F) GC (F) F) GU (F) U (F) aC (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 47: (a short-chain form of SEQ ID NO: 25)

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) U (F) U (F) C (F) GC (F) GGC (F) C (F)

The secondary structure of these compressors was predicted using the MFOLD program, and all of them were the structure shown by the consensus secondary structure 1.

Example 10: Preparation of NGF < RTI ID = 0.0 >

A 21% random sequence was doped in the sequence shown in SEQ ID NO: 12, and SELEX was performed using RNA pools to which the same primer sequences as in Example 1 were added at both ends thereof. SELEX was carried out in the same manner as in Example 1. The sequence of the template is shown below.

Template 3:

5'-gaggatccatgtatgcgcacata- acagccacggagacggaaactacgcagcaggatgtgccaa -cttctggtcgaagttctccc-3 '(SEQ ID NO: 145)

Among them, the underlined nucleotide sequence is as follows.

a : a (79%), g (7%), c (7%), t (7%

g : a (7%), g (79%), c (7%), t (7%

c : a (7%), g (7%), c (79%), t (7%

t : a (7%), g (7%), c (7%), t (79%

After the end of the fourth round, the sequence of 48 clones was confirmed and the procedure was not seen. So I added three more rounds. 5, 6, and 7 rounds of 48 clones, respectively. As the round progressed, the sequence was processed. At the 7th round, most of the sequences were processed.

From the 5th, 6th and 7th rounds, the 14th sequence was selected and the binding activity to NGF was examined by surface plasmon resonance. The measurement method is the same as that shown in the first embodiment. As a result of the measurement, all the sequences were significantly more bound to NGF than the control 40N. Hereinafter, these actually obtained nucleotide sequences are shown.

SEQ ID NO: 48:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GC (F) GC (F) GGaGU (F) U (F) U (F) C (F) AU (F) aU (F) GU (F) GC (F) aU (F) aC (F) aU (F) G (F) F) GGaU (F) C (F) C (F) U (F) C (F)

SEQ ID NO: 49:

(F) U (F) C (F) aU (F) C (F) C (F) G (C) F F) C (F) U (F) GC (F) U (F) GC (F) GU (F) aGU (F) GC (F) aU (F) GU (F) GU (F) GU (F) U (F) F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 50:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGC (F) U (F) GGC (F) U (F) GU (F) U (F) GC (F) GU (F) aGU (F) AU (F) aC (F) aC (F) aC (F) aC (F) aC (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 51:

GGGaGaaC (F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) (F) U (F) GC (F) U (F) aC (F) GGaGU (F) U (F) U (F) AU (F) aU (F) GU (F) GC (F) aU (F) aC (F) aU (F) G (F) F) GGaU (F) C (F) C (F) U (F) C (F)

SEQ ID NO: 52:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC (F) U (F) GC (F) U (F) GC (F) aU (F) aGU (F) U (F) U (F) U (F) GU (F) GGC (F) U (F) F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 53:

(F) U (F) C (F) aU (F) C (F) C (F) G (C) F (F) C (F) U (F) U (F) U (F) GC (F) GC (F) aGU (F) U GC (F) aU (F) GU (F) GU (F) GU (F) U (F) F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 54:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC F) U (F) GaU (F) GC (F) GU (F) aGU (F) U (F) U (F) C (F) GC (F) GC (F) aU (F) aC (F) GU (F) GU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 55:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC (F) U (F) GU (F) U (F) GC (F) GU (F) aGU (F) (F) GC (F) GC (F) aU (F) aC (F) GU (F) GU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 56:

(F) A (F) U (F) C (F) C (F) C (F) C (F) aGaGU (F) F) U (F) GC (F) U (F) GU (F) GU (F) aGU (F) U (F) U (F) AU (F) GC (F) GC (F) aU (F) aU (F) aU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 57:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) aGGC (F) U (F) GC (F) U (F) GC (F) aU (F) aGU (F) U GU (F) GU (F) GGC (F) U (F) aU (F) aU (F) F) GGaU (F) C (F) C (F) U (F) C (F)

SEQ ID NO: 58:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) F) U (F) GC (F) U (F) GC (F) GU (F) aGU (F) U (F) U (F) U (F) GC (F) GC (F) aU (F) aC (F) GU (F) GU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 59:

(F) U (F) C (F) aU (F) C (F) C (F) G (C) F (F) U (F) U (F) F (U) F (U) F (U) GC (F) GC (F) CG (F) CG (F) GU (F) GU (F) U (F) GU (F) F) aU (F) aC (F) aU (F) GGaU (F) C (F)

SEQ ID NO: 60:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) U (F) GGC (F) U (F) GC (F) GC (F) aGaGU (F) U (F) U (F) C (F) AU (F) aU (F) GU (F) GC (F) aU (F) aC (F) aU (F) G (F) F) GGaU (F) C (F) C (F) U (F) C (F)

SEQ ID NO: 61:

(F) a C (F) a C (F) a C (F) a C (F) a G (C) F) U (F) GC (F) U (F) GC (F) GU (F) aGU (F) U (F) U (F) U (F) U (F) CG (F) GC (F) aU (F) U (F) F) aC (F) aU (F) GGaU (F) C (F)

The secondary structure of these compressors was predicted using the MFOLD program, and all of them showed the structure represented by the consensus secondary structure 1. The sequences of these internal loops 1 were all CCU at the 5 'side and UGUU at the 3' side. Also, loop 2 contained a consensus sequence represented by 5'-UUUCCXU-3 '. Where X is either G or U. In stem 2, the first, third, eighth, and ninth base pairs were G-C, U-G, a-U, and G-C, respectively. 2 < / RTI > and 4 to 7 were several different base pairs.

These compressors were subjected to shortening in the same manner as in Example 4. As a result, it was possible to shorten the structure to the same structure as the consensus secondary structure 1 while maintaining the binding activity in all the compressors.

As in Examples 3 and 8, neurite outgrowth inhibitory activity and TF-1 cell proliferation inhibitory activity were evaluated. As a result, all of these aptamers showed high inhibitory activity at a concentration of 10 nM. Hereinafter, these actually obtained nucleotide sequences are shown.

SEQ ID NO: 62:

GU (F) C (F) U (F) GC (F) U (F) GC (F) GGaGU (F) F) C (F) U (F) C (F) GGU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 63:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) U (F) aC (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 64:

G (F) C (F) C (F) U (F) GU (F) U (F) (F) C (F) C (F) C (F) aC (F) GU (F)

SEQ ID NO: 65:

GU (F) C (F) U (F) U (F) GC (F) UC (F) GGaGU (F) U F) C (F) U (F) C (F) GGU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 66:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) U (F) U (F) U (F) GU (F) GGC (F) C (F)

SEQ ID NO: 67:

G (F) C (F) C (F) U (F) GC (F) U (F) GC (F) F) GU (F) U (F) aC (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 68:

GU (F) C (F) C (F) U (F) GaU (F) GC (F) GU (F) aGU (F) F) C (F) CG (F) GU (F) GU (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 69:

G (F) C (F) C (F) U (F) GU (F) U (F) F) GU (F) CG (F) CG (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 70:

G (F) C (F) C (F) U (F) GC (F) U (F) GU (F) F (F) F (F) F (F) F (F) F (F) U (F) G (F)

SEQ ID NO: 71:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) C (F) GU (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 72:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) CG (F) GC (F) GU (F) GGU (F) U (F) GU (F)

SEQ ID NO: 73:

G (F) C (F) C (F) U (F) GC (F) U (F) F F F U F F F U F F GU F G F F F U F F a C F C (F)

SEQ ID NO: 74:

G (F) C (F) U (F) GC (F) GC (F) aGaGU (F) U (F) F) C (F) U (F) C (F) GGU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 75:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) U (F) U (F) C (F) GC (F) GGU (F) C (F)

Example 11: Preparation of NGF-platamer 5

The same SELEX as in Example 1 was carried out using the following template with the stem 2 of the consensus secondary structure 1 as a random sequence.

Template 4:

5'-gaggatccatgtatgcgcacataacagnnnnnnngacggaaacnnnnnnncaggatgtgccaacttctggtcgaagttctccc-3 '(SEQ ID NO: 147)

After the end of the 7 round, 48 clones were identified and the sequencing was not observed. So, I added three more rounds. After the completion of the 10 rounds, 48 clones were identified, and about half of the clones were sequenced and the remaining half were single sequences. Among them, 17 sequences were selected and their binding activity to NGF was examined by surface plasmon resonance. The measurement method is the same as that shown in the first embodiment. As a result of the measurement, it was found that all the sequences bind significantly to NGF than the control 40N.

The compressed tablet was subjected to shortening in the same manner as in Example 4. As a result, it was possible to shorten the structure to the same structure as the consensus secondary structure 1 while maintaining the binding activity in all the compressors. Hereinafter, these actually obtained nucleotide sequences are shown.

