KR20140027075A - Anti cd4 antibodies to prevent in particular graft - vesus - host - disease(gvhd) - Google Patents

Abstract

The present invention provides, among other things, a) culturing a cell graft containing immune cells with an anti-CD4 antibody (the incubation runs for 1 minute to 7 days), and b) removing the unbound antibody from the graft. It relates to an in vitro method of modifying a cell graft containing immune cells, as well as a corresponding modified graft and a method of using the same, comprising the steps of: In addition, the present invention provides a CD4, such as an anti human CD4 antibody, having a reduced number of potential T-cell epitopes, but comprising a heavy chain immunoglobulin variable region (VH) and a light chain immunoglobulin variable region (VL). A modification of an antibody that is reactive to a CD4 human leukocyte antigen to provide an anti-CD4 antibody that retains its ability to bind to said at least one T cell epitope located outside the CDRs of said immunoglobulin variable region. It is removed from the area. It is preferred that the mode of action and specificity of the anti-CD4 antibody is not affected by the modification (s).

Description

In particular, anti-CD4 antibodies for the prevention of GVHD (ANTI CD4 ANTIBODIES TO PREVENT IN PARTICULAR GRAFT-VESUS-HOST-DISEASE (GVHD)}

The present invention relates to the field of grafts and their implantation. More specifically, the present invention relates to modified grafts, methods of obtaining them, and related methods of use. Among other things, the present invention relates to grafts containing immune viable cells.

In a further aspect, the present invention relates to a modified anti human CD4-antibody, wherein the immunological characteristics are modified by a reduced number of T cell epitopes and to a subject related thereto.

Currently, allogeneic hematopoietic stem cell transplantation (HSCT) is the only treatment regimen for many patients with hematological malignancies. Bone marrow (Aschan, 2006), mobilized peripheral mobilized stem cells (Bacigalupo et al., 2002), and umbilical cord blood (Kestendjieva et al., 2008) are common sources for HSCT. Despite the use of very complex therapeutic approaches, HSCT is still present for graft versus host disease (GvHD), infectious diseases, veno-occlusive disease, donor graft rejection, and basal It is associated with significant mortality caused by many complications such as relapse of the disease.

The use of immunosuppressants conventionally results in suppression of the entire immune system, which improves the likelihood of developing an infection or malignant tumor. Also in some cases, the efficacy of such drugs may be reduced or even disappear. For example, steroid refractory GvHD is one of the major problems following allogeneic hematopoietic stem cell transplantation (Auletta et al., 2009; von Bonin et al., 2009). To treat GvHD, immunosuppression strategies have already been implemented for key elements of the T-cell response (von Bonin et al., 2009). However, for many patients, this strategy has been used primarily for rheumatology (Kameda et al., 2009; Senolt et al., 2009) or for patients after kidney transplantation. Having; (Ji, etc., 2005 Chen et al., 2004) and anti-CD20 antibody (Bates et al., 2009); for the treatment of acute GvHD, OKT3 ^® (Benekli M, etc., 2006 Knop et al., 2007) or interleukin-2 receptor antibodies Most experience is available for chronic GvHD. However, such antibodies may be associated with less long-term success and toxicity because of the emergence of infectious complications. The use of monoclonal antibodies for clinical use has been limited due to missing humanizations. Antibodies from murine animals or antibodies from other species are macromolecules having a molecular weight in the range of 150 kDa that can be very immune in humans. After administration of anti-human monoclonal antibodies, life-threatening hypersensitivity complications were observed (Chester et al., 1995). In addition, the immune potential of the antibody depends on the peptide structure of the antibody. For example, IgG4 is less immune than the IgG1 isotype because of its low potential for complement activation. In addition, humanization of antibodies leads to chimeric isotypes that are less immune than their original murine and counterparts (Hosono et al., 1992). To date, there is no clear data showing that fully human antibodies have clinical advantages over chimeric antibodies.

Thus, there is still a need for research on alternative or improved therapeutic approaches or procedures, including the use of new cell sources, treatment with antibodies or other biomaterials.

One possible approach focuses on CD4 positive T helper cells. The cells mediate both pathological and physiological immune responses in the human body. Therefore, administration of anti-CD4 antibodies to affect CD4-positive T helper cells should lead to targeted regulation of the immune system.

Previously, antiviral CD4 monoclonal antibody Max16H5 (IgG1) has been used for clinical use in patients with autoimmune diseases or as a protective therapy against transplant rejection (Chatenoud et al., 1995; Emmrich et al., 1991a; Emmrich Et al., 1991b). In addition, in human kidney transplantation, Max16H5 (IgG1) has the potential to effectively reduce graft rejection (Reinke et al., 1991; Reinke et al., 1995). Administration of anti-CD4 specific monoclonal antibodies may not only result in suppression of immune activity, but also induce resistance to tetanus toxoids in a triple transgenic mouse model (Laub). Et al., 2002). Induction of resistance by murine monoclonal antibodies has also been demonstrated (Kohlhaw et al., 2001). The monoclonal antibody Max16H5 is incorporated herein by reference and among others EP 1 relates to the use of labeled ligands having specificity for human CD4 molecules for the production of diagnostic agents in vivo. 454 137 is also described.

CD4 + molecules on T helper cells bind directly to certain regions of HLA molecules on antigen presenting cells (APCs) to allow complete T cell activation. This binding is prevented by nondeficient monoclonal antibodies, leading to global steric hindrance, shortening of cell-cell contact between APC and T cells (Fehervari et al., 2002), or inhibition of protein tyrosine phosphorylation. This activation can be inhibited by induction of negative signals (Harding et al., 2002) or T cell energy induction (Madrenas et al., 1996). Among them, Fehervari et al. Harding et al. Do not describe the method and use of the present invention. Among other things, they did not culture stem cell grafts with anti-CD4 antibodies, but isolated CD4 + cells isolated from spleen and buffy coat (human).

WO 2004/112835 also describes methods that, among others, require the use of antibodies, including antibodies against CD4. In this document, anti-CD4 antibodies were used to generate regulatory T cells for long periods of time to induce immune resistance.

From the foregoing, there is still a need for promising alternative and improved treatment approaches, each of which may lack the disadvantages of the prior art methodology.

In addition, there are many cases where the efficacy of a therapeutic protein is limited to the therapeutic protein by an unwanted immune response. Several rat monoclonal antibodies have shown promise as therapeutic therapies in many human disease environments, but in certain cases, significant human anti-murine antibody (HAMA) responses (Schroff et al., 1985). Failed because of its induction. For monoclonal antibodies, many techniques have been developed in attempts to reduce the HAMA response (see, eg, WOA9106667). This recombinant DNA approach generally reduces mouse genetic information in the final antibody structure, while increasing human genetic information in the final structure. Nevertheless, the resulting "humanized" antibodies still in some cases elicited immune responses in patients (Isaacs J. D., 1990).

Antibodies are not the only type of polypeptide molecule administered as a therapeutic agent capable of raising an immune response. Even proteins of human origin and proteins with the same amino acid sequence as occur in humans can still induce an immune response in humans.

The key to the induction of the immune response is the presence of peptides in proteins that can stimulate the activity of T cells through the presentation on MHC class II molecules, the so-called “T-cell epitopes”.

MHC class II molecules are a group of highly polymorphic proteins that play a central role in helper T cell selection and activation. Human leukocyte antigen group DR (HLA-DR) is the major isotype of proteins of this group. However, isotypes HLA-DR and HLA-DP perform similar functions. In the human population, an individual has two to four DR alleles, two DQs, and two DP alleles. The structure of many DR molecules is solved, which appears as open-ended peptide binding grooves with many pockets that engage the amino acid side chains (pocket residues) of the peptide (Stern et al., 1994). Polymorphism, which identifies different allotypes of class II molecules, contributes to a wide variety of different binding surfaces for peptides in peptide binding grooves and, at the population level, recognizes foreign proteins and immune responses to pathogens. Maximum flexibility is ensured with regard to the ability to raise.

The immune response to the therapeutic protein proceeds through the MHC class II peptide presentation pathway. Here, exogenous proteins are swallowed by antigen presenting cells and processed for presentation at the cell surface associated with MHC class II molecules of DR, DQ or DP type. MHC class II molecules are expressed by specialized antigen presenting cells, such as macrophages and dendritic cells, among others. Binding of MHC class II peptide complexes by cognate T cell receptors at the surface of T cells, along with cross-linking of other specific co-receptors such as CD4 molecules, can induce an activation state within T cells. . Activation further activates other lymphocytes, such as B cells to induce release of cytokines to produce antibodies, or activate T killer cells as a whole cell immune response.

T cell epitope identification is the first step for epitope removal, as recognized in WO 98/52976 and WO 00/34317. In this teaching, predicted T cell epitopes are removed using appropriate amino acid substitutions in the protein. In addition to the computational teachings, there are in vitro methods for measuring the ability of synthetic peptides to bind MHC class II molecules. Exemplary methods can be used to identify MHC class II ligands using a defined MHC allotype B-cell line as a source of MHC class II binding surfaces (Marshall et al., 1994; O'Sullivan et al., 1990; Robadey et al., 1997). However, this teaching is not suitable for the shielding of potential multiple epitopes against a wide variety of MHC allotypes, and also cannot confirm the ability of the binding peptide to act as a T cell epitope.

Recently, techniques have been utilized to develop soluble complexes of recombinant MHC molecules in conjunction with synthetic peptides (Kern et al., 1998; Kwon et al., 2001). These reagents and procedures allow for the presence of T cell clones from peripheral blood samples from uncontrolled human or experimental animal subjects that can bind specific MHC-peptide complexes and mask potential multiple epitopes against a wide variety of MHC allotypes. Used to check.

CD4 is a surface glycoprotein expressed primarily on cells of the T lymphocyte lineage, including most thymocytes and some peripheral T cells. The functional significance of this divergent cell distribution is unknown, but low levels of CD4 are also expressed by some non-lymphoid cells. On mature T cells, CD4 performs a co-recognition function through interaction with MHC class II molecules expressed in antigen presenting cells. CD4 + T cells constitute primarily a helper subset that regulates T and B cell function during T-dependent responses to viral, bacterial, fungal, and parasitic infections.

During the onset of autoimmune disease, more specifically, if resistance to autologous antigens is destroyed, CD4 + T cells contribute to an inflammatory response, which leads to the destruction of joints and tissues. This process is facilitated by supplementation of inflammatory cells of the hematopoietic line, production of antibodies, inflammatory cytokines, and mediators, and activation of killer cells.

CD4 antibodies are known in the art. An exemplary CD4 antibody, monoclonal murine anti-CD4-antibody 30F16H5, is described in DE 3919294. The antibody can be obtained from hybrid cell line ECACC 88050502.

To reduce the immunogenicity of murine anti-CD4 antibodies, humanized anti-CD4 antibodies were predesigned by cloning the hypervariable regions of murine antibodies into the framework provided by human immunoglobulins (e.g., For example, Boon et al., 2002). Although immunogenicity was reduced compared to anti-CD4 in mice, these humanized antibodies still induce immune responses in several cases.

In addition, such "humanization" of antibodies from the art often results in antibodies with lower or significantly lower affinity for a given target.

Thus, a further object of the present invention is to provide a modified form of the anti-CD4-antibody to reduce the immune response to murine anti-CD4 antibodies. More specifically, it may be desirable to provide an anti-CD4 antibody with a reduced number of T cell epitopes that may cause a reduced or lacking potential to induce an immune response in human subjects. Such proteins can be expected to display increased circulation time in human subjects that can raise an immune response to unmodified antibodies, and are chronic or recurrent disease as is the case for many indications for anti-CD4. This may be particularly advantageous in settings. While others have provided anti-CD4 antibody molecules comprising a "humanized" form, none of these teachings recognizes the importance of T cell epitopes on the immune properties of proteins, and in a specific and controlled manner in accordance with the present disclosure. It is not intended to directly affect these properties.

In one aspect, the present invention provides a method of treating a cell graft containing immune cells with an anti-CD4 antibody (the culturing is performed for 1 minute to 7 days), and b) removing the unbound antibody from the graft. And an ex vivo method of modifying a cell graft containing immune cells.

In another aspect, the invention relates to a modified cell graft containing immune cells, wherein the graft can be obtained by i) obtaining an ex vivo method of the invention and / or ii) an accessible CD4 epitope of the graft. Anti-CD4 antibody bound to 40% to 100% of the protein.

In another aspect, the present invention relates to a modified cell graft containing an immune cell of the present invention for use in medicine, in particular in a method of treating one or more diseases treatable by transplantation in a patient. will be.

In another aspect, the invention relates to a method of using an anti-CD4 antibody for ex vivo modification of a cell graft containing immune cells, wherein the modification comprises culturing the graft with the antibody for 1 minute to 7 days. It includes.

In other aspects, the invention relates to methods, uses, and grafts as defined in the claims and below. In other aspects, the invention relates to certain antibodies described herein.

The so-called additional aspects of the present invention are summarized as follows. That is, one aspect of this additional aspect of the invention relates to an anti-CD4 antibody comprising a heavy chain immunoglobulin variable region (VH) and a light chain immunoglobulin variable region (VL), wherein the immunoglobulin variable region is At least one T cell epitope located outside the CDRs is removed from said immunoglobulin variable region with, in particular, an anti-CD4 antibody as defined below. In a preferred embodiment of this further aspect of the invention, said antibody has CDRs of the antibody produced by hybrid cell line ECACC 88050502, or said antibody has CDRs of SEQ ID NO: 2 and SEQ ID NO: 12. In certain embodiments, the heavy chain immunoglobulin variable region comprises a sequence selected from the group consisting of SEQ ID NOs: 4, 6, 8, and 10, and the light chain immunoglobulin variable region is SEQ ID NOs: 14, 16, 18 And a sequence selected from the group consisting of 20. In another aspect, the further aspect of the present invention relates to a pharmaceutical composition comprising the antibody and a pharmaceutically acceptable carrier. In another aspect, the further aspect of the invention also relates to a method of using said antibody for the manufacture of a medicament for the treatment of a patient and to a method of treatment using said antibody. In another aspect, the further aspect of the invention relates to a nucleic acid encoding a heavy and / or light chain immunoglobulin variable region of said antibody, and a vector comprising said nucleic acid, in particular said nucleic acid. Is operatively linked to an expression control sequence. This further aspect of the invention also relates to a host cell comprising said nucleic acid and / or at least one vector described above, under conditions permitting expression under the control of appropriate expression control sequence (s). A method of making an antibody of the above further aspect of the present invention comprising culturing the host cell described above and purifying the antibody from the medium of the cell. This further aspect of the invention also relates to anti-CD4 antibodies, which antibodies are obtained using the expression vectors pANTVhG4 and pANTVκ. In general, the definitions, aspects, and examples described in connection with the additional aspects above also apply generally to the present invention. In this further aspect, the mode of action and specificity of the anti-CD4 antibody is preferably not affected by the modification (s).

The present invention has the effect of providing an ex vivo method of modifying a cell graft containing immune cells.

1 schematically illustrates the principle of antibody culture of a graft as well as subsequent transplantation to a subject such as a human.
FIG. 2 includes the interpretation of triple transgenic mice / TTG as donors of stable C57Bl / 6 background. TTG mice express human CD4 and HLA-DR, whereas murine CD4 molecules are knocked out. This allows for the determination of specific human surface molecules after transplantation (unique analysis of chimerism) and the direct testing of anti-CD4 antibodies in mice.
3 shows the analysis of the experimental design. Bone marrow cells and splenocytes were taken from TTG mice, mixed and transplanted in lethal doses of TTG mice with or without pretreatment with anti-human CD4 antibody. These experiments were compared using donor cells from C57Bl / 6 wild type mice. Post-transplant therapeutic effects (survival, organ repair, chimera, GvHD) were studied.
4 shows survival after transplantation of BM / splenic cells from TTG mice in Balb / c mice with or without pre-culture of anti-CD4 antibody. In mice receiving pretreated cells, survival was significantly increased (0% to 83%, p <0.001). The effect observed was specific for transplantation from TTG in Balb / c mice, as the effect could not be repeated because wild type C57Bl / 6 was used as donor. These results show a specific binding of the antibody to human CD4, whereby wild-type donor cells are not affected.
5 illustrates hematopoietic recovery after transplantation of BM / splenic cells from TTG mice in Balb / c mice with (A + C) pretreatment of anti-CD4 antibody or without (A + B) pretreatment. In mice receiving pretreated cells, the hematopoietic system returned to initial values after transplantation. Compared to receptors transplanted without precultured cells, the monocyte and granulocyte reconstitution was prior to lymphocyte reconstitution (C).
FIG. 6 shows GvHD scores (including body weight according to Cooke et al. (1996)) after transplantation of BM / splenic cells from TTG mice in Balb / c mice without or without anti-CD4 antibody. In mice receiving pretreated cells, GvHD scores in mice receiving antibodies were lower than in animals receiving bone marrow and splenocytes without pretreatment of anti-CD4 antibodies, indicating no GvHD development. Engraftment was also confirmed through immunoohistorical analysis. In the bone marrow cavity, there was a predominant form of hematopoiesis and stable engraftment of human CD4 expressing T cells in transplanted animals.
Figure 7 relates to experiments requiring the engraftment of human CD4, murine and CD4, and murine and CD8 after transplanting BM / splenic cells from TTG mice in Balb / c mice without preculture of anti-phosphorus CD4 antibodies. On day 12 post-transplantation, human CD4, murine and CD4, and murine and CD8 cells could be stably detected and mice suffer from severe GvHD.
FIG. 8 shows the transplantation of BM / splenic cells from TTG mice in Balb / c mice without pre-culture of anti-human CD4 antibody, followed by murine MHC class I and human HLA-DR3 of (H-2Kb) TTG / C57Bl / 6. It is about an experiment requiring engraftment of. On day 12 post-transplantation, MHC class I of H-2Kb TTG / C57Bl / 6 and human HLA-DR3 could be detected stably and mice suffer from severe GvHD.
FIG. 9 shows BM / splenic cell transplantation from TTG mice in Balb / c mice pre-cultured with anti-human CD4 antibody, followed by reduction of TTG / C57Bl / 6 and CD4 of (H-2Kb) and human CD4, And experiments requiring engraftment of CD4. After transplantation, stable engraftment could be observed without the occurrence of GvHD.
10 shows survival after transplantation of BM / splenocytes from TTG mice in Balb / c mice with or without pre-culture of anti-CD4 antibody. Using IgG1-isotype regulatory antibodies, no prophylactic GvHD effect could be observed.
FIG. 11 shows exemplary vectors for expressing modified light and heavy chains in mammalian cells. dhfr is a dihydrofolate reductase gene used to amplify genes by exposing cells to increasing concentrations of methotrexate, and CMV P is a CMV IE promoter.
FIG. 12 shows the DNA and amino acid sequences of exemplary modified heavy chain variable regions.
FIG. 13 shows the DNA and amino acid sequences of exemplary modified light chain variable regions.
FIG. 14 shows the relative binding of CD4-antibodies that are chimeric anti-compared to parental mouse anti-CD4 antibodies. FIG.
FIG. 15 shows the relative binding of exemplary modified anti-CD4 antibodies as compared to parental murine anti-CD4 antibodies and chimeric anti-CD4 antibodies.
FIG. 16 shows the relative binding of exemplary modified anti-CD4 antibodies as compared to parental murine anti-CD4 antibodies and chimeric anti-CD4 antibodies.

The present invention relates, for example, to ex vivo treatment of cell grafts containing immune cells with antibodies, which ex vivo treatment avoids direct in vivo application. That is, the present invention, for example, prior to transplantation of such cell grafts containing (preferably short-term) immune cells, culturing the bone marrow graft with anti-CD4 antibody is a post-transplant GvHD compared to isotype or untreated controls. Could show that it prevents the onset of disease.

In contrast to the research of the prior art, the study of the present invention, for example, for the purpose of tolerance induction or immunosuppression for preventing GhostHD, for example T cells, in particular And short term culture of grafts (stem cells), such as cell suspensions containing CD4 cells.

Without intending to be bound by theory, the inventors of the present invention provide for the anti-CD4 antibody culture of (stem cells) grafts containing CD4-positive (immune) cells and the subsequent removal of antibodies that are not bound to produce modified grafts. In consideration of this, antibody-labeled cells are either selectively inactivated by the antibody, or prepared to become inactivated or regulatory cells as soon as they encounter a particular antigen, such that GvHD does not start. Anti-CD4 antibodies are believed to bind to immune cells (such as lymphocytes) with CD4 and exert their beneficial results. It is also contemplated that preferred anti-CD4 antibodies described herein exhibit particularly advantageous characteristics, for example due to (a) binding of specific epitope (s) to produce cells for later inactivation.

As will be readily apparent to those skilled in the art, it is advantageous to substantially reduce or avoid the administration of the released anti-CD4 antibody, ie, the anti-CD4 antibody that is not bound to the antigen located in the graft. In general, the present invention provides the following advantages, i.e., i) does not require direct administration of the antibody to the receptor, and ii) of grafts such as cell suspensions, tissues, and organs containing T cells, in particular CD4 cells. Short term culture, iii) prevention of GvHD after transplantation of the graft of the invention, iv) prevention of other immunological complications (eg, cytokine free syndrome) after transplantation of the graft of the invention, v) avoidance of conventional immunosuppressive drugs Or a decrease in cost due to a significantly reduced amount of antibody compared to systemic application, vi) improved survival of patients receiving the graft of the present invention, vii) normal graft due to anticipated immunological complications. Promotion of transplantation of grafts for patients (such as older patients) that cannot be implanted, and viii) HLA mismatch for transplantation or less HLA match than without the present invention It is considered to be about one or more of the use of a combination donor.

In a first aspect, the present invention provides a method of treating a cell graft containing immune cells with an anti-CD4 antibody, wherein the culturing is performed for 1 minute to 7 days, and b) unbound antibody is removed from the graft. An ex vivo method of modifying a cell graft containing immune cells, the method comprising removing.

Antibodies and also anti CD4 antibodies are generally well known in the art. As used herein, by “antibody” is meant, in particular, an immunoglobulin-based protein capable of specifically combining, interacting with or otherwise binding to an antigen, wherein said compound, interaction of an antibody against an antigen Action, or other binding (such as binding), is coordinated by complementarity-determining regions (CDRs). Similarly, the term “antigen” is used herein to refer to a substance that can specifically combine, interact, or otherwise bind to the antibody. In the context of the anti-CD4 antibodies of the invention, the antigen is meant to be CD4, in particular human CD4.

As used herein, the term "CDR" refers to one of the "complementarity-determining regions" of an antibody, in particular one of the hypervariable regions within an immunoglobulin variable region that contributes to determining antibody specificity. CDRs are well known to those skilled in the art. Typically, both the heavy chain immunoglobulin variable region and the light chain immunoglobulin variable region contain three CDRs.

