KR20140058713A - Flower organ-specific apetala3b promoter derived from dendrobium - Google Patents

Abstract

The present invention relates to a flower-specific APETALA3B (AP3B) promoter derived from Dendrobium orchids. Since the APETALA3B (AP3B) promoter according to the present invention increases expression specifically in a flower organ, it can selectively control a flower organ without affecting other organs.

Description

(Flower Organ-specific APETALA3B promoter derived from Dendrobium) derived from Dendrobium orchid

The present invention relates to a flower-specific APETALA3B (AP3B) promoter derived from Dendrobium orchids.

As molecular biology has evolved, several mechanisms have been identified that regulate gene expression. Expression of a gene refers to a series of processes that synthesize proteins according to the code entered into the gene through transcription and translation occurring within the cell. In particular, the transcription process is an early stage of gene expression, in which the RNA polymerase is initiated by binding to a promoter sequence located on top of the gene with the aid of several cofactors and the transcription factor (TF) As one of the factors, it is known to bind directly to the promoter sequence.

Promoters are classified into a persistent promoter that constantly expresses foreign gene expression and a specific promoter that is used to achieve the transfection purpose by confining it to the entire body and specific tissues of the plant. These can be classified as follows according to their functions.

First, it is a perennial systemic expression promoter. As a plant persistent promoter, a promoter of 35S RNA gene of cauliflower mosaic virus (CaMV) is used as a typical promoter for dicotyledonous plants. As a persistent promoter for a dicotyledonous plant such as rice, actin and maize ubiquitin (ubiquithin) gene promoters have been mainly used. Recently, a promoter of rice cytochrome C gene (OsOc1) has been developed and used by domestic researchers (Korea Patent No. 10-429335). They are already inherent in inducing the expression of antibiotics, herbicide resistance genes and reporter genes used as selectable markers in plant transgenic carriers. From the research point of view, Promoters considered.

Second, it is a seed-specific promoter. As a promoter of rice major storage protein gene, the rice glutelin promoter used for the development of golden rice is widely used when it induces seed-specific expression of monocotyledonous plants, and seed-specific expression of dicotyledonous plants Promoters which are mainly used for induction include induction of γ-tocopherol methyl transferase (γ-TMT) gene expression in soybean-derived lectin promoter, cabbage-derived napin promoter and Arabidopsis seeds And a carrot-derived DC-3 promoter used in studies promoting vitamin E production. The seed-specific promoters are mainly used for the purpose of accumulating useful proteins and producing beneficial substances in major crops in which seed itself is used as a food, a food, or a raw material for food.

Third, it is root specific expression promoter. Although there are no commercial examples yet, it has been confirmed that the peroxidase (prxEa) has been isolated and its root-specific expression has been confirmed. Recently, it has been reported that the plasmid-derived maize gene (ibMADS) and the sugar-induced adipo-glucosphate pyrophosphatase , AGPase) gene was isolated to induce a specific expression of the promoter in the root, leading to root-specific transient expression in carrot and radish, and was registered as a patent (Korean Registration No. 10-0604186, No. 10-0604191) There is a bar. These promoters can be expected to be mainly used for the purpose of improving agricultural traits, accumulating useful proteins, and producing useful substances in major root crops used for food, food, or food.

Fourth, it is other tissue specific promoter such as leaf. (RbcS: ribulose bisphosphate carboxylase / oxygenase small subunit) promoter that induces expression of strong genes only in photosynthetic tissues such as leaves, RolD promoter inducing expression of plant roots derived from Agrobacterium, potato-derived tuber A specific expression-inducible patatin promoter, and a tomato-derived fruit maturation-specific expression-promoting PDS (phytoene synthase) promoter.

Finally, pollen-specific promoters have been developed for the purpose of inducing inbred lines by linking genes that inhibit protein synthesis with pollen and drug-specific promoters, or male sterility for specific purposes, Male sterile plants have been developed by inducing the expression of the Bt protein gene, which is toxic to cells, to the carcass-specific BcA9 promoter of male organisms.

