KR20140041120A - Method of detecting adipokines using necleic acid aptamer and antibody - Google Patents

Abstract

The present invention relates to a method for detecting adipokines using nucleic acid aptamers and antibodies and, more specifically, to a method for detecting adipokines which detects the adiopokines more sensitively than the existing antibody-based analysis or aptamer detection method and enables the diagnosis of diabetes. The method for detecting adipokines according to the present invention measures the adipokine concentration in the blood more sensitively and accurately than the existing analysis using only antibody, and also the DNA aptamer can be produced at a low cost and is easy to fix on the surface compared with the antibody, thereby having an advantage in producing a biosensor. In addition, the detection method according to the present invention has sensitivity much higher than the existing aptamer detection method, thereby being useful for increasing the accuracy of the diagnosis of type two diabetes as the biosensor measuring the concentration of RBP4, Vaspin, and Nampt sensitively and accurately.

Description

Method of Detecting Adipokines Using Necleic Acid Aptamer and Antibody

The present invention relates to a method of detecting edipokines using nucleic acid aptamers and antibodies, and more particularly, to a method of detecting edipokines using antibody-based nucleic acid aptamers and antibodies, And to a method for detecting edipokines that enables diagnosis.

Adipokine is a cytokine protein secreted by adipocytes and plays an important role in the metabolism of the immune system and the nervous system. Among them, retinol binding protein-4 (RBP4), Vaspin and Nampt have been reported to be closely related to obesity-induced type 2 diabetes. Specifically, it was confirmed that the serum concentration of the above-mentioned edipokines in obese and type 2 diabetic patients was increased. By using these as a biomarker, the level of RBP4, Vaspin, It can diagnose accurately.

Among the diagnostic methods of existing edipokines, immunoassay methods using antibodies are well known. Enzyme-Linked ImmunoSorbent Assay (ELISA) measures the binding of an antigen to an antibody using an enzyme reaction. Usually, an enzyme is attached to an antibody that binds to a substance to be measured, and an antigen-antibody reaction is caused. After that, a substrate reacting with the bound enzyme is added to cause an enzyme reaction. Commonly used enzymes include alkaline phosphatase, horseradish peroxidase, and beta galactosidase. The product of the enzyme reaction is usually a colored material, which is measured with a spectrophotometer.

In particular, an ELISA technique using two kinds of antibodies binding to one target is widely used. ELISA is a method for measuring the amount of target between a capture antibody and a detection antibody. The target should have at least two antigenic sites to which the antibody can bind. Therefore, the procedure may be more difficult than the other experiments, since the antibody pair to be used in the diagnosis of edipokines needs to be tested and optimized.

In addition, the antibody as a role of detecting the target is produced through the immune system of the living body. Therefore, it is a problem that the cell culture and the animal are needed and the purification process is performed to secure the antibody, . In general, the antibody is a very large protein with a size of about 150 kDa. There are physical limitations such as a small amount of immobilization within a limited area of the plate well and the chemical stability is significantly lower than DNA or other chemical substances there is a problem. In other words, the technology using only antibodies in the diagnosis of existing blood edipokines is not efficient in terms of cost and time, the range of application is not varied, and there are limited problems in application as a biosensor.

As a new sensing substance for improving the problems of antibodies, there have been many studies using aptamer, which is a nucleic acid construct having high specificity for various target substances. Aptamer is a single stranded DNA or RNA structure with a stable tertiary structure and high specificity and affinity for a specific target. Aptamers are often compared with monoclonal antibodies due to their inherent high affinity (usually pM levels) and their ability to bind to target molecules with specificity, and are highly likely to be alternative antibodies as they are called 'chemical antibodies'. The aptamer is a small molecular structure composed of nucleic acids of about 20 to 80 mer, unlike an antibody having a large molecular structure, and has a merit that various necessary modifications are easy. In addition, since it is excellent in thermal stability, it can be stored and transported at room temperature, and regeneration can be performed again in a short time even if denaturation occurs, so that it is very easy to apply it to a diagnostic application requiring long and repeated use. Since aptamer uses chemical synthesis method, it can be produced at low cost in a short period of time, has almost no batch to batch variation, and has excellent advantages in terms of productivity because it is very easy to purify with high purity. It is superior to the sensing materials used in the field. In addition, there is no restriction on the target material, so that aptamers for various targets such as biomolecules such as proteins and amino acids, small organic chemicals such as environmental hormones and antibiotics, and bacteria can be synthesized. Due to the characteristics of the aptamer specifically binding to the target substance, a lot of research has been conducted recently in order to utilize aptamer for research on new drug development, drug delivery system, and biosensor.