In the context of the present invention, the term "antibody" is also considered to be directed to antibody fragments, including, for example, Fv, Fab, Fab ', and F (ab') 2 fragments. Such fragments may be prepared by standard methods (eg, Coligan et al., 1991-1997, incorporated herein by reference). The present invention also contemplates several recombinant forms of antibody derived molecular species that are well known in the art. Such species are stabilized by a stabilized Fv fragment comprising a single chain Fv form (eg scFv), or an interchain disulfide bond (dsFv), comprising a peptide linker linking the VH and VL regions Fv containing additional cysteine residues designed to facilitate conjoining the VH and VL regions. Equally, other compositions are familiar in the art and may include a species, also called a “minibody,” and a single variable region “dAbs”. Other species still have multiple antigens by means of increasing the valence of the modified antibody V-region, ie, by means of dimerization regions (eg, "leucine zippers") or also by engineering chemical modification strategies. It is possible to incorporate species with binding positions. In addition, the term “antibody” may also refer to a diabody, triabody or tetrabody, tandabs, flexibody, bispecific antibodies, and chimeric antibodies. As such, it is directed to the multimers of scFv, all known in the art. As used herein, an antibody is considered to include any divalent or multivalent antibody as well. Antibodies also include any antibody derivative and any other derivative known to those skilled in the art.

In some embodiments, the antibody is a polyclonal antibody. In a preferred embodiment, the antibody is a monoclonal antibody.

According to the present invention, the term "anti-CD4 antibody" refers to an antibody having the ability to bind CD4. The anti-CD4 antibody is preferably an anti-CD4 antibody. "CD4" or "cluster of differentiation 4" refers to proteins, more precisely surface glycoproteins, which are well known to those skilled in the art (see Boers et al., 1997). In the context of the present invention, CD4 may also refer to fragments of full length CD4, or otherwise modified forms of CD4, provided that the fragments or otherwise modified forms still serve as antigens in the context of the antibodies of the present invention.

Preferred anti-CD4 antibodies include Max16H5, OKT4A, OKTcdr4a, cMT-412, YHB.46. Most preferably the antibody is Max16H5. Cells for the production of Max16H5 were deposited with ECACC (European Cell Culture Depository) under accession number ECACC 88050502. Such antibodies are also described in DE 3919294, which is incorporated herein by reference. As used herein, the antibody "Max16H5" may also be referred to as "Max.16H5", "MAX16H5" or "MAX.16H5", or "30F16H5" (where the last name also refers to the antibody. Is the name of the deposited cell). Max. 16H5 can also be obtained from the cell line MAX.16H5 / 30F16H5.

More preferred anti-CD4 antibody for use in the present invention is 16H5.chimIgG4. As used herein, the antibody may also be referred to as "16H5.chim" or "CD4.16H5.chimIgG4" (wherein the later name is also the name of the deposited cell that produces the antibody). "16H5.chimIgG4 may be obtained from cell line CD4.16H5.chimIgG4.

In particular, certain preferred anti-CD4 antibodies in the context of the present invention can be obtained, for example, from any of the following deposits of biological material:

-Deposits in European cell culture deposits with accession number ECACC 88050502,

The deposit "MAX.16H5 / 30F16H5", deposited on DSMZ 2 December 2011,

-Deposit "CD4.16H5.chimIgG4", deposited on DSMZ 2 December 2011.

All such deposits require cells or cell lines, from which specific anti-CD4 antibodies can be obtained in the context of the present invention. The deposit ECACC 88050502 is also described, for example, in application DE 3919294.

In some embodiments of the methods, modified grafts, or modified grafts for use of the invention, the anti-CD4 antibody is one or more of i) Max16H5, OKT4A, Selected from the group consisting of OKTcdr4a, cMT-412, YHB.46, in particular the anti-CD4 antibody is Max16H5 and / or ii) antibody 30F16H5 and / or iii) can be obtained from a cell line deposited with accession number ECACC 88050502 And / or iv) can be obtained from the cell line MAX.16H5 / 30F16H5 deposited in DSMZ on December 2, 2011, and / or v) is antibody 16H5.chimIgG4 and / or vi) on December 2, 2011 in DSMZ. Can be obtained from the deposited cell line CD4.16H5.chimIgG4, and / or vii) an antibody comprising the VH and VK of antibody 16H5.chimIgG4, and / or viii) the cell line CD4.16H5 deposited at DSMZ on 2 December 2011. an antibody comprising VH and VK of an antibody obtainable from .chimIgG4, and / or ix) an antibody comprising any combination of VH as depicted in FIG. 12 and VK as depicted in FIG. 13, in particular wherein the combination is VH1 / VK1, VH2 / VK2, VH4 / VK2, and VH4 / VK4, in particular the combination is VH2 / VK2.

In certain embodiments, the anti-CD4 antibody used in the present invention is "MAX.16H5". In certain embodiments, the anti-CD4 antibody used in the present invention is an antibody that can be obtained from cells of ECACC 88050502. In certain embodiments, the anti-CD4 antibody used in the present invention is an antibody that can be obtained from the deposit of biological material made by Applicants at DSMZ on December 2, 2011. In certain embodiments, the anti-CD4 antibodies used in the present invention are antibodies that can be obtained from cells deposited by Applicants at DSMZ on December 2, 2011. In certain embodiments, the anti-CD4 antibody used in the present invention is an antibody that can be obtained from a deposit of a European cell culture deposit with Accession Number ECACC 88050502. In certain embodiments, the anti-CD4 antibody used in the present invention is an antibody that can be obtained from the cell "MAX.16H5 / 30F16H5" deposited in DSMZ on December 2, 2011. In certain embodiments, the anti-CD4 antibody used in the present invention is an antibody that can be obtained from the cell "CD4.16H5.chimIgG4" deposited in DSMZ on December 2, 2011. In some embodiments, the anti CD4 antibody used in the present invention comprises the VH1 of FIG. 12. In some embodiments, the anti CD4 antibody used in the present invention comprises the VH2 of FIG. 12. In some embodiments, the anti CD4 antibody used in the present invention comprises the VH4 of FIG. 12. In some embodiments, the anti CD4 antibody used in the present invention comprises the VK1 of FIG. 13. In some embodiments, the anti CD4 antibody used in the present invention comprises VK2 of FIG. 13. In some embodiments, the anti CD4 antibody used in the present invention comprises VK4 of FIG. 13. In some embodiments, the anti CD4 antibody used in the present invention comprises SEQ ID NO: 10. In some embodiments, an anti CD4 antibody used in the present invention comprises SEQ ID NO: 8. In some embodiments, the anti CD4 antibody used in the present invention comprises SEQ ID NO: 4. In some embodiments, an anti CD4 antibody used in the present invention comprises SEQ ID NO: 20. In some embodiments, the anti CD4 antibody used in the present invention comprises SEQ ID NO: 18. In some embodiments, an anti CD4 antibody used in the present invention comprises SEQ ID NO: 14. In some embodiments, the anti-CD4 antibody used in the present invention comprises VH1 of FIG. 12 and / or VK1 of FIG. In some particularly preferred embodiments, the anti-CD4 antibody used in the present invention comprises VH2 of FIG. 12 and / or VK2 of FIG. In some embodiments, the anti-CD4 antibody used in the present invention comprises VH4 of FIG. 12 and / or VK2 of FIG. In some embodiments, the anti-CD4 antibody used in the present invention comprises VH4 of FIG. 12 and / or VK4 of FIG. In some embodiments, an anti CD4 antibody used in the present invention comprises SEQ ID NO: 10 and / or SEQ ID NO: 20. In some particularly preferred embodiments, the anti CD4 antibody used in the present invention comprises SEQ ID NO: 8 and / or SEQ ID NO: 18. In some embodiments, an anti CD4 antibody used in the present invention comprises SEQ ID NO: 4 and / or SEQ ID NO: 18. In some embodiments, an anti CD4 antibody used in the present invention comprises SEQ ID NO: 4 and / or SEQ ID NO: 14.

In some embodiments, the anti-CD4 antibody used in the present invention comprises the VH and VK of antibody 16H5. ChimIgG4. In some embodiments, the anti-CD4 antibody used in the present invention comprises the CDRs of SEQ ID NO: 2 and SEQ ID NO: 12. In another preferred embodiment, the anti-CD4 antibody for use in the present invention is an anti-CD4 antibody according to or in accordance with said further aspect of the invention described in detail below. Preferably, the anti-CD4 antibody is as described in the Examples, where preferred embodiments are particularly preferred. In general, the anti-CD4 antibody used in the present invention may be any anti-CD4 antibody described herein.

In certain preferred embodiments, the anti-CD4 antibody is selected from antibodies that recognize the first and / or second region of the CD4 molecule. In certain preferred embodiments, the anti-CD4 antibody is selected from antibodies that recognize the same region of the CD4 molecule as Max16H5.

As used herein, "unbound antibody" refers to an antibody that is not bound to the graft after the culturing step. That is, "unbound antibody" refers to an antibody that is not basically bound to its ligand in the graft.

As used herein, an "in vitro method" refers to a method performed outside a living subject. In particular, "ex vivo methods" include "ex vivo methods", as in the case of grafts that comprise or are tissues or organs, but especially "in vivo" performed inside living subjects. Method ".

Preferably, according to the invention, the culturing (step) is carried out for a time sufficient to allow binding of the antibody to the graft. Preferably, the culture comprises 40% to 100%, in particular 50% to 100%, in particular 60% to 100%, in particular 70% to 100%, more specifically 80% to 100% of the accessible CD4 epitope of the graft. At 90% to 100%, more specifically 95% to 100%, more specifically 99% to 100%, for a time sufficient to allow binding of the anti-CD4 antibody. Most preferably, after the incubation, the anti CD4 antibody binds to essentially all accessible CD4 epitopes of the graft.

Appropriate incubation periods will be readily determined by those skilled in the art. In general, the appropriate incubation period will depend on the type of graft used. The preferred incubation period will also depend on the amount of antibody used. In general, if the graft is, for example, a cell suspension, a shorter incubation period will be required than if the graft is, for example, an organ.

In general, if the graft comprises or is a tissue or organ, a longer incubation period is preferred to allow the antibody to be delivered into each compartment (eg, via diffusion).

In addition, in any case, one of skill in the art can readily test the binding (state) of anti-CD4 antibodies according to methods well known in the art, which may require, for example, flow cytometry. have.

In general, short incubation periods are preferred over long incubation periods to minimize any possible damage to the graft due to ex vivo treatment.

According to the invention, the culturing can be carried out, for example, for 1 minute to 7 days. In some embodiments, the incubation is for 1 minute to 150 minutes, in particular for 10 minutes to 150 minutes, more specifically for 30 minutes to 150 minutes, more specifically for 40 minutes to 120 minutes, more specifically for 45 minutes to For 90 minutes, in particular for 50 to 70 minutes. In another embodiment, the culturing is carried out for 150 minutes to 7 days, in particular for 150 minutes to 5 days, more specifically for 150 minutes to 3 days, more specifically for 150 minutes to 1 day, in particular for 150 minutes to 8 days Runs for hours.

With regard to the removal of unbound (anti-CD4) antibodies according to the methods and methods of use of the present invention, various methods for carrying out these steps are known to those skilled in the art. One exemplary method of removing unbound antibody from a graft is by washing the graft. Washing can occur using centrifugation, for example, if the graft comprises or is a cell suspension.

In the removal step, preferably at least 40%, more specifically at least 50%, more specifically at least 60%, more specifically at least 70%, more specifically at least 80%, more specifically at least 90% of unbound ( Anti-CD4) antibody is removed from the graft. Preferably, up to 100% of unbound (anti CD4) antibody is removed from the graft.

The amount of antibody used in the culturing step is not particularly limited. Appropriate amounts can be readily determined by one skilled in the art and can, for example, depend on the type of graft used. Preferably according to the invention, the culturing is carried out with an antibody amount of 0.1 μg to 100 mg.

In some embodiments, particularly where the graft is a cell suspension, the culture may comprise 0.1 μg / ml cell suspension to 150 μg / ml cell suspension, in particular 7 μg / ml cell suspension to 100 μg / ml cell suspension, more specifically 30 It is carried out at antibody concentrations of μg / ml cell suspensions to 100 μg / ml cell suspensions, in particular 40 μg / ml cell suspensions to 60 μg / ml cell suspensions.

In some embodiments, particularly if the graft is a tissue or the graft is an organ, the culture is 0.1 mg to 10 mg, in particular 1 mg to 10 mg, more specifically 2 mg to 9 mg, more specifically 3 mg to 8 mg, especially It is run with an antibody amount of 4 mg to 6 mg.

In some embodiments, particularly if the graft is a tissue or the graft is an organ, the culture is 0.1 mg / ml to 10 mg / ml, in particular 1 mg / ml to 10 mg / ml, more specifically 2 mg / ml to 9 mg / Ml, more specifically 3 mg / ml to 8 mg / ml, in particular 4 mg / ml to 6 mg / ml. Preferably, the specified volume includes the volume of the tissue or organ as well as the volume of the (antibody-containing) solution (the tissue or organ is cultured).

In some embodiments, particularly if the graft is a tissue or the graft is an organ, the culture is 10 μg / ml to 150 μg / ml, in particular 20 μg / ml to 100 μg / ml, more specifically 30 μg / ml to 100 μg / This is done by incubating the tissue or organ in a solution having an antibody concentration of ml, in particular 40 μg / ml to 60 μg / ml. Preferably, the specified volume includes the volume of the tissue or organ as well as the volume of the (antibody-containing) solution (the tissue or organ is cultured).

In culturing tissues and / or organs with an antibody containing solution, those skilled in the art will readily carry out such culturing as by appropriate containers.

Selection of the appropriate amount of antibody is preferably within the opinion of those skilled in the art. In general, when the graft comprises or is a tissue or organ, higher amounts or larger concentrations of antibodies are preferred respectively. In addition, each choice of the exact amount or concentration of antibody used will also depend on the size of such tissue or organ.

In a preferred embodiment, the ex vivo method or use is for reducing the likelihood of any of the group consisting of GvHD, donor graft rejection, and organ rejection, in particular, the likelihood of GvHD upon transplantation of the graft. In a preferred embodiment, the ex vivo method or use is for achieving tolerance in transplanted immunocompetent cells to tissue of the receptor upon transplantation of the modified graft. In a preferred embodiment, the ex vivo method or use is for achieving resistance or partial resistance in the tissue of the receptor to the modified graft upon implantation of the modified graft. As used herein, "partial tolerance" is the result of partial immunity in a reduced immune response. In a preferred embodiment, the ex vivo method or use is for inhibiting cell activation in the graft.

Grafts, including cell grafts containing immune cells, are well known to those skilled in the art. As used herein, a "cell graft comprising immune cells" is a graft comprising immune cells. Cell grafts comprising immune cells are not particularly limited.

In accordance with the present invention, the graft may comprise cell suspensions, tissues and / or organs. The graft is preferably a cell suspension, tissue and / or organ. The graft is more preferably selected from the group consisting of cell suspensions, tissues, and organs.

In addition, in some preferred embodiments of the invention, the graft comprises stem cells. Grafts comprising stem cells may also be referred to herein as stem cell grafts.

According to the invention, the graft comprises cells with a CD4 antigen. Preferably, the graft comprises immune cells, in particular immune cells with a CD4 antigen. Such cells are well known to those skilled in the art. In certain preferred embodiments, such immune cells are CD4-positive T lymphocytes or precursor cells thereof. In certain preferred embodiments, such immune cells include, but are not limited to, T helper cells and cells (such as monocytes and macrophages) belonging to monocytes and macrophages.

In some embodiments, the graft preferably comprises tissue, preferably tissue containing stem cells. According to the present invention, suitable tissues include, but are not limited to, blood, muscle, adipose tissue, connective tissue, epithelial tissue, embryonic tissue, and cellular tissue.

In another embodiment, the graft preferably comprises an organ, preferably an organ containing stem cells. Suitable organs include, but are not limited to, skin, intestines, kidneys, and liver. The organ is preferably an intestine.

In a preferred embodiment, the graft preferably comprises a cell suspension, preferably a cell suspension containing stem cells. Suitable cell suspensions and methods for obtaining them are well known to those skilled in the art. For example, cell suspension grafts are obtained by puncture of bone, including bone marrow, such as iliac crest or sternum, or stem cell niches throughout the body, for example , Adipose tissue, root, root, and any other source described above.

In a preferred embodiment, the cell suspension, in particular the cell suspension containing stem cells, comprises bone marrow cells, non-adherent bone marrow cells, peripheral blood cells, cord blood cells, cells of Wharton's jelly, placental induction cells, hair root induction cells. And / or adipose tissue-derived cells. In a preferred embodiment, the cell suspension, in particular the cell suspension containing stem cells, comprises lymphocytes, monocytes and / or macrophages.

In certain preferred embodiments, the graft, in particular the cell suspension, contains any bone marrow stem cells, peripheral blood stem cells, cord blood stem cells, adult stem cells of the bone marrow, such as NA-BMCs, embryonic stem cells and / or reprogrammed adult stems. Cells (ie, induced pluripotent cells).

In some specific embodiments, the graft does not consist or comprise embryonic stem cells. In some specific embodiments, the graft is not comprised or does not comprise totipotent stem cells.

In a preferred embodiment, the graft is a bone marrow suspension, in particular a bone marrow suspension comprising bone marrow stem cells. In general, grafts, especially bone marrow suspensions, contain blood cells, cord blood cells, donor lymphocytes, peripheral blood stem cells, adult stem cells of the bone marrow, embryonic stem cells and / or reprogrammed adult stem cells (ie, induced pluripotent cells). It may further include any of stem cells included in).

The graft, especially the bone marrow suspension, may further comprise any of blood cells, umbilical cord blood cells, donor lymphocytes, peripheral blood stem cells, and / or stem cells contained in adult stem cells of the bone marrow.

In general, cell suspensions are also intended to include any cell suspension comprising stem cells (any combination of), optionally together with any other cells (combination).

The graft may also be a combination of one or more of the grafts referred to above, such as a combination of grafts such as a combination of organ and cell suspension.

In a further aspect, the invention relates to a modified cell graft containing immune cells obtainable according to the extracorporeal method of the invention.

Likewise, the present invention relates to modified cell grafts containing immune cells, wherein the graft comprises anti-CD4 antibodies bound to 40% to 100% of the accessible CD4 epitope of the graft. Preferably, the modified cell graft containing immune cells comprises 50% to 100%, in particular 60% to 100%, especially 70% to 100%, more specifically 80% to 100% of the accessible CD4 epitope of the graft. Anti-CD4 antibodies bound to more specifically 90% to 100%, more specifically 95% to 100%, more specifically 99% to 100%. Most preferably, essentially all accessible CD4 epitopes of cell grafts containing immune cells are bound to anti-CD4 antibodies.

In a further aspect, the invention relates to a modified graft of the invention for use in a drug.

In a further aspect, the invention relates to a modified graft of the invention for use in a method of treating in a patient one or more diseases that can be treated by transplantation.

It is well known to those skilled in the art to use grafts comprising cell grafts containing immune cells in the transplant. The present invention provides a modified graft intended to avoid serious side effects associated with transplantation, as is known in the art. Thus, modified grafts of the invention are used as is known for unmodified grafts.

Preferably, the patient is a mammalian patient, in particular a human. Preferably, the one or more diseases that can be treated by transplantation include acute myeloid leukemia (AML); Acute lymphoid leukemia (ALL); Chronic myeloid leukemia (CML); Myelodysplastic syndrome (MDS) / myeloproliferative syndrome; Malignant lymphomas, in particular, Hodgkin's disease, high grade Non-Hodgkin Lymphoma (NHL), mantle cell lymphoma (MCL), low malignant Malignant lymphoma selected from low malign NHL, chronic lymphatic leukemia (CLL), multiple myeloma; Severe aplastic anemia; Thalassemia; Sickle cell anemia; Immunological defects, in particular severe combined immunodeficiency (SCID), Wiskott-Aldrich syndrome (WAS), and hemophagocytic lymphohistiocytosis (HLH) Immunological defects selected from; Inborn errors of metabolism, in particular, congenital metabolic disorders selected from lysosomal storage disorders and disorders of peroxisomal function; Autoimmune diseases; Rheumatoid diseases; And recidivisms of any of the above diseases.

Even more preferably, said one or more diseases include, in particular, acute myeloid leukemia (AML); Acute lymphocytic leukemia (ALL); Chronic myelogenous leukemia (CML); Myelodysplastic syndrome (MDS) / myeloproliferative syndrome; Malignant lymphomas, especially malignant lymphomas selected from Hodgkin's disease, high grade non-Hodgkin's lymphoma (NHL), mantle cell lymphoma (MCL), low malignant non-Hodgkin's lymphoma (NHL), chronic lymphocytic leukemia (CLL), multiple myeloma ; Severe aplastic anemia; Thalassemia; And one or more hematological cancers selected from sickle cell anemia.

In general, the one or more diseases also include any combination of the diseases described herein, as well as the recurrence of any of the diseases.

In the latter aspect, the graft is preferably further defined as described above in connection with the ex vivo method of the present invention. That is, the graft may be preferably selected from the group consisting of cell suspensions, tissues and organs. More preferably, the graft is a cell suspension comprising bone marrow cells, non-adherent bone marrow cells, peripheral blood cells, umbilical cord blood cells, Barton's jelly cells, placental induction cells, hair root induction cells, and / or adipose tissue induction cells. ; Cell suspensions comprising lymphocytes, monocytes and / or macrophages; Tissue containing stem cells; And organs containing stem cells.

In some embodiments, treatment means a reduced likelihood of developing any one of a group consisting of GvHD, donor graft rejection, and organ rejection, in particular, a reduced likelihood of developing GvHD upon implantation of the graft. In another embodiment, treatment means resistance within the transplanted immunocompetent cells to tissue of the receptor upon transplantation of the modified graft. In another embodiment, treatment means resistance to the modified graft upon implantation of the modified graft. In another embodiment, treatment means resistance or partial resistance in the tissue of the receptor to the modified graft upon implantation of the modified graft. In another embodiment, the treatment is for inhibiting cell activation in the graft. In a preferred embodiment, treatment means any combination of the above and / or is for any combination.

The amount of cells contained in the graft is not particularly limited. Those skilled in the art will readily be able to select the graft and the appropriate amount of cells of the graft for transplantation. In addition, suitable guidance is also available from certain guidelines for transplantation (eg, for human hematopoietic stem cells in patients) developed by, for example, "Deutsche Bundesarztekammer".

Preferably, according to the invention, in particular when the graft is a cell suspension, 2 × 10 ⁶ cells to 2 × 10 ¹⁰ cells, in particular 4 × 10 ⁶ to 1 × 10 ⁹ nucleated cells, more particularly 1 × 10 An amount of ⁷ to 1 × 10 ⁸ nucleated cells is administered to the patient, preferably a human patient.

If the graft comprises or is a tissue or organ, any suitable amount of the tissue or organ may be administered to the patient. As will be appreciated by those in the art, the number of cells in a tissue or organ is difficult to determine. In particular, for this reason, the amount of cells contained in the graft is not particularly limited. Appropriate amounts will be readily determined or selected by one skilled in the art, for example, in view of the particular type of patient, graft and / or disease to be treated. In the case of organs, administration of the entire organ is preferred.