Accordingly, the present inventors have made efforts to develop a new promoter capable of selectively controlling only the flower organs, and as a result, confirmed that the APETALA3B promoter derived from Dendrobium orchid is expressed in a flower organ specific manner, thereby completing the present invention.

It is an object of the present invention to provide a flower-specific APETALA3B promoter derived from Dendrobium orchid.

It is still another object of the present invention to provide a recombinant plant expression vector comprising the APETALA3B promoter.

It is still another object of the present invention to provide a plant transformed with the recombinant plant expression vector.

It is still another object of the present invention to provide a method for expressing a foreign gene in a flower organ of a transformed plant using the APETALA3B promoter.

In order to solve the above problems, the present invention provides a flower-specific APETALA3B promoter derived from Dendrobium orchid.

The present invention also provides a recombinant plant expression vector comprising the APETALA3B promoter.

The present invention also provides a plant transformed with the recombinant plant expression vector.

In addition, the present invention provides a method for expressing a foreign gene in a flower organ of a transformed plant using the APETALA3B promoter.

Since the APETALA3B (AP3B) promoter according to the present invention increases expression specifically in a flower organ, it can selectively control a flower organ without affecting other organs.

FIG. 1 is a diagram showing the expression level of the APETALA3B (AP3B) gene in each organ of an orchid through electrophoresis.
Figure 2 is a partial cDNA sequence of the APETALA3B (AP3B) gene (underlined: primer sequence).
FIG. 3 shows electrophoretic results of 5-RACE using APETALA3B (AP3B) cDNA.
FIG. 4 shows the nucleotide sequence of the electrophoresis product (red color: initiation codon for protein synthesis, blue: 5'UTR) as a result of 5-RACE using APETALA3B (AP3B) cDNA.
FIG. 5 is a diagram showing electrophoresis results of Tail-PCR using APETALA3B (AP3B) gDNA.
FIG. 6 is a diagram showing a physical map generated based on sequence analysis of electrophoresis products by Tail-PCR using APETALA3B (AP3B) gDNA.
Fig. 7 is a diagram showing the promoter of APETALA3B (AP3B) (red color: exon, blue: 5'UTR).

Hereinafter, the present invention will be described in more detail.

The present invention provides a flower-specific APETALA3B promoter consisting of the nucleotide sequence of SEQ ID NO: 1.

The APETALA3B promoter is preferably derived from Dendrobium orchid, but is not limited thereto, and any of natural or artificial syntheses may be used. The above-mentioned " dendrobium orchid " may include dendrobium such as gigok, goby goby, dendrobium fimbriae, dendrobium densiflorum, and the like, preferably a bark.

&Quot; Promoter " in the present invention means a DNA sequence capable of regulating the expression of a coding sequence or a functional RNA.

The APETALA3B promoter of the present invention may also include such modified base sequences when a part of the bases of SEQ ID NO: 1 are substituted, deleted or added, but exhibit flower-organ specific expression promoter activity. More specifically, the modified base sequence has a nucleotide sequence that has at least 70%, more preferably at least 80%, more preferably at least 90%, and most preferably at least 95% sequence identity with the nucleotide sequence of SEQ ID NO: 1 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI > The percent is calculated by counting the number of positions where the same nucleic acid base exists in both sequences, calculating the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison region, multiplying the result by 100, Is calculated by calculating the same percent. The optimal arrangement of the sequences for comparison can be made by computer-implemented imple- mentation of known computational methods.

Since the APETALA3B (AP3B) promoter according to the present invention increases expression specifically in a flower organ, it can selectively control a flower organ without affecting other organs.

The present invention also provides a recombinant plant expression vector comprising the APETALA3B promoter.