Accordingly, the present inventors have made extensive efforts to provide a new method for detecting edipokines in order to overcome the problems of the prior arts. As a result, the present inventors have found that a specific affinity for RBP4, Vespin, and Natrium, which are biomarkers of type 2 diabetes, The present inventors confirmed that detection of edipokines more sensitively and consistently than conventional antibody-based assays can effectively diagnose type 2 diabetes through the use of DNA aptamers and antibodies, which are nucleic acid constructs, .

The information described in the Background section is intended only to improve the understanding of the background of the present invention and thus does not include information forming a prior art already known to those skilled in the art .

It is an object of the present invention to provide a novel edipokine detection method which can solve the problems of the conventional edipocine detection method and diagnose diabetes quickly and accurately.

In order to achieve the above object, the present invention provides a method of detecting edipokines using nucleic acid aptamers and antibodies, comprising the steps of:

(a) adding to the nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1, 2 and 3 a sample and an antibody that specifically binds to a target edipokine of the selected nucleic acid aptamer, immobilized on a solid phase, ; And

(b) analyzing the binding of the antibody to detect the edipokine.

The invention also relates to a nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1, 2 and 3 and immobilized on a solid phase; And an antibody that specifically binds to an edipokine targeted by the selected nucleic acid aptamer.

The invention also relates to a nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1, 2 and 3 and immobilized on a solid phase; And an antibody that specifically binds to an edipokine targeted by the selected nucleic acid aptamer.

INDUSTRIAL APPLICABILITY The method for detecting edipokines according to the present invention is capable of measuring the concentration of edipokines in blood more sensitively and accurately than the analysis using only antibodies that have been used in the past, It is easy to immobilize, which is advantageous for manufacturing biosensors. In addition, the detection technique according to the present invention has a very high detection sensitivity as compared with the conventional aptamer detection technique. Therefore, it is useful to increase the accuracy of diagnosis of type 2 diabetes as a biosensor capable of accurately and accurately measuring the concentration of RBP4, Vespin, and Nam concentration in the blood.

1 is a schematic diagram showing an embodiment of a method for detecting edipokines according to the present invention.
FIG. 2 is a graph showing the selection specificity of the method for detecting an edipocine according to the present invention (RBA: RBP4 binding aptamer, VBA: vaspin binding aptamer, NBA: Nampt binding aptamer).
FIG. 3 is a graph showing the detection limit of three edipokines (A: RBP4, B: Vaspin, C: Nampt) as a result of concentration-dependent testing of the method for detecting edipokines according to the present invention.
4 is a graph showing the results of detection of edipokines in human serum (A: RBP4, B: Vaspin, C: Nampt).
5 is a graph showing RBP4 detection results in an artificial serum.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The definitions of the main terms used in the description of the present invention and the like are as follows.

The term "nucleic acid aptamer " as used herein refers to a small single-stranded oligonucleotide capable of specifically recognizing a target substance with high affinity.

As used herein, a "sample" is presumed to contain or contain an edipokine, ie, retinol-binding protein-4 (RBP4), visceral adipose tissue-derived serpin, or Nampt (nicotinamide phosphoribosyltransferase) Means a composition to be analyzed, and is characterized in that it is detected from a sample collected from any one or more of animal intestines, animal tissues, and animal body fluids, but is not limited thereto. At this time, the body fluid may be characterized by serum, blood, urine, tears, sweat, saliva, lymph and cerebrospinal fluid. The animal tissues include tissues such as mucous membranes, skin, epidermis, hair, scales, eyes, tongue, cheeks, hooves, beak, snout, feet, hands, mouth, nipple, ear and nose.

In one aspect, the present invention relates to a method of detecting an edipokine using a nucleic acid aptamer and an antibody comprising the steps of:

(a) adding to the nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1, 2 and 3 a sample and an antibody that specifically binds to a target edipokine of the selected nucleic acid aptamer, immobilized on a solid phase, ; And

(b) analyzing the binding of the antibody to detect the edipokine.

As used herein, the term "solid phase" refers to a solid state support in which the aptamer is immobilized, so long as the aptamer can be immobilized. For the convenience of performing analytical methods, a multiwell type microplate can be generally used, but other shapes, such as a sensor chip, plastic, polypropylene, or bead filled columns such as sepharose or agarose, may also be used.

The aptamer can be fixed to the solid phase by a conventional method. In one embodiment of the present invention, steppedidin is immobilized on a solid phase, biotin is bound to a nucleic acid aptamer, and immobilized using a combination of stepavidin and biotin. However, the present invention is not limited thereto. It is obvious to those who have ordinary knowledge.