In the methods, modified grafts, and modified grafts for use of the invention, the graft is an agent or agent which promotes the formation of soluble bioactive molecules, in particular immunosuppressive, immunoresistant and / or regulatory T cells. It can be further cultured in any combination of. Such agents reduce the likelihood of any of the groups consisting of GvHD, donor graft rejection, and organ rejection, in particular, reducing the likelihood of GvHD upon transplantation of the graft or making resistance upon transplantation of the modified graft. It is desirable to respectively support the features or advantages of the methods, uses, modified grafts of the present invention, or modified grafts for use as described above. Such agents include, in particular, cytokines. In a preferred embodiment, such agent (s) is selected from the group consisting of II-2, TGF- β , rapamycin, retinoic acid, 4-1BB ligand, and anti-CD28 antibody, or any combination thereof.

Likewise, in modified grafts for use in the present invention, the graft may be optionally administered to a patient with any drug or combination of drugs. The drug (s) may be administered prior to, with and / or after the transplant. Appropriate modes and routes of administration are not particularly limited and will be readily selected by those skilled in the art. Such drug (s) are characterized by the methods, uses, modified grafts, modified grafts for use described above, such as reducing the likelihood of any of the group consisting of GvHD, donor rejection, and organ rejection. Or it is preferable to support each of these advantages. Non-limiting examples of such drugs include rapamycin and retinoic acid.

In a further aspect, the invention features a method for treating a patient in need of such treatment with a modified graft of the invention, in particular a modified graft obtainable according to the ex vivo method of the invention. In a preferred embodiment, the graft, patient, treatment, and / or disease is as described above.

In a further aspect, the invention relates to a method of using an anti-CD4 antibody for ex vivo modification of a graft, in particular a cell graft containing immune cells, wherein the modification is performed with the antibody for 1 minute to 7 days. Culturing, and in particular, the modification further comprises removing the unbound antibody from the graft. In a preferred embodiment, the method of use is further defined as described herein for the method of the present invention.

In a further aspect, the invention relates to a method of using the modified graft of the invention for the manufacture of a medicament for the treatment of one or more diseases treatable by transplantation in a patient. In a preferred embodiment, the method of use is further defined as described herein for the method of the present invention. In particular, the graft, patient, treatment, and / or disease is preferably as described above.

In a further aspect of the methods, uses, modified grafts, or modified grafts for use of the invention, the anti-CD4 antibody is substituted with any other CD4 ligand. Preferred CD4 ligands include, but are not limited to, aptamers as well as peptide ligands (including naturally occurring peptide ligands and peptide constructs). Such CD4 ligands are known in the art.

In still further aspects, the graft referred to in the methods, uses, modified grafts, and modified grafts for use may or may not include stem cells. That is, according to the latter aspect, cell grafts containing immune cells include grafts that do not contain stem cells, as well as grafts that may be substituted with any graft and include stem cells. That is, the graft of the invention or the graft used in accordance with the invention may be any graft or cell graft containing immune cells. That is, in certain embodiments, grafts of the invention or grafts used in accordance with the invention comprise stem cells, while in other embodiments, grafts of the invention or grafts used according to the invention do not comprise stem cells. Do not. In certain embodiments, the graft does not comprise independent CD4 ⁺ cells.

As described in more detail in the Examples, the inventors have described, for example, CD4-/-C57Bl / 6 transgenic mice (triple transgenic mice, TTG; for human CD4 and HLA-DR3); (See Laub et al. (2000)). TTG mice have a fully functional murine immune system, but do not have murine CD4 instead of human CD4, and human HLA-DR3 exists in addition to murine MHC-II. In this setting, bone marrow cells can be taken into TTG grafts and cultured with anti-CD4 antibodies prior to transplantation into Balb / c wild type mice. In this full MHC class I misfit transplantation model, GvHD induction is very likely and a challenge for anti CD4 antibodies.

Engraftment of TTG / C57B16 donor cells in Balb / c mice was confirmed by flow cytometry. Stable engraftment of H-2Kd (C57Bl / 6), human CD4, HLA-DR, and a decrease in murine and CD4 after transplantation indicate complete donor (TTG) hematopoiesis and were observed for the first time 12 days after transplantation. GvHD was confirmed by survival analysis, scoring system, and histology. The severity of GvHD was greater using TTG donor cells than C57Bl / 6 wild type donor cells. Survival of GvHD mice treated with anti-CD4 antibody increased significantly from 0 to 83%. Without antibody treatment, GvHD mice died within 19-35 days. The anti-CD4 antibodies used effectively inhibit the development of GvHD following murine and HSCT in a complete MHC incompatibility model (TTG mice in Balb / c mice). This unique transplant model allows for the direct testing of anti-phosphorus CD4 antibodies in mice by the stable murine and GvHD models using TTG mice as donors. There was no induction of GvHD after CD4 pretreatment, an anti- bone marrow graft in TTG mice. Such findings are considered appropriate to improve strategies for inhibiting reactive T cell clones.

In a still further aspect, the present invention provides a combination of i) antibody 16H5.chimIgG4, ii) an antibody obtainable from cell line CD4.16H5.chimIgG4 deposited in DSZM on Dec. 2, 2011, iii) a VH of antibody 16H5.chimIgG4; An antibody comprising VK, iv) an antibody comprising VH and VK of an antibody obtainable from cell line CD4.16H5.chimIgG4 deposited in DSMZ on December 2, 2011, v) VH described in FIG. 12 and in FIG. 13. An antibody comprising a combination of the described VKs, wherein the combination is selected from VH1 / VK1, VH2 / VK2, VH4 / VK2, and VH4 / VK4, in particular, the combination selected from the group consisting of antibodies, wherein the combination is VH2 / VK2 It relates to a CD4 antibody.

In certain embodiments of this even further aspect, the anti-CD4 antibody of the invention is "MAX.16H5". In certain embodiments, the anti-CD4 antibody used in the present invention is an antibody that can be obtained from the deposit of biological material made by Applicants at DSMZ on December 2, 2011. In certain embodiments, the anti-CD4 antibodies of the invention are antibodies that can be obtained from cells deposited by Applicants at DSMZ on December 2, 2011. In certain embodiments, the anti-CD4 antibodies of the invention are antibodies that can be obtained from the cell "MAX.16H5 / 30F16H5" deposited in DSMZ on December 2, 2011. In certain embodiments, the anti-CD4 antibody of the invention is an antibody that can be obtained from the cell "CD4.16H5.chimIgG4" deposited in DSMZ on December 2, 2011. In some embodiments, anti-CD4 antibodies of the invention comprise the VH1 of FIG. 12. In some embodiments, anti-CD4 antibodies of the invention comprise the VH2 of FIG. 12. In some embodiments, anti-CD4 antibodies of the invention comprise the VH4 of FIG. 12. In some embodiments, anti-CD4 antibodies of the invention comprise VK1 of FIG. 13. In some embodiments, anti-CD4 antibodies of the invention comprise VK2 of FIG. In some embodiments, anti-CD4 antibodies of the invention comprise VK4 of FIG. 13. In some embodiments, anti-CD4 antibodies of the invention comprise SEQ ID NO: 10. In some embodiments, anti-CD4 antibodies of the invention comprise SEQ ID NO: 8. In some embodiments, anti-CD4 antibodies of the invention comprise SEQ ID NO: 4. In some embodiments, anti-CD4 antibodies of the invention comprise SEQ ID NO: 20. In some embodiments, anti-CD4 antibodies of the invention comprise SEQ ID NO: 18. In some embodiments, anti-CD4 antibodies of the invention comprise SEQ ID NO: 14. In some embodiments, anti-CD4 antibodies of the invention comprise VH1 of FIG. 12 and / or VK1 of FIG. In some particularly preferred embodiments, the anti-CD4 antibodies of the invention comprise VH2 of FIG. 12 and / or VK2 of FIG. In some embodiments, anti-CD4 antibodies of the invention comprise VH4 of FIG. 12 and / or VK2 of FIG. In some embodiments, anti-CD4 antibodies of the invention comprise VH4 of FIG. 12 and / or VK4 of FIG. In some embodiments, anti-CD4 antibodies of the invention comprise SEQ ID NO: 10 and / or SEQ ID NO: 20. In some particularly preferred embodiments, the anti-CD4 antibodies of the invention comprise SEQ ID NO: 8 and / or SEQ ID NO: 18. In some embodiments, anti-CD4 antibodies of the invention comprise SEQ ID NO: 4 and / or SEQ ID NO: 18. In some embodiments, anti-CD4 antibodies of the invention comprise SEQ ID NO: 4 and / or SEQ ID NO: 14. In some embodiments, anti-CD4 antibodies of the invention comprise the VH and VK of antibody 16H5. ChimIgG4.

In general, the invention also relates to embodiments, in which the terms "comprise" or equivalent thereof are replaced with "have" or equivalent terms. For example, the present invention also generally relates to embodiments, in which the terms "comprising" or equivalent thereof are replaced with "having" or equivalent terms.

In the following, further aspects of the invention are described in detail.

In one aspect, the additional aspect of the invention relates to an anti-CD4 antibody comprising a heavy chain immunoglobulin variable region (VH) and a light chain immunoglobulin variable region (VL), wherein the CDRs of the immunoglobulin variable region are At least one T cell epitope located is removed from the immunoglobulin variable region.

Such antibodies are less immune than their parental antibodies and therefore less likely to stimulate or activate T cells, and thus less likely to cause unwanted T cell mediated immune responses to the antibody, eg in human patients.

In addition, it is advantageous for the antibody to substantially maintain the ability of the corresponding unmodified antibody to bind human CD4 antibodies, preferably further retaining at least one of their advantageous features.

As used in this additional aspect of the invention, by “antibody” is meant, in particular, an immunoglobulin-based protein capable of combining, interacting, or otherwise binding with an antigen.

In the context of this additional aspect of the invention, the term "antibody" is preferably also considered to be directed to an antibody fragment comprising, for example, Fv, Fab, Fab ', and F (ab') 2 fragments. . Such fragments can be prepared by standard methods. It is preferred that this further aspect of the invention also contemplates several recombinant forms of antibody derived molecular species that are well known in the art. Such species are stabilized by interchain disulfide bonds (dsFv) or stabilized Fv fragments comprising a single chain Fv form (eg, scFv) comprising a peptide linker linking the VH and VL regions, Fv containing additional cysteine residues designed to facilitate binding of the region. Equally, other compositions are familiar in the art and may include a species, also referred to as a “small body,” and a single variable region “dAbs”. The other species still has multiple antigen binding sites by means of increasing the valence of the modified antibody V-region, ie, by means of dimerization regions (eg, "leucine zippers") or also by engineering chemical modification strategies. Having species can be incorporated. In addition, the term “antibody” also relates to multimers of scFv, such as duplexes, triplets or tetramers, tandappes, flexibles, bispecific antibodies, and chimeric antibodies. According to this further aspect of the invention, the term “anti-injecting CD4-antibody” preferably refers to an antibody having the ability to bind to human CD4, as described above. In addition, as used in this additional aspect of the invention, the term "unmodified antibody" or "parent antibody" preferably refers to an anti-CD4-antibody, as opposed to the antibody of the additional aspect of the invention, T cell epitopes located outside the CDRs of the immunoglobulin variable region are not removed from the immunoglobulin variable region. The term “antigen” is preferably used in this additional aspect of the invention to refer to a substance that can interact with the antibody. In the context of the antibodies of this additional aspect of the invention, the antigen is preferably meant to be CD4, in particular human CD4. "CD4" or "cluster of differentiation 4" refers to proteins, more precisely surface glycoproteins, which are well known to those skilled in the art. In the context of the present invention, CD4 also refers to fragments of full-length CD4, or otherwise modified forms of CD4, provided that the fragments or otherwise modified forms still serve as antigens in the context of the antibodies of this additional aspect of the invention. It may be desirable to indicate. The term "immunoglobulin region" is preferably used in this additional aspect of the invention to refer to a protein region, in particular, comprising an immunoglobulin fold. Immunoglobulin regions and proteins are well known in the art. The term "VH" is preferably used in this additional aspect of the invention to refer to the heavy chain variable region of the heavy chain of an antibody. The "heavy chain variable region" is also called the "heavy chain immunoglobulin variable region." Such terms are also well known in the art. The term "VL" is preferably used in this additional aspect of the invention to refer to the light chain variable region of the light chain of the antibody. "Light chain variable regions" are also called "light chain immunoglobulin variable regions." Such terms are also well known in the art.

The heavy chain immunoglobulin variable region and the light chain immunoglobulin variable region preferably together provide a binding surface capable of interacting with the antigen.

As used in this additional aspect of the invention, the VH is about 110-125 amino acid residues in length, and the sequence is the VH chain specified in this further aspect of the invention capable of binding the CD4 antigen jointly with the VL. It is preferable to mean a polypeptide corresponding to any of the above. Similarly, a VL is a polypeptide of about 95 to 130 amino acid residues in length, the sequence of which corresponds to any of the VL chains specified in this additional aspect of the invention capable of binding a CD4 antigen jointly with VH. It is preferable to mean.

The full length immunoglobulin heavy chain preferably has a molecular weight of about 50 to 70 kDa, and generally is a region gene encoded by the VH gene at the N-terminus and constant at the C-terminus (eg [gamma], [ Alpha] or [epsilon]). Similarly, the full length light chain preferably has a molecular weight of about 25 kDa and is generally encoded by the V region gene at the N-terminus and by the [kappa] or [lambda] constant region gene at the C-terminus. Encrypted.

The light chain of the antibody may be a "lambda" ("λ") type chain or a "kappa" ("κ") type chain. Thus, the light chain variable region may be a “lambda” (“Vl”, “Vλ”) type light chain variable region or a “kappa” (“Vk”, “Vκ”) type light chain variable region.

In common with many monoclonal antibodies, the light chain is preferably a "kappa" ("κ") type chain. Thus, VL is preferably a Vk ("VK", "Vκ") type chain.

In the context of this additional aspect of the invention, many different heavy chain immunoglobulin variable region sequences and light chain immunoglobulin variable region sequences are provided. This specification does not limit the possible combinations of such variable region sequences that may be included in a complete antibody molecule.

The antibody of the further aspect of the present invention preferably comprises two identical heavy chain immunoglobulin variable regions and two identical light chain immunoglobulin variable regions, wherein the heavy chain immunoglobulin variable region and the light chain immunoglobulin variable region are It is selected from the variable region described in the above additional aspect of.

According to this further aspect of the invention, the term "T cell epitope" preferably denotes a peptide sequence having the ability to bind an MHC molecule, preferably an MHC class II molecule. Such sequences may, in complex with MHC class II, stimulate T cells and / or bind (but not necessarily activate) T cells.

Preferably, the term “T cell epitope” may be recognized by the T cell receptor (TCR) when bound to an MHC class II molecule and, at least in principle, binds to and responds to the TCR to promote a T cell response. The peptide sequence capable of stimulating or activating T cells.

To identify the T cell epitopes of the antibodies, any in silico method or ex vivo method known to the person skilled in the art and / or described herein or incorporated by reference can be used.

Preferably, the T cell epitope consists of at least 8 amino acids, more preferably 8 to 20 amino acids, more preferably 8 to 11 amino acids, particularly preferably 9 amino acids.

The term "peptide" as used in this additional aspect of the invention is preferably a compound comprising two or more amino acids linked by peptide bonds. Some peptides may contain only a few amino acid units. In the art, short peptides, eg, peptides having less than 10 amino acid units, are sometimes referred to as "oligopeptides", while higher number of amino acid residues, such as 10 to 100 or 100 Peptides containing the above are generally called "polypeptides".

Throughout this further aspect of the invention, it is preferred that the T cell epitope be described as removed when the T cell mediated immune response based on said epitope to the antibody is reduced, or preferably disappeared.

Preferably, the T cell mediated immune response to the antibody is reduced (preferably eliminated) when the potential of the T cell epitope that binds the MHC molecule, preferably the MHC class II molecule, is reduced (preferably eliminated). .

According to the exemplary method described in Example 2, the modified T cell epitopes can be tested in silico for MHC class II allele binding. In this method, T cell epitopes are predicted that fewer MHC class II alleles bind to modified T cell epitopes or that MHC class II alleles do not bind to modified T cell epitopes (see Example 2). ), Is considered "removed."

Other methods of measuring the reduction or elimination of T cell mediated immune responses are well known to those of skill in the art, for example, in vivo using either purified MHC class II molecules or homozygous immortalized B cell lines. Extra MHC class II binding assays, or ex vivo T cell proliferation assays.

Removal of T cell epitopes can result in reduced, preferably lacking, immunogenicity indicated by the antibody. The term “immunogenic” refers to the ability to induce, induce or otherwise promote a humoral or T cell mediated response, particularly in a host animal (especially when the host animal is a human) and / or in response to an appropriate in vitro assay. It's about the ability to elicit it. For example, immunogenicity is described as decreased when compared to the corresponding parent antibody, eg, an unmodified encroachment or chimeric (erosional V-region; constant region of human) monoclonal antibody.

As used in this additional aspect of the invention, the term "CDR" refers to one of the "complementarity-determining regions" of an antibody, in particular one of the hypervariable regions within an immunoglobulin variable region that contributes to determining antibody specificity. desirable. CDRs are well known to those skilled in the art. Typically, both the heavy chain immunoglobulin variable region and the light chain immunoglobulin variable region contain three CDRs.

CDRs in immunoglobulin variable regions can be identified and defined, for example, according to methods developed by Kabat, which are well known to those skilled in the art. According to a preferred embodiment of this additional aspect of the invention, CDRs are defined according to Kabat (Kabat et al. (1991)).

As used in this further aspect of the invention, removal of a T cell epitope is located outside the CDRs of the immunoglobulin variable region unless the sequence of the T cell epitope to be removed does not overlap any CDRs of the immunoglobulin variable region. It is preferred that the " In addition, the removed T cell epitope overlaps with any CDRs of the immunoglobulin variable region, although the sequence of the T cell epitope to be removed is made outside all CDRs of the immunoglobulin variable region, It is also described as "located outside the CDRs of an immunoglobulin variable region."

The CD4-antibody, which is an anti-topper of this additional aspect of the invention, may be a polyclonal antibody or a monoclonal antibody. Preferably the antibody is a monoclonal antibody.

According to a preferred embodiment, the antibody is obtained from a monoclonal antibody produced by hybrid cell line ECACC 88050502.

The antibody produced by the hybrid cell line ECACC 88050502 is a CD4 antibody, and more specifically, a CD4-antibody which is a monoclonal murine antibody, also called 30F16H5, for example described in DE 3919294. The antibody can be obtained from a hybrid cell line deposited with ECACC (accession number 88050502).

Antibodies of this additional aspect of the invention, if obtained by any suitable method known to those of skill in the art, using the sequence of monoclonal antibody produced by hybrid cell line ECACC 88050502, or using hybrid cell line ECACC 88050502, It is described to be "derived" from a monoclonal antibody produced by ECACC 88050502.

The antibody preferably has the CDRs of the antibody produced by the hybrid cell line ECACC 88050502, or the antibody has the CDRs of SEQ ID NO: 2 and SEQ ID NO: 12.

The CDRs of SEQ ID NO: 2 and SEQ ID NO: 12 have sequences highlighted in italics in FIGS. 12 (a) and 13 (a), which depict the preferred immunoglobulin variable region sequences of parental CD4-antibody 30F16H5 ( SEQ ID NO: 2 and SEQ ID NO: 12) are shown. Three CDRs are shown in each of FIGS. 12 (a) and 13 (a). Here, the CDRs of FIG. 12 (a) are formed by amino acids 31-35, 50-66, and 99-109 of SEQ ID NO: 2, and the CDRs of FIG. 13 (a) are amino acids of SEQ ID NO: 12 Formed by 24-33, 50-55, and 88-96.

Antibodies produced by the hybrid cell line ECACC 88050502, or antibodies with CDRs of SEQ ID NO: 2 and SEQ ID NO: 12, bind affinity to human CD4 with an affinity comparable to that of parental antibody 30F16H5. Has a high potential.

In another preferred embodiment of the antibody of the above further aspect, except for the difference due to the removal of one or more T cell epitopes from the immunoglobulin variable region, the heavy chain immunoglobulin variable region is an antibody produced by the hybrid cell line ECACC 88050502. Wherein the light chain immunoglobulin variable region is identical to SEQ ID NO: 2 or the light chain immunoglobulin variable region is identical to the light chain immunoglobulin variable region of the antibody produced by the hybrid cell line ECACC 88050502, or SEQ ID NO Contains the same sequence as 12:

As described in Example 2b, the present inventors have discovered and described the T cell epitopes of the parental anti-CD4 antibody 30F16H5, the regions of which are shown, for example, in Tables 5 and 6 below.

Such T cell epitopes, called EH1 to EH10 (“T cell e pitope of h eavy chain variable region” 1 to 10) in this additional aspect of the invention, are shown separately in Table 5 (SEQ ID NOs: 21-30), T cell epitopes known in the further aspect of the present invention as EL1 to EL11 EH10 ( "T cell e pitope of l ight chain variable region" 1 to 11) are each shown in Table 6 (SEQ ID NOs: 31-41) . Each of these T cell epitopes can also be described based on their position in the sequences of their respective parent variable regions SEQ ID NO: 2 and SEQ ID NO: 12.

Thus, in a preferred embodiment of this further aspect of the invention, at least one T cell epitope is selected from positions 4-12 (EH1) of SEQ ID NO: 2, positions 10-18 (EH2) of SEQ ID NO: 2, Positions 11 to 19 (EH3) of SEQ ID NO: 2, positions 20 to 28 (EH4) of SEQ ID NO: 2, positions 37 to 45 (EH5) of SEQ ID NO: 2, position 70 of SEQ ID NO: 2 To 78 (EH6), positions 73 to 81 (EH7) of SEQ ID NO: 2, positions 83 to 91 (EH8) of SEQ ID NO: 2, positions 107 to 115 (EH9) of SEQ ID NO: 2, SEQ ID T cell epitopes of the heavy chain immunoglobulin variable region at positions 110-118 (EH10) of NO: 2, positions 2-10 (EL1) of SEQ ID NO: 12, positions 3-11 (EL2) of SEQ ID NO: 12 , Positions 10 to 18 (EL3) of SEQ ID NO: 12, positions 11 to 19 (EL4) of SEQ ID NO: 12, positions 45 to 53 (EL5) of SEQ ID NO: 12, positions of SEQ ID NO: 12 53 to 61 (EL6), positions 59 to 67 (EL7) of SEQ ID NO: 12, positions 61 to 69 (EL8) of SEQ ID NO: 12, SEQ ID NO: 12 From the group consisting of T cell epitopes of the light chain immunoglobulin variable region at positions 62 to 70 (EL9), positions 70 to 78 (EL10) of SEQ ID NO: 12, and positions 97 to 105 (EL11) of SEQ ID NO: 12 Is selected.

In certain circumstances, additional regions of sequence for those described in this additional aspect of the invention may be immune epitopes, for example when infected with a pathogen expressing a protein or peptide having a sequence similar to that of the present invention. It is understood that.

According to a preferred embodiment of this further aspect of the invention, at least one T cell epitope is removed by a change of at least one amino acid residue.

In particular, as used in this additional aspect of the invention, the “alteration” or “modification” of at least one amino acid residue may preferably be any of the following.