SEQ ID NO: 76:

(F) C (F) C (F) C (F) C (F) U (F) GaU (F) U (F) aaGaGU (F) (F) U (F) C (F) GU (F) aaU (F) C (F) U (F)

SEQ ID NO: 77:

G (F) C (F) C (F) U (F) U (F) (F) U (F) C (F) GU (F) aGU (F) C (F) U (F) GU (F)

SEQ ID NO: 78:

(F) C (F) C (F) C (F) C (F) C (F) U (F) GGC (F) C (F) aaGaGU F) U (F) C (F) GU (F) GGU (F) C (F) U (F) GU (F)

SEQ ID NO: 79:

(F) C (F) C (F) C (F) C (F) U (F) GGU (F) U (F) aaGaGU (F) U (F) C (F) GU (F) aaC (F) C (F) U (F) GU (F)

SEQ ID NO: 80:

G (F) C (F) C (F) C (F) C (F) U (F) GGC (F) U (F) aaGaGU (F) U (F) C (F) GU (F) aGU (F) C (F) U (F) GU (F)

SEQ ID NO: 81:

GU (F) C (F) C (F) C (F) C (F) U (F) GGU (F) (F) U (F) U (F) aU (F) C (F) aC (F)

SEQ ID NO: 82:

G (F) C (F) C (F) GU (F) U (F) U (F) U (F) F) C (F) GU (F) aU (F) C (F) C (F) U (F) GU (F)

SEQ ID NO: 83:

GU (F) C (F) C (F) C (F) C (F) U (F) GU (F) aC (F) aaGaGU F) U (F) C (F) GU (F) GU (F) aC (F) U (F) GU (F)

SEQ ID NO: 84:

G (F) C (F) C (F) U (F) GU (F) C (F) F) GU (F) U (F) UC (F) U (F) GC (F) GGC (F) C (F)

SEQ ID NO: 85:

(F) C (F) C (F) GU (F) C (F) U (F) UG (F) (F) C (F) aC (F) aC (F) UC (F)

SEQ ID NO: 86:

G (F) C (F) C (F) U (F) GC (F) U (F) F F F U F F F U F F GU F G F F F U F F a C F C (F)

SEQ ID NO: 87:

G (F) C (F) U (F) GC (F) U (F) aaGaGU (F) F) C (F) U (F) C (F) GU (F) GGGC (F) U (F) GU (F)

SEQ ID NO: 88:

GU (F) C (F) U (F) GU (F) U (F) aaGaGU (F) U (F) F) C (F) U (F) C (F) GU (F) GaaC (F) U (F) GU (F)

SEQ ID NO: 89:

GU (F) C (F) U (F) U (F) GU (F) GGaaGaGU (F) U (F) F) C (F) GU (F) C (F) C (F) aC (F) U (F) GU (F)

SEQ ID NO: 90:

GU (F) C (F) C (F) C (F) C (F) U (F) GC (F) GU (F) aaGaGU (F) U (F) C (F) GU (F) aU (F) GC (F) U (F) GU (F)

SEQ ID NO: 91:

G (F) C (F) U (F) GC (F) U (F) aaGaGU (F) U F) C (F) U (F) C (F) GU (F) aGGC (F) U (F) GU (F)

SEQ ID NO: 92:

G (F) C (F) C (F) C (F) C (F) U (F) F) U (F) C (F) GU (F) GGU (F) C (F)

The neurite outgrowth inhibitory activity of these compressed tumors was determined by setting the neurite length per cell obtained when NGF alone was added to 0% for inhibitory activity and for 2 days without addition of NGF to obtain the inhibitory activity of 100% , And from the length of neurite per cell obtained when NGF and aptamer were mixed. The 50% inhibitory concentration (IC ₅₀ ) was determined from the concentration at the upper and lower points between 50% inhibitory activity. The experimental results are shown in Table 1. In Table 1, the IC ₅₀ value is described as "< X ", indicating that the inhibitory activity was 50% or more when the described concentration X was the lowest measured concentration. All the aptamers tested showed strong inhibitory activity. Table 1 shows IC ₅₀ values of some of them.

Regarding the TF-1 cell proliferation inhibitory activity, the amount of luminescence per well obtained by culturing the cells for 3 days with the addition of NGF alone was 0% for inhibitory activity and for 3 days with no addition of NGF to obtain the amount of luminescence per well obtained as 100% inhibitory activity The inhibitory activity of platemer was calculated from the amount of luminescence per well obtained when NGF and platemer were mixedly added. The 50% inhibitory concentration (IC ₅₀ ) was determined from the concentration at the upper and lower points between 50% inhibitory activity. The results are shown in Table 1. An IC ₅₀ value of "< X " indicates that the inhibitory activity was 50% or more when the described concentration X was the lowest concentration to be measured. As a result of the experiment, it was found that the aptamers other than SEQ ID NOS: 81, 84, 86 and 89 had an IC ₅₀ value of 1 nM or less.

The sequence of internal loop 1 of these plasmids was CCU on the 5 'side and UGUU on the 3' side. Also, loop 2 contained a consensus sequence represented by 5 'UUUCCXU3'. Where X is either G or U. The last base pair of stem 1 was all U-a. In stem 2, the first, eight, and ninth base pairs were G-C, a-U, and G-C, respectively. There were several different base pairs in the second to seventh.

Example 12: Preparation of NGF-platamer 6

A new SELEX was performed in order to produce an umbilical cord which inhibits NGF but does not inhibit NT-3 and NT-4. As the first pool, a 1: 1 mixture of RNA pools used at the beginning of Examples 9 and 10 was used. NT-3 (294 pmol, manufactured by R & D systems, 299 pmol), NT-4 (179 pmol, manufactured by R & D Systems) and BDNF (148 pmol, manufactured by R & D Systems) ) Was added to the immobilized beads.

After confirming the sequence of 48 clones after the end of the fourth round, the sequencing procedure was not found. 27, 28, 34, 64, and 72 in the single sequence. The new 14 sequences were selected and the secondary structure was predicted using the MFOLD program, including all consensus secondary structure 1. Therefore, these compressors were shortened to 40 mer as in the concepc- tion secondary structure 1. The binding activity of NGF and NT-3 of these short-chain products was measured by surface plasmon resonance method. As the measurement method, BIAcore2000 manufactured by BIAcore Inc. was used and CM5 which reacted with the amino group was used as the sensor chip, as shown in Example 1. [ Protein immobilization was carried out by using ethyl-3-carbodiimide hydrochloride and N-hydroxysuccinimide in the same manner as in Example 1. Human NGF or NT-3 was dissolved in immobilized solution (10 mM sodium acetate, pH 6) and used as 25 to 40 占 퐂 / ml. After protein immobilization, blocking with ethanolamine-HCl was carried out. The immobilized amounts of NGF and NT-3 were 3,000 to 4,000 RU and 3,000 to 5,000 RU, respectively. The aptamers for analytes were prepared at 0.15 μM to 0.5 μM. The running buffer and regeneration solution were the same as in Example 1. NT-3 was immobilized on FC2 and NGF was immobilized on FC3, resulting in the final sensorgram by subtracting the result of FC1, respectively. As a result, it was found that 7 sequence strongly binds to NGF. On the other hand, none of the NT-3s were bonded.

The neurite outgrowth inhibitory activity was measured in the same manner as in Example 3, and the aptamer of SEQ ID NOS: 93 to 98 showed strong inhibitory activity at 10 nM. The actual nucleotide sequence corresponding to each sequence number is shown below.

SEQ ID NO: 93:

G (F) C (F) C (F) U (F) GC (F) C (F) F) GU (F) U (F) U (F) C (F) GC (F) GGU (F) C (F)

SEQ ID NO: 94:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) C (F) U (F) GC (F) GGaGC (F) U (F) GU (F)

SEQ ID NO: 95:

G (F) C (F) C (F) U (F) GC (F) U (F) F) aU (F) U (F) U (F) C (F) GU (F) GGC (F) U (F) C (F)

SEQ ID NO: 96:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) U (F) aU (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 97:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) CG (F) CG (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 98:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) U (F) aC (F) GU (F) GGC (F) U (F) GU (F)

The sequence of internal loop 1 of these plasmids was CCU on the 5 'side and UGUU on the 3' side. Also, loop 2 contained a consensus sequence represented by 5 'UUUCCXU3'. Where X is either G or a. The last base pair of stem 1 was all U-a. In stem 2, the base pairs 2, 5, 8, and 9 were C-G, C-G, a-U, and G-C, respectively. There were several other base pairs in the rest.

SELEX was added up to 7 rounds to identify 48 clones, most of which were sequenced in one sequence. And the binding activity to NGF and NT-3 was examined by surface plasmon resonance as described above. As a result of the measurement, it was found that the 7 sequence binds strongly to NGF. On the other hand, none of the NT-3s were bonded.

 The secondary structure of these compressors was predicted using the MFOLD program, and none of them contained the consensus secondary structure 1. The neurite outgrowth inhibitory activity was measured in the same manner as in Example 3, and the aptamers represented by SEQ ID NOS: 99 and 100 showed strong inhibitory activity at 10 nM. On the other hand, when TF-1 cell proliferation inhibitory activity was measured in the same manner as in Example 8, no inhibitory activity was observed. The actual nucleotide sequence corresponding to each sequence number is shown below.

SEQ ID NO: 99:

(F) U (F) U (F) C (F) GaC (F) C (F) aGaaGU (F) C (F) C (F) aaaC (F) GGGaC F) U (F) aU (F) aC (F) C (F) U (F) C (F) U (F) GaGU (F) U (F) U (F) GC (F) U (F) C (F) CU (F) F) aU (F) GGaU (F) C (F) C (F) U (F)

SEQ ID NO: 100:

(F) U (F) U (F) U (F) C (F) GaC (F) C (F) aGaaGaC (F) C (F) aaaC (F) GGaC F) aU (F) aC (F) U (F) U (F) C (F) U (F) GaGU (F) GC (F) aU (F) aC (F) aU (F) aU (F) aU (F) GC (F) F) C (F) C (F) U (F) C (F)

Example 13: Fabrication of NGF depressant 7

A new SELEX was performed in the same manner as in Example 12 to prepare an abdominal tablet inhibiting NGF but not inhibiting NT-3 and NT-4. The template and primer of the first RNA pool used are as follows.