In the present invention, in the step (a), the sample and the selected nucleic acid aptamer are reacted with the fixed aptamer by adding an antibody that specifically binds to a target edipokine, Means that a sample and an antibody are added to an aptamer and incubated to bind a target substance present in the sample, that is, edipokines RBP4, Besin, and Nampt to an immobilized aptamer, and the antibody is allowed to bind to a target substance . At this time, the sample and the antibody may be mixed first and then added to the aptamer. That is, the sample and the antibody may be mixed to cause specific binding between the target substance and the antibody in the sample, and then the bound target substance-antibody may be added to the immobilized aptamer to bind to the aptamer.

In the step (a), the sample may be added first and then the antibody may be added. That is, the target substance in the sample may be first bound to the aptamer immobilized on the solid phase, and then the antibody may be sequentially added to bind the aptamer so that the sequential binding reaction can be performed.

Here, the antibody is characterized in that a nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1, 2 and 3 specifically binds to a target edipokine. That is, when the nucleic acid aptamer of SEQ ID NO: 1 is immobilized on a solid phase, the antibody specifically binds to RBP4. When the nucleic acid aptamer of SEQ ID NO: 2 is immobilized on a solid phase, the antibody specifically binds to Vespin And the antibody is characterized by binding specifically to Nampt when the nucleic acid aptamer of SEQ ID NO: 3 is immobilized on a solid phase. Even when an aptamer and an antibody are present for a specific target, the method according to the present invention can not be applied when the aptamer and the antibody bind to the same region, and since the known aptamer is applied as it is, As it is not possible, selection of apt tamer is very important and must be confirmed experimentally.

Herein, the sequence of each nucleic acid aptamer is as follows.

5'-ATACCAGCTTATTCAATT ACAGTAGTGAGGGGTCCGTCGTGGGGTAGTTGGGTCGTGG AGATAGTAAGTGCAATCT-3 '(SEQ ID NO: 1) which specifically binds to RBP4.

5'-ATACCAGCTTATTCAATT GGGCGGTGGGGGGGGTAGTGGGTGTTATGGCGATCGTGG AGATAGTAAGTGCAATCT-3 '(SEQ ID NO: 2) which specifically binds to Vespin:

Nucleotide aptamer specifically binding to Nampt: 5'-ATACCAGCTTATTCAATT GGGCAGGACAGGTGTCGGCTTGATAGGCTGGGGTGTGTGT AGATAGTAAGTGCAATCT-3 '(SEQ ID NO: 3)

In the present invention, any type of signal processing technique can be applied as long as the binding of the antibody in the step (b) can be confirmed, for example, an antibody or a secondary antibody that is bound to the antibody The labeling substance itself or its reaction can be detected by binding the labeling substance to the labeling substance itself. The labeling substance may be attached to the antibody or the secondary antibody indirectly or directly, and the labeling substance includes, but is not limited to, a fluorescent substance, a quantum dot, a radioactive label, a gold nanoparticle, an enzyme, A fluorescent substance such as Cy3 or Cy5, a fluorescence protein such as luciferase, GFP, or the like may be used as the fluorescent substance. Of fluorescent material can be used. In addition, the detection of the labeling substance or its reaction can be performed by a known labeling substance or a method of analyzing the reaction. For example, when a fluorescent substance is used as a labeling substance, luminescence or color change occurs in the presence of a target substance, and the target substance can be detected by measuring the fluorescence. By way of example, the reaction well can be scanned through an image scanner capable of detecting a fluorescent dye to confirm whether or not the target substance is detected, and the detection amount can be measured by measuring the extent to which the image is evolved through software.

In one embodiment of the present invention, it has been confirmed that each of the edipokines other than ADPN or other blood proteins can be specifically detected even by using the detection method of the present invention. In another embodiment of the present invention, the detection limit is about 20 times (SEQ ID NO: 1), 29 times (SEQ ID NO: 2), and 68 times (SEQ ID NO: 3) lower than the conventional aptamer detection technique And it was confirmed that the detection sensitivity was greatly improved. Thus, in another aspect, the invention provides a nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1, 2 and 3, which is immobilized on a solid phase; And an antibody that specifically binds to an edipokine targeted by the selected nucleic acid aptamer.

In another embodiment of the present invention, in order to determine if it is possible to detect edipokines in actual blood, a sample spiked with a particular edipokine in a human serum was tested and found to have the same detection limits , Indicating that specific detection can be performed without being disturbed by many proteins and physiological substances in the blood when the method of the present invention is used. In particular, the limit of detection of RBP4 and Nampt is sufficient to cover the actual serum level of type 2 diabetic patients, and it is possible to detect selective and sensitive edipokines in the field of diagnosis in hospitals and the like. Can be usefully used for diabetes diagnosis.