As used herein, the term " vector " means a DNA product containing a base sequence of a gene operably linked to a suitable regulatory sequence so as to be capable of expressing the gene of interest in a suitable host. The regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling the termination of transcription and translation. The vector used in the present invention is not particularly limited as long as it is replicable in a host, and any vector known in the art can be used. For example, a plasmid vector, a coimide vector, a bacteriophage vector or an adenovirus vector, Viral vectors such as adeno-associated viral vectors, and the like.

The expression vector of the present invention may preferably comprise one or more selectable markers. The selectable marker is a nucleic acid sequence having a characteristic that can be selected by a conventional chemical method, and all of the genes capable of distinguishing the transformed cells from the non-transformed cells include, for example, glyphosate herbicide resistance genes such as glyphosate or phosphinotricin, antibiotic resistance genes such as Kanamycin, G418, Bleomycin, hygromycin, chloramphenicol and the like .

The present invention also provides a plant transformed with the recombinant plant expression vector.

"Transformation" in the present invention means introducing DNA as a host and allowing the DNA to replicate as an extrachromosomal element or by chromosome integration completion. The method of transforming the vector of the present invention includes any method of introducing a nucleic acid into a cell and may be carried out by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, A lithium acetate-DMSO method, and the like.

As the host cell, it is preferable to use a host having high efficiency of introducing DNA and high efficiency of expression of the introduced DNA, and all microorganisms including prokaryotic and eukaryotic cells can be used.

In the present invention, the plant may be a food crop such as dendrobium orchid, rice, wheat, barley, corn, soybean, potato, wheat, red bean, oats and sorghum; Vegetable crops such as Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Special crops such as ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut and oilseed rape; Apple trees, pears, jujube trees, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots and banana; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; Or the like, preferably a dendrobium orchid. The above-mentioned Dendrobium orchid may include dendrobium such as bivalvin, noble bark, Dendrobium pimbritum, and Dendrobium densiflorum, and may be preferably a bark.

In addition,

(a) inserting a foreign gene into a recombinant plant expression vector comprising a flower-specific APETALA3B promoter consisting of the nucleotide sequence of SEQ ID NO: 1; And

(b) transforming the recombinant plant expression vector into which the foreign gene is inserted, into a plant, wherein the foreign gene is expressed in a flower organ of the transformed plant.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example  One. Boulder  bracket By organization APETALA3B  ( AP3B ) Gene expression analysis

The following experiments were carried out for the analysis of APETALA3B (AP3B) gene expression of each tissue of the bark. The bracts used for the experiment were Dendrobium moniliforme , which was supplied from a barnyard farm. Gakgok was cultivated in a greenhouse of Chonbuk National University at 22 ℃ under the conditions of 14 hours / 10 hours cancer cycle. Samples of flowering plants used young flower buds bloomed from late April to early May.

First, the young leaf, flower organs and roots of mature bamboo leaves were collected, and then the sample was disrupted using liquid nitrogen. Then, using the easy-spin ™ II Plant RNA Extraction Kit (Intron Co.) RNA was isolated. Full-length cDNA was synthesized from the total RNA using the SMARTer (TM) PCR cDNA library kit (Clonetech) according to the manufacturer's manual. RT-PCR was performed using the full-length cDNA and the primers shown in Table 1 below. RT-PCR reaction conditions are as follows. Denaturation at 95 ° C for 15 seconds, annealing at 55 ° C for 30 seconds, and extension at 72 ° C for 1 minute were repeated for 20 cycles. Finally, the extension process at 72 ° C for 10 minutes was performed for 1 minute Respectively.

Name of the primer DNA sequence Target gene DenAP3B-Fd Gt; AP3B forward DenAP3B-Rd 5'-GTGTCRGTTTGTGTGGCGATCACA-3 ' AP3B reverse

The final reaction products were analyzed by 0.8% agarose gel electrophoresis. The results are shown in Fig.

