KR20140021799A - Lfa3 variant and fusion protein comprising target specific polypeptide linked to the lfa3 variant or lfa3 cd2 binding region and use thereof - Google Patents

Abstract

Disclosed are modified LFA3, polynucleotides coding for the same, and a vector and a host cell comprising the same. Also disclosed are modified LFA3 or wild-type LFA3, fusion proteins of target-specific polypeptides fused with the modified LFA3 or wild-type LFA3, and a use of the modified LFA3 or wild-type LFA3 as a disease treatment agent. The LFA3 mutant and the fusion protein comprising same disclosed in the present invention are produced to recognize a specific cell and induce death of specific cells such as cancer through the activation of the immune system, and therefore, can be used effectively in treating diseases.

Description

LFA3 variant and fusion protein linked to the variant or LFA3 CD2 binding region with a target specific polypeptide and use thereof {LFA3 variant and fusion protein comprising target specific polypeptide linked to the LFA3 variant or LFA3 CD2 binding region and use}

Therapeutic technology using LFA3 and its variants.

In various diseases including autoimmune diseases and cancer, targeted therapy using the immune system has emerged as an effective treatment method. Conventional treatment with the immune system utilizes an effector function that kills cells expressing specific antigens. For example, T cells, NK cells, macrophages, and the like are used to target specific immune affinity cells. Among them, T cells, in particular, are widely used, and a representative one of them is CD3. CD3 is involved in signal transduction and complexes with T cell receptors. CD3 is often used for the purpose of directly inducing cytotoxic T cells to kill cells expressing a particular antigen. However, various co-stimulatory factors are required for T cells to be activated. The CD3 target molecule that overcomes these limitations is BiTE (Bispecific T cell engager), which shows T-cell mediated cytotoxicity without co-stimulation compared to other CD3 antibodies (Curr Opin Mol Ther. 11, 22). -30 (2009) However, BiTE is polyclonally involved in T cell activity, but due to its small molecular size, its short half-life in the blood has the disadvantage of daily administration.

Another example is the use of T cell activating molecules, such as Lymphocyte Function associated Antigen-3 (LFA3). It is a protein present in antigen presenting cells and the like that binds to the CD2 receptor of T cells and induces proliferation of memory T cells to induce release of cytokines. Therefore, a drug for psoriasis treatment such as Alefacept (Biogen Inc.) using a fusion protein of LFA3 that interferes with CD2 binding and the Fc region of the antibody has been developed.

US Patent Publication No. 2006-0233796 relates to a memory effector T cell control method and composition, and discloses a therapeutic use for intestinal disease, rheumatoid arthritis, multiple sclerosis using the CD2 binding region of LFA3.

US Patent No. 5,547,853 discloses the CD2 binding region sequence of LFA3.

However, in the production and side effects of therapeutic agents for a variety of diseases that can target specific cells using T cell activating molecules, there is a need for the development of improved materials.

The present invention has been made to solve the above problems, to provide a method that can effectively kill cells that specifically express a specific factor associated with the disease using the immune system.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In one aspect provided herein is a CD2 binding polypeptide of modified LFA3. The CD2 binding polypeptide variant according to the present invention comprises 29 to 123 amino acid residues based on the sequence of SEQ ID NO: 1, wherein the modification is substituted at any of the following positions with any of the amino acids described in each position below LFA3 CD2 Binding Polypeptide: 36th amino acid is selected from Thr, Lys, Pro or Val in Val; The 37th amino acid is Val in Trp, Lys or Val; The 38th amino acid is Lys or Gly at Tyr; 40th amino acid is selected from Asp or Thr in Asn; The 76th amino acid is Ser to Asp, or Arg; The 79th amino acid is Gly to Asn; 93 th amino acid is Asn in Tyr; The 94th amino acid is Ser in Asn; 96th amino acid is selected from Thr in Gln, Lys, or Arg; 97th amino acid is substituted with Ile, Arg, Ala or Pro.

In one embodiment according to the invention, the substitutions included in the variants herein additionally include one or more of the following modifications: wherein the 39th amino acid is Asp in Gly; The 44th amino acid is Thr in His; The 45th amino acid is from Cys in Val; The 46th amino acid is selected from Thr in Pro; The 47th amino acid is Ala in Ser; The 48th amino acid is Ser in Asn; The 50th amino acid is Lys in Pro; The 51st amino acid is Leu to Ser; The 52nd amino acid is Lys in Ile; The 81st amino acid is Val in Ala; The 82nd amino acid is Asp at Tyr; The 83rd amino acid is Leu to Trp; The 85th amino acid is Gln at Thr; The 86th amino acid is Gly at Val; The 87th amino acid is Ser in Asn; The 88 th amino acid is Gly Phe; The 89th amino acid is Pro in Ser; The 98th amino acid is Glu at Ser; Or the 101st amino acid is substituted for Aly by Gly; Or insertion of Gln at the 48 th site or insertion of the polypeptide of sequence as Ser-Arg-Arg-Ser-Leu at the 82 th site.

In other embodiments according to the invention the modified CD2 binding polypeptides of the present disclosure are represented by any one of SEQ ID NOs: 2-6. In another embodiment according to the present disclosure, the polypeptide further comprises Leu-Pro-Ser-Pro-Thr at its C-terminus.

In another aspect the application provides a polynucleotide encoding a CD2 binding polypeptide of modified LFA3 according to the present application. In one embodiment according to the present invention, the polynucleotide is represented by any one of SEQ ID NOs: 8-12. In one embodiment according to the present invention, the polynucleotide further comprises a nucleic acid sequence ctgccgtctccgacc encoding Leu-Pro-Ser-Pro-Thr added to the C-terminus at the 3 'end of the sequence represented by SEQ ID NOs: 8 to 12. Include.

In another aspect the application includes a vector comprising a polynucleotide according to the present disclosure, comprising a regulatory sequence operably linked thereto, a strain comprising said vector, such as a prokaryotic or eukaryotic cell.