Template 5:

5'-gaggatccatgtatgcgcacatnnnn ggatacgag nnnnnnn ctcttatcc nnnatgtgccaacttctggtcgaagttctccc-3 '(SEQ ID NO: 148)

Among them, the underlined nucleotide sequence is as follows.

a : a (70%), g (10%), c (10%), t (10%

g : a (10%), g (70%), c (10%), t (10%

c : a (10%), g (10%), c (70%), t (10%

t : a (10%), g (10%), c (10%), t (70%

Primer Fwd3:

5'-taatacgactcactatagggagaacttcgaccagaagttggcaca (SEQ ID NO: 149)

Primer Rev3:

5'-gaggatccatgtatgcgaca (SEQ ID NO: 150)

The template sequence is based on the sequence shown in SEQ ID NO: 82, and 30% random sequence is doped into stem 2 of consensus secondary structure 1, and the internal loop 1 and loop 2 portions are completely randomized (n) Respectively.

The sequence of 48 clones was confirmed after the end of the fourth round, and the 21 clones corresponded to the sequence shown in SEQ ID NO: 22. Two of the remaining sequences were the same sequence and the others were single sequences. Among them, 13 sequences were selected and the secondary structure was predicted by the MFOLD program, which had the structure of the consensus secondary structure 1. Thus, these compressors were shortened to 40 mer so as to be identical to the consecence secondary structure 1. The binding activity of the single stranded platamer was confirmed by the surface plasmon resonance method as in Example 12. [ NT-4 was measured in the same manner as NT-3. As a result, it was found that the short-chain substance binds strongly to NGF. On the other hand, the binding with NT-3 and NT-4 was weak.

Further, neurite outgrowth inhibitory activity was measured for these short-chain substances in the same manner as in Example 3, and the IC ₅₀ values of the plumbers represented by SEQ ID NOS: 101 and 102 showed a strong inhibitory activity of 1 nM or less (see Table 1 ). On the other hand, the TF-1 cell proliferation inhibitory activity was measured in the same manner as in Example 8, and the IC ₅₀ value of the same 2-pressure tamer was 1 nM or more. The actual nucleotide sequence corresponding to each sequence number is shown below.

SEQ ID NO: 101:

GU (F) C (F) C (F) U (F) GaC (F) GU (F) aU (F) aGU (F) F) C (F) U (F) GU (F) aU (F) GU (F)

SEQ ID NO: 102:

(F) U (F) C (F) C (F) GU (F) C (F) U (F) G (A) F) C (F) aU (F) GC (F) U (F) C (F) U (F) GU (F)

Example 14: Sequence analysis using a high-speed sequencer

Sequence analysis was performed using a high-speed sequencer GS FLX (manufactured by Roche) in order to obtain an abdominal hamster which inhibits NGF but does not inhibit other neurotrophins with an aspirator having a concepcancy secondary structure 1. [ In Example 1, 48 clones were subjected to sequencing analysis based on the Saury sequence. However, when a high-speed sequencer is used, analysis of tens of thousands of sequences is possible. Measurement and data interpretation were carried out by Operon, and sample preparation was carried out according to the protocol of Operon. DNAs to be measured were 7, 9 and 10 rounds obtained in Example 8, 4 and 5 rounds obtained in SELEX performed in Example 12, DNA pools after 3 and 4 rounds obtained in SELEX performed in Example 13 Were mixed with each other.

The total number of sequence sequences obtained was 69249. Of these, the FLX primer sequence was a completely identical or single base substituted sequence, while the N40 sequence sequence length of 40 was 40077 sequence. The secondary structure of these sequences was predicted using the RNAfold program. The sequence containing the same structure as the consensus secondary structure 1 was 22453 sequence. Compared with the sequences obtained by the Sanger sequences in Examples 10, 12 and 13, 99% were new sequences. Of the new sequences, 1615 kinds were sequenced and 4168 sequences were single. Of these, 52 novel sequences emerging at high frequency were selected and shortened to 40 mer so as to form the consensus secondary structure 1. In addition, in Example 13, the single sequence obtained by the Saury sequence was selected again in 10 sequences, and it was similarly shortened to 40 mer.

The single stranded sequence was bound to NGF, NT-3 and NT-4 by surface plasmon resonance. The measurement was carried out in the same manner as in Example 13. As a result, all the sequences were bound to NGF, but in particular 15 sequences shown below were strongly bound. On the other hand, NT-3 and NT-4 rarely joined.

Thus, the neurite outgrowth inhibitory activity of these 15 sequences was measured in the same manner as in Example 3. As a result, it was found that the IC ₅₀ value of all compressors was 1 nM or less (Table 1). The TF-1 cell proliferation inhibitory activity was measured by the same method as in Example 8, and the aptamers represented by SEQ ID NOS: 111, 112, and 114 to 117 had an IC ₅₀ value of 1 nM or less (Table 1).

The actual nucleotide sequence corresponding to each sequence number is shown below. On the other hand, SEQ ID NO: 111 is a sequence obtained by the Saury sequence in Example 13.

SEQ ID NO: 103:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) CG (F) GC (F) GU (F) GGU (F) U (F) GU (F)

SEQ ID NO: 104:

GU (F) C (F) C (F) U (F) GAU (F) GU (F) C (F) aaGU (F) F) C (F) U (F) U (F) GaU (F) GU (F) C (F) U (F) GU (F)

SEQ ID NO: 105:

G (F) C (F) C (F) U (F) GU (F) U (F) (F) C (F) C (F) U (F) U (F) aGU (F) GaC (F) U (F)

SEQ ID NO: 106:

G (F) C (F) C (F) U (F) GC (F) U (F) F) GU (F) CG (F) CG (F) GU (F) aGC (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 107:

G (F) C (F) U (F) GC (F) U (F) GC (F) GaaGU (F) U F) C (F) U (F) C (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 108:

G (F) C (F) C (F) U (F) GU (F) U (F) F) GU (F) CG (F) GC (F) GU (F) GaC (F) U (F) GU (F)

SEQ ID NO: 109:

G (F) C (F) C (F) U (F) GC (F) U (F) F F F U F F F U F F GU F G F F U F F a C F C (F)

SEQ ID NO: 110:

G (F) C (F) C (F) U (F) GC (F) C (F) F) GU (F) CG (F) CG (F) GU (F) GGC (F) U (F) GU (F)

SEQ ID NO: 111:

GU (F) C (F) U (F) GU (F) C (F) U (F) aaGaGU (F) F) C (F) U (F) C (F) GU (F) aGaC (F) U (F) GU (F)

SEQ ID NO: 112:

GU (F) C (F) U (F) GU (F) U (F) aaGaGU (F) U (F) F) C (F) U (F) C (F) GU (F) GGaC (F) U (F) GU (F)

SEQ ID NO: 113:

G (F) C (F) C (F) U (F) GC (F) U (F) GU (F) F (F) F (F) F (F) F (F) F (F) U (F) G (F)

SEQ ID NO: 114:

(F) U (F) C (F) C (F) GU (F) C (F) U (F) UG F) C (F) GU (F) U (F) GU (F) U (F) GU (F)

SEQ ID NO: 115:

GU (F) C (F) U (F) GU (F) C (F) U (F) aaGaGU (F) F) C (F) U (F) C (F) GU (F) aGaC (F) U (F) GU (F)

SEQ ID NO: 116:

GU (F) C (F) U (F) GU (F) U (F) aaGaGU (F) U (F) F) C (F) U (F) C (F) GU (F) GaaC (F) U (F) GU (F)

SEQ ID NO: 117:

(F) C (F) C (F) C (F) C (F) U (F) GU (F) U (F) GaaGaGU (F) (F) U (F) C (F) GU (F) C (F) aaC (F) U (F) GU (F)

The sequence of internal loop 1 of these plasmids was CCU on the 5 'side and UGUU on the 3' side. Also, loop 2 contained a consensus sequence represented by 5'UUUCCXU3 '. Where X is either G or U. The last base pair of stem 1 was all U-a. In stem 2, the 8th and 9th base pairs were a-U and G-C, respectively. There were several different base pairs in the first to seventh.

Example 15: The equation of the single-stranded extruder

To improve the stability of platemers in blood, a dog variant was prepared by changing the formula of 2 'above in ribose.

Hereinafter, the sequences of the respective expression constructs are shown. The parentheses in the nucleotides represent the above 2 ', F represents a fluorine atom, M represents an O-methyl group, and L represents a Locked Nucleic Acid (LNA). The upper case is RNA, the lower case is DNA, and idT is inverted dT. The linker used ssH Linker (SAFC) or DMS (O) MT-AMINO-MODIFIFIER C6 (GLENRESEARCH) for the 5 'terminus and TFA Amino C-6 lcaa CPG (ChemGenes) for the 3' terminus. PEG40GS2 has a molecular weight of 40,000, a 2-branch type GS (manufactured by SUNBRIGHT GL2-400GS2 Nichia), PEG40TS2 has a molecular weight of 40,000 and a 2-branch TS (manufactured by SUNBRIGHT GL2-400TS Nichi) -400 TS Nichis), PEG80TS2 is a TS type (SUNBRIGHT GL2-800TS Nichi-like) having a molecular weight of 80000, and PEG80TS4 is a 4-branch TS type having a molecular weight of 80000 (SUNBRIGHT GL4-800TS Nichia).