Substitution of at least one originally existing amino acid residue by another amino acid residue,

Addition of at least one amino acid residue,

Deletion of at least one originally existing amino acid residue,

Chemical modification of at least one amino acid residue,

Or a combination thereof.

Criteria for the term “change” of at least one amino acid residue are, if necessary, generally in the T cell epitope where the additional change (s) are identical or by the substitution, addition or deletion of specific amino acid (s) or of an antibody molecule. Also included are situations that occur elsewhere to substantially maintain the ability of the corresponding unmodified antibody to bind human CD4. More specifically, such additional change (s) may occur to further maintain one or more of the advantageous features of the antibody.

Preferably, the one or more changes occur at one or more residues from any or all of EH1 to EH10 and / or EL1 to EL11, preferably from any or all of EH1 to EH10 and EL1 to EL11.

It is particularly preferred that the change (s) occur at one or more amino acids commonly designated as “pocket residues,” since such changes are associated with the pocket of the MHC binding groove. As will be appreciated by those skilled in the art, the pocket residues constitute residues that are particularly involved in immunogenicity and, therefore, are more likely to reduce or, preferably, eliminate T cell mediated immune responses to antibodies. In general, it is particularly desirable to provide modified antibody molecules in which amino acid changes are performed within the most immune domain of the parent antibody.

However, amino acid changes, alone or in a single epitope, within a given epitope, can be performed at the same position as the pocket residue for the MHC class II binding groove, as well as at any point in the peptide sequence. All such changes fall within the scope of this additional aspect of the invention.

In addition, as will be apparent to those skilled in the art, alternative sets of multiple changes may be made that result in the removal of epitopes. However, the resulting sequence will remain broadly corresponding to the particular composition described in this additional aspect of the invention and, therefore, will fall within the scope of the invention. It will be common to reach at least about 70%, or at least about 90%, or at least about 95%, or at least about 99% of the corresponding sequences with the specified sequences of the invention in the minimum corresponding region and remain operationally identical. Such sequences will equally be within the scope of this invention.

Preferably, the change in at least one amino acid residue is a substitution of one or more amino acids.

Thus, in a preferred embodiment of the antibody of this additional aspect of the invention, at least one amino acid within at least one T cell epitope is substituted with another amino acid to remove at least one T cell epitope.

It is understood that a single amino acid substitution within a given T cell epitope is the preferred route by which the epitope can be removed. In addition, the combination of substitutions within a single epitope can be completed, and can be particularly suitable when, for example, individually defined epitopes overlap each other.

In various embodiments, in the heavy and / or light chain, two or more amino acid substitutions, or three or more amino acid substitutions, or four or more amino acid substitutions, or five or more amino acid substitutions, or six or more amino acid substitutions, or seven or more At least 8 amino acids, or at least 9, or at least 10, or at least 11, or at least 12 amino acid substitutions occur. In some embodiments, in the heavy and light chains, 1 to 21, 5 to 20, or 7 to 14 amino acid substitutions occur.

In each of the aforementioned T cell epitopes EH1 to EH10 and EL1 to EL11, if at least one substitution is present and the antibody maintains its ability to bind human CD4, 0, 1, 2, 3, 4, 5, 6, There may be 7, 8, or 9 substitutions.

The number of substitutions is preferably selected such that the number of MHC II alleles that bind or predict to bind, respectively, is greatly reduced. Preferably, the number is at least 50%, more preferably 40%, more preferably 30%, more preferably 20%, more preferred compared to the number of alleles bound when no substitution is present Preferably 10%, more preferably 5%, more preferably 2%, more preferably 1% and most preferably 0%.

As illustrated in Example 2b, in a particular assay, “the number of bound MHC II alleles” is the number of MHC II alleles in a given panel of MHC class II alleles examined in the assay (eg, , 34 MHC class II alleles), which were found to be binding peptides to the T cell epitope at issue. This number is described as "reduced" if the number decreases for the modified T cell epitope compared to the unmodified T cell epitope of the parent antibody.

As described herein, several modified terms, CD4-antibodies, with one or more T cell epitopes removed, were generated by MHC class II epitope removal requiring amino acid substitutions. Examples of particularly useful substitutions in this respect are provided in FIGS. 12 and 13 showing particular individual substitutions, ie, individual substitutions highlighted in FIGS. 12 (e) and 13 (e), wherein the particular individual substitutions are SEQ ID NO. : 2 {see FIG. 12 (a)} or SEQ ID NO: 12 {see FIG. 13 (a)}, respectively. Such substitutions are also described in Table 5 (relative to heavy chain immunoglobulin regions) and Table 6 (relative to light chain immunoglobulin regions).

Thus, according to a preferred embodiment of this further aspect of the invention, the at least one substitution is at T9S, V10E, A12K, Q19K, S28T, K38R, R40A, L70I, A72R, V73D, S91T, T115L in SEQ ID NO: , L116V, and SEQ ID NO: 12 are selected from the group consisting of I10T, M11L, L46A, V59S, I62S, S69D, R76S, L105I.

In a particularly preferred embodiment, 0, 1, 2, or 3 substitutions are in EH1 and EH6, respectively, 0, 1 or 2 substitutions are in EH12, EH5, and EH10, respectively, and 0 or 1 substitutions are in EH3, EH4, EH7 , EH8, and EH9 are respectively within 0, 1 or 2 substitutions are in EL2, EL3, EL7, EL8, and EL9 respectively, and 0 or 1 substitutions are in EL1, EL4, EL5, EL6, EL10, and EL11 respectively. Provided that at least one substitution is present.

According to an embodiment of this additional aspect of the invention, 6, 8, or 10 T cell epitopes are removed from the heavy chain immunoglobulin variable region and / or 5, 9, 10, or 11 T cell epitopes are added to the above addition of the invention. The light chain immunoglobulin variable region of the antibody of the aspect is removed.

More specifically, 6, 8, or 10 T cell epitopes are removed from the heavy chain immunoglobulin variable regions, and 5, 9, 10, or 11 T cell epitopes are removed from the light chain immunoglobulin variable regions of the antibodies of this additional aspect of the invention. Removed.

According to one embodiment, all T cell epitopes are removed from immunoglobulin variable regions.

Furthermore, according to this further aspect of the invention, an exemplary substitution group was made in an immunoglobulin variable region, which group is set forth in SEQ ID NOs: 4, 6, 8, and 10 {FIGS. 12 (b)-(e). And SEQ ID NOs: 14, 16, 18, and 20 (shown in FIGS. 13 (b)-(e)).

Accordingly, a further preferred embodiment of this further aspect of the invention is an anti-CD4-antibody wherein the heavy chain immunoglobulin variable region comprises and / or comprises a sequence selected from the group consisting of SEQ ID NOs: 4, 6, 8, and 10 The light chain immunoglobulin variable region comprises a sequence selected from the group consisting of SEQ ID NOs: 14, 16, 18, and 20.

More preferably, the heavy chain variable region comprises a sequence selected from the group consisting of SEQ ID NOs: 4, 6, 8, and 10, and the light chain variable region is from the group consisting of SEQ ID NOs: 14, 16, 18, and 20 Contains the selected sequence.

Even more preferably, the heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 4, the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 14, and the heavy chain immunoglobulin variable region is the SEQ ID NO The light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 20, the heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 6, and the light chain immunoglobulin variable region Comprises the same sequence as SEQ ID NO: 14, the heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 6, the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 16, the heavy chain The immunoglobulin variable region comprises the same sequence as SEQ ID NO: 6, the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 20, and the heavy chain immunoglobulin variable zero. Comprises a sequence identical to SEQ ID NO: 8, the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 16, the heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 8, a light chain The immunoglobulin variable region comprises the same sequence as SEQ ID NO: 20, the heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 10, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 14 Wherein the heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 10, the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 16, or the heavy chain immunoglobulin variable region is the SEQ ID NO : 10 and a light chain immunoglobulin variable region comprising the same sequence as SEQ ID NO: 20.

As can be appreciated from Example 2, antibodies comprising such specific variable region sequence combinations exhibit advantageous features, particularly with regard to their binding affinity for CD4 antibodies.

Particularly preferably, the heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 4, the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 14, and the heavy chain immunoglobulin variable region is SEQ ID NO: Wherein the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 16, the heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 10, and the light chain immunoglobulin variable region is Wherein the heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 10, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 20.

As shown in Example 2c described herein, the antibodies according to this example exhibited binding to human CD4, which binding was enhanced compared to the parental monoclonal anti CD4-antibody 30F16H5 used as reference.

In general, as indicated above, the modified antibodies of the invention exhibit the ability to bind human CD4. As used in this further aspect of the invention, the antibody has an affinity for its target antigen CD4, at least 5%, more preferably at least 10, of the affinity indicated by the unmodified monoclonal anti CD4-antibody. %, More preferably at least 20%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, More preferably at least 90%, more preferably at least 100%, is preferably described as "substantially maintaining" its ability to bind human CD4.

Various methods for measuring the affinity of an antibody are well known to those skilled in the art. Suitable methods include measuring affinity through competitive ELISA, or assays using Scatchard analysis or Biacore (Perkin Elma) or similar instruments as described in Example 2c herein. Include.

In a preferred embodiment of this additional aspect of the invention, the affinity for the target antigen CD4 is within orders of magnitude greater or less than the affinity indicated by the parental anti-CD4 monoclonal antibody.

For example, the binding affinity of the antibody of this additional aspect of the invention for CD4 is preferably within one digit larger or smaller than the binding affinity of the antibody produced by the hybrid cell line ECACC 88050502.

More preferably, the binding affinity is twice or greater than the binding affinity of the antibody produced by the hybrid cell line ECACC 88050502.

According to a particularly preferred embodiment, the antibody has a greater binding affinity than the antibody produced by the hybrid cell line ECACC 88050502.

Preferably, the modified antibody described in this further aspect of the invention also retains at least one, most preferably all functional activity of the parental CD4-antibody. Thus, embodiments of this additional aspect of the invention exhibit one or more of the advantageous technical features associated with the therapeutic efficacy of the unmodified parent antibody, most preferably all technical features, while the antibody binds to the MHC class II molecule. Modified antibodies that have a reduced ability and / or induce a weaker immune response in the patient or do not induce an immune response at all.

Preferably, the anti-CD4-antibody heavy chain comprises a human IgG4 region domain and the light chain further comprises a human kappa constant region. Thus, in another preferred embodiment, the heavy chain variable region of the antibody of said further aspect of the invention is linked to a region of human IgG4 constant region, and the light chain variable region of the antibody of said further aspect of the invention is a region of human kappa constant region. Is connected to. IgG4 has a low tendency to stimulate effector functions such as ADCC (antibody-dependent cell mediated cytotoxicity) and CDC (complementary induced cell death), thus resulting in a pro-inflammatory response in patients. I can't stimulate it.

In certain embodiments, the anti-CD4-antibody comprises a region of human IgG4 constant region adjacent to a heavy chain variable region sequence selected from SEQ ID NOs: 4, 6, 8, and 10, and SEQ ID NOs: 14, 16, 18, and And further comprises a kappa constant region portion of human adjacent to the light chain variable region sequence selected from 20.

As mentioned above, such exemplary sequences for each of the heavy and light chain variable regions are preferred variable region sequences.

According to another aspect of this additional aspect of the invention, the antibody of the further aspect of the invention is obtained using the expression vectors pANTVhG4 and pANTVκ.

As a non-limiting example, antibodies of this additional aspect of the invention can be obtained using the expression vectors pANTVhG4 and pANTVκ as described in Example 2. In addition, any other suitable method (s) well known to those skilled in the art can be used, wherein the modified antibody is constructed based on specific antibody sequences such as those contained in the expression vectors pANTVhG4 and pANTVκ.

In another aspect, the further aspect of the present invention relates to a method of preparing a CD4-antibody, which is a term of said additional aspect of the invention, comprising the following steps:

(i) providing an amino acid sequence of an antibody that can be derived from a hybrid cell line ECACC 88050502 or a portion thereof,

(ii) identifying one or more T cell epitopes within the amino acid sequence of the antibody or portion thereof by any method comprising determining the binding of the peptide to the MHC molecule using ex vivo or in silico technology or biological analysis. To do that,

(iii) a new sequence variant with one or more amino acids in the identified T cell epitope that has been modified in a manner that substantially reduces or eliminates binding of the peptide to the MHC molecule measured in vitro or in silico technology or biological assay ( designing the variant,

(iv) testing said sequence variant to identify one or more sequence variants constructed by recombinant DNA techniques and having the properties of a CD4-antibody, which is an aspect of this additional aspect of the invention.

Identification of T cell epitopes according to step (ii) can be carried out according to methods previously described in the art. Suitable methods are described, for example, in WO 98/59244; WO 00/34317; US Application 20030153043, all of which are incorporated herein by reference. In the method described above, the sequence variant, unless such new T cell epitope is modified in such a way as to substantially reduce or eliminate the binding of the peptide to the MHC class II molecule, results in a new T cell epitope by the sequence variant. It is preferably produced in such a way as to prevent production. Indeed, when carrying out changes to the protein sequence, it is desirable to retest the considered sequences for the presence of epitopes and / or MHC class II ligands by any suitable means so that the considered changes are prevented from introducing new immune epitopes. Do.

In various embodiments, the modified antibodies of this additional aspect of the invention are produced by expression of different combinations of the VH and VL genes specified in said further aspect of the invention. All such combinations of heavy and light chains are covered by this additional aspect of the invention.

In general, the construction of complete antibody molecules can be accomplished by recombinant DNA techniques and methods for purifying and handling antibody molecules that are well known in the art. The required technique is fully described in the specification literature well known to those skilled in the art.

Preferred molecules of this additional aspect of the invention can be prepared in any of a variety of ways, but most preferably can be carried out using general recombinant methods. It is a relatively easy procedure to use the protein sequences and information provided in this additional aspect of the present invention to infer polynucleotides (DNAs) encoding any of the preferred antibody V-regions. This can be done, for example, using computer software tools such as the DNAstar software bundle (DNAstar Inc., Madison, Wisconsin, USA) or aborted. Any such DNA sequence with the ability to encode a preferred polypeptide of the invention or its equivalent should be considered an embodiment of this additional aspect of the invention.

In a general scheme, any VH or VL chain gene can be prepared using gene synthesis and cloned into the appropriate expression vector. Again, expression vectors are introduced and cultured into host cells and selected cells. Antibody molecules are readily purified from the medium and prepared in preparations suitable for therapeutic administration.

By way of non-limiting example, one such scheme involves the gene synthesis process using a panel of synthetic oligonucleotides. Genes are assembled using a ligase chain reaction (LCR), where oligonucleotides characterized by complementary ends are annealed and then polymerase chain reaction (PCR) Amplification and fill-in occur. PCR is run to act as a primer by the addition of increased concentrations of flanking oligonucleotides. PCR products are assembled into full length antibody genes by additional PCR from vectors containing 5 'and 3' immunoglobulin gene flanking regions and subcloned into expression vectors for expression of the complete antibody. The assembled VH and VL genes can serve as templates for mutagenesis and for the construction of multivariate antibody sequences such as any of those described in this additional aspect of the invention. While other methodologies and systems can be readily applied, it is particularly convenient to use the strategy of "overlapping extended PCR" as described by Higuchi et al. (1998).

The full length immunoglobulin gene containing the variable region cassette is most conveniently assembled using overlapping PCR and subcloned into an expression vector containing the desired immunoglobulin region domain. Expression vectors can be introduced into mammals or other host cells using, for example, electroporation techniques. The NS0 cell line is a non-immunoglobulin producing rat myeloma obtained from the European Animal Cell Culture Depository (ECACC) and is an example host cell line that is particularly suitable for this procedure. Cell lines that secrete antibodies are expanded and antibodies can be readily purified using, for example, Protein A affinity chromatography {Harlow E & Lane D (2006)}. The concentration of purified antibody can be determined using an enzyme linked immunosorbent assay (ELISA) to detect human kappa constant regions of the antibody.

As far as said further aspect of the invention relates to a modified anti-CD4 antibody, compositions and related compositions containing such modified antibody or fragments of the modified antibody are also considered to be within the scope of the present invention.

Accordingly, this further aspect of the present invention also relates to a pharmaceutical composition comprising a CD4-antibody, which is an aspect of said further aspect of the invention, and a pharmaceutically acceptable carrier.

The therapeutic composition of the CD4-antibody, which is an aspect of this additional aspect of the present invention, may be used with a pharmaceutically acceptable excipient. Pharmaceutical compositions according to this additional aspect of the present invention are prepared by conventional methods, including materials customarily used in medicine, including excipients, carriers, adjuvants, and buffers. The composition can be administered, for example, parenterally, orally, intramuscularly, subcutaneously, intravenously, or via other routes useful for obtaining effects. Conventional excipients include pharmaceutically acceptable organic or inorganic carrier materials suitable for parenteral, oral, and other routes of administration that do not adversely react with the medicament. For parenteral administration, sterile injectable solutions, preferably oils or aqueous solutions, as well as implants including suspensions, emulsions, or suppositories are particularly suitable. Ampoules are convenient unit dosages. Pharmaceutical formulations may be sterilized and, if desired, mixed with stabilizers, wetting agents, emulsifiers, salts that affect osmotic pressure, buffers, or other materials that do not adversely react with the active compound.

The modified antibodies described in this additional aspect of the invention include many of humans, including but not limited to, multiple sclerosis, rheumatoid arthritis, systemic vasculitis, uveitis, inflammatory bowel disease, and scleroderma, particularly autoimmune diseases. It is useful for major diseases and also for transplantation. Thus, antibodies of this additional aspect of the invention can be used in therapy. Non-limiting examples include methods of treating an autoimmune disease in a patient, comprising administering an effective amount of a modified antibody according to the additional aspect of the present invention. In various embodiments, the autoimmune disease is multiple sclerosis, rheumatoid arthritis, systemic vasculitis, uveitis, inflammatory bowel disease, or scleroderma. Another example is a method of immunosuppressing a patient before or after transplantation of an organ, comprising administering to said patient an effective amount of an antibody in accordance with said further aspect of the invention. In one embodiment, the organ for transplant is a kidney transplant. This further aspect of the invention also relates to a method for treating a human using a modified antibody composition. For administration to an individual, it would be desirable for any modified antibody composition to be prepared to be at least 80% pure and free of pyrogen and other contaminants.

Thus, in one further aspect, the further aspect of the present invention relates to a method of therapy comprising administering an antibody to a subject, preferably a patient. Preferably, the method is for treating an autoimmune disease, in particular an autoimmune disease selected from multiple sclerosis, rheumatoid arthritis, systemic vasculitis, uveitis, inflammatory bowel disease, and scleroderma. According to another preferred embodiment, the method is for immunosuppressing a patient before or after transplantation of an organ, in particular a kidney. Preferably the patient is a human. It is preferred that an effective amount of the antibody be administered.

In a related aspect, this further aspect of the invention relates to the use of a CD4-antibody, which is an aspect of this additional aspect of the invention, for the manufacture of a medicament for treating a patient with a therapy. Preferably, the drug is for treating an autoimmune disease, in particular an autoimmune disease selected from multiple sclerosis, rheumatoid arthritis, systemic vasculitis, uveitis, inflammatory bowel disease, and scleroderma. According to another preferred embodiment, the drug is for immunosuppressing the patient before or after transplantation of an organ, in particular a kidney. Preferably the patient is a human.

In another related aspect, the additional aspect of the present invention relates to the antibody of the additional aspect of the present invention for use in a method of therapy. Preferably, the method is for treating an autoimmune disease, in particular an autoimmune disease selected from multiple sclerosis, rheumatoid arthritis, systemic vasculitis, uveitis, inflammatory bowel disease, and scleroderma. According to another preferred embodiment, the method is for immunosuppressing a patient before or after transplantation of an organ, in particular a kidney. Preferably the patient is a human.

In the methods of treatment and medical uses of the additional aspects of the invention, the actual dosage of the anti-CD4 antibodies of the additional aspects of the invention used may be selected from a variety of factors including the type and severity of the disease being treated, It will depend on other modality or modalities. Guidance for a dosage regimen is obtained from the administration of humanized anti-CD4 known in the art.

In another aspect, the further aspect of the invention relates to a nucleic acid encoding a heavy and / or light chain immunoglobulin variable region of a CD4-antibody which is an aspect of the further aspect of the invention. The nucleic acid preferably comprises a sequence selected from the group consisting of SEQ ID NOs: 3, 5, 7, 9, 13, 15, 17, and 19.

Also part of this additional aspect of the invention relates to nucleic acids encoding the heavy and / or light chain immunoglobulin variable regions of the CD4-antibody, which is an aspect of the further aspect of the invention, which is a degeneracy of the genetic code ( degeneracy), which differs from SEQ ID NOs: 3, 5, 7, 9, 13, 15, 17, and 19.

Degeneration for polynucleotides refers to the well-known fact in the art that many amino acids in the genetic code are designated by one or more codons. The degeneration of the code describes 20 different amino acids encoded with 64 possible triple sequences of four different bases.

In another aspect, the further aspect of the invention relates to a vector comprising a nucleic acid as described above. The nucleic acid is preferably operably linked to an expression control sequence.

In some embodiments, the expression vector comprises a V-region heavy chain comprising a modified substitution variant of SEQ ID NO: 2 or SEQ ID NO: 12 with a reduced number of T cell epitopes operably linked to an expression control sequence Or a nucleic acid sequence encoding a light chain. In various embodiments, the expression vector comprises or is derived from a pANTVhG4 vector (for VH) and pANTVκ (for VL) as shown in FIG. 11.

In another aspect, the further aspect of the invention relates to a host cell comprising the nucleic acid described above and / or at least one vector described above. The host cell preferably comprises one or more vectors, each containing a nucleic acid, as described above. The host cell preferably comprises two vectors, each containing a nucleic acid, as described above.

The further aspect of the invention also includes culturing the host cell described above under conditions that permit expression under the control of appropriate expression control sequence (s) and purifying the antibody from the medium of the cells. A method of making a CD4-antibody, which is an aspect of this additional aspect of the invention.

In the following items 1 to 33, specific embodiments of this additional aspect of the invention are described:

1. The CD4-antibody, which is an anti-containing heavy chain immunoglobulin variable region (VH) and light chain immunoglobulin variable region (VL),

At least one T cell epitope located outside the CDRs of the immunoglobulin variable region is anti-CD4-antibody that is removed from the immunoglobulin variable region.

2. The CD4-antibody of claim 1, wherein the antibody is a monoclonal antibody.

3. The CD4-antibody of claim 2, wherein the antibody is anti-derived from the monoclonal antibody produced by the hybrid cell line ECACC 88050502.

4. The antibody according to any one of items 1 to 3, wherein the antibody has CDRs of the antibody produced by the hybrid cell line ECACC 88050502, or wherein the antibody is of SEQ ID NO: 2 and SEQ ID NO: 12 An anti-CD4-antibody having CDRs.