In another aspect the application provides a fusion protein comprising a modified LFA3 CD2 binding polypeptide or a wild type polypeptide thereof and a target specific polypeptide according to the present disclosure. In one embodiment according to the present disclosure, the CD2 binding polypeptide may be located at the N-terminal or C-terminal site of the fusion protein.

The fusion protein according to the invention may be linked by a linker, for example a polypeptide linker, for example a flexible polypeptide linker, for example a linker represented by the sequence of SEQ ID NO: 13.

A target specific polypeptide linked to a fusion protein according to the present invention is a variety of target specific polypeptides known as antibodies, antigen binding fragments, antibody mimetics, aptamers, or receptors that specifically recognize antigens or epitopes. Peptides may be used, for example scFv, BITE, TandAb, Immunobody, Flexibody, Nanobody, Triomab, Troybody, Pepbody, Vaccibody, SMIP, Fragment Antigen Binding, mAb ² , UniBody, Fv (fragment variable), dAB , scFV-Fc, Diabody, Tetrabody, Minibody, scFab (single chain Fab), or Fcab may include, but is not limited thereto. In one embodiment according to the present invention the antibody mimetics include but are not limited to DARPin, Tetranectin, Affibody, Transbody, Anticalin, AdNectin, Affilin, Microbody, Peptide aptamer, Phylomer, Stradobody, Avimer, Maxibodiy, Evibody, or Fynomer .

The fusion protein according to the present invention specifically recognizes specific targets, which are particularly located on the cell surface. After recognizing a target located on the cell surface, cell death can be induced through the activity of the immune system. In one embodiment according to the present disclosure the factors located on the cell surface recognized by the target specific polypeptides herein are, for example, CD2, CD4, CD19, CD20, CD22, CD23, CD30, CD33, CD37, CD40, CD44v6, CD52, CD56, CD70, CD74, CD79a, CD80, CD98, CD138, Epidermal growth factor receptor (EGFR), Vascular endothelial growth factor (VEGF), Vascular endothelial growth factor receptor I (VEGFRI), Platelet-derived growth factor receptor ), Receptor activator of nuclear factor kappa-B ligand (RANKL), transmembrane glycoprotein neuromedin B (GPNMB), Ephrin type-A receptor 2 (EphA2), a novel tumor-associated protein (MN), and prostate-specific membrane antigen ), Cripto (Cryptic family protein 1B), EpCAM (Epithelial cell adhesion molecule), Cytotoxic T-Lymphocyte Antigen 4 (CTLA4), Type 1 insulin-like growth factor receptor (IGF-IR), M13 bacteriophage (GP3), GP9 ( Glycoprotein IX (platelet), CD42a, GP40 (Glycoprotein 40kDa) TRAILRI (Tumor necrosis factor-related apoptosis-inducing ligand re receptor I), TRUMRII (Tumor necrosis factor-related apoptosis-inducing ligand receptor II), Type II transmembrane protein (FAS), phosphatidyl serine (PS) lipid, Gal GlNac Gal N-linked, Muc1 (Mucin 1, cell surface associated, PEM), Muc18 CD146, A5B1 integrin (α5β1), α4β1 integrin, αv integrin (Vitronectin Receptor), Chondrolectin, Carbonic anhydrase IX, gene G250 / MN-encoded transmembrane protein, GD2 gangloside, GD3 gangloside Y, Mesothelin, Human Epidermal Growth factor 2 (HER2), HER3, Fibroblast Growth Factor Inducible 14 (FN14), Cell surface glycoprotein, CD2 subset 1, CRACC, SLAMF7, CD319), 41BB CD137, SIP (Siah-1 Interacting) Protein (CTGF), Connective tissue growth factor (CTGF), MHC class II cell surface receptor (HLADR), Programmed Death 1, Type I membrane protein, Interleukin-2 (IL-2), Interleukin-8 (IL-8) ), IL-13 (Interleukin-13), Phosphhatidylinositol-glycan biosynthesis class F protein (PIGF), NRP1 (Neuropilin-1), ICAM1 CD54, GC182 (Claudin 18.2), Claudin, H Hepatocyte growth factor (GF), carcinoembryonic antigen (CEA), lymphotoxin β receptor (LTβR), Kappa Myeloma, Folare Receptor alpha, GRP78 (BIP, 78 kDa Glucose-regulated protein), A33 antigen, Prostate-specific antigen (PSA) ), CA125 (Cancer antigen 125 or carbohydrate antigen 125), CA19.9, CA15.3, CA242, Leptin, Prolactin, Osteopontin, Insulin-like growth factor 2 (IGF-II), Fascin, sPIgR (secreted chain of the polymorphic immunoglobulin receptor), 14-3-3 protein eta. 5T4 oncofetal protein, Epithelial Tumor Antigen (ETA), Melanoma-associated antigen (MAG), Melanoma-associated proteoglycan (NG2), Vimentin, Early prostate cancer antigen-2 (EPCA-1), TAG-72 (Tumor-associated) glycoprotein 72), Factor VIII, Neprilysin (Membrane metallo-endopeptidase) and 17-1A (Epithelial cell surface antigen 17-1A), including but not limited to, in one embodiment according to the present invention is HER2 or CD20. In one embodiment according to the present invention the cells where the target is located are cancer cells, for example, but not limited to ovarian cancer, breast cancer, colon cancer, prostate cancer, melanoma, Hodgkins lymphoma, non-Hodgkins lymphoma, Leukemias (acute myeloid leukemia, chronic myelogenous leukemia, acute lymphocytic leukemia, leukemias including chronic lymphocytic leukemia, gastric cancer, renal cell carcinoma, colon cancer, colon cancer, lung cancer, brain cancer, cervical cancer, esophageal cancer, and liver cancer). In one embodiment according to the present disclosure, the polypeptide that specifically recognizes HER2 or CD20 included in the fusion protein of the present disclosure is ScFv or Fab, and the sequence of such fusion protein may be, for example, an scFv fusion protein targeting HER2. The scFv fusion protein represented by SEQ ID NO: 14, 15, or 16, and targeting the CD20 is represented by any one of SEQ ID NOs: 18 to 24, and the CD2 Fab fusion proteins targeting zero are represented by SEQ ID NOs: 25 and 26.

