KR20140057837A - X-ray structure of human snail/importin beta protein complex and the crystallization method - Google Patents

Abstract

The present invention relates to a crystal structure of a complex of snail zinc finger and importin-beta protein which is fundamentally involved in the metastasis of cancer cells, and a crystallization method thereof. More specifically, the present invention relates to the specification of a binding site of importin-beta protein, which is carrier protein for the transportation from cytoplasm into nucleus, with respect to snail protein. Particularly, the present invention relates to: the crystallization condition and optimization condition of human-derived snail protein; and a crystal structure such as a main binding site on the crystal structure of the complex of snail zinc finger and importin-beta protein.

Description

[0002] X-ray structure of human snail / importin beta protein complex and the crystallization method [

The present invention relates to a crystal structure of a snail zinc finger and an impotin beta protein complex and a crystallization method thereof, and more particularly, to a specific structure and crystallization structure of a binding site with an impotin beta protein to a snail protein.

Recently, studies on the mechanism of nuclear-cytoplasmic material transport have progressed rapidly, so that the factors related to nuclear-cytoplasmic transport and their roles have become known in detail [Weis, K. Cell 112, 441-451 (2003 ); Harel, A., et al., Mol Cell 16, 319-330 (2004); Stewart, M. Biochem Soc Trans 34, 701-704 (2006)]

The nucleus and cytoplasm are divided into two layers of nuclear membrane lipid bilayers, and the nuclear - cytoplasmic material exchange takes place through the Nuclear Pore Complex (NPC). Molecules with a molecular weight of less than 40,000 will pass through the nuclear pore through free diffusion, but larger molecules will be able to travel between the nucleus and the cytoplasm only by the soluble carrier, the transport carrier. Until now, the following information has been known about the structure of nuclear plume through structural analysis through electron microscope and proteomics technology. Nuclear plagioclase is a complex of huge molecules, with mammalian diameters of about 120 nanometers and molecular weight of about 120 million. However, the structure of the known nuclear pore structure is an external structure, and the internal structure of the nuclear pore structure, which actually passes through, is not yet known.

In particular, the metastasis of cancer is also related to the process of transporting material between the nucleus and the cytoplasm. In the epithelial-mesenchymal transition (EMT) of epithelial cells, One of the important steps in the process [Thiery, JP Nat Rev Cancer 2, 442-54 (2002); Thiery, J. P et al. Nat Rev Mol Cell Biol 7,131-42 (2006); Peinado, H., et al. Nat Rev Cancer 7, 415-28 (2007)] Several transcription factors such as Snail, ZEB, Helix-Loop- Helix type proteins are known to be involved in cancer progression.

Snail is known to be involved in the EMT process by inhibiting E-cadherin, which is known to be an inhibitor of invasion in the process of cancer metastasis, and is also known to be involved in the mesoderm and neural tube formation of the fetal stage . From the results of experiments known so far, it has been demonstrated that Snail is involved in melanoma, bladder cancer, rectal cancer and pancreatic cancer [Cano, A. et al. Nat Cell Biol 2, 76-83 (2000); Batlle, E. et al. Nat Cell Biol 2, 84-9 (2000); Poser, I. et al. J Biol Chem 276, 24661-6 (2001); De Craene, B. et al. Cancer Res 65, 6237-44 (2005)). It is known that the expression level of i-cadherin is remarkably reduced in these tumors, and it is known that a large amount of the snail protein is involved in this background. The expression of the snail gene is expressed by TGF- Lt; RTI ID = 0.0 > Wnt < / RTI >

It is known that the position of the snail protein in the cell is greatly changed by phosphorylation. It is known that protein degradation by ubiquitination is promoted by phosphorylation in the destruction box region of the snail which recognizes Beta-TrCP, and the transport by the exportin 1 of the nucleus to the cytoplasm is serine Which is promoted by phosphorylation of the residue.

Regarding which part of the snail protein is present in the cytoplasm and the nucleus, it is highly related to the biological activity of the snail protein, and control thereof is expected to lead to the development of an anticancer drug that can prevent cancer metastasis .

Thus, the present inventors confirmed the crystallization conditions, optimization conditions, and specific binding sites of impotin beta, which is a carrier protein transported from the cytoplasm to the nucleus, into the snail protein, and found that the Zinc Finger portion of the human- (Snail zinc finger) and an impotin beta protein, and a function that plays an important role in the proliferation and metastasis of cancer, and completed the present invention.

1. Cano, A. et al. Nat Cell Biol 2, 76-83 (2000). 2. Batlle, E. et al. Nat Cell Biol 2, 84-9 (2000).

The main object of the present invention is to determine the three-dimensional structure of a snail / impotin beta complex, which plays an important role in cancer proliferation and metastasis, and to provide information therefor.

It is another object of the present invention to provide a method of crystallizing the snail / impotin beta complex.

It is yet another object of the present invention to provide an anticancer application based on the nuclear transport mechanism of the crystal of the three-dimensional structure of the snail / impotin beta complex.

In order to solve the above problems, the present invention provides a sneale-impotin beta complex crystal having a three-dimensional crystal structure in which the snail protein zinc finger 2-4 domain forms a spherical structure and binds to an impotin beta protein, Provide information on this.

The domain of the snail protein zinc finger 1 to 3 is composed of Cys-Cys ... His-His, and the domain of the snail protein zinc finger 4 is composed of Cys-Cys ... His-Cys , Particularly when the sneale protein zinc finger 2 to 4 domain forms a spherical structure while binding to the impotin beta protein, the sneale protein zinc finger 1 domain has an impotin beta heat repeating structure (HEAT repeat) 10 times.

The snail protein used in one embodiment of the present invention is derived from a human. Preferably, the snail protein having the amino acid sequence shown in SEQ ID NO: 5 and the protein having the amino acid sequence shown in SEQ ID NO: 6 can be used .

In particular, as shown in FIG. 4, amino acids ranging from the 153th position to the 264th position of the snail protein bind to the amino acid of the infectin beta protein. Among them, the amino acids L166, G167, E191, W193, N196, R215, S221, R224, N228, R247, S249, K253, C262 and R264 correspond to the corresponding amino acid residues E203, E281, D288, E289, D292, E295, D426, T427, W430, P440, E441, D579, S582, G622, and D627.

In the complex of the present invention, the amino acid residue of snail is a nuclear localization signal (NLS) transported from the cytoplasm to the nucleus while being bound to the impotin beta to form a spherical structure.

In addition, the snail-impotin beta complex crystal has a size of 105 X 75 X 660 A and may have the following X-ray crystal structure.

ㆍ Space group of crystals: Single crystal space group (C2),

Lattice unit: a = 228.210, b = 277.528, c = 72.019, and? = 90 占? = 100.96 占? = 90 占

In particular, the sNail-impotin beta complex crystals of the present invention are characterized in that they inhibit the metastasis of cancer by inhibiting the nuclear transport process by the epithelial-mesenchymal transition (EMT) of Snale protein.