SEQ ID NO: 38 (1):

(F) G (M) G (M) G (M) U (F) C (F) U (F) U (F) U (F) U (F) C (F) C (F) F) G (M) C (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 151:

(F) G (M) G (M) G (M) U (F) C (F) U (F) U (F) U (F) U (F) C (F) C (F) G (M) U (F) M) U (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 152:

(F) G (M) G (M) G (M) U (F) C (F) U (F) U (F) U (F) U (F) C (F) G (M) U (F) F) G (M) U (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 153:

G (M) G (M) G (M) U (F) C (F) C (F) U (F) GC (F) U (F) U (F) U (F) U (F) C (F) G (M) U (F) F) G (M) U (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 154:

(F) G (M) G (M) G (M) U (F) C (F) U (F) U (F) U (F) U (F) C (F) G (M) U (F) F) G (M) U (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 155:

(F) G (M) G (M) G (M) U (F) C (F) C (F) U (F) U (F) U (F) C (F) G (M) U (F) M) U (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 62 (1):

(F) G (M) G (M) G (M) U (F) C (F) G (M) aG (M) U (F) U (F) U (F) C (F) G (M) U (F) M) G (M) U (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 66 (1):

(F) U (F) G (M) G (M) G (M) U (F) C (F) U (F) U (F) U (F) U (F) C (F) C (F) M) U (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 68 (1):

G (M) G (M) G (M) U (F) C (F) C (F) U (F) GaU (F) (F) U (F) U (F) C (F) C (F) G (M) U (F) M) U (F) G (M) U (F) C (F) U (F) GU (F)

SEQ ID NO: 71 (1):

(F) U (F) G (M) G (M) G (M) U (F) C (F) (F) U (F) U (F) C (F) C (F) G (M) U (F) M) U (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 74 (1):

(F) G (M) G (M) G (M) U (F) C (F) (F) U (F) U (F) C (F) C (F) G (M) U (F) M) U (F) G (M) G (M) C (F) U (F) GU (F)

SEQ ID NO: 76 (1):

G (M) G (M) G (M) U (F) C (F) U (F) U (F) U (F) C (F) C (F) G (M) U (F) C (F) U (F) C (F) F) U (F) GU (F) U (F) aC (F) C (F)

SEQ ID NO: 77 (1):

G (M) G (M) G (M) U (F) C (F) U (F) U (F) U (F) C (F) C (F) C (F) G (M) U (F) C (F) U (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 78 (1):

G (M) G (M) G (M) U (F) C (F) C (F) U (F) U (F) C (F) C (F) G (M) U (F) C (F) M (F) C (F) U (F) U (F) U (F)

SEQ ID NO: 78 (2):

G (M) G (M) G (M) G (M) U (M) C (F) C (M) U U (F) U (F) C (F) C (M) G (M) U (M) C (F) M (M) U (M) U (M) C (M) U (F) GU

SEQ ID NO: 78 (3):

(M) G (M) G (M) U (M) C (F) C (M) U (F) GG (M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) M) U (F) C (M) U (F) GU (M) U (F) aC

SEQ ID NO: 78 (4):

(M) G (M) G (M) U (M) C (F) C (M) U (F) GG (M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) M (M) U (M) U (M) C (M) U (F) GU

SEQ ID NO: 79 (1):

G (M) G (M) G (M) U (F) C (F) C (F) U U (F) U (F) C (F) C (F) C (F) G (M) U (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 80 (1):

G (M) G (M) G (M) U (F) C (F) C (F) U U (F) U (F) C (F) C (F) C (F) G (M) U (F) M) U (F) C (F) U (F) GU (F) U (F) aC

SEQ ID NO: 82 (1):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (2):

(F) aG (M) aG (M) aG (M) U (M) C (F) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (3):

(F) aG (M) aG (M) U (F) C (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (4):

(F) G (M) aU (M) aG (M) aG (M) U (F) C (F) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (5):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (6):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (M) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (7):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (M) C (F) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (8):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) U (M) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (9):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (10):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (11):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) A (M) C (F) U (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (12):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) M) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (13):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (M) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (14):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (M) GU (F) U (F) aC (F)

SEQ ID NO: 82 (15):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (M) U (F) aC (F)

SEQ ID NO: 82 (16):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (M)

SEQ ID NO: 82 (17):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (18):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (19):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) U (F) C (M) C (M) G (M) U (F) C (F) M) C (M) U (F) GU (M) U (F) aC (M)

SEQ ID NO: 82 (20):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) (F) U (F) C (F) C (M) G (M) U (M) C (F) U (F) F) C (M) U (F) GU (M) U (F) aC (M) C

SEQ ID NO: 82 (21):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) F) C (M) U (F) GU (M) U (F) aC (M) C

SEQ ID NO: 82 (22):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) F) C (M) U (F) GU (M) U (F) aC (M) C

SEQ ID NO: 82 (23):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) (F) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) C (M) U (F) GU (M) U (F) aC (M)

SEQ ID NO: 82 (24):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) C (M) U (F) GU (M) U (F) aC (M)

SEQ ID NO: 82 (25):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) M) C (M) U (F) GU (M) U (F) aC (M)

SEQ ID NO: 82 (26):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) U (F) C (M) C (M) G (M) U (M) C (F) M) C (M) U (F) GU (M) U (F) aC (M)

SEQ ID NO: 82 (27):

(F) U (F) G (M) aU (F) aG (M) aG (M) U (F) C (F) C (F) G (M) U (F) C (F) U (F) C (F) F) U (F) GU (F) U (F) aC (F) C (F)

SEQ ID NO: 156:

(F) aG (M) aG (M) aG (M) tU (F) G (M) U (F) C (F) C (F) G (M) U (F) C (F) U (F) C (F) F) U (F) GU (F) U (F) aC (F) C (F)

SEQ ID NO: 157:

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) (F) C (F) C (F) G (M) U (F) C (F) U (F) C (F) F) U (F) GU (F) U (F) aC (F) C (F)

SEQ ID NO: 82 (30):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) U (F) C (F) C (F) C (F) U (F) C (F) F) U (F) GU (F) U (F) aC (F) C (F)

SEQ ID NO: 82 (31):

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) CU (F) C (F) F) U (F) GU (F) U (F) aC (F) C (F)

SEQ ID NO: 158:

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) G (M) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) tGU (F) U (F) aC (F)

SEQ ID NO: 159:

(F) aG (M) aG (M) aG (M) U (F) C (F) U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) taC (F) C (F)

SEQ ID NO: 160:

(F) G (M) aU (M) aG (M) aG (M) tU (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) G M) U (F) GU (M) U (F) aC (M) C (M)

SEQ ID NO: 161:

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) M) C (M) tGU (M) U (F) aC (M) C

SEQ ID NO: 162:

G (M) aG (M) aG (M) aG (M) tU (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) G M) tGU (M) U (F) aC (M) C (M) C

SEQ ID NO: 82 (37):

G (M) G (M) G (M) U (M) C (F) C (M) uGG (M) aU U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) G M) U (F) GU (M) U (F) aC (M) C (M)

SEQ ID NO: 82 (38):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) U (F) GU (M) U (F) aC (M) C (M)

SEQ ID NO: 82 (39):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) (M) C (M) U (M) U (F) C (M) G (M) U (M) C (F) M) U (F) GU (M) U (F) aC (M) C (M)

SEQ ID NO: 82 (40):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) uC (M) G (M) M) U (F) GU (M) U (F) aC (M) C (M)

SEQ ID NO: 82 (41):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) M) C (M) U (F) GU (M) uaC (M) C

SEQ ID NO: 82 (42):

(M) G (M) G (M) G (M) U (M) C (F) C (M) U U (F) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) C (M) C (M) U (F) GU (M) U (F) aC

SEQ ID NO: 82 (43):

(M) G (M) G (M) G (M) U (M) C (F) C (M) U U (F) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) C (M) C (M) U (F) GU (M) U (F) aC

SEQ ID NO: 82 (44):

(M) G (M) G (M) G (M) U (M) C (F) C (M) U U (F) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) C (M) C (M) U (F) GU (M) U (F) aC

SEQ ID NO: 82 (45):

G (M) G (M) G (M) G (M) U (M) C (F) C (M) U U (F) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) C (M) C (M) U (F) GU (M) U (F) aC

SEQ ID NO: 82 (46):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) C (M) C (M) U (F) GU (M) U (F) aC

SEQ ID NO: 82 (47):

(F) G (M) aU (M) aG (M) aG (M) U (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) M) C (M) U (F) GU (M) U (F) A (M)

SEQ ID NO: 82 (48):

G (M) G (M) G (M) G (M) U (M) C (F) C (M) U G (M) U (F) U (F) U (F) C (F) C (M) G (M) U (M) M) A (M) U (M) C (M) C (M) U (F) GU

SEQ ID NO: 163:

(F) G (M) aU (M) aG (M) aG (M) tU (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) G M) tGU (M) uaC (M) C (M) C (M) -idT

SEQ ID NO: 164:

(F) U (F) u (M) aG (M) aG (M) aG (M) aG C (F) C (M) G (M) U (M) C (F) U (F) C (M) G (M) M) U (F) aC (M) C (M) C (M) -idT

SEQ ID NO: 165:

(F) G (M) aU (M) aG (M) aG (M) tU (F) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) G M) tGU (M) uA (M) C (M) C (M)

SEQ ID NO: 166:

G (M) G (M) G (M) G (M) U (M) C (F) C (M) U G (M) tU (F) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) U (M) C (M) C (M) tGU (M) uA (M) C

SEQ ID NO: 167:

G (M) G (M) G (M) G (M) U (M) C (F) C (M) U G (M) tU (F) U (F) C (F) C (M) G (M) U (M) C (F) U (F) M) U (M) C (M) C (M) tGU (M) U (F) A (M) C

SEQ ID NO: 168:

G (M) G (M) G (M) U (M) C (F) C (M) uGG (M) (F) U (F) C (F) C (M) G (M) U (M) C (F) M) C (M) C (M) tGU (M) uA (M) C (M)

SEQ ID NO: 82 (55):