In another aspect, the present disclosure provides a polynucleotide encoding a fusion protein of the present disclosure, a vector comprising a regulatory sequence comprising the operably linked thereto, and a strain comprising the vector. In one embodiment according to the present disclosure the polynucleotide according to the present disclosure is directed to HER2, represented by SEQ ID NO: 17, or the polynucleotide is targeted to CD20, represented by any one of SEQ ID NOs: 27 to 32 .

In another aspect, the present disclosure also provides a method for disintegrating a target cell, which is T-cell mediated in vitro, which method comprises contacting the target cell with a fusion protein of the present disclosure or a polynucleotide encoding the same. In addition, the protein expressed by the fusion protein or the polynucleotide specifically recognizes a factor present on the surface of the target cell.

Target cells in which the method according to the present invention can be used are cells derived from diseases, including autoimmune diseases including cancer, rheumatoid arthritis, systemic lupus erythematosus, type 1 diabetes, multiple sclerosis, anti-neutrophil cytoplasmic antibody-associated vasculitis, Or cells associated with or derived from a microbial infection, including tuberculosis, Listeriosis, Legionnaires'disease, candidiasis, or infectious mononucleosis. . In another aspect, the target cells are cancer-derived, such cancers include ovarian cancer, breast cancer, colon cancer, prostate cancer, melanoma, Hodgkins lymphoma, lymphoma including non-Hodgkins lymphoma, leukemia (acute myeloid leukemia, chronic myelogenous leukemia, Leukemias including acute lymphocytic leukemia, chronic lymphocytic leukemia, gastric cancer, renal cell carcinoma, colon cancer, colon cancer, lung cancer, brain cancer, cervical cancer, esophageal cancer, or liver cancer.

In another aspect the invention also provides a pharmaceutical composition for disintegration of T-cell mediated target cells comprising a fusion protein according to the invention or a polynucleotide encoding the same. Cells targeted by the pharmaceutical composition according to the present application and factors located on the cell surface are as described above.

In another aspect the invention also provides a method of treating cancer comprising administering to a subject in need thereof a pharmaceutically effective amount of a fusion protein that specifically recognizes the cancer according to the invention.

When used in combination with a variant or wild type LFA3 according to the present invention and a target specific polypeptide that specifically recognizes a specific factor expressed in a cell, activation of T cells destroys only cells expressing a specific factor without toxicity to normal cells. It can be effectively used as a therapeutic agent for diseases such as cancer, and employing polypeptides for various targets can be applied to various diseases.

The fusion protein of the present invention can also be produced using mammalian cells to reproduce natural glycosylation, so it is possible to develop a therapeutic agent having higher activity than a protein expressed in E. coli .

1 is a pRSET-A-anti-HER2 scFv-LFA3 plasmid cleavage map.
Figure 2 is a schematic diagram of the structure of the anti-HER2 scFv-LFA3 including 6X HIS tag, LFA3, linker, VH, VL domain.
Figure 3 shows the expression of the red arrow is expressed as a result of SDS-PAGE analysis of the expression of anti-HER2 scFv-LFA3WT, anti-HER2 scFv-LFA3-5 expressed using the E. coli pLysS expression system.
4 shows the results of ELISA analysis of specific binding of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 to HER2 expressed using the E. coli pLysS expression system.
FIG. 5 shows the results of ELISA analysis of binding to two randomly selected non-specific antigens of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 expressed using the E. coli pLysS expression system.
FIG. 6 shows the results of ELISA analysis of specific binding of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 to CD2 expressing Jurkat T cells using E. coli pLysS expression system. to be.
FIG. 7 shows the results of ELISA analysis of specific binding of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 to HER2 expressing SKBR3 cells using E. coli pLysS expression system. .
FIG. 8 shows ELISA of specific binding of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 expressed using E. coli pLysS expression system to CT26-Her2 / neu cells expressing HER2. The result of the analysis.
FIG. 9 shows the results of ELISA analysis of specific binding of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 to A431 cells having HER2 expressed using the E. coli pLysS expression system.
FIG. 10 shows the results of analyzing the effects of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 on CD4-positive T lymphocyte proliferation using E. coli pLysS expression system.
11 is a result of analyzing the toxicity of SKBR3, cancer cells of anti-HER2 scFv-LFA3WT, anti-HER2 scFv-LFA3-5 expressed using the E. coli pLysS expression system.
FIG. 12 shows the results of IL-2 (pg / ml) induction of human PBMCs of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 expressed using the E. coli pLysS expression system.
Figure 13 shows the results of agarose gel analysis of the size of the optimized anti-HER2 scFv-LFA3 after restriction enzyme treatment in synthesized mammalian cells.
14 is a schematic diagram of the anti-HER2 scFv-LFA3 structure including LFA3, linker, VH, VL domain, 6X HIS tag optimized expression in mammalian cells.
15 is a cleavage map of the pCIneo-anti-HER2 scFv-LFA3 plasmid.
Figure 16 shows agarose gel analysis of the pCIneo vector and anti-HER2 scFv-LFA3 used for cloning the pCIneo-anti-HER2 scFv-LFA3 plasmid.
17 is agarose gel analysis results confirmed the gene size difference of the optimized expression in anti-HER2 scFv-LFA3 and E. coli optimized in mammalian cells.
Figure 18 shows the protein expressed in the red arrow as a result of confirming the expression in COS-7 cells of anti-HER2 scFv-LFA3 optimized expression in mammalian cells.
19 shows the results of ELISA analysis of specific binding of anti-HER2 scFv-LFA3 to HER2 expressed using a mammalian expression system.
20 shows the results of ELISA analysis of binding of two randomly selected non-specific antigens of anti-HER2 scFv-LFA3 expressed using a mammalian expression system.
Figure 21 shows the results of ELISA analysis of the ability to simultaneously bind to two antigens of anti-HER2 scFv-LFA3 expressed using a mammalian expression system.
Figure 22 is a cleavage map of the pRSET-A-anti CD20 scFv-LFA3 plasmid expressed using the E. coli pLysS expression system.
FIG. 23 shows the results of ELISA analysis of specific binding of anti-CD20 scFv-LFA3-1 to CD20 expressing Raji cells expressed using the E. coli pLysS expression system.
24 shows the results of ELISA analysis of specific binding of anti-CD20 scFv-LFA3-1 expressed to CD20 expressing Jurkat T cells using E. coli pLysS expression system.
FIG. 25 shows the results of analyzing the effect of anti-CD20 scFv-LFA3-1 on CD4-positive T lymphocyte proliferation using E. coli pLysS expression system.
FIG. 26 shows the results of IL-2 (pg / ml) induction of human PBMCs of anti-CD20 scFv-LFA3 expressed using the E. coli pLysS expression system.
FIG. 27 is a schematic of a bi-specific, tri-specific, tetra-specific and multi-specific fusion protein structure comprising LFA3. FIG.
28 is a schematic diagram of the anti-CD20 scFv-LFA3 structure produced using a mammalian cell expression system.
29 is a schematic diagram of the anti-CD20 Fab-LFA3 structure produced using a mammalian cell expression system.
FIG. 30A shows the efficacy of anti-HER2scFv-LFA3 on cancer cell growth after induction of cancer with SKOV3 in a nude mouse model and after treatment with anticancer drugs.
30B shows the efficacy of anti-HER2scFv-LFA3 on cancer cell growth by treating anticancer agents simultaneously with SKOV3 cancer cell transplantation in nude mouse model.
FIG. 31 shows the results of evaluating the anticancer effect of anti-CD20 scFv-LFA3 in a human-derived blood cancer (Raji) transplantation model in which Raji cells were transplanted into NOD.CB17 / scid mice.