Therefore, the present invention also provides an anticancer use based on the metastatic function of the above snail-impotin beta complex crystals.

For example, it can be provided as a cancer-inhibiting anti-cancer composition comprising a snail-impotin beta complex as an active ingredient.

The cancer is not limited, but is preferably a metastatic cancer. For example, it can be used for the treatment of skin cancer, basal cell carcinoma and malignant melanoma, renal cell carcinoma, liver cancer, thyroid carcinoma, nasopharyngeal cancer, solid tumors, prostate cancer, gastric / abdominal cancer, esophageal cancer, rectal cancer, pancreatic cancer, breast cancer, , Acute leukemia, chronic leukemia, chronic myelogenous leukemia, herpocytic leukemia, lymphoid adenoma, multiple myeloma, hematogenous leukemia, and Kaposi sarcoma ≪ / RTI >

The present invention also provides a method of making crystals of a three-dimensional structure of a snail-impotin beta complex:

(i) separating and purifying a human-derived snail and an impotin beta protein to form a complex;

(ii) crystallizing the protein complex using a reservoir containing 0.1 M Tris HCl (pH 7.5), 10% (w / v) PEG 8000, 20% (v / v) glycerol; And

(iii) optimizing the protein complex crystals using a preservation solution comprising 0.1 M bis-Tris HCl (pH 6.9), 10% (w / v) PEG 8000, 0.5 M urea, 20% glycerol.

Wherein the human-derived snail protein of step (i) is preferably a peptide consisting of an amino acid from position 153 to position 264, and the crystallization of step (ii) (hanging-drop vapor-diffusion method) and allowed to stand in the preserving solution for about one day. In addition, in step (iii), it is preferable to grow the crystal to an appropriate size by standing in a preserving solution for about 7 days.

As described above, the present invention relates to a method for crystallizing a complex of a zinc finger portion (snail zinc finger) / impotin beta protein of a snail protein and a three-dimensional structure obtained by a structural analysis thereof, Information on the binding site of impotin beta, a carrier protein transported into the nucleus, optimization of protein crystallization conditions and conditions; Further, the present invention provides anti-cancer use of the above-mentioned snail-impotin beta complex for inhibiting cancer metastasis.

INDUSTRIAL APPLICABILITY The present invention relates to a novel crystal structure of a two-protein complex of snail zinc finger / impotin beta and a crystallization method of the same which are essential for the transfer of cancer cells, and a method of crystallizing a snail-impotin beta- Blocking the nuclear transport of proteins may block EMT (epithelial-mesenchymal transition) processes associated with cancer metastasis and may be useful for the development of anticancer drugs.

FIG. 1 is a schematic diagram showing the three-dimensional structure of two protein complexes of a zinc finger part (snail zinc finger, pink) / impotin beta (importin b) of a snail protein derived from human by X-ray structural analysis.
FIG. 2 is a schematic diagram of a human-derived snail zinc finger / impotin beta protein complex by X-ray structural analysis, wherein the first zinc finger 1 among the total four zinc fingers is a heat repetition of impotin beta And the zinc finger 2, the zinc finger 3, and the zinc finger 4 are bonded to each other while forming a distinctive round shape by the impotin beta.
Fig. 3 is a photograph of a crystal finally used for the X-ray structure analysis of the composite of the present invention. Fig.
FIG. 4 is a graph showing the interaction between the snail zinc finger protein and the impotin beta protein on the three-dimensional structure obtained by the X-ray structure analysis, in which 14 amino acids of the snail zinc finger bind to 15 amino acids of the impotin beta It is a specific list of amino acids.
FIG. 5 is a graph showing the relationship between the structure and the activity of a snail zinc finger protein according to the X-ray structure analysis.

The terms used in the present invention are defined as follows.

"Protein crystals" refers to one type of solid state of matter consisting of a three-dimensional crystal lattice, distinct from the amorphous solid state. Whether or not the protein is in a crystalline state can be measured by methods known in the art, for example, an X-ray diffraction method or a powder X-ray diffraction method

"Polypeptide" or "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term also applies to amino acid polymers wherein one or more amino acid residues are analogous or mimic of naturally occurring amino acid polymers as well as corresponding naturally occurring amino acids. The term may also include amino acid polymers that have been modified or phosphorylated to form glycoproteins by, for example, addition of carbohydrate moieties. Polypeptides and proteins may be produced by naturally-occurring and non-recombinant cells, or the polypeptides and proteins may be produced by genetically engineered cells or recombinant cells. Polypeptides and proteins can include molecules having amino acid sequences of a Naive protein or molecules having deletions, additions thereto and / or substitutions therefrom, from one or more amino acids of a Naive sequence

"Nucleic acid" is meant to include any DNA or RNA, such as chromosomes, mitochondria, viruses and / or bacterial nucleic acids present in a tissue sample. Includes one or both strands of a double-stranded nucleic acid molecule and includes any fragment or portion of the intact nucleic acid molecule.

"Gene" means any nucleic acid sequence or portion thereof that has a functional role at the time of protein coding or transcription, or in the control of other gene expression. The gene may consist of only a portion of the nucleic acid encoding or expressing any nucleic acid or protein that encodes the functional protein. The nucleic acid sequence may comprise an exon, an intron, an initiation or termination region, a promoter sequence, another regulatory sequence, or a gene abnormality within a particular sequence adjacent to the gene.

The term "vector" refers to any nucleic acid that is inserted into a host cell, recombined with the host cell genome, inserted into it, or contains a competent nucleotide sequence that replicates spontaneously as an episome.

The terms "cancer" and "cancerous" refer to physiological disease states in mammals, typically representing cell growth is not regulated. Examples of cancers include carcinoma; But are not limited to, lymphoma, blastoma, sarcoma and leukemia. More specific examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, small cell lung cancer, non small cell lung cancer, gastrointestinal cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatocellular carcinoma, Endometrial carcinoma, parotid carcinoma, kidney cancer, liver cancer, vulvar cancer, thyroid cancer, liver carcinoma, and various types of head and neck cancer.

"Metastatic cancer" is defined as cancer that has the potential to spread to other parts of the body, specifically to the bone. The term " metastatic cancer "

"Treatment" means an approach to obtaining beneficial or desired clinical results. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction in the extent of disease, stabilization of the disease state (i. E., Not worsening), slowing or slowing the progression of the disease, (Either partially or totally), detectable or undetected, whether or not an improvement or temporary relief or reduction Also, "treatment" may mean increasing the survival rate compared to the expected survival rate when not receiving treatment. "Treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Such treatments include treatments required for disorders that have already occurred as well as disorders to be prevented. &Quot; Palliating " a disease may reduce the extent of the disease state and / or undesirable clinical symptoms and / or delay or slow the time course of the progression, It means to lose. In the present invention, it refers to a therapeutic use for cancer, preferably metastatic cancer.