5. The method according to any one of items 1 to 4, except for the difference due to the removal of one or more T cell epitopes from the immunoglobulin variable region,

The heavy chain immunoglobulin variable region is identical to the heavy chain immunoglobulin variable region of the antibody produced by the hybrid cell line ECACC 88050502 or comprises the same sequence as SEQ ID NO: 2,

The light chain immunoglobulin variable region is an anti-CD4-antibody, which is identical to the light chain immunoglobulin variable region of the antibody produced by the hybrid cell line ECACC 88050502 or comprises the same sequence as SEQ ID NO: 12.

6. The method according to any one of items 1 to 5, wherein the at least one T cell epitope is

Positions 4 to 12 (EH1) of EQ ID NO: 2, positions 10 to 18 (EH2) of SEQ ID NO: 2, positions 11 to 19 (EH3) of SEQ ID NO: 2, position 20 of SEQ ID NO: 2 To 28 (EH4), positions 37 to 45 (EH5) of SEQ ID NO: 2, positions 70 to 78 (EH6) of SEQ ID NO: 2, positions 73 to 81 (EH7) of SEQ ID NO: 2, SEQ ID The T cell epitope of the heavy chain immunoglobulin variable region at positions 83-91 (EH8) of NO: 2, positions 107-115 (EH9) of SEQ ID NO: 2, positions 110-118 (EH10) of SEQ ID NO: 2; ,

Positions 2 to 10 (EL1) of SEQ ID NO: 12, positions 3 to 11 (EL2) of SEQ ID NO: 12, positions 10 to 18 (EL3) of SEQ ID NO: 12, positions 11 of SEQ ID NO: 12 To 19 (EL4), positions 45 to 53 (EL5) of SEQ ID NO: 12, positions 53 to 61 (EL6) of SEQ ID NO: 12, positions 59 to 67 (EL7) of SEQ ID NO: 12, SEQ ID NO: positions 61-69 (EL8) of 12, positions 62-70 (EL9) of SEQ ID NO: 12, positions 70-78 (EL10) of SEQ ID NO: 12, and positions 97- of SEQ ID NO: 12 T cell epitopes of the light chain immunoglobulin variable region at 105 (EL11).

The CD4-antibody, wherein the antibody is selected from the group consisting of:

7. The CD4- according to any one of items 1 to 6, wherein at least one amino acid is substituted with another amino acid in the at least one T cell epitope to remove the at least one T cell epitope. Antibodies.

8. The compound of claim 7, wherein the substitution is selected from the group consisting of T9S, V10E, A12K, Q19K, S28T, K38R, R40A, L70I, A72R, V73D, S91T, T115L, L116V, and

From SEQ ID NO: 12 to I10T, M11L, L46A, V59S, I62S, S69D, R76S, L105I

The CD4-antibody, wherein the antibody is selected from the group consisting of:

9. The method according to any one of items 6 to 8, wherein

0, 1, 2, or 3 substitutions are within EH1 and EH6, respectively

0, 1 or 2 substitutions are within EH12, EH5, and EH10, respectively,

0 or 1 substitution is in EH3, EH4, EH7, EH8, and EH9, respectively,

0, 1 or 2 substitutions are within EL2, EL3, EL7, EL8, and EL9, respectively

0 or 1 substitution is in EL1, EL4, EL5, EL6, EL10, and EL11, respectively,

Provided that the term CD4-antibody, wherein the term is at least one substitution.

10. The method according to any one of items 1 to 9,

6, 8, or 10 T cell epitopes are removed and / or removed from the heavy chain immunoglobulin variable region

The anti-CD4-antibody, wherein 5, 9, 10, or 11 cell epitopes are removed from the light chain immunoglobulin variable region.

11. The method according to any one of items 1 to 10,

The heavy chain immunoglobulin variable region comprises and / or comprises a sequence selected from the group consisting of SEQ ID NOs: 4, 6, 8, and 10

Wherein said light chain immunoglobulin variable region comprises a sequence selected from the group consisting of SEQ ID NOs: 14, 16, 18, and 20.

12. The method of clause 10 or 11,

The heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 4, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 14, or

The heavy chain immunoglobulin variable region comprises a sequence identical to SEQ ID NO: 4, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 20, or

The heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 6, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 14, or

The heavy chain immunoglobulin variable region comprises a sequence identical to SEQ ID NO: 6, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 16, or

The heavy chain immunoglobulin variable region comprises a sequence identical to SEQ ID NO: 6, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 20, or

The heavy chain immunoglobulin variable region comprises a sequence identical to SEQ ID NO: 8, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 16, or

The heavy chain immunoglobulin variable region comprises a sequence identical to SEQ ID NO: 8, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 20, or

The heavy chain immunoglobulin variable region comprises a sequence identical to SEQ ID NO: 10 and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 14, or

The heavy chain immunoglobulin variable region comprises a sequence identical to SEQ ID NO: 10, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 16, or

Wherein said heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 10 and said light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 20.

13. The method of clause 12, wherein

The heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 4, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 14, or

The heavy chain immunoglobulin variable region comprises a sequence identical to SEQ ID NO: 6, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 16, or

The heavy chain immunoglobulin variable region comprises a sequence identical to SEQ ID NO: 10, and the light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 16, or

Wherein said heavy chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 10 and said light chain immunoglobulin variable region comprises the same sequence as SEQ ID NO: 20.

14. The binding affinity of the antibody for CD4, according to any one of items 1 to 13, which is within one digit larger or smaller than the binding affinity of the antibody produced by the hybrid cell line ECACC 88050502. , Anti-CD4-antibody.

15. The CD4-antibody of claim 14, wherein the binding affinity of the antibody for CD4 is greater or less than twice the binding affinity of the antibody produced by the hybrid cell line ECACC 88050502.

16. The CD4-antibody according to item 14 or 15, wherein the antibody has a greater binding affinity for CD4 than the antibody produced by the hybrid cell line ECACC 88050502.

17. The method according to any one of items 1 to 16,

(a) the antibody has a reduced ability to bind to MHC class II molecules,

(b) the antibody induces a weaker immune response in the patient,

(c) the protein is a full length antibody,

(d) the antibody is a chimeric antibody and / or

(e) The substitution (s) is in the most immune region of the parent molecule.

18. The method according to any one of items 1 to 17, wherein the heavy chain variable region is linked to a human IgG4 constant region domain, and the light chain variable region is linked to a human kappa constant region. , Anti-CD4-antibody.

19. The CD4-antibody of claim 18, wherein the antibody is an anti-body obtained using expression vectors pANTVhG4 and pANTVκ.

20. The method of producing the antibody of any one of items 1 to 19, wherein

(i) providing an amino acid sequence of an antibody that can be derived from a hybrid cell line ECACC 88050502 or a portion thereof,

(ii) identifying one or more T cell epitopes within the amino acid sequence of the antibody or portion thereof by any method comprising determining the binding of the peptide to the MHC molecule using ex vivo or in silico technology or biological analysis. To do that,

(iii) a new sequence variant with one or more amino acids in the identified T cell epitope that has been modified in a manner that substantially reduces or eliminates binding of the peptide to the MHC molecule measured in vitro or in silico technology or biological assay ( designing the variant,

(iv) testing said sequence variant for constructing such sequence variant by recombinant DNA technology and identifying one or more sequence variants having the properties of the antibody of any of items 1-20.

It includes a method for producing an antibody.

21. A pharmaceutical composition comprising the antibody of any one of clauses 1 to 19 and a pharmaceutically acceptable carrier.

22. A method of using the antibody of any one of claims 1 to 19 for the manufacture of a medicament for treating a patient with a therapy.

23. The drug of claim 22, wherein the drug is for treating an autoimmune disease, in particular an autoimmune disease selected from multiple sclerosis, rheumatoid arthritis, systemic vasculitis, uveitis, inflammatory bowel disease, and scleroderma. Is for immunosuppressing a patient before or after transplantation of an organ, in particular a kidney.

24. The antibody of any one of claims 1 to 19 for use in a method of therapeutic treatment.

25. The drug of paragraph 24, wherein the drug is for treating an autoimmune disease, in particular an autoimmune disease selected from multiple sclerosis, rheumatoid arthritis, systemic vasculitis, uveitis, inflammatory bowel disease, and scleroderma. Is for immunosuppressing a patient before or after transplantation of an organ, in particular a kidney.

26. The method of claim 22 or the antibody of any one of claims 22 to 25, wherein the patient is a human.

27. A nucleic acid encoding the heavy and / or light chain immunoglobulin variable region of the antibody of any of clauses 1-19.

28. The nucleic acid according to item 27, comprising a sequence selected from the group consisting of SEQ ID NOs 3, 5, 7, 9, 13, 15, 17, and 19.

29. A vector comprising the nucleic acid of paragraph 27 or 28.

30. The vector of claim 29 wherein the nucleic acid is operably linked to an expression control sequence.

31. The antibody of any one of the above items, wherein the antibody is

i) antibody 16H5.chimIgG4,

ii) an antibody which can be obtained from the cell line CD4.16H5.chimIgG4 deposited in DSZM on Dec. 2, 2011.

32. A host cell comprising the nucleic acid of paragraphs 27 or 28 and / or at least one vector of any of paragraphs 29-31.

33. The method of producing the antibody of any one of items 1 to 19, wherein

Culturing the host cell of claim 32 under conditions permitting expression under the control of appropriate expression control sequence (s),

Purifying the antibody from the medium of cells

It includes a method for producing an antibody.

The invention also relates to an alternative embodiment of the embodiments described herein, wherein the term "ECACC 88050502" is replaced with "MAX.16H5 / 30F16H5". Similarly, the invention also relates to examples, wherein the term "cell line ECACC 88050502", or equivalent, as used herein, is replaced by "cell line MAX.16H5 / 30F16H5" or equivalent. do.

The invention also relates to an alternative embodiment of the embodiments described herein, wherein the term "ECACC 88050502" is replaced with "CD4.16H5.chimIgG4". Similarly, the present invention also relates to examples, wherein the term "cell line ECACC 88050502", or equivalent, as used herein is replaced with "cell line CD4.16H5.chimIgG4" or equivalent term. do.

In the following, the invention is illustrated by way of examples and figures which are not intended to limit the scope of the invention.

Yes

Example 1:

animal

Donor C57Bl / 6 CD4k / o mice, C57Bl / 6 wild-type mice, and recipient Balb / c wild-type mice were bred at the animal facility of the University of Leipzig. Mice strains were maintained at standard conditions. C57Bl / 6 CD4k / o mice have a stable C57Bl / 6 background in which murine CD4 molecules are knocked out and express human CD4. The CD4 transgene includes its own promoter tied to the murine CD4 enhancer element, resulting in T cell subset specific expression. CD8 + cells are not affected in TTG mice. These mice also express HLA-DR3 molecules in addition to the MHC II complex with murine. TTG mice have a fully functional murine and immune system modified with respect to CD4 and HLA-DR. Mice were fed randomly. As donors, C57Bl / 6 and Balb / c mice were purchased from the Charles River (Sulzfeld, Germany; http://jaxmice.jax.org).

All mice were reared, processed or handled according to the guidelines of the University of Leipzig Animal Protection Committee and the Animal Protection Regional Committee of Leipzig (Animal Experiment Registration No. 28/08).

Statistical analysis

All data are presented as mean ± SD. Statistical analysis and graphical presentation were performed using SigmaPlot 10.0 / Sigmastat 3.5 software (SYSTAT, Aircraft, Germany).

Investigation protocol

For irradiation of the rats, an X-ray apparatus (D3225, commercial voltage, Girlmay Medical, Camberley, UK) for animal irradiation was adjusted. Five animals were examined in parallel in a plexiglass container (divided into five spaces for 0.5 cm × 64.0 cm) according to their weight. The average dose was 8.5 Gy.

Preparation of Bone Marrow Cells and Spleen Cells

Bone marrow cells (BMCs) were freshly obtained from the tibia and femur of C57Bl / 6 CD4k / o mice or C57Bl / 6 wild-type mice under sterile conditions. Thus, carefully prepared muscle tissue and tendons were removed from the bone and distal and proximal ends. Using a thin needle (0.4 × 19 mm), myeloid cells were rinsed with sterile PBS and harvested in 50 ml tubes. Single cell suspension was achieved by careful resuspension through the needle. Cells were then washed once in PBS (1 ×) at 300 × g for 10 minutes and resuspended again in PBS (1 ×) to determine cell number using staining with counting chamber and Tuerk staining solution. Next, the bone marrow cells are washed once more in PBS (1 ×) at 300 × g for 10 minutes, and the cell pellets are the minimum essential medium of Dulbecco's Modified Eagle without FCS {DMEM; Resuspended in Perbio, Bonn, Germany}. For generation of single cell spleen cell suspensions from C57Bl / 6 CD4k / o mice or C57Bl / 6 wild-type mice, the spleen is immediately removed under sterile conditions after the rat dies and pressed through a cell strainer (100 μm). And collected in 50 ml tubes of PBS (1 ×). Single cell suspensions were washed twice in PBS (1 ×) at 300 × g for 10 minutes. The erythrocytes were then dissolved in lysis buffer containing 0.155 moles of NH ₄ Cl, 0.01 moles of KHCO ₃ , and 0.01 moles of EDTA-Na (pH 7.3) in sterile PBS. Cells were washed again, resuspended in DMEM medium without FCS and cell number determined. Bone marrow cells and spleen cells were adjusted to the desired number of cells before antibody culture.

As will be readily understood by those skilled in the art, the use of spleen cells in the examples of the present invention occurs for operational reasons, with the additional addition of splenocytes not actually required according to the invention, especially if human subjects are involved.

Antibody Culture

For antibody culture, the required amount of Max16H5 antibody was dissolved at a final concentration of 1 mg / ml {DMEM (without FCS) just prior to use. Subsequently, 1.4 × 10 ⁸ bone marrow cells and 1.4 × 10 ⁸ splenocytes obtained from C57Bl / 6 CD4k / o or C57Bl / 6 wild-type mice were treated with 800 μg of 15 ml DMEM without FCS for 1 hour at room temperature in the dark. Was incubated with Max16H5. As a control, bone marrow cells and splenocytes of C57Bl / 6 CD4k / o mice or C57Bl / 6 wild-type mice without antibody treatment were also cultured in DMEM without FCS under the same conditions. After 1 hour incubation, the cells are centrifuged to pellet the cells at 300 × g for 10 minutes and washed once in PBS (1 ×) at 300 × g for 10 minutes to remove unbound antibody.

Cell transplantation

For co-transplantation experiments, 2 × 10 ⁷ bone marrow cells from CD4k / o mice treated with Max16H5 were added to 2 × 10 ⁷ splenocytes from CD4k / o mice treated with Max16H5. Cell concentration was adjusted to a final volume of 150 μl sterile 0.9% NaCl. The same was done for bone marrow cells and spleen cells of C57Bl / 6 wild-type mice also treated with Max16H5. As a control, 2 × 10 ⁷ untreated bone marrow cells of CD4k / o mice were added to 2 × 10 ⁷ untreated spleen cells of CD4k / o mice, or 2 × 10 ⁷ bone marrow of C57Bl / 6 wild type mice Cells were added to 2 × 10 ⁷ spleen cells of C57Bl / 6 wild type mice. The grafts were then allogeneically transplanted by intravenous injection into the lateral tail vein of the lethal irradiated receptor Balb / c wild type mice. Survival, GvHD symptoms, and weight according to Cooke et al. (1996) were assessed daily after transplantation.

Flow cytometry

Before and after transplantation, the recipient Balb / c wild-type mice were analyzed by flow cytometry.

Donor CD4k / o of mouse spleen cells and bone marrow cells Characterization

For cell count analysis, cells were incubated with 2.5 μL of conjugated monoclonal antibody (VIII and CD3-FITC, human CD4-APC [both Beckman Coulter, Krefeld, Germany]; VIII and CD8-PerCP, MHC- I (H-2D [b])-PE, murine CD4-PECy7, murine CD19-APCCy [BD Biosciences, Heidelberg, Germany]). After 20 min incubation, two wash steps followed in PBS / 1% FBS (1250 rpm, 5 min, room temperature [RT]). Finally, the pellet was resuspended in 200 μl of PBS. In addition, the viability of splenocytes and bone marrow cells was tested prior to transplantation by staining with 7-amino-actinomycin D (7AAD). 1 × 10 ⁶ cells were incubated with 5 μl (0.25 μg / test) of 7AAD dissolved in 300 μl of PBS for 30 minutes at room temperature and measured immediately. Data was obtained on a BD FACSCantoIITM Flow Cytometer and the BD FACSDIVA ^™ Analyzes were performed using the software (both BD Biosciences, Heidelberg, Germany).

Receptor Balb Cytometry and Hematology in / c Wild-type Rats

Before and after the transplant procedure, the recipient mice were analyzed by flow cytometry. At certain time points, blood (150 μl) was drawn from the retro orbital vein of each rat under ether anesthesia. Blood was collected through heparinized capillaries (Grainer Biochemica, Flacht, Germany). Hemoglobin concentration was measured using the Animal Blood Counter (SCIL, Viernheim, Germany), which was calibrated against the blood of rats within 2 hours after blood collection. For cell count analysis, 100 μl of blood cells were incubated with 2.5 μl of conjugated monoclonal antibody according to samples (VIII and CD4-PECy7, MHC-I (H-2D [b])-PE, MHC -I (H-2K [d])-FITC, murine CD8-PerCP, murine CD19-APCCy7 [BD Biosciences, Heidelberg, Germany]; murine CD3-FITC, human CD4-APC [Beckman Coulter, Crewe Felt, Germany]; Human HLA-DR3-FITC [Immunotool, Prisoite, Germany] After 20 minutes of incubation, erythrocyte lysing was followed by manufacturer's instructions (BD FACS lysis solution [BD Bio Science, Heidelberg, Germany]) The sample was washed twice with the addition of PBS / 1% FBS (1250 rpm, 5 min, room temperature [RT]) Finally, the pellet was resuspended in 200 μl of PBS. for cell counting analysis of murine FoxP3 for detecting T cells, murine T _reg detection kit (Biotech geem milten the beha, suberic Kishu geulradeubaheu, Germany) was used. 1 × 10 ⁶ Cells are resuspended in 90 μl MACS buffer (0.5% FCS, 2 mM EDTA in PBS, [Miltei Biotech GmbH, Bergisch Gladbach, Germany]) and cell surface labels with 10 μl CD4-FITC and CD25-PE antibodies. Stain (Milten Biotech GmbH, Bergisch Gladbach, Germany) After incubation in the dark at 4 ° C. for 10 minutes, cells were washed with 2 ml MACS buffer and centrifuged at 300 × g for 5 minutes at 4 ° C. Supernatant After removal, 1 × 10 ⁶ cells were permeabilized by incubation for 30 minutes at 4 ° C. in 1 ml of freshly prepared fixation / permeabilization solution (containing formaldehyde). Washed in cold MACS buffer and centrifuged at 300 × g for 5 minutes at 4 ° C. Supernatant removal followed by permeation step for intercellular FoxP3 staining 1 × 10 ⁶ cells were washed in 2 ml cold permeation buffer and At 300 xg for 5 minutes at 4 ° C. It was deeply separated. Cell pellets were resuspended in 80 μl cold permeation buffer and incubated at 4 ° C. for 5 minutes. 10 μl of anti-FoxP3-APC (Miltenyi Biotech, Bergisch Gladbach, Germany) antibody was then added, mixed carefully and incubated at 4 ° C. for 30 minutes. Cells were washed with 2 ml of cold permeation buffer and centrifuged at 300 × g for 5 minutes at 4 ° C., supernatants were removed and cells were resuspended in 100 μL MACS buffer. Data was obtained on a BD FACSCantoIITM Flow Cytometer and the BD FACSDIVA ^™ Analyzes were performed using the software (both BD Biosciences, Heidelberg, Germany).

Immune histology immunohistology )

Rat organs were placed in a stainless steel beaker (containing 2-methylbutane; Karl Roth, Karlsruhe, Germany), soaked in liquid nitrogen for 15 minutes and stored at −80 ° C. until ready for cleavage. Cleavage is performed using cryostat (Leica Biosystems, Nussloch, Germany), the object is transported to a superfrost slide (Thermo Scientific, Braunschweig, Germany) and immunohistochemical analysis Stored immediately at -80 ° C until. The object slides were incubated with 0.3% w / v H ₂ O ₂ , dissolved in PBS for 10 minutes in a wet chamber and then washed three times with PBS. The trachea was treated with 10% w / v FBS in PBS for 60 minutes at room temperature (RT), washed immediately with PBS and incubated with avidin solution (Dakonos America, Capinderia, USA) for 10 minutes. And washed with PBS. The preparation is incubated with biotin solution (Daknoth America) for 10 minutes, washed with PBS and isotype, diluted with primary antibody anti-CD4 antibody (US, Biologic, Massachusetts, USA) or 1: 100. The control group (Rat IgG1, κ, BD Biosciences, San Diego, USA) was incubated for 1 hour at room temperature (RT). The slides were then covered with secondary antibody (Biotin-Conjugate Goat Antigen IgG ₁ , BD Biosciences, San Diego, USA), diluted 1: 100, at room temperature (RT) for 30 minutes and washed with PBS. Object slides are covered with Streptavidin-Horseradish Peroxidase (BD Biosciences, San Diego, USA) for 30 minutes, washed three times with PBS (2 minutes during each wash step). ), Incubated with DAB solution (BD Biosciences, San Diego, USA) for 5 minutes until clear intensity of color was achieved and washed three times with ddH ₂ O. Samples were covered with Mayer's hemalaun solution (Merck, Darmstadt, Germany) for 1 minute and then washed with tap water for 10 minutes to show blue staining. Object slides passing through increasing alcohol series (40-100 w / v) were incubated with xylene (calose) for 5 minutes and finally covered with Entelan ^® (Merck). Slides were analyzed under a microscope (Zace, Axio, Imager A1, Objective Lens 920 EX Plan-Neoflua, Axiocam MRc5 Zeiss, Axio Vision Release 4.6.3; Göttingen, Germany).

histology( histology )

Liver, bone, and intestine of all transgenic mice were analyzed histologically. The organs were prepared immediately after death and transferred to formalin (4% w / v; Merck) for hematoxylin-eosin (HE) and kaolin-aniline-orange G (KAO) staining. The formalin box was stored in the dark to prevent formalin precipitation. The bones were cultured in five soft austenitic ^® at room temperature for at least 7 days. All samples were washed with tap water for 2 hours and then submerged in 70-100% w / v alcohol dilution for 9 hours. The final incubation consisted of isopropanol (JT Baker, Deventer, The Netherlands) for 1 hour and methylbenzoate (Ridel de-Fenne, Celle, Germany) overnight. The trachea was then buried and sliced (6 lm) in paraffin for 3 days. The slides were incubated twice with xylene for 5 minutes at room temperature (RT), passed through a decreasing alcohol series (100-50% w / v) and finally transferred to ddH ₂ O at room temperature. The object slides were placed in Meyer's Hemaran solution for 5 minutes and washed with tap water to reach blue staining. After incubation with 1% w / v Eosin Y, slides passed through increasing (70-100% w / v) alcohol series and finally covered with Entelan ^® (Merck). Object slides were analyzed under a microscope (Nikon, Eclipse TE2000-E 920, objective lens plan Fluor 920 / 0.45 Ph1 DM ∞ / 0-2 WD 7.4 Histo, Software Nikon, Lucia G 5.00; Dusseldorf, Germany). Bone was stained with KAO as described according to the Khalmi-Connexi.