The present application uses a immune system to produce a mutant of LFA3 that acts as an effector that induces the killing of cells expressing a specific antigen, and fusion proteins fused with a polypeptide that specifically binds to a specific factor of the cell. It is based on the finding that the disease can be treated by activating the human immune system.

In one aspect the invention relates to a CD2 binding region of a modified LFA3 (Lymphocyte Functioning Associated Antigen-3). The modified LFA3 herein allows for variants expressed in the absence of glycans in prokaryotic cells to stably bind to T lymphocyte receptors.

LFA3 (CD58) is an joining molecule belonging to the immunoglobulin superfamily, with multiple isoforms ranging in size from 55,000 to 75,000 da, depending on alternative splicing and sugar chain additions. For example, transmembrane type and GPI attached type. LFA3 consists of two extracellular domains and one transmembrane domain and is expressed in almost all cells, especially on the surface of antigen presenting cells, in particular macrophages. LFA3 is increased in expression by cytokine stimulation. In addition, it is known to be involved in cytotoxic activity expression or antigen presentation reaction by binding to CD2. In addition, only the first domain of the two extracellular domains binds to CD2 on the surface of the T lymphocytes, placing the T lymphocytes and antigen presenting cells close together, enabling the T lymphocytes to generate an immune response (Biogen Inc. J.). Exp. Med. 1993; 178 (1): 211-222). However, attempting to treat cancer by activating the immune system using this has not been attempted previously, and this is the first time.

Variants according to the present disclosure are modified to include one or more amino acid substitutions in the CD2 binding region of LFA3, based on the amino acid sequence represented by SEQ ID NO: 1, wherein the 36th amino acid is Val, Lys, Pro or Val; The 37th amino acid is Val in Trp, Lys or Val; The 38th amino acid is Lys or Gly at Tyr; The 39th amino acid is Gsp in Asp; 40th amino acid is selected from Asp or Thr in Asn; The 44th amino acid is Thr in His; The 45th amino acid is from Cys in Val; The 46th amino acid is selected from Thr in Pro; The 47th amino acid is Ala in Ser; The 48 th amino acid is Ser (or Gln insertion) at Asn; The 50th amino acid is Lys in Pro; The 51st amino acid is Leu to Ser; The 52nd amino acid is Lys in Ile; The 76th amino acid is Ser to Asp, or Arg; The 79th amino acid is Gly to Asn; The 81st amino acid is Val in Ala; The 82nd amino acid is Asp at Tyr (or inserted SRRSL); The 83rd amino acid is Leu to Trp; The 85th amino acid is Gln at Thr; The 86th amino acid is Gly at Val; The 87th amino acid is Ser in Asn; The 88 th amino acid is Gly Phe; The 89th amino acid is Pro in Ser; 93 th amino acid is Asn in Tyr; The 94th amino acid is Ser in Asn; 96th amino acid is selected from Thr in Gln, Lys, or Arg; The 97 th amino acid is Ile, Arg, Ala or Pro; The 98th amino acid is Glu at Ser; Or the 101st amino acid replaces Gly with Asp.

Herein, the CD2 binding region is residue 29 to residue 123 excluding a signal sequence based on the amino acid sequence of SEQ ID NO: 1, and the CD2 binding region is, for example, an additional 5 amino acid residues (SEQ ID NO: 1). Leu-Pro-Ser-Pro-Thr) corresponding to 124-128 residues may be included as a reference. When the residues are included, the nucleic acid sequence described later may further include a corresponding sequence such as ctgccgtctccgacc. (Carboxy or C-terminal).

As long as there is an effect according to the present application, variants of various combinations (position of amino acid and type of amino acid at each position) may be included herein within the substitution range as described above.

For example, in one embodiment according to the present disclosure, the variant according to the present disclosure includes substitution at all positions below: when the 36th amino acid is Val, Thr, Lys, Pro or Val; The 37th amino acid is Val in Trp, Lys or Val; The 38th amino acid is Lys or Gly at Tyr; 40th amino acid is selected from Asp or Thr in Asn; The 76th amino acid is Ser to Asp, or Arg; The 79th amino acid is Gly to Asn; 93 th amino acid is Asn in Tyr; The 94th amino acid is Ser in Asn; 96th amino acid is selected from Thr in Gln, Lys, or Arg; 97th amino acid is replaced by Ile, Arg, Ala or Pro.