"About" means that the reference quantity, level, value, number, frequency, percentage, dimension, size, quantity, weight or length is 30, 25, 20, 25, 10, 9, 8, 7, , Level, value, number, frequency, percent, dimension, size, quantity, weight, or length that varies from one to three, two, or one percent.

Throughout this specification, the words " comprising "and" comprising ", unless the context requires otherwise, include the stated step or element, or group of steps or elements, but not to any other step or element, And that they are not excluded.

Hereinafter, the present invention will be described in detail.

TECHNICAL FIELD The present invention relates to a crystal structure of a snail zinc finger and an impotin beta protein complex and a method of crystallizing the snail zinc finger and an impotin beta protein complex, which are essential for the transfer of cancer cells.

More specifically, the present invention relates to the specification of a binding site to a protein, which is a carrier protein transported from the cytoplasm to the snail protein, into the nucleus, in particular, a human-derived snail protein crystallization condition and optimization conditions; And the crystal structure of the binding main site on the structure of the snail and the impotin beta protein complex.

<Crystal Structure>

The present invention relates in one aspect to a novel three-dimensional crystal structure of a snail zinc finger and an impotin beta protein complex. That is, the present invention provides crystals of a three-dimensional structure different from binding of impanthin beta with conventional snail zinc fingers and their analogues. The term "three-dimensional structure" can be used in the art in place of the terms such as "spatial arrangement "," spatial structure ", and the like.

The snail protein family consists of three proteins in vertebrates: snail 1, snail 2, and snail 3. Although there is no limitation, it is preferable to use a snail protein group derived from a human in the present invention. The snail protein family has four to five repeating structures at the carboxyl-terminal site, all of which are known as well-preserved zinc finger moieties, and have a SNAG moiety at the amino- There is a part. In the present invention, for each of the sneak finger fingers involved in the structure of the composite, the numbers are indicated together with the sneak finger fingers 1 to 4 for convenience. The amino acid sequence of the human-derived snail protein according to the present invention is shown in SEQ ID NO:

The zinc finger domain is a domain that binds to DNA and enters the nucleus and recognizes and suppresses the DNA sequence called E2-box. Recently, it has been found that the zinc finger moiety is recognized as a nuclear protein (Nuclear Localization Signal, NLS), which is transported to the nucleus by impotin beta.

Importin protein is a type of transport carrier responsible for the transport of substances between the nucleus and the cytoplasm, and is particularly responsible for the transport from the cytoplasm to the nucleus in the transport carrier transporting the transport material. And what is used for transporting out of the nucleus is called exportin. The nucleotide sequence of the transport material transported to the nucleus is recognized by nuclear localization signal (NLS), the nucleotide sequence of the transport material transported to the cytoplasm It is called the nuclear export signal (NES).

Among these, the most well-known function is impotin beta, and carrier proteins having a similar structure are collectively referred to as &quot; impotin beta group &quot;.

The impotin beta protein group consists of a heat repeating structure (HEAT repeat) in which 40 amino acids form a hairpin structure composed of two alpha helical structures, for example, 19 for impetin beta and 20 for heat repeating repeating structure Structure. In addition, the amino acid sequence of the IMPOTTINE BETA protein according to the present invention is shown in SEQ ID NO: 6.

The nuclear transport sequence is recognized by the adapter molecule, impotin alpha, and the nuclear transport protein / impotin alpha complex is recognized by a formal nuclear transport sequence transported after binding to impotin beta and an atypical There is a nuclear transport sequence. Snail protein is a protein with atypical nuclear transport sequence that binds directly to impotin beta, and it is known that the role of atypical NLS is four zinc finger moieties, but it is not known how it is structurally recognized.

The present invention relates to a binding site between four zinc finger portions of the snail protein and an impotin beta protein having a nuclear transport sequence and a specific three-dimensional crystal structure of the complex due to such binding; And includes both the crystallization condition and the optimization condition.

The structure of the snail / impotin beta complex of the present invention can be analyzed using, but not limited to, X-ray crystallography.

In one embodiment, each of the constituent amino acids of the complex was defined as a set of structural coordinates (also known as "atomic coordinates"). The term "structural coordinates" refers to Cartesian coordinates derived from mathematical formulas relating to a pattern obtained by diffracting a monochromatic beam of X-rays by a complex of the invention in crystalline form. The electron density map of the repeating unit of the crystal is calculated using the diffraction data. The electron density map is then used to establish the location of the individual atoms of the complex

Some deviation of the structure coordinates can be generated by mathematically adjusting the composite structure coordinates. For example, the structural coordinates described herein may be adjusted by permutation, division, addition or subtraction of the entire set, inversion, or any combination of the above. Alternatively, modifications of the crystalline structure due to mutations, additions, substitutions and / or deletions of amino acids, or other changes in any of the constituent constituents of the crystal may also provide alterations in structural coordinates. This slight deviation in individual coordinates will have little effect on the overall arrangement. If such deviations are within acceptable standard deviations compared to the original coordinates, the resulting three-dimensional shape is considered structurally equivalent.

X-ray structural coordinates define a unique point arrangement in space. One of ordinary skill in the art will appreciate that the set of structural coordinates for a protein or protein complex or portion thereof also defines a set of related points that define the placement in three dimensions. Similar or identical arrangements can be defined by different sets of coordinates globally, with distances and angles between the coordinates being kept substantially constant. Extensible point placement can also be defined by increasing or decreasing the distance between coordinates by a scalar factor while keeping the angles substantially equal.

A variety of computer analyzes can be used to determine whether a molecule or portion thereof is "structurally equivalent" to a complex described herein, or a portion thereof, as defined in terms of its three-dimensional structure. For example, different parts of the same structure, different shapes of the same structure, or different parts of the same structure can be made by various computer analyzes. In one embodiment, this analysis includes four steps: (1) loading the compared structure; (2) defining valences in these structures; (3) performing the adaptation task, and (4) analyzing the results.

Preferably, the present invention can provide a crystal structure of a three-dimensional active structure Snale-Impotin beta with the following structural features, according to X-ray analysis at a resolution of 2.6 A.

- Crystal space group: Single crystal space group (C2)

Lattice unit: a = 228.210, b = 277.528, c = 72.019 and? = 90?,? = 100.96,? = 90

In one embodiment, the crystal structure of the human snail / impotin beta complex was observed at a resolution of 2.6 A, resulting in a size of approximately 105 X 75 X 660 A. The unit cell parameter of the crystal may have a maximum of 5% variability in all cell parameters.

The snail zinc finger domain consists of three typical Cys-Cys ... His-His (cysteine 2 histidine 2) and the zinc finger 4 domain is Cys-Cys ... His-Cys (cysteine 2 histidine cysteine) But it has a structure similar to that of cysteine 2-histidine 2. That is, the four zinc finger portions exhibit almost the same structure, and there is no particular structural change in the zinc finger portion due to binding with impotence beta.

1 and 2 show a schematic and simple schematic diagram of the three-dimensional crystal structure of the snail / impotin beta complex of the present invention.

Particularly, the impotence-beta recognition structure of three zinc finger domains from the snail zinc finger 2 to the zinc finger 4 is very particular.