(F) GG (M) aU (M) aaG (M) aG (M) U (F) PEG80TS4-G (M) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) M) C (M) U (F) GU (M) U (F) aC (M)

SEQ ID NO: 82 (56):

G (M) aG (M) aG (M) U (F) C (F) C (F) U (F) GG U (F) C (F) C (F) C (F) G (M) U (F) C (F) F) C (F) U (F) GU (F) U (F) aC (F)

SEQ ID NO: 82 (57):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) A (M) U (M) C (M) C (M) U (F) GU

SEQ ID NO: 82 (58):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GsG (M) M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) A (M) U (M) C (M) C (M) U (F) GU

SEQ ID NO: 82 (59):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GG (M) M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) A (M) U (M) C (M) C (M) U (F) GU

SEQ ID NO: 82 (60):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GG (M) M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) A (M) U (M) C (M) C (M) U (F) GU

SEQ ID NO: 82 (61):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GG (M) M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) A (M) U (M) C (M) C (M) U (F) GU

SEQ ID NO: 82 (62):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GG (M) M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) A (M) U (M) C (M) C (M) U (F)

SEQ ID NO: 82 (63):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GG (M) M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) A (M) U (M) C (M) C (M) U (F) GsU (M)

SEQ ID NO: 82 (64):

(F) GG (M) aU (M) aaG (M) aG (M) U (F) PEG40TS2-G (M) G (M) U (F) C (F) C (M) G (M) U (M) C (F) U (F) C (M) M) C (M) U (F) GU (M) U (F) aC (M)

SEQ ID NO: 87 (1):

(F) U (F) G (M) G (M) G (M) U (F) C (F) C U (F) C (F) GU (F) C (F) U (F) GU (F) GGGC (F) M) C (M) C (M) -dT

SEQ ID NO: 87 (2):

(M) G (M) G (M) U (M) C (F) C (M) U (F) GC (F) U U (F) U (F) C (F) C (M) G (M) U (M) C (F) M) U (F) GU (M) U (F) aC (M) C (M)

SEQ ID NO: 87 (3):

(M) G (M) G (M) U (M) C (F) C (M) U (F) GC (F) U U (F) U (F) C (F) C (M) G (M) U (M) C (F) M) G (M) G (M) C (M) U (F) GU (M) U (F) aC

SEQ ID NO: 87 (4):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GC (M) U U (F) U (F) C (F) C (M) G (M) U (M) C (F) M) G (M) G (M) C (M) U (F) GU (M) U (F) aC

SEQ ID NO: 87 (5):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GC M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) G (M) G (M) G (M) C (M) U (F) GU (M) U (F) A

SEQ ID NO: 88 (1):

(F) U (F) C (F) U (F) F (U) F (U) F (U) GU (F) U (F) C (F) C (F) GU (F) GaaC (F)

SEQ ID NO: 88 (2):

(F) UA (F) UA (F) UA (F) UA (F) UA (F) G (M) G (M) U (F) C (F) GU (F) C (F) U (F) GU (F) GaaC (F) M) C (M) C (M) -dT

SEQ ID NO: 88 (3):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GU (F) U (F) U (F) U (F) C (F) C (M) G (M) U (M) C (F) M) U (F) GU (M) U (F) aC (M) C (M)

SEQ ID NO: 88 (4):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GU (M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) M) aaC (M) U (F) GU (M) U (F) aC (M) C

SEQ ID NO: 89 (1):

(F) U (F) U (F) G (M) G (M) G (M) U (F) C C (F) GU (F) C (F) U (F) C (F) GU (F) M) C (M) C (M) -dT

SEQ ID NO: 89 (2):

G (M) G (M) G (M) U (F) C (F) C (M) U (F) GU (F) GGaaG U (F) C (F) C (M) G (M) U (M) C (F) M) U (F) GU (M) U (F) aC (M) C (M)

SEQ ID NO: 89 (3):

G (M) G (M) G (M) U (F) C (F) C (M) U (F) U (F) U (F) C (F) C (M) G (M) U (M) C (F) F) aC (M) U (F) GU (M) U (F) aC (M)

SEQ ID NO: 89 (4):

(M) G (M) G (M) U (F) C (F) C (M) U U (F) U (F) C (F) C (M) G (M) U (M) C (F) M) C (M) aC (M) U (F) GU (M) U (F) aC

SEQ ID NO: 89 (5):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GU (M) M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) C (M) C (M) C (M) U (F) GU (M) U (F) A (M) C

SEQ ID NO: 111 (1):

G (M) G (M) G (M) U (M) C (F) C (M) U (F) GU (M) M) U (F) U (F) C (F) C (M) G (M) U (M) C (F) A (M) G (M) A (M) C (M) U (F) GU (M)

The binding activity of the RNA represented by SEQ ID NO: 82 (2) to NGF, NT-3 and NT-4 was measured by surface plasmon resonance method as in Example 13. As a result, it was found that the protein binds to either of the proteins (Fig. 3). Further, whether or not the aptamer represented by SEQ ID NO: 82 (2) inhibits the binding of NGF to its receptor TrkA or p75 was examined using the surface plasmon resonance method as in Example 2. [ As a result, it was found that the binding of NGF to the receptor was strongly inhibited (FIGS. 4 and 5).

The neurite outgrowth inhibitory activity was measured in the same manner as in Example 3 with respect to all of the above recipients. As a result, IC ₅₀ values of all of the recipients other than SEQ ID NO: 62 (1) were 1 nM or less (Table 1). In particular, IC ₅₀ value of the aptamer shown by SEQ ID NO: 162 was 0.033 nM. In addition, TF-1 cell proliferation inhibitory activity was measured by the same method as in Example 8, and the IC ₅₀ value of most of the tympanic membranes was 1 nM or less (Table 1). In particular, IC ₅₀ value of the aptamer shown by SEQ ID NO: 162 was 0.014 nM. IC ₅₀ values of the aptamer shown by SEQ ID NO: 62 (1) was 0.49 nM.

From the above, it was revealed that this aptamer can maintain the inhibitory activity even if the formula of the 2 'above is changed.

[Table 1-1]

[Table 1-2]

[Table 1-3]

Example 16: Confirmation of cross-reactivity with other neurotrophins by TF-1 cell proliferation inhibition evaluation system

TF-1 cells were used to examine whether NGF aptamers inhibited BDNF, NT-3, and NT-4. (TrkB, TrkC, p75) for each neurotrophic factor were introduced into a human leukemia cell line TF-1 cells (ATCC Number: CRL-2003) using a retroviral vector and their receptors were stably Cells with high expression were prepared. TF-1 cells transfected with TrkB and p75, and TrkC and p75 transfected with NT-3 were evaluated for BDNF inhibition activity, TF-1 cells transfected with TrkC and p75 for NT-3, and TF- -1 cells were used. These cells were suspended in RPMI-1640 medium containing 20% fetal bovine serum and 1000 (50 쨉 l) cells were inoculated per well in a white 96-well flat plate. Human BDNF (final concentration 0.074 nM) or NT-3 (final concentration 0.074 nM) or NT-4 (final concentration 0.071 nM) pre-reacted in RPMI-1640 medium without serum for 30 minutes at room temperature, (Final concentration: 1 μM to 0.01 nM) was added to the wells. After 3 days, 100 μl of CellTiter-Glo reagent of CellTiter-Glo Luminescent Cell Viability Assay (Promega) was added to each well, To measure chemiluminescence. The amount of luminescence per well obtained by culturing the cells for 3 days with the addition of BDNF, NT-3 or NT-4 alone was cultured for 3 days with 0% inhibitory activity, no BDNF or NT-3 or NT-4, The inhibitory activity of platemer was calculated from the amount of luminescence per well obtained when BDNF, NT-3 or NT-4 and platemer were mixedly added with inhibitory activity of 100%. And 0% when the inhibitory activity was 0 or less. The 50% inhibitory concentration (IC ₅₀ ) was determined from the concentration at the upper and lower points between 50% inhibitory activity. The experimental results are shown in Table 2. An IC ₅₀ value of "> X " indicates that the inhibitory activity was 50% or less when the concentration X described was the highest measured concentration. ND means not measured.

All the aptamers tested showed strong inhibitory activity. Table 2 shows the IC ₅₀ values of some of them. Inhibitory activity of the aptamer of the present invention as set forth in Table 2, with respect to the IC ₅₀ values less than 0.1 nM with respect to NGF, IC ₅₀ values for BDNF was more than 1000 nM. NT-3 was varied from 0.97 nM to more than 10 nM depending on the platemaker. For NT-4, it was 3 nM or less to 30 nM or more.

[Table 2]

Example 17: Analgesic action by NGF < RTI ID = 0.0 >

In order to study the analgesic action of NGF depressant on NGF-induced pain, a recessive hyperpigmentation model caused by subcutaneous administration of NGF to rat hind legs was used. For the experiment, Jcl: SD rats (6 weeks old) were used. As an index of thermal hyperalgesia, we used a reaction latency response of infrared radiation to the sole from a foot thermal stimulus measuring device (Ugo Basile). The evaluation system was refined on the day before the test. Before the administration on the day of the test, the escape behavior response time was measured, and the subjects were used for 10 seconds to less than 20 seconds. Human β-NGF (R & D systems, final concentration 50 μg) was added to Vehicle (20 mM Tris-HCl (pH 7.6), 145 mM NaCl, 5.4 mM KCl, 0.8 mM MgCl ₂ , 1.8 mM CaCl ₂ , 0.1% BSA) / Ml) and the test substance were mixed, incubated at room temperature for 30 minutes, subcutaneously administered to the soles of the left hind paws at 10 占 퐇, and after 5 hours, the escape behavior response time was measured. The platemer of SEQ ID NO: 153 was administered at a final concentration of 50 mg / ml (molar ratio to NGF: 1000-fold). As a control, a mixed solution of vehicle or vehicle and NGF was administered in the same manner. The results are shown in Table 3 (Mean ± SEM, n = 9).