Example 2 :

Recombinant DNA techniques have been performed using methods well known in the art and, where appropriate, the supplier's instructions for using the enzymes used in these methods. Sources of common methods included standard literature such as well-known books compiled by Sambrook and Russell and edited by Osbel. Detailed laboratory methods are also described below. In silico methods such as those described in WO 9859244 were used to analyze the variable heavy and light chain sequences of murine anti-CD4 for peptides predicted to bind to MHC class II molecules (which were considered T cell epitopes). .

Example 2a: Chimeric  term- CD4  Antibody

mRNA was extracted from rat anti-CD4 hybrid cells using PolyAtract System 1000 mRNA Extraction Kit: (Promega Corp. Madison, Wisconsin), according to the manufacturer's instructions. mRNA was reverse transcribed as follows: For kappa light chains, 5.0 microliters of mRNA were 1.0 microliters of 20 pmol / microliter MuIgκVL-3 ′ primer OL040 (Table 2) and 5.5 microliters of nuclease free water. (Promega Corp. Madison, Wisconsin). For lambda light chains, 5.0 microliters of mRNA were 1.0 microliters of 20 pmol / microliter MuIgκVL-3 ′ primer OL042 (Table 2) and 5.5 microliters of nuclease-free water (Promega Corp. Madison, Wisconsin). Mixed with. For gamma heavy chains, 5 microliters of mRNA were 1.0 microliters of 20 pmol / microliter MuIgVH-3 ′ primer OL023 (Table 1) and 5.5 microliters of nuclease-free water (Promega Corp. Madison, Wisconsin). Mixed with. All three reaction mixtures were placed in a preheated thermal cycler block set at 70 ° C. for 5 minutes. These reaction mixtures each contain 4.0 microliters of ImPromII 5x reaction buffer (Promega Corp. Madison, Wisconsin), 0.5 microliters of RNasin ribonuclease inhibitor (Promega Corp. Madison, Wisconsin), 2.0 microliters of 25 mM MgCl ₂ (Promega Corp. Madison, Wisconsin), 1.0 microliter of 10 mM dNTP mixture (Invitrogen, Paisley, UK), and 1.0 microliter of Improm II reverse transcriptase (Promega Corp. Madison, Wisconsin) Cooled on ice for 5 minutes before addition. The reaction mixture was incubated at room temperature for 5 minutes before being delivered to the preheated PCR block, set at 42 ° C. for 1 hour. After this time reverse transcriptase was heat inactivated by incubating at 70 ° C. in a PCR block for 15 minutes.

The heavy and light chain sequences were expanded from cDNA as follows: The PCR master mix was 37.5 microliters of 10 × HiFi Expand PCR buffer (Roche, Mannheim, Germany), 7.5 microliters of 10 mM dNTP mixture (in vitro) Trogen, Paisley, UK), and 3.75 microliters of HiFi Expanded DNA Polymerase (Roche, Mannheim, Germany) were prepared by adding 273.75 microliters of nuclease-free water. This master mixture was dispensed into aliquots of 21.5 microliters into 15 thin wall PCR reaction tubes on ice. To these six tubes, 2.5 microliters of MuIgVH-3 'reverse transcription compound mixture and 1.0 microliter of heavy chain 5' primer pool HA to HF (see Table 1 for primer sequences and primer pool components) are added. It became. To the other seven tubes, 2.5 microliters of MuIgκVL-3 'reverse transcription reaction and 1.0 microliter of light chain 5' primer pool LA to LG (Table 2) were added. To the final tube, 2.5 microliters of MuIgκVL-3 'reverse transcription reaction and 1.0 microliter of lambda light chain primer MuIgλVL5'-LI were added. The reaction was placed in a block of thermal cycler and heated to 95 ° C. for 2 minutes. The PCR reaction was performed for 40 cycles of 94 ° C. for 30 seconds, 55 ° C. for 1 minute, and 72 ° C. for 30 seconds. Finally, the PCR product was heated at 72 ° C. for 5 minutes and then maintained at 4 ° C.

code order Length Name-pool OL007 ATGRASTTSKGGYTMARCTKGRTTT 25 MuIgV _H 5'-HA OL008 ATGRAATGSASCTGGGTYWTYCTCTT 26 MuIgV _H 5'-HB OL009 ATGGACTCCAGGCTCAATTTAGTTTTCCT 29 MuIgV _H 5'-HC OL010 ATGGCTGTCYTRGBGCTGYTCYTCTG 26 MuIgV _H 5'-HC OL011 ATGGVTTGGSTGTGGAMCTTGCYATTCCT 29 MuIgV _H 5'-HC OL012 ATGAAATGCAGCTGGRTYATSTTCTT 26 MuIgV _H 5'-HD OL013 ATGGRCAGRCTTACWTYYTCATTCCT 26 MuIgV _H 5'-HD OL014 ATGATGGTGTTAAGTCTTCTGTACCT 26 MuIgV _H 5'-HD OL015 ATGGGATGGAGCTRTATCATSYTCTT 26 MuIgV _H 5'-HE OL016 ATGAAGWTGTGGBTRAACTGGRT 23 MuIgV _H 5'-HE OL017 ATGGRATGGASCKKIRTCTTTMTCT 25 MuIgV _H 5'-HE OL018 ATGAACTTYGGGYTSAGMTTGRTTT 25 MuIgV _H 5'-HF OL019 ATGTACTTGGGACTGAGCTGTGTAT 25 MuIgV _H 5'-HF OL020 ATGAGAGTGCTGATTCTTTTGTG 23 MuIgV _H 5'-HF OL021 ATGGATTTTGGGCTGATTTTTTTTATTG 28 MuIgV _H 5'-HF OL022 CCAGGGRCCARKGGATARACIGRTGG 26 MuIgV _H 3'-2

(SEQ ID NOs: 70-85)

code order Length Name-pool OL024 ATGRAGWCACAKWCYCAGGTCTTT 24 MuIgkV _L 5'-LA OL025 ATGGAGACAGACACACTCCTGCTAT 25 MuIgkV _L 5'-LB OL026 ATGGAGWCAGACACACTSCTGYTATGGGT 29 MuIgkV _L 5'-LC OL027 ATGAGGRCCCCTGCTCAGWTTYTTGGIWTCTT 32 MuIgkV _L 5'-LD OL028 ATGGGCWTCAAGATGRAGTCACAKWYYCWGG 31 MuIgkV _L 5'-LD OL029 ATGAGTGTGCYCACTCAGGTCCTGGSGTT 29 MuIgkV _L 5'-LE OL030 ATGTGGGGAYCGKTTTYAMMCTTTTCAATTG 31 MuIgkV _L 5'-LE OL031 ATGGAAGCCCCAGCTCAGCTTCTCTTCC 28 MuIgkV _L 5'-LE OL032 ATGAGIMMKTCIMTTCAITTCYTGGG 26 MuIgkV _L 5'-LF OL033 ATGAKGTHCYCIGCTCAGYTYCTIRG 26 MuIgkV _L 5'-LF OL034 ATGGTRTCCWCASCTCAGTTCCTTG 25 MuIgkV _L 5'-LF OL035 ATGTATATATGTTTGTTGTCTATTTCT 27 MuIgkV _L 5'-LF OL036 ATGAAGTTGCCTGTTAGGCTGTTGGTGCT 29 MuIgkV _L 5'-LG OL037 ATGGATTTWCARGTGCAGATTWTCAGCTT 29 MuIgkV _L 5'-LG OL038 ATGGTYCTYATVTCCTTGCTGTTCTGG 27 MuIgkV _L 5'-LG OL039 ATGGTYCTYATVTTRCTGCTGCTATGG 27 MuIgkV _L 5'-LG OL040 ACTGGATGGTGGGAAGATGGA 21 MuIgkV _L 3'-1 OL041 ATGGCCTGGAYTYCWCTYWTMYTCT 25 MuIgλV _L 5'-LI OL042 AGCTCYTCWGWGGAIGGYGGRAA 23 MuIgλV _L 3'-1

(SEQ ID NOs: 86-104)

Amplification products were cloned into pGEM-T easy vectors using the pGEM-T Easy Vector System I (Promega Corporation, Madison, Wisconsin) kit and the sequences listed. The resulting murine VH and VL sequences are shown in SEQ ID NOs: 1 and 2 (FIG. 12) and SEQ ID NOs: 11 and 12 (FIG. 13).

To generate chimeric antibodies, the VH region genes were expanded by PCR using primers OL330 and OL331 (Table 3), which were 5 'MluI and 3' using plasmid DNA from one of the cDNA clones as a template. It was designed to run at the HindIII restriction enzyme site. In a 0.5 ml PCR tube, 5 microliters of 10 × Hi-Fi expanded PCR buffer (Roche, Mannheim, Germany), 1.0 microliter of 10 mM dNTP mixture (Invitrogen, Paisley, UK), 0.5 microliters of primer OL330, 0.5 microliter of primer OL331, 1.0 microliter of template DNA, and 0.5 microliter of HiFi Expanded DNA polymerase (Roche, Mannheim, Germany) were added to 41.5 microliter of nuclease free water.

code order Length OL 330 GATCACGCGTGTCCACTCCGAAGTGCAGCTGGTGGAGTC 39 OL 331 GTACAAGCTTACCTGAGGAGACGGTGACTGAGG 33

(SEQ ID NOs: 105-106)

The VL region was expanded in a similar manner using oligonucleotides OL332 and OL333 (Table 4) to engineer the BssHII and BamHI restriction enzyme sites. The reaction was placed on a block of thermal cycler and heated to 95 ° C. for 2 minutes. The polymerase chain reaction (PCR) reaction was performed for 30 cycles of 94 ° C. for 30 seconds, 55 ° C. for 1 minute, and 72 ° C. for 30 seconds. Finally, the PCR product was heated at 72 ° C. for 5 minutes and then maintained at 4 ° C. VH and VL region PCR products were then cloned into the vectors pANTVhG4 and pANTVκ (FIG. 11) at the MluI / HinDIII and BssHII / BamHI positions, respectively. Both pANTVhG4 and pANTVκ are pAT153-based plasmids containing human Ig expression cassettes. The heavy chain cassette in pANTVhG4 consists of a human genomic IgG4 constant region gene operated by an hCMVie promoter having a downstream human IgG polyA region. pANTVhG4 also contains the hamster dhfr gene, operated by an SV40 promoter having a downstream SV40 polyA region.

The light chain cassette of pANTVκ consists of a genomic human kappa constant region operated by hCMVie promoter with a downstream light chain polyA region. The cloning position between the human Ig leader sequence and a region allows insertion of the variable region gene.

code order Length OL 332 CATGGCGCGCGATGTGACATCCAGATGACTCAGTC 35 OL 333 TGCGGGATCCAACTGAGGAAGCAAAGTTTAAATTCTACTCACGTCTCAGCTCCAGCTTGGTCC 63

(SEQ ID NOs: 107-108)

NS0 cells (ECACC 85110503, Photon, UK) are co-transfected with these two plasmids via electroporation, DMEM (Invitrogen, Paisley, UK) + 5% FBS (ultra low) IgG Cat No. 16250-078 Invitrogen, Paisley, UK) + Penicillin / Streptomycin (Invitrogen, Paisley, UK) + 100 nM Methotrexate (Sigma, Poole, UK). Methotrexate resistant colonies were isolated and antibodies were protein A affinity chromatography using a 1 ml HiTrap MabSelect Sure column (GE Healthcare, Amersham, UK) following manufacturer's recommendations Purification by chromatography.

NS0 supernatants were quantified for antibody expression in IgG Fc / kappa ELISA using purified human IgG1 / kappa (Sigma, Poole, UK) as standard. Immunosorb 96 well plates (Naljin, Hereford, UK) were IgG Fc-specific, antiviral antigens of mice diluted 1: 1500 in 1 × PBS (pH 7.4) at 37 ° C. for 1 hour. Coated with antibody (I6260 Sigma, Poole, UK). Plates were washed three times in PBS + 0.05% Tween 20 before adding the sample and standard material diluted in 2% BSA / PBS. Plates were washed three times in PBS / Twin and added 100 μl / well of detection antibody goat anti-kappa light chain peroxidase conjugate (A7164 Sigma, Poole, UK) diluted 1: 1000 in 2% BSA / PBS. Before incubation at room temperature (RT) for 1 hour. Plates were incubated for 1 hour at room temperature (RT) before washing five times with PBS / Twin and bound antibodies were detected using OPD substrate (Sigma, Poole, UK). The assay was performed in the dark for 5 minutes before being stopped by the addition of 3M HCl. The assay plate was then read at MR490 TCII plate reader (Dynex Technologies, Worthing, UK) at 490 nm.

Chimeric antibodies were tested in ELISA-based competition assays using murine anti-CD4 antibodies, biotinylated using the B-tag micro biotinylation kit (Sigma, Poole, UK). Dilution series of 10 μg / ml to 0.009 μg / ml chimeric IgG4 or control rat antibodies were prepared using Nunc MaxiSorp 96 well flat bottom microtitre plate precoated with 50 μl / well of 1 μg / ml CD4 ( Fischer, Loughborough, UK) was premixed with a constant concentration of biotinylated anti-CD4 (0.2 μg / ml) before incubating 100 μl / well for 1 hour at room temperature. Binding of biotinylated mAb was determined by incubating for 1 hour at room temperature with 100 μl / well of 1/500 dilution of streptavidin-HRP (Sigma) and then detecting with 100 μl / well OPD substrate (Sigma). . After stopping this reaction with 50 μl / well of 3M HCl, absorbance at 490 nm was measured using a Dynex Technologies (Wording, UK) MRX TC II plate reader.

The results obtained (FIG. 14) show that chimeric IgG4 and rat anti-CD4 antibodies have very similar binding profiles with IC50 values of 0.25 μg / ml and 0.18 μg / ml, respectively. Thus, the correct variable region sequences were identified and cloned.

Example 2b: Modified Anti- CD4  Design of Antibodies

Consecutive 9mer peptides spanning the entire length of the variable region were tested in silico for binding to a panel of 34 MHC class II alleles. The scores for each individual allele were normalized on a scale of 0 to 1, and extensive validation using a panel of known MHC class II binding peptides was performed with binding peptides with a cut-off value of 0.55 predicted. It was demonstrated to effectively distinguish peptides that did not bind. In detail, potential MHC class II binding sequences within the variable domain were identified using the software iTope ^™ . iTope ^™ software predicts beneficial interactions between amino acid side chains of peptides and specific binding pockets within the binding grooves of 34 human MHC class II alleles. The location of the key binding residues is achieved by in silico production of 9mer peptides overlapped by one amino acid across the test protein sequence. Each 9mer was scored based on the potential 'fit' and interaction of amino acid side chains with binding grooves of MHC class II molecules. The peptide score calculated by the software is between 0 and 1. Peptides that produced high mean binding scores (> 0.55 in iTope ^™ scoring function) were highlighted and> 50% of MHC class II binding peptides, ie, 17 out of 34 alleles had high binding affinity (Score> 0.6) These peptides were defined as “promiscuous high affinity” MHC class II binding peptides that were considered high risk for containing CD4 ⁺ T cell epitopes. MHC class II binding peptides of appropriate affinity bind a very large number of alleles with high affinity but less than 17 affinity. Next, high and moderate affinity binders were analyzed using iTope ^™ software for changes that could be made to sequences that reduce or eliminate binding to MHC class II alleles. In performing amino acid selection, a range of amino acids that were naturally found in human antibodies at any given position were considered. Alternatively, for example, publicly available software may be used as follows.

ProPred (www.imtech.res.in/raghava/propred/),

Rankpep (bio.dfci.harvard.edu/RANKPEP/) or

NetMHCII (www.cbs.dtu.dk/services/NetMHCII/).

Ten MHC class II binding peptides were identified in the rat heavy chain variable region (Table 5) and eleven MHC class II binding peptides were identified in the rat light chain variable region (Table 6). Tables 5 and 6 list the sequence of sequence variants used in the sequences of FIGS. 12 and 13 and the identified MHC class II binding sequences to reduce MHC class II binding. If an MHC class II binding sequence was identified, the amino acid of the peptide at the key MHC class II binding site was replaced with an alternative amino acid to reduce or eliminate MHC class II binding. In some cases, one or more mutations were needed to completely eliminate binding, and in other cases, even though the number of alleles involved was small and the binding score approached the cutoff value, MHC class II binding could not be completely eliminated. .

rat VH4 VH3 VH2 VH1 order * order * order * order * order * LQQSGTVLA 26 LQQSGT E L K 13 LQQSG SE L K 0 LQQSG SE L K 0 LQQSG SE L K 0 VLARPGASV 29 E L K RPGASV 0 E L K RPGASV 0 E L K RPGASV 0 E L K RPGASV 0 LARPGASVQ 20 L K RPGASV K 2 L K RPGASV K 2 L K RPGASV K 2 L K RPGASV K 2 MSCKASGYS 18 MSCKASGY T 7 MSCKASGY T 7 V SCKASGY T 0 V SCKASGY T 0 VKQRPGQGL 24 VKQ A PGQGL One VKQ A PGQGL One VKQ A PGQGL One V R Q A PGQGL One LTAVTSAST 17 LTAVTSAST 17 LTAVTSAST 17 LTA D TSAST 4 I T RD TSAST 0 VTSASTAYM 31 VTSASTAYM 31 VTSASTAYM 31 D TSASTAYM 0 D TSASTAYM 0 LSSLTNEDS 20 LSSLTNEDS 20 LSSLTNED T 2 LSSLTNED T 2 LSSLTNED T 2 LDYWGQGTT 21 LDYWGQGTT 21 LDYWGQGT L 0 LDYWGQGT L 0 LDYWGQGT L 0 WGQGTTLTV 27 WGQGTT V TV 0 WGQGT LV TV 0 WGQGT LV TV 0 WGQGT LV TV 0 SEQ ID
NOs: 21-30 SEQ ID NOs: 42-55, 138

(*) Number of alleles bound

rat VK4 VK3 VK2 VK1 order * order * order * order * order * IVLTQSPAI 27 IVLTQSPAI 27 IVLTQSPA T 3 IVLTQSPA T 3 IVLTQSPA T 3 VLTQSPAIM 11 VLTQSPAIM 11 VLTQSPA TL 0 VLTQSPA TL 0 VLTQSPA TL 0 IMSASPGEK 10 IMSASPGEK 10 TL SASPGEK 0 TL SASPGEK 0 TL SASPGEK 0 MSASPGEKV 24 MSASPGEKV 24 L SASPGEKV 2 L SASPGEKV 2 L SASPGEKV 2 LLIYDTSNL 6 LLIYDTSNL 6 LLIYDTSNL 6 LLIYDTSNL 6 A LIYDTSNL 0 LASGVPVRF 19 LASGVP S RF 2 LASGVP S RF 2 LASGVP S RF 2 LASGVP S RF 2 VRFIGSGSG 29 S RFIGSGSG 0 S RFIGSGSG 0 S RF S GSGSG 0 S RF S GSGSG 0 FIGSGSGTS 14 FIGS GSGT D 0 FIGS GSGT D 0 F S GSGSGT D 0 F S GSGSGT D 0 IGSGSGTSY 22 IGSGSGT D Y 22 IGSGSGT D Y 22 S GSGSGT D Y 0 S GSGSGT D Y 0 YSLTISRME 17 YSLTIS S ME 0 YSLTIS S ME 0 YSLTIS S ME 0 YSLTIS S ME 0 FGAGTKLEL 16 FGAGTKLE I 0 FGAGTKLE I 0 FGAGTKLE I 0 FGAGTKLE I 0 SEQ ID
NOs: 31-41 SEQ ID NOs: 56-69

(*) Number of alleles bound

Example 2c: Modified Anti- CD4  Generation of antibodies

Initially modified antibody VH and VK region genes were generated by overlapping PCR mutagenesis of the parental rat anti-CD4 variable region of Example 2a using methods known in the art {SEQ ID NO: 1 (FIG. 12) and SEQ ID NO: 11 (FIG. 13)} (FIGS. 12 and 13). Further variants were constructed by overlapping PCR mutagenesis from SEQ ID NO: 3 (FIG. 12) and SEQ ID NO: 13 (FIG. 13). The assembled variant was then directly cloned into the expression vector of FIG. All clones were verified by DNA sequencing. In detail, PCR mutagenesis was performed as follows: In both sense and anti-sense DNA strands, primer pairs were designed that span the region of the template nucleotide sequence to be altered. It became. The primers included sequences that would be introduced / modified, contacted by the same sequence as the template sequence, and would serve to fix the primer in the correct position. There was also a need for 5 'and 3' terminal primers with restriction sites suitable for cloning mutated PCR products into expression vectors (ie, MluI and HinDIII for the VH gene, BssHII and BamHI for the VK gene). Tables 3, 4, and 7 list all primers used for the construction of de-immunized variants. For overlapping PCR, small fragments of genes are individually expanded PCRs that overlap adjacent fragments at their ends, and mutations are introduced by primers in regions of overlap. Next, short PCR fragments are purified and assembled in a single PCR reaction using 5 'and 3' terminal primers. To generate variant 4 genes, the murine variable region was used as a template and for all subsequent variants, variant 4 genes were used as templates for PCR reactions: for VH variant 4, two separate PCRs were identified as OL335 + OL337 and OL336 + OL338 were performed and fragments were joined using OL334 + OL338. For VH variant 3, two separate PCRs were performed using OL339 + OL341 and OL340 + OL342, and fragments were joined using OL339 + OL342. For VH variant 2, three individual PCRs were performed using OL330 + OL344, OL343 + OL346, and OL354 + OL342, and fragments were joined using OL330 + OL342. For VH variant 1, three separate PCRs were performed using OL339 + OL348, OL347 + OL350, and OL349 + OL342, and fragments were combined using OL339 + OL342. For VK variant 4, four individual PCRs were performed using OL332 + OL352, OL351 + OL354, OL353 + OL356, and OL355 + OL357, and fragments were combined using OL332 + OL357. For VK variant 3, PCR was performed using OL358 + OL357. For VK variant 2, two separate PCRs were performed using OL358 + OL360 and OL359 + OL357, and fragments were joined using OL358 + OL357. For VK variant 1, two separate PCRs were performed using OL358 + OL362 and OL361 + OL357, and fragments were joined using OL358 + OL357. The PCR conditions used were as described in Example 2a for the expansion of chimeric variable region genes. The resulting PCR fragment was digested with either MluI and HinDIII for the VH gene or BssHII and BamHI for the VK gene and cloned into the appropriate expression vector.