The crystal structures of other Cys-Cys ... His-His (cysteine 2-histidine 2) zinc finger proteins, which have been known so far, are mostly complex structures with DNA and all have unfolded structures, 3 (ZIC3) The zinc finger portion of the protein and the dog nail protein are not identical in structure.

However, the snail zinc finger 1 of the present invention binds to the heat repetition structure 10 of impotence beta, and the zinc finger 2 to the zinc finger 4 have a round shape and bind to the impotence beta. That is, in the composite according to the present invention, as shown in FIGS. 1 and 2, the three zinc finger domains of the zinc finger 2 to the zinc finger 4 are characterized as having a "spherical structure" which is curled like a round ball.

By forming such a structure, the protein structure of the snail is stably contained in the impotin beta molecule and is transported into the nucleus, thereby acting as a transcription factor.

The present invention provides a protein spatial structure model comprising a three dimensional structure of the complex of the invention and provides a scalable three dimensional arrangement of points derived from peptides comprising the spherical structure. The extensible three-dimensional arrangement may be represented as a holographic image, a stereoscopic diagram, a model, or a computer display image.

The present invention also includes information on specific binding sites in the three-dimensional crystal structure of the snail / impotin beta complex.

Fourteen amino acids derived from four zinc finger domains of the snail and 14 amino acids of the impotin beta are bound to the binding of the snail and the impotin beta forming the three-dimensional complex crystal structure. The involved amino acids and their binding status are shown in Fig.

More specifically, two amino acids of zinc finger 1 of snail protein, three amino acids of zinc finger 2, four amino acids of zinc finger 3, three amino acids of zinc finger 4, and two amino acids of the tail portion, Beta is involved in the reaction with 14 amino acids. In other words, each zinc finger of the snail protein participates in the binding of evenly distributed impotin beta. In particular, the amino acid from the 153th position to the 264th position of the snail protein binds to the amino acid of the infectin beta protein.

Thus, in another aspect, the invention provides a selected portion of the three-dimensional structure of a complex of the invention containing atomic coordinates of one or more amino acid residues from said amino acid residue.

In one embodiment of the present invention, in the process of transporting the snail zinc finger protein from the cytoplasm to the nucleus, the nucleotide localization signal (NLS) of the snail recognized in the impotin beta protein (NLS) The amino acid residue information of tin beta is most preferably as follows:

E203, E281, D288, E289 as the amino acid residues of the snail's amino acid residues L166, G167, R191, W193, N196, R215, S221, R224, N228, R247, S249, K253, C262, R264 and the corresponding impotin beta , D292, E295, D426, T427, W430, P440, E441, D579, S582, G622, D627.

Their specific correspondence and correspondence are shown in Fig.

The individual amino acids of the present invention include variant peptides that can be substituted by other closely related amino acids as will be understood in the art. For example, individual amino acids may be substituted as follows: any hydrophobic aliphatic amino acid may be substituted with any other hydrophobic aliphatic amino acid; Any hydrophobic aromatic amino acid may be substituted with any other hydrophobic aromatic amino acid; Any neutral amino acid having a polar side chain can be substituted with any other neutral amino acid having a polar side chain; The acidic amino acid may be substituted with any other acidic amino acid; A basic amino acid may be substituted with any other basic amino acid.

&Quot; Analogs ", "functional / structural analogs" are peptide variants or organic compounds having the same functional / structural activity as the polypeptides described herein, examples of such analogs or analogs being modeled to resemble the three-dimensional structure of interferons described herein And compounds and peptides having such an alignment of chemical compounds or peptides, preferably amino acid residues, that are present.

Thus, analogs of the snail / impotin beta complexes of the present invention may have the same spherical spatial structure as the peptide variants or organic compounds having the same action / structure activity as the complexes of the present invention, particularly the snail / . When "analog" is a peptide variant, the length of its amino acid sequence is generally similar to that in the complex of the invention.

In one embodiment of the present invention, a specific amino acid displacer at the binding site of each zinc finger was made to compare the binding force of the snail / impotin beta to confirm the role of the main binding site in the three-dimensional structure.

Experimental results show that the formed bodies have significantly lower binding force to impotin beta than those of natural type snails, and the combination of the displacements showed weaker binding force. Therefore, it was confirmed that the main bonds shown in the crystal structure of the present invention are nuclear transport sequences recognized by impotin beta to allow the snail protein to be transported to the nucleus.

<Crystallization method>

Further, the present invention in another aspect includes a method for crystallizing a snail / impotin beta complex of the three-dimensional structure.

This can be performed by appropriately changing the known method. For example, the following steps may be included.

- a human-derived recombinant protein snail zinc finger / impotin beta complex solution and a polyethylene glycol 8000 (PEG 8000) concentration of 8% to 14%, a urea solution at a concentration of 0.1 to 1 M as a precipitant 1: 1 to form droplets;

- a second step of placing the droplets obtained in the first step on a glass slide coated with silicone and placing it on a prepared plate in an upside-down state and sealing;

- a mixture of protein and preservation solution at a concentration lower than that of the preservation solution is placed in a sealed state at a temperature of 15 to 25 占 폚 for 1 to 10 days to prepare a sneeze finger / impotin beta protein complex The third step in which crystals are formed.

Through the process including these steps, the sneak zinc finger / impotin beta complex of the present invention contained in the subgrid lattice can be crystallized.

As a more specific example thereof, the crystallization method of the PRL-1 protein, a snail protein, will be described in more detail.

PRL-1, -2, and -3 are three types of proteins that share a single COOH-group of protein tyrosine phosphatases (PTPs) that accept the signaling sequence of HCXXGXXR, . PRLs are genes that promote cell migration, invasion, and metastasis.

(i) Separation and purification of human-derived snail and impotin beta protein to form a complex.

The human-derived snail protein of step (i) can be a peptide consisting of an amino acid from position 153 to position 264, and can be prepared by subcloning into a vector for expression of the snail protein, for example, pGEX4T-TEV can do. In one embodiment of the present invention, the snail protein produced from the cultured transformant E. coli BL21 (DE3) / pGEX4T-TEV is isolated and purified, and the snail is cloned into the recombinant vector pET28a expressing the impotin beta protein Respectively.

Purification of the protein is preferably, but not limited to, using affinity chromatography and ion-exchange chromatography.

In one embodiment of the present invention, the protein produced in the expression vector used is labeled with Glutathion-S-Transferase (GST), and thus can be purified by GST-affinity chromatography. The labeled GST can be removed by treatment with TEV protease and then purified by ion exchange chromatography.

(ii) crystallizing the protein complex using a reservoir containing 0.1 M Tris HCl (pH 7.5), 10% (w / v) PEG 8000, 20% (v / v) glycerol.