After 5 hours of administration, the duration of escape response was significantly smaller in the NGF group than in the vehicle group (p <0.01). In addition, after 5 hours of administration, the withdrawal response time of the platemer group was larger than that of the NGF alone group (p < 0.01). From the above results, it can be seen that this aptamer can be used as a pain medicine due to NGF.

[Table 3]

Example 18: Analgesic effect on post-op pain model by NGF aptamer

To investigate the efficacy of NGF antipyretic therapy, a postoperative pain model was used to induce febrile hyperalgesia. Crl: CD (SD) rats (5 weeks old) were used for the experiment. The tip of the catheter was held in the femoral vein and the other end was exposed to the outside of the rat at the back. One week later, a Quick connect infusion system (manufactured by Strategic applications Incorporated) was mounted on the rats and evaluated for thermal hyperalgesia one week later. As an index of the thermal hyperalgesia, a brief reaction of the escape behavior to the infrared irradiation of the sole from the foot thermal stimulus measuring apparatus (Ugo Basile) was used. Three days before the start of the test, the evaluation system was refined. On the start of the study, a short time of escape behavior response was measured, and individuals within 10 seconds to less than 20 seconds were used. NGF-platamer dissolved in physiological saline was continuously administered intravenously using a syringe pump (manufactured by Terumo Corporation). As the NGF antiserum, there were used an umbraculler (administered at 21.2 mg / 240 ml / kg / 96 hr) shown in SEQ ID NO: 82 (56) and a platemer (10.08 mg / 240 ml / kg / 96 hr) was used. As a control, the vehicle was administered identically. One hour after the start of the administration, the skin and fascia of the hindlimb of the right hind paw were incised, and the flexor muscles were cut vertically and the skin was sutured. After one, two, three, and four days after the incision, the escape behavior response time was measured. The results are shown in Table 4.

In the vehicle group, the duration of the escape behavior response at 1, 2, 3, and 4 days after administration / incision was significantly smaller than that before administration / incision (p <0.01). At 1, 2, 3, and 4 days after administration and incision, the escape behavior response of any of the platemer treated groups was significantly larger than that of the vehicle group (p <0.01). The experimental results are shown in Table 4 and Table 5 (Mean 占 占 EM m, n = 8-9). This suggests that anti-NGF aptamers have analgesic effects on postoperative pain models.

[Table 4]

[Table 5]

The aptamer of the present invention may be useful as medicines for diseases such as pain and inflammatory diseases, as diagnostic reagents and reagents. The platemers and complexes of the present invention may also be useful for the purification and enrichment of NGF and for the detection and quantification of NGF.

This application is based on Japanese Patent Application No. 2011-213585 (filed on September 28, 2011) filed in Japan, the contents of which are incorporated herein by reference in its entirety.