In another embodiment according to the invention said substitution additionally comprises one or more substitutions as follows: the 39th amino acid is Asp at Gly; The 44th amino acid is Thr in His; The 45th amino acid is from Cys in Val; The 46th amino acid is selected from Thr in Pro; The 47th amino acid is Ala in Ser; The 48th amino acid is Ser in Asn; The 50th amino acid is Lys in Pro; The 51st amino acid is Leu to Ser; The 52nd amino acid is Lys in Ile; The 81st amino acid is Val in Ala; The 82nd amino acid is Asp at Tyr; The 83rd amino acid is Leu to Trp; The 85th amino acid is Gln at Thr; The 86th amino acid is Gly at Val; The 87th amino acid is Ser in Asn; The 88 th amino acid is Gly Phe; The 89th amino acid is Pro in Ser; The 98th amino acid is Glu at Ser; Or the 101st amino acid is substituted for Aly by Gly; Or insertion of Gln at the 48th site or insertion of a polypeptide having the Ser-Arg-Arg-Ser-Leu sequence at the 82nd site.

In other embodiments according to the present disclosure, the LFA3 variant according to the present disclosure may be represented by any one of SEQ ID NOs: 2-6.

In another embodiment the present application relates to a polynucleotide encoding an LFA3 variant according to the present application as described above, for example, may be represented by any one of SEQ ID NOs: 8-12.

In another aspect, the present disclosure includes a polynucleotide according to the present disclosure and a sequence for controlling expression of mRNA of the polynucleotide operably linked thereto or expression of mRNA to a protein, eg, regulatory sequences such as promoters and / or enhancers, and the like. It relates to a vector or a plasmid. Vectors according to the invention can be linked to appropriate regulatory sequences and vectors known for amplification and / or expression in prokaryotic and / or eukaryotic cells. Various vectors and control sequences that can be used for this purpose are known, and those skilled in the art will be able to select appropriate ones in view of the specific purposes and effects of the present application, and may include, for example, those described in the examples and drawings herein. It is not limited to this. In one embodiment according to the present disclosure, such vectors include those described in the examples and figures herein, for example the vectors of FIG. 1, 15 or 22.

In another aspect the invention also relates to a host cell comprising a vector according to the invention, which host cell comprises both prokaryotic and eukaryotic cells for the amplification of the vector according to the invention and / or for the production of the protein to which the vector is to be expressed. It is. Various cells that can be used for this purpose are known, and those skilled in the art will be able to select appropriate ones in view of the specific purposes and effects herein, and may include, for example, those described in the Examples and the drawings herein, but not limited thereto. It is not. Examples include E. coli, Mammalian cells, Yeast, Plant cells, Insect cells.

Methods for transforming a host cell with a vector according to the present application are known, for example, using calcium phosphate precipitation, shotgun method, liposome method, nano needle or electroporation method known in the art. Can be performed.

LFA3 according to the present application may act as an effector capable of binding T lymphocytes and activating the immune system to induce cell death. In this aspect, the application herein includes one or more, modified CD2 binding polypeptides (also referred to as regions) of LFA3 or wild type polypeptides thereof, ie, polypeptides consisting of 29 to 123 residues or 29 to 128 residues of SEQ ID NO: 1. And it relates to a fusion protein comprising a target specific polypeptide linked thereto.

A target specific polypeptide according to the present application is a polypeptide capable of specifically binding to a specific factor expressed in a target cell, for example, a specific factor that can act as a protein marker or other antigen present on the cell surface. It can be recognized and combined. Examples include, but are not limited to, antibodies, antigen-binding fragments of antibodies, antibody mimetics, aptamers, or receptors.

In one embodiment according to the invention, the antibody is one comprising a polyclonal, monoclonal antibody, or chimeric or humanized antibody, full length antibody or fragment thereof. In another embodiment according to the present disclosure, the antigen-binding fragment comprises all or a portion of the antigen-binding site in the full-length antibody, for example, scFv (see below), BITE (see, eg, US Pat. No. 72,564,1). , TandAb (see, eg, US Patent Publication No. 2005-089519), Immunobody (see, eg, US Patent Publication No. 2004-146505), Flexibody (see, eg, US Patent No. 6838254), Nanobody (e.g., See, eg, US Patent Publication No. 2003-088074), Triomab (see, for example, US Pat. No. 65,529,923), Troybody (see, for example, US Pat. No. 6,266,654), Pepbody (see, for example, US Pat. ), Vaccibody (see, eg, US Patent Publication No. 2004-253238), SMIP (see, eg, US Patent Publication No. 2008-227958), Fab (fragment antigen binding fragment, see examples), mAb ² (for example, U.S. Patent Application Publication No. 2009-298195 No. true ), UniBody (see, eg, US Pat. No. 72,5641), Fv (Fragment variable), dAB (see, eg, US Pat. No. 2006-280734), scFV-Fc, Diabody (see, eg, US Pat. Tetrabody (see, eg, US Pat. No. 72,5641), Minibody (see, eg, US Pat. No. 72,564,1), scFab (single chain Fab), Fcab (see, eg, US Patent Publication No. 2009-298195). (But not limited to).

In other embodiments according to the present disclosure the antibody mimetics may comprise DARPin (see, eg, US Pat. No. 7417130), Tetranectin (see, eg, US Pat. No. 2004-132094), Affibody (eg, US Pat. No. 5831012). ), Transbody (see, eg, US Patent Publication No. 2004-023334), Anticalin (see, eg, US Pat. No. 7,726,97), AdNectin (see, eg, US Pat. No. 68,184,18), Affilin (e.g., US Patent No. 7838629), Microbody (see eg US Pat. No. 7186524), Peptide aptamer (see eg US Pat. No. 6004746), Phylomer (see eg US Pat. No. 6994982), Stradobody ( See, eg, US Patent Publication No. 2010-239633), Avimer (see, eg, US Pat. No. 7,078,077), Evibody (see, eg, US Pat. No. 7166697), or Fynomer (see, eg, US Pat. Including but not limited to 2010-119446). It is not.

Each component included in the fusion protein according to the present application, namely the LFA3 CD2 binding region and the target specific polypeptide as described above, may be located at the N-terminus or C-terminus, respectively, and the direction is specific for example to be fused. It may be determined according to the type of polypeptide.