In step (ii), crystallization of the snail zinc finger / impotin beta protein is performed. This crystallization can be carried out using, for example, a hanging drop method, a sitting drop method, have. One embodiment of the present invention utilizes a hanging-drop vapor-diffusion method. In this case, the pH value of the crystallization solution used may range from about 6 to about 8, and 0.1 M Tris HCl (pH 7.5), 10% (w / v) PEG 8000, 20% ) &Lt; / RTI &gt; glycerol can be used. And allowing the crystallization solution to stand for about one day.

At this stage, a small plate-type crystal is formed in the initial stage.

(iii) optimizing the protein complex crystals using a preservation solution comprising 0.1 M bis-Tris HCl (pH 6.9), 10% (w / v) PEG 8000, 0.5 M urea, 20% glycerol.

In step (iii), the crystallization is optimized. The pH value of the crystallization solution used may range from about 6.7 to about 8, for example, 0.1 M bis-Tris HCl (pH 6.9), 10% (w / v) PEG 8000, A preservation solution containing 20% glycerol may be used. In this optimization step, the crystallization solution is allowed to stand for about 5 days to about 1 week, preferably for 1 week.

Through the optimization of these crystals, larger (0.5 x 0.2 x 0.03 mm) crystals can be obtained.

The method of crystallizing a protein complex as described above is merely an example, and it will be apparent that the method can be suitably performed based on a known technique having a conventional knowledge in the art.

<Applications>

In addition, the present invention includes the function of transporting snail proteins into the nucleus according to the three-dimensional crystal structure of the snail and impotin beta proteins and uses thereof.

Immunotin beta binds the acidic amino acid of the snail protein to the basic surface inside its molecule and transports it to the nucleus.

This recognition method is similar to the binding of other proteins to impotencebeta, but the amino acid of impotencebeta used to recognize direct snail proteins differs significantly from what is known to date. In particular, impotin beta has a total of 30 amino acids in binding to impotin alpha, but only 6 of them are superimposed. That is, the binding site and the amino acid used are mostly different from each other in the three-dimensional structure by the crystal structure analysis of the present invention. In particular, only one amino acid overlaps with the amino acid used to bind the SREBP2 protein.

Therefore, the binding mode of the snail protein of the present invention to impotin beta for nuclear transport is completely different from the binding with other known proteins.

In particular, the snail protein of the present invention is a key protein for cancer metastasis, and its crystal structure of the snail zinc finger protein / impotin beta nuclear transport complex is an EMT (epithelial-mesenchymal transition) process related to cancer metastasis By blocking the nuclear transport of the snail protein by controlling the process by inhibiting the transfer of cancer features.

Therefore, the present invention includes "anticancer applications" of inhibiting the metastasis of said three-dimensional crystals of such a snail zinc finger protein / impotin beta nuclear transport complex. This, of course, includes all available embodiments, such as compositions and methods of use thereof.

In one embodiment, the composition is an anti-cancer agent, i.e., a pharmaceutical composition for anti-cancer. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

A preferred dose is a "prophylactically effective amount" or "therapeutically effective amount ", such as a polypeptide, antibody, peptide, nucleic acid molecule, small molecule, analog or other pharmaceutically useful compound according to the present invention, Should be sufficient to provide the beneficial effect thereof. The actual dosage, frequency and time course will depend on the nature and severity of the disease being treated. Decisions about treatment regimens, such as dose, are under the responsibility of physicians and other health care providers. Depending on this situation, the pharmaceutical compositions may be administered alone or in combination. The pharmaceutical compositions and those for use in the present invention may contain, in addition to the active ingredient, pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The exact nature of the carrier or other substance will depend on the route of administration which may be oral or injectable, for example, subcutaneous, subcutaneous or intravenous. The pharmaceutical composition may be formulated into the following dosage forms: tablets, capsules, oral solutions, patches, injections, sprays, suppositories and solutions. The recommended dosage form is an injection, e. G., Subcutaneous or intravenous injection, and the carrier in the pharmaceutical composition comprises a binder, disintegrant, lubricant, filler, solubilizer, buffer, preservative, thickener, chelating agent and other adjuvant May be any acceptable drug carrier. "Pharmaceutically acceptable carrier" may be any standard pharmaceutical carrier. For example, known suitable carriers include, but are not limited to, phosphate buffered saline and various wetting agents. Other carriers may include additives used in tablets, granules and capsules. Typical carriers are often starches, emulsions, sugars, cellulose, certain types of clays, gelatin, stearic acid and its salts such as magnesium stearate or calcium stearate, talc, vegetable oil, rubber, Lt; / RTI &gt; Such carriers may also include flavors and coloring additives or other ingredients. The composition of these carriers can be formulated using known methods.

In another aspect, the invention provides a method of treating cancer (tumor) comprising administering to a subject an effective amount of a composition comprising a complex of the invention or an analogue thereof.

The cancer is not limited, but includes, for example, skin cancer, basal cell carcinoma and malignant melanoma, kidney cell cancer, liver cancer, thyroid cancer, nasopharyngeal cancer, solid tumor, prostate cancer, gastric cancer / abdominal cancer, The present invention relates to a method for the treatment and prophylactic treatment of leukemia in a patient in need of such treatment or prevention of breast cancer, ovarian cancer, surface bladder cancer, angioma, epidermal cancer, cervical cancer, non-small cell lung cancer, small cell lung cancer, neurocolleum tumor, leukemia, acute leukemia, chronic leukemia, chronic myelogenous leukemia, Blood bulbous hyperplasia and Kaposi sarcoma, and the like. Preferably melanoma, bladder cancer, rectal cancer, pancreatic cancer, and the like.

In particular, said use of the present invention may be useful for the treatment and prevention of cancer at all stages, but may be more suitable for advanced or metastatic cancer.

Also, it may be desirable to apply such a treatment method to a patient who has not received chemotherapy treatment with chemotherapy or radiotherapy, but the therapy that is performed with the treatment method of the present invention is not limited to a patient who has received chemotherapy treatment more than once .

As described above, the present invention relates to a method for crystallizing a sneak zinc finger protein / impotin beta protein complex derived from a human by mass expression and highly purified, and a method for crystallizing a binding region between two proteins based on the three- .

The snail protein of the present invention is a key protein for cancer metastasis, and its crystal structure of the snail zinc finger protein / impotin beta nuclear transport complex is a new mechanism to control the nuclear transfer process of the snail protein, As an anti-cancer agent.

<Examples>

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

In general, column chromatography, optical microscopy, UV-VIS spectroscopy, pharmacokinetic analytes, recombinant DNA methods, peptide and protein chemistry, nucleic acid chemistry and molecular biology techniques and related nomenclature described herein are well known and commonly known in the art .

Example  One : Snail Zinc finger  Protein expression and purification

Was prepared by cloning a snail into a recombinant vector pGEX4T-TEV expressing a snail zinc finger protein for use in crystallization.

Specifically, the gene region containing the amino acids 153 to 264 from the snail cDNA was amplified by PCR using the forward primer 5CGTAGGATCCGCCTTCAACTGCAAATACTGC3 '(SEQ ID NO: 1) and the reverse primer 5'CGGATGTCGACTCAGCGGGGACATCCTGA3' (SEQ ID NO: 2) , And then inserted into the BamHI-SalI site of the pGEX4T-TEV vector.