code order Length OL334
OL335
OL336
OL337
OL338
OL339
OL340
OL341
OL342
OL343
OL344
OL345
OL346
OL347
OL348
OL349
OL350
OL351
OL352
OL353
OL354
OL355
OL356
OL357
OL358
OL359
OL360
OL361
OL362
GTTGCTACGCGTGTCCACTCCGAGGTTCAGCTCCAGCAGTCTGGGACTGaGCTGaaAAGGCCTGG
ACTGaGCTGaaAAGGCCTGGGGCTTCCGTGaAGATGTCCTGCAAGGCTTCTGGCTACAcCTTTGC
ACAGGGTCTACAATGGATTGG
CCAATCCATTGTAGACCCTGTCCAGGggcCTGTTTTA
CCCAGAAAGCTTACCTGAGGAGACTGTGAcAGTGGTGCC
GTTGCTACGCGTGTCCACTCCGAGGTTCAGCTCCAGCAGTCTGGGtCTGAGCTGAAAAGG
CAAATGAGGACaCcGCGGTCTATT
AATAGACCGCgGtGTCCTCATTTG
CCCAGAAAGCTTACCTGAGGAGACTGTGACAagGGTGCC
CTTCCGTGAAGgTGTCCTGCAAGGC
GCCTTGCAGGACAcCTTCACGGAAG
AACTGACTGCAGaCACATCCGCCAG
CTGGCGGATGTGtCTGCAGTCAGTT
TGCACTGGGTAAgACAGGCCCCTGG
CCAGGGGCCTGTcTTACCCAGTGCA
GTTCAAGGACAAGGCCAAAaTcACTagAGACACATCCGCCAGCACT
AGTGCTGGCGGATGTGTCTctAGTgAtTTTGGCCTTGTCCTTGAAC
CTCCAGGGGAGAAGGcCGCCATGACC
GGTCATGGCGgCCTTCTCCCCTGGAG
TCCTGATTTATGACACATCCAACCTGGCTTCTGGAGTCCCTtcTCGCTTCA
GTTGGATGTGTCATAAATCAGGA
TCTGGGACCgaTTACTCTCTCACAATCAGCaGcATGGAGGCTG
CAGCCTCCATgCtGCTGATTGTGAGAGAGTAAtcGGTCCCAGA
ATTGCGGGATCCAACTGAGGAAGCAAAGTTTAAATTCTACTCACGTTTgAtCTCCAGCTTG
CCCAGGCGCGCGATGTCAAATTGTTCTCACCCAGTCTCCAGCAAcCCTGTCTGCA
TTCTCGCTTCAgcGGCAGTGGG
CCCACTGCCgcTGAAGCGAGAA
CTCCCCCAGAgcCCTGATTTAT
ATAAATCAGGgcTCTGGGGGAG
65
65
21
37
39
60
24
24
39
25
25
25
25
25
25
46
46
26
26
51
23
43
43
61
55
22
22
22
22

(SEQ ID NOs: 109-137)

All combinations of variant heavy and light chains (ie 16 pairs in total) were stably cell infected with NS0 cells via electroporation. Cell infected cells were first selected using 100 nM methotrexate, expanded to 200 nM methotrexate, and tested for IgG expression as in Example 2a. No expression was observed with the variant with the VK3 chain or the variant with VH3 / VK1 and VH1 / VK2. The best expression line for each strain was expanded and frozen under liquid nitrogen. CD4-antibody strains, which are anti-NSO stable cell transfections, were purified from cell culture supernatants via Protein A affinity chromatography. The supernatant was pH adjusted with 0.1 volume of 10 × PBS (pH 7.4) and passed over a 1 ml Map Select Sure Protein A column (GE Healthcare, Amersham, UK). The column was washed with 10 volumes of PBS (pH 7.4) before eluting with 50 mM citrate buffer (pH 3.0). A 1 mL fraction was collected and immediately neutralized with 0.1 mL of 1M Tris-HCl, pH 9.0. Fractions containing protein (measured by absorbance at 280 nm) were pooled, buffers were replaced with PBS (pH 7.4) and purified antibodies were stored at + 4 ° C. The concentration of stagnant antibody was measured by UV absorbance at 280 nm. Purified antibodies were tested for binding to their target human CD4 via competitive ELISA. Nunc MaxiSorp 96 well flat bottom microtiter plates (Fisher) were coated overnight at 4 ° C. with 50 μl / well of 1 μg / ml CD4 dissolved in PBS pH 7.4. Duplicate titrations of mouse and epitope deficient antibody samples were generated (in the range of 0.005 μg / ml to 12 μg / ml) and dissolved in PBS (pH 7.4) / 2% BSA. Mixed with constant concentration (0.2 μg / ml). Titration (final volume of 100 μl / well) was added to pre-washed (4 × with PBS pH 7.4) /0.05% Tween 20 assay plates and incubated for 1 hour at room temperature. Next, the plate is washed as described above, 100 μl / well of 1/500 dilution of streptavidin HRP (Sigma) dissolved in PBS pH 7.4 / 0.05% Tween 20 is added and another 1 hour at room temperature. Incubated. After further washing, bound biotinylated murine antibodies were detected with 100 μl / well of 3,3'-5,5 'tetramethylbenzidine substrate (Sigma). After stopping the reaction with 50 μl / well 3M HCl, the absorbance was measured at 450 nm with a Dynex Technologies MRX TCII plate reader, and the binding curve of the test antibody was compared to that of the rat reference standard and purified chimeric antibody. It became. The results are shown in FIGS. 15 and 16. Absorbance was plotted against sample concentration and straight lines were fitted through each data set. The linear equation was used to calculate the concentration (IC 50) needed to inhibit 50% binding of biotinylated murine antibodies to CD4. The IC50 value of the test sample was divided by the value of the mouse antibody to calculate the fold difference in binding efficiency. These values indicate that seven of the antibodies (highlighted by underline) bind within at least twice the rat reference antibody and four antibodies (VH1 / VK1, VH2 / VK2, VH4 / VK2, and VH4 / VK4) exhibit improved binding. It is reported in Table 8 showing the indication.

Relative Combination of Anti-CD4 Variants VK1 VK2 VK3 VK4 VH1 0.14 - - 5.06 VH2 8.66 0.96 - 1.44 VH3 - 1.77 - 1.44 VH4 3.89 0.73 - 0.49

List of references ( List of Reference )

DE 3919294

EP 1 454 137

US 20030153043

WO 199106667

WO 1998/59244;

WO 2000/34317;

WO 2004/112835

Aschan, J. Allogeneic haematopoietic stem cell transplantation: current status and future outlook. Br. Med Bull. 77-78, 23-36 (2006).

Auletta, J. J. & Cooke, K.R. Bone marrow transplantation: new approaches to immunosuppression and management of acute graft-versus-host disease. Curr. Opin. Pediatr. 21, 30-38 (2009).

Bacigalupo, A., Frassoni, F. & Van Lint, M. T. Bone marrow or peripheral blood as a source of stem cells for allogeneic transplantation. Haematologica 87, 4-8 (2002).

Bates, J. S., Engemann, A. M. & Hammond, J.M. Clinical utility of rituximab in chronic graft-versus-host disease. Ann. Pharmacother. 43, 316-321 (2009).

Benekli, M. et al. Muromonab-CD3 (Orthoclone OKT3), methylprednisolone and cyclosporine for acute graft-versus-host disease prophylaxis in allogeneic bone marrow transplantation. Bone Marrow Transplant. 38, 365-370 (2006).

Boon et al. (2002) Toxicology, 172: 191-203

Bowers, K., Pitcher, C. & Marsh, JM CD4: A co-receptor in the immune response and HIV infection. Int. J. Biochem. Cell Biol. 29, 871-875 (1997).

Chatenoud, L., Waldmann, H. & Emmrich, F. Tolerance induction in the adult: 'danger' at Le Bischenberg. Immunol. Today 16, 121-123 (1995).

Chen, HR et al. [CD25 monoclonal antibody for GVHD prophylaxis in non-T-cell depleted haploidentical bone marrow transplantation for treatment of childhood leukemia]. Zhonghua Er. Ke. Za Zhi. 42, 294-298 (2004).

Chester, K.A. & Hawkins, R. E. Clinical issues in antibody design. Trends Biotechnol. 13, 294-300 (1995).

Coligan et al., Current Protocols in Immunology, John Wiley & Sons 1991-1997

Cooke KR, Kobzik L, Martin TR, Brewer J, Delmonte J, Crawford JM et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation. The roles of minor H antigens and endotoxin. Blood 88 (8): 3230-3239 (1996)

Emmrich, F. et al. An anti-CD4 antibody for treatment of chronic inflammatory arthritis. Agents Actions Suppl 32, 165-170 (1991a).

Emmrich, J., Seyfarth, M., Fleig, W.E. & Emmrich, F. Treatment of inflammatory bowel disease with anti-CD4 monoclonal antibody. Lancet 338, 570-571 (1991b).

Fehervari, Z., Cooke, A., Brett, S. & Turner, J. Perturbation of naive TCR transgenic T cell functional responses and upstream activation events by anti-CD4 monoclonal antibodies. Eur. J. Immunol. 32, 333-340 (2002).

Harding, S., Lipp, P. & Alexander, D. R. A therapeutic CD4 monoclonal antibody inhibits TCR-zeta chain phosphorylation, zeta-associated protein of 70-kDa Tyr319 phosphorylation, and TCR internalization in primary human T cells. J. Immunol. 169, 230-238 (2002).

Harlow E & Lane D (2006) Antibody purification on protein A or protein G columns. Cold Spring Harb. Protoc .; 2006; doi: 10.1101 / pdb.prot4283

Higuchi et al. 1988, Nucleic Acids Res. 16: 7351

Hosono, M. et al. Human / mouse chimeric antibodies show low reactivity with human anti-murine antibodies (HAMA). Br. J. Cancer 65, 197-200 (1992).

Isaacs J. D. (1990) Sem. Immunol. 2: 449-456

Ji, SQ et al. Anti-CD25 monoclonal antibody (basiliximab) for prevention of graft-versus-host disease after haploidentical bone marrow transplantation for hematological malignancies. Bone Marrow Transplant. 36, 349-354 (2005).

Kabat et al. (1991) Sequences of proteins of immunological interest. 5th Edn. NIH Publication No. 91-3242

Kameda, H. & Takeuchi, T. Rheumatoid arthritis. Nippon Rinsho 67, 495-499 (2009).

Kern et al. (1998) Nature Medicine 4: 975-978

Kestendjieva, S. et al. Characterization of mesenchymal stem cells isolated from the human umbilical cord. Cell Biol. Int. 32, 724-732 (2008).

Knop, S. et al. Treatment of steroid-resistant acute GVHD with OKT3 and high-dose steroids results in better disease control and lower incidence of infectious complications when compared to high-dose steroids alone: a randomized multicenter trial by the EBMT Chronic Leukemia Working Party. Leukemia 21, 1830-1833 (2007).

Kohlhaw, K. et al. The monoclonal anti-CD4 antibody RIB5 / 2 induces donor-specific tolerance in the high-responder liver transplant model in the rat. Transplant. Proc. 33, 2371-2373 (2001).

Kwok et al (2001) TRENDS in Immunol. 22: 583-588

Laub, R. et al. Anti-human CD4 induces peripheral tolerance in a human CD4 +, murine CD4-, HLA-DR + advanced transgenic mouse model. J. Immunol. 169, 2947-2955 (2002).

Laub, R. et al. A multiple transgenic mouse model with a partially humanized activation pathway for helper T cell responses. J. Immunol. Methods 246, 37-50 (2000).

Madrenas, J., Schwartz, R. H. & Germain, R.N. Interleukin 2 production, not the pattern of early T-cell antigen receptor-dependent tyrosine phosphorylation, controls anergy induction by both agonists and partial agonists. Proc. Natl. Acad. Sci. U.S.A 93, 9736-9741 (1996).

Marshall et al. (1994) J. Immunol. 152: 4946-4956

O'Sullivan et al. (1990) J. Immunol. 145: 1799-1808

Reinke, P. et al. Anti-CD4 therapy of acute rejection in long-term renal allograft recipients. Lancet 338, 702-703 (1991).

Reinke, P. et al. Anti-CD4 monoclonal antibody therapy of late acute rejection in renal allograft recipients--CD4 + T cells play an essential role in the rejection process. Transplant. Proc. 27, 859-862 (1995).

Robadey et al. (1997) J. Immunol 159: 3238-3246

Schroff et al. (1985) Cancer Res. 45: 879-885

Senolt, L., Vencovsky, J., Pavelka, K., Ospelt, C. & Gay, S. Prospective new biological therapies for rheumatoid arthritis. Autoimmun. Rev. (2009).

Stern et al. (1994) Nature 368: 215-221

von Bonin, M. et al. Treatment of refractory acute GVHD with third-party MSC expanded in platelet lysate-containing medium. Bone Marrow Transplant. 43, 245-251 (2009).

DEUTSCHE SAMMLUNG VON MIKROORGANISMEN UND ZELLKULTUREN GmbH (DSMZ) DSMACC3147 20111202 DEUTSCHE SAMMLUNG VON MIKROORGANISMEN UND ZELLKULTUREN GmbH (DSMZ) DSMACC3148 20111202