The linker according to the present invention is a molecule that connects each protein included in the fusion protein to each other. As long as the effect of the fusion protein according to the present invention is achieved, linkers of various kinds and lengths known in the art may be used. In one embodiment according to the present invention, a polypeptide linker may be used, and those skilled in the art will be able to select an appropriate one in consideration of the contents described herein and the specific objects and effects of the present application. In one embodiment according to the invention the linker must be flexible and not be degraded by proteases. In one embodiment according to the present invention, in order to enable LFA3 to function effectively, a polypeptide linker represented by SEQ ID NO: 13 is used. In another embodiment, a linker such as GGGGS, GGGGSGGGGS, or GGGGSGGGGSGGGGS or GSTSGSGKPGSGEGSTKG (where G is Glycine, S for serine, T for threoine, K for lysine, P for proline, and E for glutamic acid).

The fusion protein according to the present invention can specifically recognize and bind to specific factors through the target specific polypeptide as described above.

In this aspect, the fusion protein according to the present invention may bind to various factors depending on the kind of target specific polypeptide included therein. These factors are mainly present on the cell surface, and include factors that are specifically expressed in a certain cell in consideration of the effects of the fusion protein according to the present application. In one embodiment according to the invention the cell is a cell associated with cancer, autoimmune disease, or microbial infection, and the factor may be a non-modified or modified protein that is specifically expressed in such a cell. In one embodiment according to the present invention, a cell associated with cancer, and may bind to a marker or factor specifically expressed in cancer. Factors expressed on such cell surfaces are known and can vary depending on the specific target for which the fusion protein is to be used, for example CD2, CD4, CD19, CD20, CD22, CD23, CD30, CD33, CD37, CD40, CD44v6, CD52, CD56, CD70, CD74, CD79a, CD80, CD98, CD138, Epidermal Growth Factor Receptor (EGFR), Vascular Endothelial Growth Factor (VEGF), Vascular Endothelial Growth Factor Receptor (VEGFRI), Platelet- derived growth factor receptor (RANKL), receptor activator of nuclear factor kappa-B ligand (RANKL), transmembrane glycoprotein neuromedin B (GPNMB), Ephrin type-A receptor 2 (EphA2), a novel tumor-associated protein (MN), prostate PSMA -specific membrane antigen, Cripto (Cryptic family protein 1B), EpCAM (Epithelial cell adhesion molecule), CTLA4 (Cytotoxic T-Lymphocyte Antigen 4), IGF-IR (Type 1 insulin-like growth factor receptor), GP3 (M13 bacteriophage) ), GP9 (Glycoprotein IX (platelet), CD42a, GP40 (Glycoprotein 40kDa) TRAILRI (Tumor necr osis factor-related apoptosis-inducing ligand receptor I, TRAILRII (Tumor necrosis factor-related apoptosis-inducing ligand receptor II), type II transmembrane protein (FAS), phosphatidyl serine (PS) lipid, Gal GlNac Gal N-linked, Muc1 (Mucin 1, cell surface associated, PEM), Muc18 CD146, A5B1 integrin (α5β1), α4β1 integrin, αv integrin (Vitronectin Receptor), Chondrolectin, CAIX (Carbonic anhydrase IX, gene G250 / MN-encoded transmembrane protein), GD2 gangloside , GD3 gangloside, GM1 gangloside, Lewis Y, Mesothelin, HU2 (Human Epidermal Growth factor 2), HER3, FN14 (Fibroblast Growth Factor Inducible 14), CS1 (Cell surface glycoprotein, CD2 subset 1, CRACC, SLAMF7, CD319), 41BB CD137, Siah-1 Interacting Protein (SIP), Connective tissue growth factor (CTGF), MHC class II cell surface receptor (HLADR), Programmed Death 1, Type I membrane protein, Interleukin-2 (IL-2) , IL-8 (Interleukin-8), IL-13 (Interleukin-13), PIGF (Phosphatidylinositol-glycan biosynthesis class F protein), NRP1 (Neuropilin -1), ICAM1 CD54, GC182 (Claudin 18.2), Claudin, Hepatocyte growth factor (HGF), Carcinoembryonic antigen (CEA), Lymphotoxin β receptor (LTβR), Kappa Myeloma, Folare Receptor alpha, GRP78 (BIP, 78 kDa Glucose- regulated protein), A33 antigen, Prostate-specific antigen (PSA), Cancer antigen 125 or carbohydrate antigen 125 (CA125), CA19.9, CA15.3, CA242, Leptin, Prolactin, Osteopontin, IGF-II (Insulin- like growth factor 2), Fascin, sPIgR (secreted chain of the polymorphic immunoglobulin receptor), 14-3-3 protein eta. 5T4 oncofetal protein, Epithelial Tumor Antigen (ETA), Melanoma-associated antigen (MAG), Melanoma-associated proteoglycan (NG2), Vimentin, Early prostate cancer antigen-2 (EPCA-1), TAG-72 (Tumor-associated) glycoprotein 72), Factor VIII, Neprilysin (Membrane metallo-endopeptidase) and 17-1A (Epithelial cell surface antigen 17-1A), but are not limited thereto. In one embodiment according to the present application, HER2, a breast cancer or ovarian cancer marker, and CD20, a lymphoma marker, are used.

Polypeptides that target factors as described above may be prepared in the context of various antibodies, antigen-binding fragments of antibodies, antibody mimetics, aptamers, or receptors as described above, and in one embodiment according to the present disclosure Or Fab is used, but is not limited thereto. scFV (Single chain Fv) is a form in which VH and VL, which are the smallest units of the antibody molecule, are linked with amino acid polypeptide linkers (Anal Biochem 205, 263-270 (1992)), and Fab is the antigen-binding portion of the antibody molecule. Using only, it has a more stable structure than scFv (Int J Cancer 57, 856-864 (1994)).