Accordingly, the present invention provides, in a further aspect, a nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1, 2 and 3 and immobilized on a solid phase; And an antibody that specifically binds to an edipokine targeted by the selected nucleic acid aptamer.

An edipokerine detection or diabetes diagnostic system applying the method according to the present invention may be provided in the form of a kit. It may take the form of a bottle, a tub, a sachet, an envelope, a tube, an ampoule and the like, which may be partly or wholly formed from plastic, glass, paper, foil, wax, . The container may be fitted with a cap which is initially part of the container or can be fully or partially detachable, which may be attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, which is accessible to the contents by the injection needle. The kit may include an external package, and the external package may include instructions for use of the components.

Example

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Selectivity test of edifocal diagnosis

First, a DNA aptamer that specifically binds to each of RBP4, Vespin, and Nampt in Table 1 was labeled with biotin and then fixed on a plate coated with streptavidin. In order to activate the 96-well plate coated with streptavidin before the DNA aptamer, each microwell contained 200 μl of washing buffer (WB): 150 mM NaCl, 25 mM Tris, 0.1% BSA, and 0.05% Tween-20, pH 7.2), and 0.4 μM of each biotinylated aptamer solution (100 μl) was added to each well, followed by incubation at room temperature for 2 hours.

Next, to remove the non-fixed reagent, an aptamer fixed plate was washed 3 times with the washing buffer (WB), and the binding buffer (BB): 100 mM NaCl, 20 mM TrisHCl, 2 mM MgCl ₂ , KCl, 1mM CaCl _2, and 0.02% Tween-20, after each 5㎍ / ㎖ target eddy myrtle of (RBP4, Vaspin, Nampt) of dissolved in the pH 7.6) to each injection well, aptamer-target binding of Were incubated for 1 hour. After binding with the target, the plate was washed with a washing buffer (WB), and 100 쨉 l of an antibody (AdipoGen, Inc., Korea), which binds to 4 쨉 g / ml of each target edipokine, (HRP-conjugated se- raid rabbit IgG antibody, Santa Cruz Biotechnology, INC, USA) was added and incubated for 1 hour. At this time, after each reaction was completed, washing was performed with washing buffer (WB). At this time, adiponectin (ADPN), and HSA, human IgG, and fibrinogen were bound to 5 μg / ml of DNA in a 96-well plate immobilized with DNA aptamer to test the selectivity of the edipokerine diagnosis. At this time, the human RBP4, Vespin, Nampt, ADPN and their antibodies were purchased from AdigoGen Inc. (Korea), and HSA, IgG, and Bibrinogen were purchased from Sigma.

Finally, o-phenylenediamine (OPD, Thermo Fisher Scientic Inc., U.S.A.) was used as an enzyme substrate to induce the color reaction, and the absorbance was confirmed at 490 nm. 1 schematically illustrates the invention.

Edifocalin specific nucleic acid aptamer SEQ ID NO: Aptamer The base sequence (5'-3 ') One RBA (RBP4 binding aptamer) ATACCAGCTTATTCAATT ACAGTAGTGAGGGGTCCGTCGTGGGGTAGTTGGGTCGTGG AGATAGTAAGTGCAATCT 2 VBA (vaspin binding aptamer) ATACCAGCTTATTCAATT GGGCGGTGGGGGGGGTAGTGGGTGTTATGGCGATCGTGG AGATAGTAAGTGCAATCT 3 NBA (Nampt binding aptamer) ATACCAGCTTATTCAATT GGGCAGGACAGGTGTCGGCTTGATAGGCTGGGGTGTGTGT AGATAGTAAGTGCAATCT

As a result, as shown in Fig. 2, the absorbance signal appeared only when the target edifcaine corresponding to each of the aptamers was processed, whereby the detection method of the present invention was used to specifically detect each target edifocal Can be detected.

Sensitivity of the diagnosis of edipokerine

(RBP4, Vaspin, Nampt) diluted twice in the binding buffer (BB) of Example 1 were tested for binding and binding in the same manner as in Example 1, in order to test the sensitivity of the diagnostic of the edipokines through the present invention. And the reaction results were confirmed.

As a result, as shown in Fig. 3, all three kinds of edipokines exhibited a wide working range.