The E. coli transformant transformed with the above recombinant vector pGEX4T-TEV containing the gene sequence of the snail zinc finger was inactivated by 0.5 mM IPTG and cultured at 37 ° C for 2 hours.

It was also prepared by cloning the snail into the recombinant vector pET28a expressing the impotin beta protein.

Specifically, the gene region containing the entire cDNA of human-derived impotencebeta was amplified by PCR using the forward primer 5'ACCATATGGAGCTGATCACCATTCTCG3 '(SEQ ID NO: 3) and the reverse primer 5'GTCTCGAGTCAAGCTTGGTTCTTCAGTTTCC3 (SEQ ID NO: 4) was inserted into the NdeI-XhoI site of the pET28a vector.

The E. coli transformant transformed with the recombinant vector pET28a containing the gene sequence of impotin beta was induced by induction of 1.0 mM IPTG and cultured at 25 ° C for 5 hours.

Cell pellets cultured with these two proteins were dissolved in a lysis buffer containing 20 mM Tris-HCl (pH 7.4), 300 mM NaCl, 1 mM ZnCl 2 and 1 mM DTT, and disrupted by ultrasonication.

First, the sample was thoroughly washed with a 20 mM Tris-HCl (pH 7.4), 100 mM NaCl, 1 mM ZnCl 2 and 1 mM DTT solution through a hydrophilic column, a phenyl sepharose column, and then the mixture of a snail zinc finger / . At this stage, the snail protein complex bound to impotin beta and impotin beta is removed from the hydrophobic column.

Then, the GST-labeled sneak zinc finger protein was purified using a GS-4B sepharose column. After washing with a sufficient amount of buffer, the complex of the snail zinc finger / impotin beta protein extracted with 10 mM glutathion was purified to be more pure.

Next, the labeled GST was removed by treatment with TEV protease, which was then purified by size exclusion chromatography using 20 mM Tris-HCl (pH 7.4), 1 mM DTT, 20 mM solution.

Example  2: Human Origin Snail Zinc finger / Impotin beta  crystallization

Crystals of snail zinc finger / impotin beta protein were obtained by a hanging-drop vapor-diffusion method using a 24-well plate at 20 ° C.

The initial crystallization screening was carried out in the laboratory to the PEG Screen system developed for protein complex crystallization.

As a result, at the initial stage, a small plate-type crystal was immersed in a solution containing 0.1 M Tris HCl (pH 7.5), 0.6 M urea, 10% (w / v) PEG 8000 and 20% (v / v) glycerol In one day.

Subsequently, 30 mg / ml of the same volume of 0.1 M bis-Tris HCl (pH 6.7 to 8.0), 8 to 14% (w / v) PEG 8000, 0.1 to 1.0 M element, The same crystals were obtained from a mixture of the precipitating solutions containing 20% glycerol and the same volume of 0.1 M bis-Tris HCl (pH 6.9), 9% (w / v) PEG 8000, 0.5 M element, 20% glycerol (0.5 x 0.2 x 0.03 mm) crystals were generated from the mixed solution containing the precipitating solution containing the precipitate.

The crystallization mixture reached equilibrium with 0.5 ml of the same precipitation solution at 20 ° C, and the crystals grew to the maximum size in about one week.

The thus obtained sneak zinc finger / impotin beta protein crystals are shown in Fig.

Example  3: Snail Zinc finger / Impotin Beta  Structural analysis, modeling and refinement of proteins

Single anomalous dispersion (SAD) data was collected from the SPring-8 synchrotron radiation device laboratory Beamline BL44XU of Japan using four zinc atoms contained in the snail zinc finger protein (Hendrickson, WA et al., Methods Enzymol. 276, 494-523,1997). Data collected at the wavelength of peak (lambda 1) was processed with the HKL2000 program. All four zinc sites expected in the asymmetric unit were located in the Phenix program. (Terwilliger, TC et al., Acta Crystallogr. D 55, 849-861, 1999). DM programs were used to enhance the image by solvent flattening (Collaborative Computational Project Number 4. The CCP4 suite: programs for protein crystallography Acta Crystallogr. D50, 760-763, 1994).

The resulting experimental map maintained a sufficient level of quality to represent most of the protein molecules.

Modeling of the protein crystals was determined by the program Coot and refined to a resolution of 2.6 A by the program Refmac (Brunger, AT et al., Acta Crustallogr. D54, 905-921, 1998). 5% of the randomly selected data were used for Rfree calculations.

The refinement step includes anisotropic B factor refinement and full size solvent calibration. The final models, Rcryst and Rfree, were 22.4 and 27.6%, respectively (Table 1).

As a result, the asymmetric unit contained one molecule of a snail zinc finger / impotin beta protein complex. The final structure model includes residues of impotin beta 15-487, residues 490-876 and residues 154-264 and four zinc ions and water molecules in the snail zinc finger protein.

Example  4: Based on the structure of the protein complex Mutant  Biological activity assay used

The degree of binding of the snail protein to the impotin beta was examined by using 14 kinds of mutant proteins prepared based on the snail zinc finger / impotin beta natural protein and crystal structure prepared in the above examples 4).

The variants of the binding site based on the crystal structure are as follows.

i) one amino acid displacer R191E, W193A, R224E, R247E Dislocation

ii) Composite displacement body

R191E / W193A / Q196A / R224E / Q228A (Fig. 5, lane M)

R191E / W193A / Q196A / R247E (Fig. 5, lane N),

R191E / W193A / Q196A / R224E / Q228A / R247E (Fig. 5, lane O)

Each mutant was constructed to identify the role of the major binding site in the three-dimensional structure by comparing the binding of sNail's native form and mutant to impotin beta in vitro.

As a result, two amino acids of zinc finger 1 of zinc finger, three amino acids of zinc finger 2, four amino acids of zinc finger 3, three amino acids of zinc finger 4, and two amino acids of the tail portion, (Fig. 4). &Lt; tb &gt; &lt; TABLE &gt; That is, each zinc finger of the snail protein participated in the binding of evenly distributed impotin beta.

In addition, the structure-based mutants showed significantly lower binding to impotin beta than the native-type snail, and the combination of each variant exhibited a weaker binding force, Binding was able to confirm that the snail protein was the major nuclear transport sequence recognized by impotin beta to be transported to the nucleus.