<110> FRAUNHOFER-GESELLSCHAFT ZUR FORDERUNG DER ANGEWANDTEN FORSCHUNG E.V. <120> Tolerance induction or immunosupression to prevent in particular          Graft-versus-Host-Disease (GvHD) by short-term pre-incubation of          transplanted cell suspensions, tissues or organs coated with          ligands to cell surface molecules <130> F67480PC <150> EP 10015236.2 <151> 2010-12-02 <160> 134 <170> PatentIn version 3.5 <210> 1 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Mouse Anti-CD4 Heavy Chain <220> <221> CDS (222) (1) .. (360) <400> 1 gag gtt cag ctc cag cag tct ggg act gtg ctg gca agg cct ggg gct 48 Glu Val Gln Leu Gln Gln Ser Gly Thr Val Leu Ala Arg Pro Gly Ala   1 5 10 15 tcc gtg cag atg tcc tgc aag gct tct ggc tac agc ttt gcc aac tac 96 Ser Val Gln Met Ser Cys Lys Ala Ser Gly Tyr Ser Phe Ala Asn Tyr              20 25 30 tgg atg cac tgg gta aaa cag agg cct gga cag ggt cta caa tgg att 144 Trp Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Gln Trp Ile          35 40 45 ggt gct ctt tat cct gga aat gtt gat act acc tac aac cag aag ttc 192 Gly Ala Leu Tyr Pro Gly Asn Val Asp Thr Thr Tyr Asn Gln Lys Phe      50 55 60 aag gac aag gcc aaa ctg act gca gtc aca tcc gcc agc act gcc tac 240 Lys Asp Lys Ala Lys Leu Thr Ala Val Thr Ser Ala Ser Thr Ala Tyr  65 70 75 80 atg gag ctc agc agc ctg aca aat gag gac tct gcg gtc tat tac tgt 288 Met Glu Leu Ser Ser Leu Thr Asn Glu Asp Ser Ala Val Tyr Tyr Cys                  85 90 95 aca aga atg ggt act act tta gaa gcc ccc ctt gac tat tgg ggc caa 336 Thr Arg Met Gly Thr Thr Leu Glu Ala Pro Leu Asp Tyr Trp Gly Gln             100 105 110 ggc acc act ctc aca gtc tcc tca 360 Gly Thr Thr Leu Thr Val Ser Ser         115 120 <210> 3 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Heavy chain VH4 <220> <221> CDS (222) (1) .. (360) <400> 3 gag gtt cag ctc cag cag tct ggg act gag ctg aaa agg cct ggg gct 48 Glu Val Gln Leu Gln Gln Ser Gly Thr Glu Leu Lys Arg Pro Gly Ala   1 5 10 15 tcc gtg aag atg tcc tgc aag gct tct ggc tac acc ttt gcc aac tac 96 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ala Asn Tyr              20 25 30 tgg atg cac tgg gta aaa cag gcc cct gga cag ggt cta caa tgg att 144 Trp Met His Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Gln Trp Ile          35 40 45 ggt gct ctt tat cct gga aat gtt gat act acc tac aac cag aag ttc 192 Gly Ala Leu Tyr Pro Gly Asn Val Asp Thr Thr Tyr Asn Gln Lys Phe      50 55 60 aag gac aag gcc aaa ctg act gca gtc aca tcc gcc agc act gcc tac 240 Lys Asp Lys Ala Lys Leu Thr Ala Val Thr Ser Ala Ser Thr Ala Tyr  65 70 75 80 atg gag ctc agc agc ctg aca aat gag gac tct gcg gtc tat tac tgt 288 Met Glu Leu Ser Ser Leu Thr Asn Glu Asp Ser Ala Val Tyr Tyr Cys                  85 90 95 aca aga atg ggt act act tta gaa gcc ccc ctt gac tat tgg ggc caa 336 Thr Arg Met Gly Thr Thr Leu Glu Ala Pro Leu Asp Tyr Trp Gly Gln             100 105 110 ggc acc act gtc aca gtc tcc tca 360 Gly Thr Thr Val Thr Val Ser Ser         115 120 <210> 5 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Heavy chain VH3 <220> <221> CDS (222) (1) .. (360) <400> 5 gag gtt cag ctc cag cag tct ggg tct gag ctg aaa agg cct ggg gct 48 Glu Val Gln Leu Gln Gln Ser Gly Ser Glu Leu Lys Arg Pro Gly Ala   1 5 10 15 tcc gtg aag atg tcc tgc aag gct tct ggc tac acc ttt gcc aac tac 96 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ala Asn Tyr              20 25 30 tgg atg cac tgg gta aaa cag gcc cct gga cag ggt cta caa tgg att 144 Trp Met His Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Gln Trp Ile          35 40 45 ggt gct ctt tat cct gga aat gtt gat act acc tac aac cag aag ttc 192 Gly Ala Leu Tyr Pro Gly Asn Val Asp Thr Thr Tyr Asn Gln Lys Phe      50 55 60 aag gac aag gcc aaa ctg act gca gtc aca tcc gcc agc act gcc tac 240 Lys Asp Lys Ala Lys Leu Thr Ala Val Thr Ser Ala Ser Thr Ala Tyr  65 70 75 80 atg gag ctc agc agc ctg aca aat gag gac acc gcg gtc tat tac tgt 288 Met Glu Leu Ser Ser Leu Thr Asn Glu Asp Thr Ala Val Tyr Tyr Cys                  85 90 95 aca aga atg ggt act act tta gaa gcc ccc ctt gac tat tgg ggc caa 336 Thr Arg Met Gly Thr Thr Leu Glu Ala Pro Leu Asp Tyr Trp Gly Gln             100 105 110 ggc acc ctt gtc aca gtc tcc tca 360 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 7 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Heavy chain VH2 <220> <221> CDS (222) (1) .. (360) <400> 7 gag gtt cag ctc cag cag tct ggg tct gag ctg aaa agg cct ggg gct 48 Glu Val Gln Leu Gln Gln Ser Gly Ser Glu Leu Lys Arg Pro Gly Ala   1 5 10 15 tcc gtg aag gtg tcc tgc aag gct tct ggc tac acc ttt gcc aac tac 96 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ala Asn Tyr              20 25 30 tgg atg cac tgg gta aaa cag gcc cct gga cag ggt cta caa tgg att 144 Trp Met His Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Gln Trp Ile          35 40 45 ggt gct ctt tat cct gga aat gtt gat act acc tac aac cag aag ttc 192 Gly Ala Leu Tyr Pro Gly Asn Val Asp Thr Thr Tyr Asn Gln Lys Phe      50 55 60 aag gac aag gcc aaa ctg act gca gac aca tcc gcc agc act gcc tac 240 Lys Asp Lys Ala Lys Leu Thr Ala Asp Thr Ser Ala Ser Thr Ala Tyr  65 70 75 80 atg gag ctc agc agc ctg aca aat gag gac acc gcg gtc tat tac tgt 288 Met Glu Leu Ser Ser Leu Thr Asn Glu Asp Thr Ala Val Tyr Tyr Cys                  85 90 95 aca aga atg ggt act act tta gaa gcc ccc ctt gac tat tgg ggc caa 336 Thr Arg Met Gly Thr Thr Leu Glu Ala Pro Leu Asp Tyr Trp Gly Gln             100 105 110 ggc acc ctt gtc aca gtc tcc tca 360 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 9 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Heavy chain VH1 <220> <221> CDS (222) (1) .. (360) <400> 9 gag gtt cag ctc cag cag tct ggg tct gag ctg aaa agg cct ggg gct 48 Glu Val Gln Leu Gln Gln Ser Gly Ser Glu Leu Lys Arg Pro Gly Ala   1 5 10 15 tcc gtg aag gtg tcc tgc aag gct tct ggc tac acc ttt gcc aac tac 96 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ala Asn Tyr              20 25 30 tgg atg cac tgg gta aga cag gcc cct gga cag ggt cta caa tgg att 144 Trp Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Gln Trp Ile          35 40 45 ggt gct ctt tat cct gga aat gtt gat act acc tac aac cag aag ttc 192 Gly Ala Leu Tyr Pro Gly Asn Val Asp Thr Thr Tyr Asn Gln Lys Phe      50 55 60 aag gac aag gcc aaa atc act aga gac aca tcc gcc agc act gcc tac 240 Lys Asp Lys Ala Lys Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr  65 70 75 80 atg gag ctc agc agc ctg aca aat gag gac acc gcg gtc tat tac tgt 288 Met Glu Leu Ser Ser Leu Thr Asn Glu Asp Thr Ala Val Tyr Tyr Cys                  85 90 95 aca aga atg ggt act act tta gaa gcc ccc ctt gac tat tgg ggc caa 336 Thr Arg Met Gly Thr Thr Leu Glu Ala Pro Leu Asp Tyr Trp Gly Gln             100 105 110 ggc acc ctt gtc aca gtc tcc tca 360 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 11 <211> 318 <212> DNA <213> Artificial Sequence <220> <223> Mouse Anti-CD4 Light Chain <220> <221> CDS (222) (1) .. (318) <400> 11 caa att gtt ctc acc cag tct cca gca atc atg tct gca tct cca ggg 48 Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly   1 5 10 15 gag aag gtc gcc atg acc tgc agt gcc agg tca agt gta agt tac ttg 96 Glu Lys Val Ala Met Thr Cys Ser Ala Arg Ser Ser Val Ser Tyr Leu              20 25 30 tac tgg tac cag cag aag cca gga tcc tcc ccc aga ctc ctg att tat 144 Tyr Trp Gln Gln Lys Pro Gly Ser Ser Pro Arg Leu Leu Ile Tyr          35 40 45 gac aca tcc aac ctg gct tct gga gtc cct gtt cgc ttc att ggc agt 192 Asp Thr Ser Asn Leu Ala Ser Gly Val Pro Val Arg Phe Ile Gly Ser      50 55 60 ggg tct ggg acc tct tac tct ctc aca atc agc cga atg gag gct gaa 240 Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Met Glu Ala Glu  65 70 75 80 gat gct gcc act tat tac tgc cag cag tgg agt gat tac ccg ctc acg 288 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Asp Tyr Pro Leu Thr                  85 90 95 ttc ggt gct ggg acc aag ctg gag ctg aaa 318 Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys             100 105 <210> 13 <211> 318 <212> DNA <213> Artificial Sequence <220> <223> Light Chain VK4 <220> <221> CDS (222) (1) .. (318) <400> 13 caa att gtt ctc acc cag tct cca gca atc ctg tct gca tct cca ggg 48 Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly   1 5 10 15 gag aag gcc gcc atg acc tgc agt gcc agg tca agt gta agt tac ttg 96 Glu Lys Ala Ala Met Thr Cys Ser Ala Arg Ser Ser Val Ser Tyr Leu              20 25 30 tac tgg tac cag cag aag cca ggg tcc tcc ccc aga ctc ctg att tat 144 Tyr Trp Gln Gln Lys Pro Gly Ser Ser Pro Arg Leu Leu Ile Tyr          35 40 45 gac aca tcc aac ctg gct tct gga gtc cct tct cgc ttc att ggc agt 192 Asp Thr Ser Asn Leu Ala Ser Gly Val Pro Ser Arg Phe Ile Gly Ser      50 55 60 ggg tct ggg acc gat tac tct ctc aca atc agc agc atg gag gct gaa 240 Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu  65 70 75 80 gat gct gcc act tat tac tgc cag cag tgg agt gat tac ccg ctc acg 288 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Asp Tyr Pro Leu Thr                  85 90 95 ttc ggt gct ggg acc aag ctg gag atc aaa 318 Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys             100 105 <210> 15 <211> 318 <212> DNA <213> Artificial Sequence <220> <223> Light chain VK3 <220> <221> CDS (222) (1) .. (318) <400> 15 caa att gtt ctc acc cag tct cca gca acc ctg tct gca tct cca ggg 48 Gln Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Ala Ser Pro Gly   1 5 10 15 gag aag gcc gcc atg acc tgc agt gcc agg tca agt gta agt tac ttg 96 Glu Lys Ala Ala Met Thr Cys Ser Ala Arg Ser Ser Val Ser Tyr Leu              20 25 30 tac tgg tac cag cag aag cca ggg tcc tcc ccc aga ctc ctg att tat 144 Tyr Trp Gln Gln Lys Pro Gly Ser Ser Pro Arg Leu Leu Ile Tyr          35 40 45 gac aca tcc aac ctg gct tct gga gtc cct tct cgc ttc att ggc agt 192 Asp Thr Ser Asn Leu Ala Ser Gly Val Pro Ser Arg Phe Ile Gly Ser      50 55 60 ggg tct ggg acc gat tac tct ctc aca atc agc agc atg gag gct gaa 240 Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu  65 70 75 80 gat gct gcc act tat tac tgc cag cag tgg agt gat tac ccg ctc acg 288 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Asp Tyr Pro Leu Thr                  85 90 95 ttc ggt gct ggg acc aag ctg gag atc aaa 318 Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys             100 105 <210> 17 <211> 318 <212> DNA <213> Artificial Sequence <220> <223> Light chain VK2 <220> <221> CDS (222) (1) .. (318) <400> 17 caa att gtt ctc acc cag tct cca gca acc ctg tct gca tct cca ggg 48 Gln Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Ala Ser Pro Gly   1 5 10 15 gag aag gcc gcc atg acc tgc agt gcc agg tca agt gta agt tac ttg 96 Glu Lys Ala Ala Met Thr Cys Ser Ala Arg Ser Ser Val Ser Tyr Leu              20 25 30 tac tgg tac cag cag aag cca ggg tcc tcc ccc aga ctc ctg att tat 144 Tyr Trp Gln Gln Lys Pro Gly Ser Ser Pro Arg Leu Leu Ile Tyr          35 40 45 gac aca tcc aac ctg gct tct gga gtc cct tct cgc ttc agc ggc agt 192 Asp Thr Ser Asn Leu Ala Ser Gly Val Pro Ser Arg Phe Ser Gly Ser      50 55 60 ggg tct ggg acc gat tac tct ctc aca atc agc agc atg gag gct gaa 240 Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu  65 70 75 80 gat gct gcc act tat tac tgc cag cag tgg agt gat tac ccg ctc acg 288 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Asp Tyr Pro Leu Thr                  85 90 95 ttc ggt gct ggg acc aag ctg gag atc aaa 318 Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys             100 105 <210> 19 <211> 318 <212> DNA <213> Artificial Sequence <220> <223> Light chain VK1 <220> <221> CDS (222) (1) .. (318) <400> 19 caa att gtt ctc acc cag tct cca gca acc ctg tct gca tct cca ggg 48 Gln Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Ala Ser Pro Gly   1 5 10 15 gag aag gcc gcc atg acc tgc agt gcc agg tca agt gta agt tac ttg 96 Glu Lys Ala Ala Met Thr Cys Ser Ala Arg Ser Ser Val Ser Tyr Leu              20 25 30 tac tgg tac cag cag aag cca ggg tcc tcc ccc aga gcc ctg att tat 144 Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Arg Ala Leu Ile Tyr          35 40 45 gac aca tcc aac ctg gct tct gga gtc cct tct cgc ttc agc ggc agt 192 Asp Thr Ser Asn Leu Ala Ser Gly Val Pro Ser Arg Phe Ser Gly Ser      50 55 60 ggg tct ggg acc gat tac tct ctc aca atc agc agc atg gag gct gaa 240 Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu  65 70 75 80 gat gct gcc act tat tac tgc cag cag tgg agt gat tac ccg ctc acg 288 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Asp Tyr Pro Leu Thr                  85 90 95 ttc ggt gct ggg acc aag ctg gag atc aaa 318 Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys             100 105 <210> 21 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 21 Val Lys Gln Arg Pro Gly Gln Gly Leu   1 5 <210> 22 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 22 Leu Thr Ala Val Thr Ser Ala Ser Thr   1 5 <210> 23 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 23 Val Thr Ser Ala Ser Thr Ala Tyr Met   1 5 <210> 24 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 24 Leu Ser Ser Leu Thr Asn Glu Asp Ser   1 5 <210> 25 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 25 Leu Asp Tyr Trp Gly Gln Gly Thr Thr   1 5 <210> 26 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 26 Trp Gly Gln Gly Thr Thr Leu Thr Val   1 5 <210> 27 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 27 Ile Val Leu Thr Gln Ser Pro Ala Ile   1 5 <210> 28 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 28 Val Leu Thr Gln Ser Pro Ala Ile Met   1 5 <210> 29 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 29 Ile Met Ser Ala Ser Pro Gly Glu Lys   1 5 <210> 30 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 30 Met Ser Ala Ser Pro Gly Glu Lys Val   1 5 <210> 31 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 31 Leu Leu Ile Tyr Asp Thr Ser Asn Leu   1 5 <210> 32 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 32 Leu Ala Ser Gly Val Pro Val Arg Phe   1 5 <210> 33 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 33 Val Arg Phe Ile Gly Ser Gly Ser Gly   1 5 <210> 34 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 34 Phe Ile Gly Ser Gly Ser Gly Thr Ser   1 5 <210> 35 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 35 Ile Gly Ser Gly Ser Gly Thr Ser Tyr   1 5 <210> 36 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 36 Tyr Ser Leu Thr Ile Ser Arg Met Glu   1 5 <210> 37 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 37 Phe Gly Ala Gly Thr Lys Leu Glu Leu   1 5 <210> 38 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 38 Leu Gln Gln Ser Gly Thr Glu Leu Lys   1 5 <210> 39 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 39 Leu Gln Gln Ser Gly Ser Glu Leu Lys   1 5 <210> 40 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 40 Glu Leu Lys Arg Pro Gly Ala Ser Val   1 5 <210> 41 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 41 Leu Lys Arg Pro Gly Ala Ser Val Lys   1 5 <210> 42 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 42 Met Ser Cys Lys Ala Ser Gly Tyr Thr   1 5 <210> 43 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 43 Val Ser Cys Lys Ala Ser Gly Tyr Thr   1 5 <210> 44 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 44 Val Lys Gln Ala Pro Gly Gln Gly Leu   1 5 <210> 45 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 45 Leu Thr Ala Asp Thr Ser Ala Ser Thr   1 5 <210> 46 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 46 Ile Thr Arg Asp Thr Ser Ala Ser Thr   1 5 <210> 47 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 47 Asp Thr Ser Ala Ser Thr Ala Tyr Met   1 5 <210> 48 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 48 Leu Ser Ser Leu Thr Asn Glu Asp Thr   1 5 <210> 49 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 49 Leu Asp Tyr Trp Gly Gln Gly Thr Leu   1 5 <210> 50 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 50 Trp Gly Gln Gly Thr Thr Val Thr Val   1 5 <210> 51 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 51 Trp Gly Gln Gly Thr Leu Val Thr Val   1 5 <210> 52 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 52 Ile Val Leu Thr Gln Ser Pro Ala Thr   1 5 <210> 53 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 53 Val Leu Thr Gln Ser Pro Ala Thr Leu   1 5 <210> 54 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 54 Thr Leu Ser Ala Ser Pro Gly Glu Lys   1 5 <210> 55 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 55 Leu Ser Ala Ser Pro Gly Glu Lys Val   1 5 <210> 56 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 56 Ala Leu Ile Tyr Asp Thr Ser Asn Leu   1 5 <210> 57 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 57 Leu Ala Ser Gly Val Pro Ser Arg Phe   1 5 <210> 58 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 58 Ser Arg Phe Ile Gly Ser Gly Ser Gly   1 5 <210> 59 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 59 Ser Arg Phe Ser Gly Ser Gly Ser Gly   1 5 <210> 60 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 60 Phe Ile Gly Ser Gly Ser Gly Thr Asp   1 5 <210> 61 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 61 Phe Ser Gly Ser Gly Ser Gly Thr Asp   1 5 <210> 62 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 62 Ile Gly Ser Gly Ser Gly Thr Asp Tyr   1 5 <210> 63 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 63 Ser Gly Ser Gly Ser Gly Thr Asp Tyr   1 5 <210> 64 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 64 Tyr Ser Leu Thr Ile Ser Ser Met Glu   1 5 <210> 65 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 65 Phe Gly Ala Gly Thr Lys Leu Glu Ile   1 5 <210> 66 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 66 atgrasttsk ggytmarctk grttt 25 <210> 67 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 67 atgraatgsa sctgggtywt yctctt 26 <210> 68 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 68 atggactcca ggctcaattt agttttcct 29 <210> 69 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 69 atggctgtcy trgbgctgyt cytctg 26 <210> 70 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 70 atggvttggs tgtggamctt gcyattcct 29 <210> 71 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 71 atgaaatgca gctggrtyat sttctt 26 <210> 72 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 72 atggrcagrc ttacwtyytc attcct 26 <210> 73 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 73 atgatggtgt taagtcttct gtacct 26 <210> 74 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 74 atgggatgga gctrtatcat sytctt 26 <210> 75 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 75 atgaagwtgt ggbtraactg grt 23 <210> 76 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <220> <221> modified_base &Lt; 222 > (15) <223> I <400> 76 atggratgga sckkrrtctt tmtct 25 <210> 77 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 77 atgaacttyg ggytsagmtt grttt 25 <210> 78 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 78 atgtacttgg gactgagctg tgtat 25 <210> 79 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 79 atgagagtgc tgattctttt gtg 23 <210> 80 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 80 atggattttg ggctgatttt ttttattg 28 <210> 81 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <220> <221> modified_base <222> (21) <223> I <400> 81 ccagggrcca rkggatarac rgrtgg 26 <210> 82 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 82 atgragwcac akwcycaggt cttt 24 <210> 83 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 83 atggagacag acacactcct gctat 25 <210> 84 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 84 atggagwcag acacactsct gytatgggt 29 <210> 85 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <220> <221> modified_base <222> (27) <223> I <400> 85 atgaggrccc ctgctcagwt tyttggrwtc tt 32 <210> 86 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 86 atgggcwtca agatgragtc acakwyycwg g 31 <210> 87 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 87 atgagtgtgc ycactcaggt cctggsgtt 29 <210> 88 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 88 atgtggggay cgktttyamm cttttcaatt g 31 <210> 89 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 89 atggaagccc cagctcagct tctcttcc 28 <210> 90 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <220> <221> modified_base <222> (6) <223> I <220> <221> modified_base <12> <223> I <220> <221> modified_base <222> (18) <223> I <400> 90 atgagrmmkt crmttcartt cytggg 26 <210> 91 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <220> <221> modified_base <12> <223> I <220> <221> modified_base <222> (24) <223> I <400> 91 atgakgthcy crgctcagyt yctrrg 26 <210> 92 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 92 atggtrtccw casctcagtt ccttg 25 <210> 93 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 93 atgtatatat gtttgttgtc tatttct 27 <210> 94 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 94 atgaagttgc ctgttaggct gttggtgct 29 <210> 95 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 95 atggatttwc argtgcagat twtcagctt 29 <210> 96 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 96 atggtyctya tvtccttgct gttctgg 27 <210> 97 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 97 atggtyctya tvttrctgct gctatgg 27 <210> 98 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 98 actggatggt gggaagatgg a 21 <210> 99 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 99 atggcctgga ytycwctywt mytct 25 <210> 100 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <220> <221> modified_base &Lt; 222 > (15) <223> I <400> 100 agctcytcwg wggarggygg raa 23 <210> 101 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 101 gatcacgcgt gtccactccg aagtgcagct ggtggagtc 39 <210> 102 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 102 gtacaagctt acctgaggag acggtgactg agg 33 <210> 103 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 103 catggcgcgc gatgtgacat ccagatgact cagtc 35 <210> 104 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 104 tgcgggatcc aactgaggaa gcaaagttta aattctactc acgtctcagc tccagcttgg 60 tcc 63 <210> 105 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 105 gttgctacgc gtgtccactc cgaggttcag ctccagcagt ctgggactga gctgaaaagg 60 cctgg 65 <210> 106 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 106 actgagctga aaaggcctgg ggcttccgtg aagatgtcct gcaaggcttc tggctacacc 60 tttgc 65 <210> 107 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 107 acagggtcta caatggattg g 21 <210> 108 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 108 ccaatccatt gtagaccctg tccaggggcc tgtttta 37 <210> 109 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 109 cccagaaagc ttacctgagg agactgtgac agtggtgcc 39 <210> 110 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 110 gttgctacgc gtgtccactc cgaggttcag ctccagcagt ctgggtctga gctgaaaagg 60                                                                           60 <210> 111 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 111 caaatgagga caccgcggtc tatt 24 <210> 112 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 112 aatagaccgc ggtgtcctca tttg 24 <210> 113 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 113 cccagaaagc ttacctgagg agactgtgac aagggtgcc 39 <210> 114 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 114 cttccgtgaa ggtgtcctgc aaggc 25 <210> 115 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 115 gccttgcagg acaccttcac ggaag 25 <210> 116 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 116 aactgactgc agacacatcc gccag 25 <210> 117 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 117 ctggcggatg tgtctgcagt cagtt 25 <210> 118 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 118 tgcactgggt aagacaggcc cctgg 25 <210> 119 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 119 ccaggggcct gtcttaccca gtgca 25 <210> 120 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 120 gttcaaggac aaggccaaaa tcactagaga cacatccgcc agcact 46 <210> 121 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 121 agtgctggcg gatgtgtctc tagtgatttt ggccttgtcc ttgaac 46 <210> 122 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 122 ctccagggga gaaggccgcc atgacc 26 <210> 123 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 123 ggtcatggcg gccttctccc ctggag 26 <210> 124 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 124 tcctgattta tgacacatcc aacctggctt ctggagtccc ttctcgcttc a 51 <210> 125 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 125 gttggatgtg tcataaatca gga 23 <210> 126 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 126 tctgggaccg attactctct cacaatcagc agcatggagg ctg 43 <210> 127 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 127 cagcctccat gctgctgatt gtgagagagt aatcggtccc aga 43 <210> 128 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 128 attgcgggat ccaactgagg aagcaaagtt taaattctac tcacgtttga tctccagctt 60 g 61 <210> 129 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 129 cccaggcgcg cgatgtcaaa ttgttctcac ccagtctcca gcaaccctgt ctgca 55 <210> 130 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 130 ttctcgcttc agcggcagtg gg 22 <210> 131 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 131 cccactgccg ctgaagcgag aa 22 <210> 132 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 132 ctcccccaga gccctgattt at 22 <210> 133 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 133 ataaatcagg gctctggggg ag 22 <210> 134 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> epitope <400> 134 Val Arg Gln Ala Pro Gly Gln Gly Leu   1 5

Claims (16)

In vitro methods for modifying cell grafts containing immune cells,
a) culturing a cell graft containing immune cells with an anti CD4 antibody, wherein the culturing is performed for 1 minute to 7 days,
b) removing the unbound antibody from the graft
Including, in vitro method. The method of claim 1, wherein the culture is
i) for 1 to 150 minutes, in particular for 5 to 150 minutes, more specifically for 10 to 150 minutes, more specifically for 30 to 150 minutes, more specifically for 40 to 120 minutes, more specific For 45 to 90 minutes, in particular 50 to 70 minutes, or
ii) ex vivo, which is carried out for 150 minutes to 7 days, in particular for 150 minutes to 5 days, more specifically for 150 minutes to 3 days, more specifically for 150 minutes to 1 day, especially for 150 minutes to 8 hours Way. The method of claim 1 or 2, wherein the culturing is carried out with an antibody amount of 0.1 µg to 100 mg, in particular,
i) when the graft is a cell suspension, 0.1 μg / ml cell suspension to 150 μg / ml cell suspension, in particular 7 μg / ml cell suspension to 100 μg / ml cell suspension, more specifically 30 μg / ml Running at an antibody concentration of from cell suspension to 100 μg / ml cell suspension, in particular from 40 μg / ml cell suspension to 60 μg / ml cell suspension, or
ii) when the graft is a tissue or organ, the antibody amount of 0.1 mg to 10 mg, in particular 1 mg to 10 mg, more specifically 2 mg to 9 mg, more specifically 3 mg to 8 mg, especially 4 mg to 6 mg Performed in vitro, in vitro methods. The method according to any one of claims 1 to 3, wherein the method
i) reducing the likelihood of any of the groups consisting of GvHD, donor graft rejection, and organ rejection, in particular, when transplanting the graft,
ii) tolerance in transplanted immunocompetent cells to tissue of the receptor upon transplantation of the modified graft,
iii) attaining or achieving resistance or partial resistance in the tissue of the receptor to the modified graft upon implantation of the modified graft,
iv) an ex vivo method for inhibiting cell activation in said graft. The method of claim 1, wherein the graft is
i) selected from the group consisting of cell suspensions, tissues, and organs,
ii) an ex vivo method comprising stem cells. The method of claim 5, wherein the graft, bone marrow cells (non adherent bone marrow cells), peripheral blood cells (peripheral blood cells), cord blood cells (cord blood cells), Barton Cell suspension comprising cells of Wharton's jelly, placenta-derived cells, hair-root-derived cells, and / or fat-tissue-derived cells ; Cell suspensions including lymphocytes, monocytes and / or macrophage; Tissue containing stem cells; Organs containing stem cells; Tissue containing immune cells; And an organ containing immune cells. In a modified cell graft containing immune cells,
The graft,
i) obtainable according to the method of any one of claims 1 to 6 and / or
ii) a modified cell graft comprising an anti-CD4 antibody bound to 40% to 100% of the accessible CD4 epitope of the graft. 8. The modified cell graft of claim 7 for use in a drug. 8. The modified cell graft of claim 7 for use in a method of treating in a patient one or more diseases that can be treated by transplantation. The method of claim 7, wherein the graft is
i) selected from the group consisting of cell suspensions, tissues, and organs,
ii) modified cell graft comprising stem cells. The method of claim 10, wherein the graft is derived from bone marrow cells, non-adherent bone marrow cells, peripheral blood cells, cord blood cells, cells of Wharton's jelly, placental induction cells, hair root induction cells, and / or adipose tissue induction. Cell suspensions comprising cells; Cell suspensions comprising lymphocytes, monocytes and / or macrophages; Tissue containing stem cells; Organs containing stem cells; Tissue containing immune cells; And organs containing immune cells. The method according to any one of claims 9 to 11, wherein the treatment is
i) means a reduced likelihood of developing any one of the group consisting of GvHD, donor graft rejection, and organ rejection, in particular, a reduced likelihood of developing GvHD upon implantation of the graft;
ii) resistance in the transplanted immunocompetent cells to tissue of the receptor upon transplantation of the modified graft,
iii) the resistance or partial resistance in the tissue of the receptor to the modified graft upon implantation of the modified graft;
iv) Modified cell graft for inhibiting cell activation within the graft. The method of claim 9, wherein the graft is a cell suspension, wherein the graft is 2 × 10 ⁶ cells to 2 × 10 ¹⁰ nucleated cells, in particular 4 × 10 ⁶ to 1 × 10 ⁹ nucleus. The modified cell graft wherein the amount of cells, more specifically 1 × 10 ⁷ to 1 × 10 ⁸ nucleated cells, is administered to the patient. 14. A method, modified graft, or modified graft for use as claimed in any of claims 1 to 13, wherein
The anti-CD4 antibody,
i) Max16H5, OKT4A, OKTcdr4a, cMT-412, YHB.46, in particular the anti-CD4 antibody is Max16H5, or
ii) is antibody 30F16H5, or
iii) an access number can be obtained from a cell line deposited with ECACC 88050502, or
iv) can be obtained from the cell line MAX.16H5 / 30F16H5 deposited in DSMZ on Dec. 2, 2011, or
v) is antibody 16H5.chimIgG4, or
vi) can be obtained from the cell line CD4.16H5.chimIgG4 deposited in DSMZ on Dec. 2, 2011, or
vii) the antibody comprises the VH and VK of antibody 16H5.chimIgG4, or
viii) an antibody comprising the VH and VK of an antibody obtainable from the cell line CD4.16H5.chimIgG4 deposited in DSMZ on Dec. 2, 2011, or
ix) an antibody comprising any combination of the VH described in FIG. 12 and the VK described in FIG. 13, in particular wherein said combination is selected from VH1 / VK1, VH2 / VK2, VH4 / VK2, and VH4 / VK4, in particular , Wherein the combination is VH2 / VK2, modified graft, or modified graft for use. 14. A method, modified graft, or modified graft for use as claimed in any of claims 1 to 13, wherein
The graft is a soluble bioactive molecule,
In particular, agents that promote the formation of immunosuppression, immunotolerance and / or regulatory T cells,
In particular, a medicament selected from the group consisting of II-2, TGF- β , rapamycin, retinoic acid, 4-1BB ligand, and anti-CD28 antibody, or any combination thereof
A method, modified graft, or modified graft for use, which is further cultured. In the anti-CD4 antibody,
i) antibody 16H5.chimIgG4,
ii) an antibody obtainable from the cell line CD4.16H5.chimIgG4 deposited in DSZM on Dec. 2, 2011,
iii) an antibody comprising the VH and VK of antibody 16H5.chimIgG4,
iv) an antibody comprising the VH and VK of an antibody obtainable from the cell line CD4.16H5.chimIgG4 deposited in DSMZ on Dec. 2, 2011,
v) an antibody comprising a combination of VH described in FIG. 12 and VK described in FIG. 13, wherein the combination is selected from VH1 / VK1, VH2 / VK2, VH4 / VK2, and VH4 / VK4, in particular the combination being VH2 With antibody, which is / VK2
An anti CD4 antibody, selected from the group consisting of:

Images