In the case of RBP4, the concentration of RBP4 was 5 ng / mL (R2 = 0.99), 39 ng / mL to 2.5 μg / mL (R2 = 0.99) / mL (R2 = 0.99), respectively. The detection limits of each edipokine were RBP4: 78 ng / mL, Vespin: 39 ng / mL, and Nat: 19 ng / mL, This is 20 times, 29 times, and 68 times lower than the detection limit obtained by combining with the sensor.

These results show that the detection sensitivity of the nucleic acid aptamer of Table 1 is significantly improved when the method of the present invention is used, compared to the conventional aptamer detection method.

Diagnosis of Edipokines in serum

In order to verify whether the method of the present invention can detect edipokines in actual blood, a sample spiked with each edipokine was tested in human serum in the same manner as in Example 2. Human serum was purchased from Invitrogen and diluted 10-fold to reduce interference with other proteins in the serum. The target concentration range of the binding assay was set to be the same as in Example 2.

As a result, as shown in Fig. 4, the absorption signal increased in a concentration-dependent manner, and the results obtained in Example 2 showed the same or slightly narrow working range. In the case of RBP4, 2.5 ng / mL (R2 = 0.99) of 78 ng / mL, 39 ng / mL of 625 ng / (R2 = 0.99), respectively. In the case of the detection limit, all three edipokines were obtained in the same manner as in Example 2, that is, in the buffer, so that the diagnosis of the edipokines using the method of the present invention can not inhibit many proteins and physiological substances in the blood And no nonspecific binding was observed. In addition, since the detection limit of RBP4 and Nampt through the present invention is within a range that can sufficiently cover the serum level of type 2 diabetic patients, it is possible to detect selective and sensitive edipokines in diagnostic applications in hospitals and the like .

Diagnostic testing of edipokines in artificial serum and comparison with conventional methods

An artificial serum was prepared and used for the detection of RBP4 in order to compare the sensitivity of the diagnosis of edipokerine using the method according to the present invention with other methods. The artificial serum was normal serum level RBP4 70 ug / mL; Vespin 0.7 ng / mL; Adipokines and albumin were prepared by dissolving albumin in 0.1 M PBS, pH 7.4 buffer, with 16 ng / mL of adiponectin, 30 ug / mL of adiponectin and 40 mg / mL of albumin. The prepared artificial serum was diluted to 1: 100-1: 1000 and samples of each dilution were applied to the method of the present invention.

As a result, as shown in FIG. 5, using the method according to the present invention, it was confirmed that RBP4 detection in an artificial serum showed sensitivity up to 800X. On the other hand, in the case of RBP4 based on SPR using only aptamer applied to artificial serum of the same condition, dilution factor of 350X was detected. Thus, the detection of edipokines using the method according to the present invention can be performed by using only a conventional aptamer It has been proved that it has superior sensitivity than the method.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the invention is not limited thereby. It will be obvious. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Unsigned

<110> Korea University Research and Business Foundation <120> Method of Detecting Adipokines Using Necleic Acid Aptamer and          Antibody <130> P12-B164 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> RBP4 binding aptamer <400> 1 ataccagctt attcaattac agtagtgagg ggtccgtcgt ggggtagttg ggtcgtggag 60 atagtaagtg caatct 76 <210> 2 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Vaspin binding aptamer <400> 2 ataccagctt attcaattgg gcggtggggg gggtagtggg tgttatggcg atcgtggaga 60 tagtaagtgc aatct 75 <210> 3 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> Nampt binding aptamer <400> 3 ataccagctt attcaattgg gcaggacagg tgtcggcttg ataggctggg gtgtgtgtag 60 atagtaagtg caatct 76

Claims (4)

A method for detecting edipokines using nucleic acid aptamers and antibodies, comprising the steps of:
(a) adding to the nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1, 2 and 3 a sample and an antibody that specifically binds to a target edipokine of the selected nucleic acid aptamer, immobilized on a solid phase, ; And
(b) analyzing the binding of the antibody to detect the edipokine.
The method according to claim 1, wherein the step (b) comprises the step of contacting a labeling substance selected from the group consisting of a fluorescent substance, a quantum dot, a radioactive label, a gold nanoparticle, an enzyme, an enzyme substrate and an electrochemical functional group, Binding to a secondary antibody that is secondarily bound to the antibody, and detecting the binding of the antibody by detecting the reaction of the labeling substance or the labeling substance.
A nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1, 2 and 3 and immobilized on a solid phase; And an antibody that specifically binds to an edipokine targeted by the selected nucleic acid aptamer.
Nucleic acid aptamers immobilized on a solid phase and selected from the group consisting of SEQ ID NOs: 1, 2 and 3; And an antibody that specifically binds to edipocaine targeted by the selected nucleic acid aptamer.

Images