<110> Industry Academic Cooperation Foundation of Chungbuk National University <120> X-ray structure of human Snail / importin beta protein complex and          the crystallization method <130> pn1209-475 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Snail F primer <400> 1 cgtaggatcc gccttcaact gcaaatactg c 31 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Snail R primer <400> 2 cggatgtcga ctcagcgggg acatcctga 29 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> importin beta F primer <400> 3 accatatgga gctgatcacc attctcg 27 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> importin beta R primer <400> 4 gtctcgagtc aagcttggtt cttcagtttc c 31 <210> 5 <211> 264 <212> PRT <213> Artificial Sequence <220> <223> human snail amino acid sequence <400> 5 Met Pro Arg Ser Phe Leu Val Arg Lys Pro Ser Asp Pro Asn Arg Lys   1 5 10 15 Pro Asn Tyr Ser Glu Leu Gln Asp Ser Asn Pro Glu Phe Thr Phe Gln              20 25 30 Gln Pro Tyr Asp Gln Ala His Leu Leu Ala Ala Ile Pro Pro Pro Glu          35 40 45 Ile Leu Asn Pro Thr Ala Ser Leu Pro Met Leu Ile Trp Asp Ser Val      50 55 60 Leu Ala Pro Gln Ala Gln Pro Ile Ala Trp Ala Ser Leu Arg Leu Gln  65 70 75 80 Glu Ser Pro Arg Val Ala Glu Leu Thr Ser Leu Ser Asp Glu Asp Ser                  85 90 95 Gly Lys Gly Ser Gln Pro Pro Ser Pro Pro Ser Pro Ala Pro Ser Ser             100 105 110 Phe Ser Ser Thr Ser Ser Ser Seru Glu Ala Glu Ala Tyr Ala Ala         115 120 125 Phe Pro Gly Leu Gly Gln Val Pro Lys Gln Leu Ala Gln Leu Ser Glu     130 135 140 Ala Lys Asp Leu Gln Ala Arg Lys Ala Phe Asn Cys Lys Tyr Cys Asn 145 150 155 160 Lys Glu Tyr Leu Ser Leu Gly Ala Leu Lys Met His Ile Arg Ser His                 165 170 175 Thr Leu Pro Cys Val Cys Gly Thr Cys Gly Lys Ala Phe Ser Arg Pro             180 185 190 Trp Leu Gln Gly His Val Arg Thr His Thr Gly Glu Lys Pro Phe         195 200 205 Ser Cys Pro His Cys Ser Arg Ala Phe Ala Asp Arg Ser Asn Leu Arg     210 215 220 Ala His Leu Gln Thr His Ser Asp Val Lys Lys Tyr Gln Cys Gln Ala 225 230 235 240 Cys Ala Arg Thr Phe Ser Arg Met Ser Leu Leu His Lys His Gln Glu                 245 250 255 Ser Gly Cys Ser Gly Cys Pro Arg             260 <210> 6 <211> 876 <212> PRT <213> Artificial Sequence <220> <223> human importin beta amino acid sequence <400> 6 Met Glu Leu Ile Thr Ile Leu Glu Lys Thr Val Ser Pro Asp Arg Leu   1 5 10 15 Glu Leu Glu Ala Ala Gln Lys Phe Leu Glu Arg Ala Ala Val Glu Asn              20 25 30 Leu Pro Thr Phe Leu Val Glu Leu Ser Arg Val Leu Ala Asn Pro Gly          35 40 45 Asn Ser Gln Val Ala Arg Val Ala Gly Leu Gln Ile Lys Asn Ser      50 55 60 Leu Thr Ser Lys Asp Pro Asp Ile Lys Ala Gln Tyr Gln Gln Arg Trp  65 70 75 80 Leu Ala Ile Asp Ala Asn Ala Arg Arg Glu Val Lys Asn Tyr Val Leu                  85 90 95 Gln Thr Leu Gly Thr Glu Thr Tyr Arg Pro Ser Ser Ala Ser Gln Cys             100 105 110 Val Ala Gly Ile Ala Cys Ala Glu Ile Pro Val Asn Gln Trp Pro Glu         115 120 125 Leu Ile Pro Gln Leu Val Ala Asn Val Thr Asn Pro Asn Ser Thr Glu     130 135 140 His Met Lys Glu Ser Thr Leu Glu Ala Ile Gly Tyr Ile Cys Gln Asp 145 150 155 160 Ile Asp Pro Glu Gln Leu Gln Asp Lys Ser Asn Glu Ile Leu Thr Ala                 165 170 175 Ile Ile Gln Gly Met Arg Lys Glu Glu Pro Ser Asn Asn Val Lys Leu             180 185 190 Ala Ala Thr Asn Ala Leu Leu Asn Ser Leu Glu Phe Thr Lys Ala Asn         195 200 205 Phe Asp Lys Glu Ser Glu Arg His Phe Ile Met Gln Val Val Cys Glu     210 215 220 Ala Thr Gln Cys Pro Asp Thr Arg Val Val Ala Ala Leu Gln Asn 225 230 235 240 Leu Val Lys Ile Met Ser Leu Tyr Tyr Gln Tyr Met Glu Thr Tyr Met                 245 250 255 Gly Pro Ala Leu Phe Ala Ile Thr Ile Glu Ala Met Lys Ser Asp Ile             260 265 270 Asp Glu Val Ala Leu Gln Gly Ile Glu Phe Trp Ser Asn Val Cys Asp         275 280 285 Glu Glu Met Asp Leu Ala Ile Glu Ala Ser Glu Ala Ala Glu Gln Gly     290 295 300 Arg Pro Pro Glu His Thr Ser Lys Phe Tyr Ala Lys Gly Ala Leu Gln 305 310 315 320 Tyr Leu Val Pro Ile Leu Thr Gln Thr Leu Thr Lys Gln Asp Glu Asn                 325 330 335 Asp Asp Asp Asp Asp Trp Asn Pro Cys Lys Ala Ala Gly Val Cys Leu             340 345 350 Met Leu Leu Ala Thr Cys Cys Glu Asp Asp Ile Val Pro His Val Leu         355 360 365 Pro Phe Ile Lys Glu His Ile Lys Asn Pro Asp Trp Arg Tyr Arg Asp     370 375 380 Ala Ala Val Ala Phe Gly Cys Ile Leu Glu Gly Pro Glu Pro Ser 385 390 395 400 Gln Leu Lys Pro Leu Val Ile Gln Ala Met Pro Thr Leu Ile Glu Leu                 405 410 415 Met Lys Asp Pro Ser Val Val Val Arg Asp Thr Ala Ala Trp Thr Val             420 425 430 Gly Arg Ile Cys Glu Leu Leu Pro Glu Ala Ala Ile Asn Asp Val Tyr         435 440 445 Leu Ala Pro Leu Leu Gln Cys Leu Ile Glu Gly Leu Ser Ala Glu Pro     450 455 460 Arg Val Ala Ser Asn Val Cys Trp Ala Phe Ser Ser Leu Ala Glu Ala 465 470 475 480 Ala Tyr Glu Ala Ala Asp Val Ala Asp Asp Glu Glu Glu Ala Thr                 485 490 495 Tyr Cys Leu Ser Ser Ser Phe Glu Leu Ile Val Gln Lys Leu Leu Glu             500 505 510 Thr Thr Asp Arg Pro Asp Gly His Gln Asn Asn Leu Arg Ser Ser Ala         515 520 525 Tyr Glu Ser Leu Met Glu Ile Val Lys Asn Ser Ala Lys Asp Cys Tyr     530 535 540 Pro Ala Val Gln Lys Thr Thr Leu Val Ile Met Glu Arg Leu Gln Gln 545 550 555 560 Val Leu Gln Met Glu Ser His Ile Gln Ser Thr Ser Asp Arg Ile Gln                 565 570 575 Phe Asn Asp Leu Gln Ser Leu Leu Cys Ala Thr Leu Gln Asn Val Leu             580 585 590 Arg Lys Val Gln His Gln Asp Ala Leu Gln Ile Ser Asp Val Val Met         595 600 605 Ala Ser Leu Leu Arg Met Phe Gln Ser Thr Ala Gly Ser Gly Gly Val     610 615 620 Gln Glu Asp Ala Leu Met Ala Val Ser Thr Leu Val Glu Val Leu Gly 625 630 635 640 Gly Glu Phe Leu Lys Tyr Met Glu Ala Phe Lys Pro Phe Leu Gly Ile                 645 650 655 Gly Leu Lys Asn Tyr Ala Glu Tyr Gln Val Cys Leu Ala Ala Val Gly             660 665 670 Leu Val Gly Asp Leu Cys Arg Ala Leu Gln Ser Asn Ile Ile Pro Phe         675 680 685 Cys Asp Glu Val Met Gln Leu Leu Leu Glu Asn Leu Gly Asn Glu Asn     690 695 700 Val His Arg Ser Val Lys Pro Gln Ile Leu Ser Val Phe Gly Asp Ile 705 710 715 720 Ala Leu Ala Ile Gly Gly Glu Phe Lys Lys Tyr Leu Glu Val Val Leu                 725 730 735 Asn Thr Leu Gln Gln Ala Ser Gln Ala Gln Val Asp Lys Ser Asp Tyr             740 745 750 Asp Met Val Asp Tyr Leu Asn Glu Leu Arg Glu Ser Cys Leu Glu Ala         755 760 765 Tyr Thr Gly Ile Val Gln Gly Leu Lys Gly Asp Gln Glu Asn Val His     770 775 780 Pro Asp Val Met Leu Val Gln Pro Arg Val Glu Phe Ile Leu Ser Phe 785 790 795 800 Ile Asp His Ile Ala Gly Asp Glu Asp His Thr Asp Gly Val Val Ala                 805 810 815 Cys Ala Ala Gly Leu Ile Gly Asp Leu Cys Thr Ala Phe Gly Lys Asp             820 825 830 Val Leu Lys Leu Val Glu Ala Arg Pro Met Ile His Glu Leu Leu Thr         835 840 845 Glu Gly Arg Arg Ser Lys Thr Asn Lys Ala Lys Thr Leu Ala Thr Trp     850 855 860 Ala Thr Lys Glu Leu Arg Lys Leu Lys Asn Gln Ala 865 870 875