                         SEQUENCE LISTING <110> RIBOMIC Inc.   <120> Aptamers to NGF and use thereof <130> 091940 <150> JP2011-213585 <151> 2011-09-28 <160> 168 <170> PatentIn version 3.5 <210> 1 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 1 gggagaacuu cgaccagaag uugacgacca acucgucuu uauggauuua cgugaacccg 60 uaugugcgca uacauggauc cuc 83 <210> 2 <211> 82 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 2 gggagaacuu cgaccagaag uccaaacggg acuuuauacc ucugagucgc cuacgcuccu 60 augugcgcau acauggaucc uc 82 <210> 3 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 3 gggagaacuu cgaccagaag uuggcacauc cugcugcgua guuuccgucu ccguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 4 <211> 91 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 4 gggagaacuu cgaccagaag uacguuagua cguuugcaua uguacaaccu ugcauacgau 60 acguagauua ugugcgcaua cauggauccu c 91 <210> 5 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 5 gggagaacuu cgaccagaag uuagaagagg acuaguugcu aaugcccugg uucgucgcua 60 uaugugcgca uacauggauc cuc 83 <210> 6 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 6 gggagaacuu cgaccagaag ugcaauacuu ucgcggcaua ugugcaaacc uugccacgac 60 uaugugcgca uacauggauc cuc 83 <210> 7 <211> 81 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 7 gggagaacuu cgaccagaag acgcaccucu uaucacacau gcgucagccu ugugauacua 60 ugugcgcaua cauggauccu c 81 <210> 8 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 8 gggagaacuu cgaccagaag auccacuggu acuacgugac cccgcauagg caauccugcu 60 uaugugcgca uacauggauc cuc 83 <210> 9 <211> 73 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 9 gggagaacuu cgaccagaag uuggcacauc cugcugcgua guuuccgucu ccguggcugu 60 uaugugcgca uac 73 <210> 10 <211> 68 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 10 gggagaacuu cgaccagaag uuggcacauc cugcugcgua guuuccgucu ccguggcugu 60 uaugugcg 68 <210> 11 <211> 46 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 11 gggcacaucc ugcugcguag uuuccgucuc cguggcuguu augugc 46 <210> 12 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 12 ggguccugcu gcguaguuuc cgucuccgug gcuguuaccc 40 <210> 13 <211> 42 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 13 gggguccugc ugcguaguuu ccgucuccgu ggcuguuacc cc 42 <210> 14 <211> 78 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 14 gggagaacuu cgaccagaag ugcaauacuu ucgcggcaua ugugcaaacc uugccacgac 60 uaugugcgca uacaugga 78 <210> 15 <211> 73 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 15 gggagaacuu cgaccagaag ugcaauacuu ucgcggcaua ugugcaaacc uugccacgac 60 uaugugcgca uac 73 <210> 16 <211> 63 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 16 cgaccagaag ugcaauacuu ucgcggcaua ugugcaaacc uugccacgac uaugugcgca 60 uac 63 <210> 17 <211> 58 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 17 agaagugcaa uacuuucgcg gcauaugugc aaaccuugcc acgacuaugu gcgcauac 58 <210> 18 <211> 48 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 18 ugcaauacuu ucgcggcaua ugugcaaacc uugccacgac uaugugcg 48 <210> 19 <211> 46 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 19 gcaauacuuu cgcggcauau gugcaaaccu ugccacgacu augugc 46 <210> 20 <211> 50 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 20 gugcaauacu uucgcggcau augugcaaac cuugccacga cuaugugcgc 50 <210> 21 <211> 48 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 21 gggaauacuu ucgcggcaua ugugcaaacc uugccacgac uauguccc 48 <210> 22 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 22 gggagaacuu cgaccagaag uuggcacauc cugcugcgua guuuccgucu ucguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 23 <211> 82 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 23 gggagaacuu cgaccagaag uggcacaucc ugcugcguag uuuccgucug cguggcuguu 60 augugcgcau acauggaucc uc 82 <210> 24 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 24 gggagaacuu cgaccagaag uuggcacauc cugcugcgaa guuuccgucu ccguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 25 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 25 gggagaacuu cgaccagaag uuggcacauc cugcugcgca guuuccgucu acguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 26 <211> 82 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 26 gggagaacuu cgaccagaag uggcacaucc ugcugcguag uuuccgucuu cgcggcuguu 60 augugcgcau acauggaucc uc 82 <210> 27 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 27 gggagaacuu cgaccagaag uuggcacauc cugcugcgca guuuccgucu gcguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 28 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 28 gggagaacuu cgaccagaag uuggcacauc cugcugcgua guuuccaucu gcguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 29 <211> 81 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 29 gggagaacuu cgaccagaag uucacauccu gcugcgaagu uuccuucuuc guggcuguua 60 ugugcgcaua cauggauccu c 81 <210> 30 <211> 85 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 30 gggagaacuu cgaccagaag uuggcacauc cugcugcgaa gguuccgucu ucguggcugu 60 acuaugugcg cauacaugga uccuc 85 <210> 31 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 31 gggagaacuu cgaccagaag uuggcacauc cugcugcgca guuucccucu gcguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 32 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 32 gggagaacuu cgaccagaag uuggcacauc cugcugcgga guuuccuucu ucguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 33 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 33 gggagaacuu cgaccagaag uuggcacauc cugccgcgua guuucaaucu ugguggcgug 60 uaugugcgca uacauggauc cuc 83 <210> 34 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 34 gggagaacuu cgaccagaag uuggcacauc cugccgcgua guuuccgucu gcguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 35 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 35 gggagaacuu cgaccagaag uuggcacauc cuguugcgua guuuccuucu acguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 36 <211> 92 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 36 gggagaacuu cgaccagaag guacguuagu acguuugcau auguacaacc uugcauacga 60 uacguagguu augugcgcau acauggaucc uc 92 <210> 37 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 37 gggagaacuu cgaccagaag uuggcacauc cugcuacgua guuuccuucu ucguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 38 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 38 ggguccugcu gcguaguuuc cgucuucgcg gcuguuaccc 40 <210> 39 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 39 ggguccugcu gcgcaguuuc cgucugcgug gcuguuaccc 40 <210> 40 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 40 ggguccugcu gcguaguuuc caucugcgug gcuguuaccc 40 <210> 41 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 41 ggguccugcu gcgaaguuuc cuucuucgug gcuguuaccc 40 <210> 42 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 42 ggguccugcu gcgcaguuuc ccucugcgug gcuguuaccc 40 <210> 43 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 43 ggguccugcu gcggaguuuc cuucuucgug gcuguuaccc 40 <210> 44 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 44 ggguccugcc gcguaguuuc cgucugcgug gcuguuaccc 40 <210> 45 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 45 ggguccuguu gcguaguuuc cuucuacgug gcuguuaccc 40 <210> 46 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 46 ggguccugcu gcgcaguuuc cgucuacgug gcuguuaccc 40 <210> 47 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 47 ggguccugcu gcguaguuuc cgucuucgcg gcuguuaccc 40 <210> 48 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 48 gggagaacuu cgaccagaag uuggcacauc cugcugcgga guuuccgucu cgguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 49 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 49 gggagaacuu cgaccagaag uuugcacauc cugcugcgua guuuccgucu acguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 50 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 50 gggagaacuu cgaccagaag cuggcacauc cuguugcgua guuuccgucu acgugacugu 60 uaugugcgca uacauggauc cuc 83 <210> 51 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 51 gggagaacuu cgaccagaag uuggcacacc cugcuacgga guuuccgucu cgguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 52 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 52 gggagaacuu cgaccagaag uuggcacauc cugcugcaua guuuccgucu uuguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 53 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 53 gggagaacuu cgaccagaag uuugcacauc cugcugcgca guuuccgucu acguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 54 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 54 gggagaacuu cgaccagaag uuggcacauc cugaugcgua guuuccgucu gcgugucugu 60 uaugugcgca uacauggauc cuc 83 <210> 55 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 55 gggagaacuu cgaccagaag uuggcacauc cuguugcgua guuuccgucu gcguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 56 <211> 82 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 56 gggagaacuu cgaccagaag uugcacaucc ugcuguguag uuuccgucug caugguuguu 60 augugcgcau acauggaucc uc 82 <210> 57 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 57 gggagaacuu cgaccagaag uaggcacguc cugcugcaua guuuccgucu guguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 58 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 58 gggagaacuu cgaccagaag uugacacauc cugcugcgua guuuccgucu gcgugguugu 60 uaugugcgca uacauggauc cuc 83 <210> 59 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 59 gggagaacuu cgaccagaag uuugcacauc cugcugcgua guuuccuucu gcgugguugu 60 uaugugcgca uacauggauc cuc 83 <210> 60 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 60 gggagaacuu cgaccagaag uuggcacauc cugcugcaga guuuccgucu cgguggcugu 60 uaugugcgca uacauggauc cuc 83 <210> 61 <211> 83 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 61 gggagaacuu cgaccagaag uuagcacauc cugcugcgua guuuccgucu ucgcgguugu 60 uaugugcgca uacauggauc cuc 83 <210> 62 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 62 ggguccugcu gcggaguuuc cgucucggug gcuguuaccc 40 <210> 63 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 63 ggguccugcu gcguaguuuc cgucuacgug gcuguuaccc 40 <210> 64 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 64 ggguccuguu gcguaguuuc cgucuacgug acuguuaccc 40 <210> 65 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 65 ggguccugcu acggaguuuc cgucucggug gcuguuaccc 40 <210> 66 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 66 ggguccugcu gcauaguuuc cgucuuugug gcuguuaccc 40 <210> 67 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 67 ggguccugcu gcgcaguuuc cgucuacgug gcuguuaccc 40 <210> 68 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 68 ggguccugau gcguaguuuc cgucugcgug ucuguuaccc 40 <210> 69 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 69 ggguccuguu gcguaguuuc cgucugcgug gcuguuaccc 40 <210> 70 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 70 ggguccugcu guguaguuuc cgucugcaug guuguuaccc 40 <210> 71 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 71 ggguccugcu gcauaguuuc cgucugugug gcuguuaccc 40 <210> 72 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 72 ggguccugcu gcguaguuuc cgucugcgug guuguuaccc 40 <210> 73 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 73 ggguccugcu gcguaguuuc cuucugcgug guuguuaccc 40 <210> 74 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 74 ggguccugcu gcagaguuuc cgucucggug gcuguuaccc 40 <210> 75 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 75 ggguccugcu gcguaguuuc cgucuucgcg guuguuaccc 40 <210> 76 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 76 ggguccugau uaagaguuuc cgucucguaa ucuguuaccc 40 <210> 77 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 77 ggguccugac uaagaguuuc cgucucguag ucuguuaccc 40 <210> 78 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 78 ggguccuggc caagaguuuc cgucucgugg ucuguuaccc 40 <210> 79 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 79 ggguccuggu uaagaguuuc cgucucguaa ccuguuaccc 40 <210> 80 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 80 ggguccuggc uaagaguuuc cgucucguag ucuguuaccc 40 <210> 81 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 81 ggguccuggu gauaaguuuc cgucuuauca ccuguuaccc 40 <210> 82 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 82 ggguccugga uaagaguuuc cgucucguau ccuguuaccc 40 <210> 83 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 83 ggguccugua caagaguuuc cgucucgugu acuguuaccc 40 <210> 84 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 84 ggguccuguc gcuaaguuuc cgucuuugcg gcuguuaccc 40 <210> 85 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 85 ggguccugag uaagaguuuc cgucucauac ucuguuaccc 40 <210> 86 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 86 ggguccugcu gcguaguuuc cuucugcgug guuguuaccc 40 <210> 87 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 87 ggguccugcu caagaguuuc cgucucgugg gcuguuaccc 40 <210> 88 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 88 ggguccuguu caagaguuuc cgucucguga acuguuaccc 40 <210> 89 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 89 ggguccugug gaagaguuuc cgucucgucc acuguuaccc 40 <210> 90 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 90 ggguccugcg uaagaguuuc cgucucguau gcuguuaccc 40 <210> 91 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 91 ggguccugcc uaagaguuuc cgucucguag gcuguuaccc 40 <210> 92 <211> 39 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 92 ggguccugac caagaguuuc cgucucgugg ucuguaccc 39 <210> 93 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 93 ggguccugcc gcguaguuuc cgucuucgcg guuguuaccc 40 <210> 94 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 94 ggguccugcu gcguaguuuc cgucugcgga gcuguuaccc 40 <210> 95 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 95 ggguccugcu gcguaguuuc caucuucgug gcuguuaccc 40 <210> 96 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 96 ggguccugcu gcguaguuuc cgucuaugug gcuguuaccc 40 <210> 97 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 97 ggguccugcu acguaguuuc cgucugcgug gcuguuaccc 40 <210> 98 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 98 ggguccugcu acguaguuuc cgucuacgug gcuguuaccc 40 <210> 99 <211> 82 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 99 gggagaacuu cgaccagaag uccaaacggg acuuuauacc ucugagucgc cuuugcuccu 60 augugcgcau acauggaucc uc 82 <210> 100 <211> 81 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 100 gggagaacuu cgaccagaag accaaacgga cuuuauaccu cugagucgcc uaugcuccua 60 ugugcgcaua cauggauccu c 81 <210> 101 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 101 ggguccugac guauaguuuc cgucuguaug ucuguuaccc 40 <210> 102 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 102 ggguccugag caagaguuuc cgucucaugc ucuguuaccc 40 <210> 103 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 103 ggguccugcu gcguaguuuc cgucugcgug guuguuaccc 40 <210> 104 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 104 ggguccugau gucaaguuuc cgucuugaug ucuguuaccc 40 <210> 105 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 105 ggguccuguu gcuaaguuuc cgucuuagug acuguuaccc 40 <210> 106 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 106 ggguccugcu gcguaguuuc cgucugcgua gcuguuaccc 40 <210> 107 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 107 ggguccugcu gcgaaguuuc cgucuucgug gcuguuaccc 40 <210> 108 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 108 ggguccuguu gcguaguuuc cgucugcgug acuguuaccc 40 <210> 109 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 109 ggguccugcu gcguaguuuc cuucugcgug gcuguuaccc 40 <210> 110 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 110 ggguccugcc gcguaguuuc cgucugcgug gcuguuaccc 40 <210> 111 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 111 ggguccuguc uaagaguuuc cgucucguag acuguuaccc 40 <210> 112 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 112 ggguccuguu caagaguuuc cgucucgugg acuguuaccc 40 <210> 113 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 113 ggguccugcu guguaguuuc cgucugcaug guuguuaccc 40 <210> 114 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 114 ggguccugac aaagaguuuc cgucucguug ucuguuaccc 40 <210> 115 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 115 ggguccuguc uaagaguuuc cgucucguag acuguuaccc 40 <210> 116 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 116 ggguccuguu caagaguuuc cgucucguga acuguuaccc 40 <210> 117 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 117 ggguccuguu gaagaguuuc cgucucguca acuguuaccc 40 <210> 118 <211> 83 <212> DNA <213> Artificial <220> <223> DNA template <220> <221> misc_feature &Lt; 222 > (24) <223> n is a, c, g, or t <400> 118 gaggatccat gtatgcgcac atannnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnncttctgg tcgaagttct ccc 83 <210> 119 <211> 45 <212> DNA <213> Artificial <220> <223> primer <400> 119 cggaattcta atacgactca ctatagggag aacttcgacc agaag 45 <210> 120 <211> 23 <212> DNA <213> Artificial <220> <223> primer <400> 120 gaggatccat gtatgcgcac ata 23 <210> 121 <211> 44 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 121 gggcacaucc ugcgcguagu uuccgucucc gugcuguuau gugc 44 <210> 122 <211> 44 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 122 gggcacaucc ugcugcgagu uuccgucucg uggcuguuau gugc 44 <210> 123 <211> 44 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 123 gggcacaucc ugugcguagu uuccgucucc gugcuguuau gugc 44 <210> 124 <211> 44 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 124 gggcacaucc ugcugguagu uuccgucucc uggcuguuau gugc 44 <210> 125 <211> 44 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 125 gggcacaucc ugcugcuagu uuccgucucg uggcuguuau gugc 44 <210> 126 <211> 44 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 126 gggcacaucc ugcugcgugu uuccgucccg uggcuguuau gugc 44 <210> 127 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 127 gggguccucu gcguaguuuc cgucuccgug guguuacccc 40 <210> 128 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 128 gggguccugc ugcguauuuc cguuccgugg cuguuacccc 40 <210> 129 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 129 ggggccugcu gcguaguuuc cgucuccgug gcuguucccc 40 <210> 130 <211> 45 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 130 gggcacaucc ugcugcguag uuccgucucc guggcuguua ugugc 45 <210> 131 <211> 44 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 131 gggcacaucc ugcugcguag uuugucuccg uggcuguuau gugc 44 <210> 132 <211> 45 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 132 gggcacaucc ugcugcguag uuuccucucc guggcuguua ugugc 45 <210> 133 <211> 41 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 133 gggguccugc ugcguaguuu ccgcuccgug gcuguuaccc c 41 <210> 134 <211> 45 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 134 gggcacaucc ugcugcguag uuuccgucuc cguggcugua ugugc 45 <210> 135 <211> 41 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 135 ggggucugcu gcguaguuuc cgucuccgug gcuguuaccc c 41 <210> 136 <211> 41 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 136 gggguccgcu gcguaguuuc cgucuccgug gcuguuaccc c 41 <210> 137 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 137 ggggucugcu gcguaguuuc cgucuccgug gcuguacccc 40 <210> 138 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 138 ggggucugcu gcguaguuuc cgucuccgug gcuuuacccc 40 <210> 139 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 139 gggguccgcu gcguaguuuc cgucuccgug gcguuacccc 40 <210> 140 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 140 gggguccgcu gcguaguuuc cgucuccgug gcuuuacccc 40 <210> 141 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 141 gggguccgcu gcguaguuuc cgucuccgug gcuguacccc 40 <210> 142 <211> 79 <212> DNA <213> Artificial <220> <223> DNA template <220> <221> misc_feature &Lt; 222 > (21) <223> n is a, c, g, or t <400> 142 ccagttgttg gtgacaatgc nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 gcagctccac aggcttccc 79 <210> 143 <211> 36 <212> DNA <213> Artificial <220> <223> primer <400> 143 taatacgact cactataggg aagcctgtgg agctgc 36 <210> 144 <211> 20 <212> DNA <213> Artificial <220> <223> primer <400> 144 gcattgtcac caacaactgg 20 <210> 145 <211> 83 <212> DNA <213> Artificial <220> <223> DNA template <400> 145 gaggatccat gtatgcgcac ataacagcca cggagacgga aactacgcag caggatgtgc 60 caacttctgg tcgaagttct ccc 83 <210> 146 <211> 22 <212> DNA <213> Artificial <220> <223> oligo DNA <400> 146 agacggaaac tacgcagcag ga 22 <210> 147 <211> 83 <212> DNA <213> Artificial <220> <223> DNA template <220> <221> misc_feature <222> (28) <223> n is a, c, g, or t <220> <221> misc_feature &Lt; 222 > (44) <223> n is a, c, g, or t <400> 147 gaggatccat gtatgcgcac ataacagnnn nnnngacgga aacnnnnnnn caggatgtgc 60 caacttctgg tcgaagttct ccc 83 <210> 148 <211> 83 <212> DNA <213> Artificial <220> <223> DNA template <220> <221> misc_feature &Lt; 222 > (23) <223> n is a, c, g, or t <220> <221> misc_feature &Lt; 222 > (36) <223> n is a, c, g, or t <220> <221> misc_feature &Lt; 222 > (52) <223> n is a, c, g, or t <400> 148 gaggatccat gtatgcgcac atnnnnggat acgagnnnnn nnctcttatc cnnnatgtgc 60 caacttctgg tcgaagttct ccc 83 <210> 149 <211> 45 <212> DNA <213> Artificial <220> <223> primer <400> 149 taatacgact cactataggg agaacttcga ccagaagttg gcaca 45 <210> 150 <211> 21 <212> DNA <213> Artificial <220> <223> primer <400> 150 gaggatccat gtatgcgcac a 21 <210> 151 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 151 ggguccugcu gcguaguuuc cgucugcgug gcuguuaccc 40 <210> 152 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 152 ggguccugcu gcguaguuuc cgucugcgug gcuguuaccc 40 <210> 153 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 153 ggguccugcu gcguaguuuc cgucugcgug gcuguuaccc 40 <210> 154 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 154 ggguccugcu gcguaguuuc cgucugcgug gcuguuaccc 40 <210> 155 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 155 ggguccugcu gcgcaguuuc cgucuacgug gcuguuaccc 40 <210> 156 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 156 ggguccugga uaagagtuuc cgucucguau ccuguuaccc 40 <210> 157 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 157 ggguccugga uaagagutuc cgucucguau ccuguuaccc 40 <210> 158 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 158 ggguccugga uaagaguuuc cgucucguau cctguuaccc 40 <210> 159 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 159 ggguccugga uaagaguuuc cgucucguau ccugutaccc 40 <210> 160 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 160 ggguccugga uaagagtuuc cgucucguau ccuguuaccc 40 <210> 161 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 161 ggguccugga uaagaguuuc cgucucguau cctguuaccc 40 <210> 162 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 162 ggguccugga uaagagtuuc cgucucguau cctguuaccc 40 <210> 163 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 163 ggguccugga uaagagtuuc cgucucguau cctguuaccc 40 <210> 164 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 164 ggguccugga uaagagtuuc cgucucguau cctguuaccc 40 <210> 165 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 165 ggguccugga uaagagtuuc cgucucguau cctguuaccc 40 <210> 166 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 166 ggguccugga uaagagtuuc cgucucguau cctguuaccc 40 <210> 167 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 167 ggguccugga uaagagtuuc cgucucguau cctguuaccc 40 <210> 168 <211> 40 <212> DNA <213> Artificial <220> <223> Aptamer to NGF <400> 168 ggguccugga uaagagtuuc cgucucguau cctguuaccc 40