One or more LFA3s produced in the context of various antibodies, antigen binding fragments of antibodies, antibody mimetics, aptamers, or receptors comprising a binding region for a factor to which a target polypeptide according to the present invention may bind, Can be fused with In one embodiment according to the present invention provides a protein wherein the scFv and Fab targeting HER2 is fused with the LFA3 wild type CD2 binding region or a variant thereof according to the present invention, for example, the fusion protein targeting HER2 is SEQ ID NO: 14 , 15, or 16, scFv fusion protein targeting the CD20 is represented by any one of SEQ ID NOs: 18 to 24, Fab fusion protein targeting the CD20 is represented by SEQ ID NOs: 25 and 26, but is not limited thereto. It is not.

One or more LFA3 and target specific polypeptides included in the fusion protein of the present disclosure may be included as long as the effects according to the present disclosure are included, and may be variously located at the N- or C-terminus. In addition, when comprising more than one, each of the constituent proteins may be combined in duplicate, repeat or random.

In another aspect the present disclosure also provides a polynucleotide encoding a fusion protein according to the present application as described above. In one embodiment according to the present disclosure, a fusion protein targeting HER2 is provided and the polynucleotide sequence encoding it is represented by SEQ ID NO: 17. In another embodiment, a fusion protein is provided that targets CD20 and the polynucleotide sequence encoding it is represented by any of SEQ ID NOs: 27-32, but is not limited thereto.

In another embodiment the present disclosure also provides a sequence, eg, a promoter and / or enhancer, that modulates the expression of a polynucleotide encoding a fusion protein according to the present invention and the polynucleotide operably linked thereto, or the expression of an mRNA into a protein. It relates to a vector comprising a. Vectors according to the invention can be linked with appropriate vectors and regulatory sequences known for amplification and / or expression in prokaryotic and / or eukaryotic cells. Various vectors and control sequences that can be used for this purpose are known, and those skilled in the art will be able to select appropriate ones in view of the specific purposes and effects of the present application, and may include, for example, those described in the examples and drawings herein. It is not limited to this. In one embodiment according to the present application such vectors include, but are not limited to, for example, those disclosed in FIG. 1, 15, or 22.

In another aspect the invention also relates to a host cell comprising a vector according to the invention, ie a recombinant cell line, wherein the host cell is for prokaryotic and eukaryotic, for the amplification of the vector according to the invention and / or for the production of proteins to which the vector is to be expressed. It includes all the cells. Various cells that can be used for this purpose are known, and those skilled in the art will be able to select appropriate ones in view of the specific purposes and effects herein, and may include, for example, those described in the Examples and the drawings herein, but not limited thereto. It is not. Methods for transforming a host cell with a vector according to the present application are known, for example, using calcium phosphate precipitation, shotgun method, liposome method, nano needle or electroporation method known in the art. Can be performed.

In another aspect, the present invention also provides a method of culturing a recombinant cell line prepared above; And it relates to a method for producing a fusion protein comprising the step of separating the target specific fusion protein from the cell line.

The fusion protein according to the present invention has the effect of activating the T cell mediated immune system and then killing the cell after binding to a specific factor, and in this aspect, the present invention provides a fusion protein or a polynucleotide encoding the same and a pharmaceutically acceptable compound. It relates to a pharmaceutical composition for T-cell mediated, target cell disintegration comprising a possible carrier. The pharmaceutical composition according to the present application may be provided as a specific disease therapeutic agent depending on the type of cells to be disintegrated. For example, when the target cell is a cell associated with cancer, autoimmune disease, or microbial infection, the target cell may be referred to as a cancer treatment agent, an autoimmune disease treatment agent, or a microbial infection treatment agent, respectively.

The disease in which the composition of the present invention can be used is not particularly limited and may include various diseases depending on the type of target cell, for example, cancer, rheumatoid arthritis, systemic lupus erythematosus, type 1 diabetes, multiple sclerosis, Autoimmune diseases, including anti-neutrophil cytoplasmic antibody-associated vasculitis, or tuberculosis, Listeriosis, Legionellasis, candidiasis, or infectious mononucleosis It can be used for the treatment of diseases associated with microbial infection.

Target cells are derived from various diseases such as ovarian cancer, breast cancer, colon cancer, prostate cancer, melanoma, Hodgkins lymphoma, lymphoma including non-Hodgkins lymphoma, leukemia (acute myeloid leukemia, chronic myeloid leukemia, acute lymphocytic leukemia) And leukemia, including chronic lymphocytic leukemia, gastric cancer, renal cell carcinoma, colon cancer, colon cancer, lung cancer, brain cancer, cervical cancer, esophageal cancer and / or liver cancer.