As shown in Fig. 1, the APETALA3B (AP3B) gene was found to be highly expressed in flower organs in each tissue of bark.

Example  2. APETALA3B  ( AP3B ) Promoter analysis

The cDNA product identified in Example 1 was recovered using a gel extraction kit and then cloned using TOPcloner TA kit (Enzynomics). After that, bidirectional DNA sequencing (Bioneer Inc.) was performed using M13F and M13R primers. The results are shown in Fig.

Furthermore, in order to analyze the APETALA3B (AP3B) promoter predicted site and gene structure, information on the transcription initiation site was confirmed. For this, 5-RACE was performed using the full-length cDNA prepared in Example 1. The reaction conditions of 5-RACE are as follows. Denaturation at 95 ° C for 15 seconds, annealing at 60 ° C for 30 seconds, and extension at 72 ° C for 30 seconds were repeated 20 times, followed by extension at 72 ° C for 10 minutes 1 time. The reaction products were stored at 4 ° C and analyzed by agarose gel electrophoresis. The results are shown in Figs. 3 and 4, respectively.

Tail-PCR was performed to find the 5'-flaking nucleotide sequence of the APETALA3B (AP3B) gene. Three nested primers and six arbitrary primers were designed based on the cDNA sequence and are shown in Table 2 below.

Name of the primer The DNA sequence (5'-3 ') AP3B-R1 GAGASTTGAGCGTCGCAGAGCAM AP3B-R2 AGTATGTCACTTGCCTGTTCGTTGG AP3B-R3 CTTGCCTGYTCGTYGRGTTCTCTATC AD1 NTCGASTWTSGWGTT AD2 NGTCGASWGANAWGAA AD3 WGTGNGGWANCANAGA AP1 NGTCGASWGANAWGAA AP2 TGWGNAGSANCASAGA AP3 AGWGNAGWANCAWAGG

(In Table 2, N means A, T, G, or C; W means A or T; S means C or G.)

Six random primers were prepared in separate PCR tubes and mixed in the ratios described in Table 3 below followed by primary PCR.

Genomic DNA 1 [mu] l (50 ng) AP3B-R1 (10 pmol / 占 퐇) 2 μl Any primer (100 pmol / l) 2 μl water 7.5 μl 2x Master PCR Mix 12.5 μl

The primary PCR reaction conditions are as follows.

93 DEG C for 1 minute, 95 DEG C for 1 minute;

[94 ° C for 30 seconds, 62 ° C for 1 minute and 30 seconds, 72 ° C for 2 minutes and 30 seconds] (5 cycles);

At 94 ° C for 10 seconds, at 68 ° C for 1 minute, at 72 ° C for 2 minutes and 30 seconds, at 94 ° C for 10 seconds, at 68 ° C for 1 minute, at 72 ° C for 2 minutes and 30 seconds, at 94 ° C for 10 seconds, at 44 ° C for 1 minute, at 72 ° C for 2 minutes Sec] (12 cycles);

72 ° C for 1 minute.

The primary PCR reaction solution was diluted 1/50 with water and mixed at the ratios shown in Table 4, followed by secondary PCR.

A 1/50 diluted primary PCR reaction solution 1 μl AP3B-R2 (10 pmol / 占 퐇) 2 μl Any primer (100 pmol / l) 2 μl water 7.5 μl 2x Master PCR Mix 12.5 μl

The secondary PCR reaction conditions are as follows.

 At 94 ° C for 10 seconds, at 64 ° C for 1 minute, at 72 ° C for 2 minutes and 30 seconds, at 94 ° C for 10 seconds, at 64 ° C for 1 minute, at 72 ° C for 2 minutes and 30 seconds, at 94 ° C for 10 seconds, at 44 ° C for 1 minute, ] (12 cycles)

72 ° C for 1 minute.

The secondary PCR reaction solution was diluted 1/10 with water, mixed at the ratios shown in Table 5, and subjected to tertiary PCR.