Claims (18)

Snale-Imphotin beta-complex crystals having a three-dimensional crystal structure in which two to four domains of Snale protein zinc finger bind spheres with an impotin beta protein while forming a spherical structure. The method according to claim 1,
Snale-imphotin beta complex crystals characterized in that the snail protein zinc finger 1 domain binds to the impotin beta heat repetition structure (HEAT repeat 10). 3. The method of claim 2,
The domains of the snail protein zinc finger 1 to 3 are composed of Cys-Cys ... His-His and the domain of the snail protein zinc finger 4 is composed of Cys-Cys ... His-Cys Characterized by a snail-impotin beta complex. The method according to claim 1,
Wherein the snail protein is composed of a human-derived amino acid sequence represented by SEQ ID NO: 5, and the infantin beta protein is composed of an amino acid sequence represented by SEQ ID NO: 6. decision. 5. The method of claim 4,
Wherein the amino acid from the 153th to 264th positions of the snail protein binds to the amino acid of the infantin beta protein. 6. The method of claim 5,
The amino acids L166, G167, R191, W193, N196, R215, S221, R224, N228, R247, S249, K253, C262 and R264 of the snail protein correspond to the corresponding amino acid residues E203 , E281, D288, E289, D292, E295, D426, T427, W430, P440, E441, D579, S582, G622, D627. 6. The method of claim 5,
Wherein the amino acid residue of the snail is transported from the cytoplasm to the nucleus while being coupled with impotin beta to form a spherical structure. The method according to claim 1,
Wherein the snail-impotin beta complex crystals have a size of 105 X 75 X 660 ANGSTROM. The method according to claim 1,
The snail-impotin beta complex crystals have the following X-ray crystal structure: &lt; tb &gt;&lt; TABLE &
Space group of crystals: single crystal space group (C2),
Lattice unit: a = 228.210, b = 277.528, c = 72.019, and alpha = 90 deg., Beta = 100.96 deg., Gamma = 90 deg The method according to claim 1,
Wherein the snail protein and the impotin beta protein are derived from human. The method according to claim 1,
The above snail-impotin beta complex crystals
Wherein the sNail-impotin beta complex crystal has a function of inhibiting cancer metastasis by inhibiting the nuclear transport process by the epithelial-mesenchymal transition (EMT) of the snail protein. A method for preparing crystals of a three-dimensional structure of a snail-impotin beta complex according to claim 1 comprising:
(i) separating and purifying a human-derived snail and an impotin beta protein to form a complex;
(ii) crystallizing the protein complex using a reservoir containing 0.1 M Tris HCl (pH 7.5), 10% (w / v) PEG 8000, 20% (v / v) glycerol; And
(iii) optimizing the protein complex crystals using a preservation solution comprising 0.1 M bis-Tris HCl (pH 6.9), 10% (w / v) PEG 8000, 0.5 M urea, 20% glycerol. 13. The method of claim 12,
Wherein the human-derived snail protein of step (i) is a peptide consisting of amino acids from position 153 to position 264. 13. The method of claim 12,
Wherein the crystallization of step (ii) is carried out by a hanging-drop vapor-diffusion method. 15. The method of claim 14,
And in step (ii) the solution is allowed to stand for one day. 13. The method of claim 12,
And in step (iii) the solution is allowed to stand for 7 days. An anticancer composition for inhibiting cancer metastasis comprising the snail-impotin beta complex of claim 1 as an active ingredient. 18. The method of claim 17,
Wherein the cancer is selected from the group consisting of skin cancer, basal cell carcinoma and malignant melanoma, renal cell carcinoma, liver cancer, thyroid cancer, nasopharyngeal cancer, solid tumor, prostate cancer, gastric cancer / abdominal cancer, esophagus cancer, rectal cancer, pancreatic cancer, breast cancer, A group consisting of epidermal cancer, cervical cancer, non-small cell lung cancer, small cell lung cancer, neurocytoma, leukemia, acute leukemia, chronic leukemia, chronic myelogenous leukemia, myeloid leukemia, lymphoma, multiple myeloma, Lt; RTI ID = 0.0 &gt; metastatic &lt; / RTI &gt; cancer selected.

Images