Claims (17)

An abdominal that binds to NGF, capable of forming a potential secondary structure represented by formula (I).

Wherein N is a single nucleotide selected from the group consisting of A, G, C, U, and T,
N11 to N13, N21 to N23, N32 to N38 and N42 to N48 are the same or different and are one or two nucleotides or bonds selected from the group consisting of A, G, C, U and T,
N14, N24, N31, N41, N39 and N49 are each the same or different and are one nucleotide selected from the group consisting of A, G, C, U and T,
N14 and N24, N31 and N41, and N39 and N49 form a mutually Watson-Crick base pair,
A nucleotide sequence capable of forming a stem structure by a combination of N11-N12-N13-N14 and N21-N22-N23-N24,
N31-N32-N33-N34-N35-N36-N37-N38-N39 and N41-N42-N43-N44-N45-N46-N47-N48-N49 are nucleotide sequences capable of forming a stem structure. 2. The method according to claim 1, wherein N11 to N13, N21 to N23, N32 to N38 and N42 to N48, which are the same or different, each represent a single nucleotide selected from the group consisting of A, G, C, Tamer. The piezoelectric device according to claim 1 or 2, wherein N14 is U, N24 is A, N31 is G, N41 is C, N39 is G, and N49 is C. 4. The method according to any one of claims 1 to 3, wherein at least four Watson-Crick base pairs are substituted with N32-N33-N34-N35-N36-N37-N38 and N42-N43-N44-N45- Aptamer to form. The electrochemical device according to claim 1, which is any one of the following (a) or (b):
(a) a nucleic acid comprising a nucleotide sequence selected from SEQ ID NO: 3, SEQ ID NOs: 9 to 13, SEQ ID NOs: 22 to 117 and SEQ ID NOs: 152 to 168, wherein uracil may be thymine;
(b) a nucleic acid consisting of a nucleotide sequence in which one or several nucleotides are substituted, deleted, inserted or added in the nucleotide sequence of (a), and which binds to NGF. 6. An abatumer according to any one of claims 1 to 5, wherein the base length is 50 or less. 7. An abatumer according to any one of claims 1 to 6, wherein at least one nucleotide is modified. 8. The platemaker according to claim 7, wherein the platamer is modified with inverted dT or polyethylene glycol. 9. The platemaker according to claim 8, wherein the inverted dT or polyethylene glycol is bonded to the 5'end or the 3'end of the extender. 10. The method according to any one of claims 7 to 9, wherein the hydroxyl group at the 2 ' position of the ribosome of each pyrimidine nucleotide is the same or different, and is unsubstituted or substituted with a hydrogen atom, a fluorine atom and a methoxy group Substituted with an atom or group selected from the group. 10. The method according to any one of claims 7 to 9, wherein the hydroxyl group at the 2 ' position of the ribose of each purine nucleotide is the same or different and is a group consisting of a hydrogen atom, a fluorine atom and a methoxy group Substituted with an atom or group selected from &lt; RTI ID = 0.0 &gt; 12. The platemer according to any one of claims 1 to 11, which inhibits neurite outgrowth activity and / or cell proliferation activity of NGF. A pharmaceutical composition comprising the plaster according to any one of claims 1 to 12. 12. An antitumor control comprising the platemaster of any one of claims 1 to 12. An anti-inflammatory agent comprising the plaster according to any one of claims 1 to 12. A method for treating or preventing a disease associated with pain or inflammation, which comprises administering the squamometer according to any one of claims 1 to 12 to a subject in need thereof. 13. The platemer according to any one of claims 1 to 12, for the treatment or prevention of a disease accompanied by pain or inflammation.

Images