1/10 diluted secondary PCR reaction solution 1 μl AP3B-R3 (10 pmol / l) 2 μl Any primer (100 pmol / l) 2 μl water 7.5 μl 2x Master PCR Mix 12.5 μl

The conditions for the third PCR reaction are as follows.

 [94 ° C for 15 seconds, 44 ° C for 1 minute, 72 ° C for 2 minutes and 30 seconds] (20 cycles)

72 ℃ 1 min

Each PCR reaction was confirmed by 0.8% agarose gel electrophoresis. The results are shown in Fig.

As shown in FIG. 5, it was confirmed that a specific band was amplified in the secondary PCR reaction product.

The amplified DNA was separated and analyzed for its base sequence. Then, a physical map was prepared by comparing the nucleotide sequence of the PCR product and the cDNA sequence using the genomic DNA as a template, and the transcription initiation site and translation initiation codon were determined. The results are shown in Figs. 6 and 7, respectively.

<110> NATIONAL ARBORETUM, KOREA FOREST SERVICE <120> Flower Organ-specific APETALA3B Promoter derived from Dendrobium <130> 33 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 757 <212> DNA <213> Artificial Sequence <220> <223> APETALA3B Promoter <400> 1 actttaaaag ttacattcat gaaagagatc cgaatccaca gtccccatct ttccctctct 60 caatgatctg tcgctctccg atgcgctcag cccgagatat tcacagaggg cctcagacct 120 atcaccaccc aatcttccct agagagagaa agaaagactc catgcaacta tttccgcccg 180 aaagaaaaat gttctttttt atcgtttcac cataaaaatg ctaagaacaa aaaccaataa 240 aatgaactaa acattttaac aagaagctca cagaatatat aaatttccaa taacttagtg 300 attaattctc ttacattaat aattcagttt tttgccaatt ttaagccgtg attcatacat 360 agaaaaattc aaaaatctaa tttaattctt aatttaactg attttttaat taatccactt 420 ttttcgccaa aaacaaacaa tcaaaatata attatataaa tcgacaggtt aacatttcaa 480 accaaaagac cttgaggggg ataagtctag cttgtaataa ataaaagtat tcagagcaag 540 aaaatggccg tattattaaa cgcggtcaga catggcacgc gaggtagtac gcacaaccct 600 ttggccattg cccgataatg gaaacccagc tgctactttt ttcctcccca gccttacatg 660 ccttcaattc gtctcttctg cctccatttt tataagctta ctttgaaact tttcctaccc 720 ttatcaatct catctctttt gcttctgttg cttcgga 757

Claims (6)

A flower-specific APETALA3B promoter derived from a dendrobium orchid consisting of the nucleotide sequence of SEQ ID NO: 1.
2. The promoter according to claim 1, wherein the Dendrobium orchid is at least one selected from the group consisting of Dendrobium monile, Noppei, Dendrobium pimbritum, and Dendrobium densiflorum.
A recombinant plant expression vector comprising the APETALA3B promoter of claim 1.
A plant transformed with the recombinant plant expression vector of claim 3.
The plant according to claim 4, wherein the plant is selected from the group consisting of Dendrobium orchid, rice, wheat, barley, corn, soybean, potato, wheat, red bean, oats, sorghum, Arabidopsis, cabbage, radish, Peanuts, peaches, sheep grapes, grapes, citrus, persimmon, plum, peas, peanuts, beets, peas, peas, cabbage, melon, squash, onions and carrots , Apricot, banana, rose, gladiolus, gerbera, carnation, chrysanthemum, lily and tulip.
(a) inserting a foreign gene into a recombinant plant expression vector comprising a flower-specific APETALA3B promoter consisting of the nucleotide sequence of SEQ ID NO: 1; And
(b) transforming the recombinant plant expression vector having the foreign gene inserted therein into a plant, wherein the foreign gene is expressed in a flower organ of the transformed plant.

Images