As described above, the target cell expresses a factor specifically expressed in each cell, particularly on its surface. In one embodiment according to the present invention, the target cell is a cell associated with cancer, autoimmune disease, or microbial infection, In particular cancer cells, in which case the factor is a cancer cell specific factor. The cancer cell specific factors according to the present application are for example CD2, CD4, CD19, CD20, CD22, CD23, CD30, CD33, CD37, CD40, CD44v6, CD52, CD56, CD70, CD74, CD79a, CD80, CD98, CD138, Epidermal growth factor receptor (EGFR), Vascular endothelial growth factor (VEGF), Vascular endothelial growth factor receptor I (VEGFRI), Platelet-derived growth factor receptor (PDGFR), Receptor activator of nuclear factor kappa-B ligand (RANKL), GPNMB (Transmembrane glycoprotein Neuromedin B), Ephin type-A receptor 2 (EphA2), a novel tumor-associated protein (MN), prostate-specific membrane antigen (PSMA), cryptic family protein 1B (Cripto), epihelial cell adhesion molecule (EpCAM) ), Cytotoxic T-Lymphocyte Antigen 4 (CTLA4), Type 1 insulin-like growth factor receptor (IGF-IR), M13 bacteriophage (GP3), Glycoprotein IX (platelet), GP42 (Glycoprotein 40kDa) and TRAILRI (Tumor) necrosis factor-related apoptosis-inducing ligand receptor I, TRAILRII (Tumor necrosis factor-related apoptosis-inducing ligand receptor I I), Type II transmembrane protein (FAS), phosphatidyl serine (PS) lipid, Gal GlNac Gal N-linked, Muc1 (Mucin 1, cell surface associated, PEM), Muc18 CD146, A5B1 integrin (α5β1), α4β1 integrin, αv integrin (Vitronectin Receptor), Chondrolectin, Carbonic anhydrase IX, gene G250 / MN-encoded transmembrane protein (CAIX), GD2 gangloside, GD3 gangloside, GM1 gangloside, Lewis Y, Mesothelin, HER2 (Human Epidermal Growth factor 2), N14 HER3 (Fibroblast Growth Factor Inducible 14), CS1 (Cell surface glycoprotein, CD2 subset 1, CRACC, SLAMF7, CD319), 41BB CD137, SIP (Siah-1 Interacting Protein), CTGF (Connective tissue growth factor), HLADR (MHC class II) cell surface receptor, PD-1 (Programmed Death 1, Type I membrane protein, IL-2 (Interleukin-2), IL-8 (Interleukin-8), IL-13 (Interleukin-13), PIGF (Phosphatidylinositol-glycan) biosynthesis class F protein), NRP1 (Neuropilin-1), ICAM1 CD54, GC182 (Claudin 18.2), Claudin, HGF (Hepatocyte growth factor), CEA (Carcinoembryonic antigen), LTβR (lymphotoxin β rece ptor), Kappa Myeloma, Folare Receptor alpha, GRP78 (BIP, 78 kDa Glucose-regulated protein), A33 antigen, Prostate-specific antigen (PSA), Cancer antigen 125 or carbohydrate antigen 125 (CA125), CA19.9, CA15.3, CA242, Leptin, Prolactin, Osteopontin, Insulin-like growth factor 2 (IGF-II), Fascin, secreted chain of the polymorphic immunoglobulin receptor (sPIgR), 14-3-3 protein eta. 5T4 oncofetal protein, Epithelial Tumor Antigen (ETA), Melanoma-associated antigen (MAG), Melanoma-associated proteoglycan (NG2), Vimentin, Early prostate cancer antigen-2 (EPCA-1), TAG-72 (Tumor-associated) glycoprotein 72), Factor VIII, Neprilysin (Membrane metallo-endopeptidase) and 17-1A (Epithelial cell surface antigen 17-1A), but are not limited thereto.

In addition, the pharmaceutical compositions herein may be used alone or in combination with methods using surgery, drug treatment and biological response modifiers.

The composition of the present invention may be prepared by including one or more pharmaceutically or physiologically acceptable carriers in addition to the above-mentioned active ingredients.

The term carrier, as used herein, means a pharmaceutically acceptable carrier, excipient, or stabilizer that is nontoxic to a cell or mammal that is exposed to the dosages and concentrations employed. Examples of such carriers include saline, Ringer's solution, buffered saline, buffers such as phosphate, citrate and other organic acids, antioxidants including ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins such as serum albumin, gelatin Or immunoglobulins; Hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine or lysine, monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrins, for example EDTA, sugars Alcohols such as mannitol or sorbitol, salt-forming counter ions such as sodium, and / or nonionic surfactants such as tween, polyethylene glycol (PEG) and PLURONICS.

If desired, other conventional additives such as antioxidants, buffers, bacteriostatics, etc. may be added. In addition, it can be formulated into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, Specific antibody or other ligand can be used in combination with the carrier. Furthermore, it may be preferably formulated according to each disease or component by an appropriate method in the art or using a method disclosed in Remington's Pharmaceutical Science (Recent Edition, Mack Publishing Company, Easton PA). have.

Solid formulations for oral administration include tablets, patients, powders, granules, capsules, troches and the like, which may contain one or more excipients such as starch, calcium carbonate Sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions or syrups. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like are included in addition to commonly used simple diluents such as water and liquid paraffin. .

Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.

Examples of the non-aqueous solvent and suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. As a base for suppositories, witepsol, macrogol, tween 61, cacao paper, laurin, glycerol, gelatin and the like can be used.

The compositions herein can be administered orally or parenterally (eg, applied intravenously, subcutaneously, intraperitoneally or topically) according to the desired method, with parenteral administration being particularly preferred. The dosage depends on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the time of day, and may be appropriately selected by those skilled in the art.

The composition according to the invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically or therapeutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level means the type, severity, It can be determined according to the activity of the drug, sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of treatment, factors including the concurrent drug and other factors well known in the medical field. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the compound according to the present invention may vary depending on the age, sex, and weight of the patient, and in general, 0.01 μg to 100 mg, preferably 0.01 μg to 10 mg per kg of body weight is administered daily or every other day. Or divided into 1 to 3 times a day. However, the dosage may be varied depending on the route of administration, the severity of obesity, sex, weight, age, etc. Therefore, the dosage is not limited to the scope of the present invention by any means.

The fusion protein according to the present invention can specifically kill specific cells by activating the T cell mediated immune system. In this respect, the present application is also a method of lysis of target cells, T-cell mediated in vivo or in vitro. In one embodiment the method comprises contacting a target cell with a fusion protein or a polynucleotide encoding the same, wherein the protein expressed by the fusion protein or polynucleotide is a factor present on the surface of the target cell. Specifically recognize Target cells to which the method of the present invention works are those that express factors specific to the cells, such as cancer, rheumatoid arthritis, systemic lupus erythematosus, type 1 diabetes, multiple sclerosis, anti-neutrophil cytoplasmic antibody-associated vasculitis. Cells associated with microbial infections, including autoimmune diseases, including tuberculosis, listeriosis, legionnaires'disease, candidiasis, or infectious mononucleosis It is not limited to this. In another aspect target cells to which the methods of the present invention can be effective include ovarian cancer, breast cancer, colon cancer, prostate cancer, melanoma, Hodgkins lymphoma, lymphoma including non-Hodgkins lymphoma, acute myeloid leukemia, chronic myelogenous leukemia, Leukemia, including acute lymphocytic leukemia, chronic lymphocytic leukemia, gastric cancer, renal cell carcinoma, colon cancer, colon cancer, lung cancer, brain cancer, cervical cancer, esophageal cancer, or liver cancer.

The composition of the present application may further contain a compound which maintains / increases the solubility and / or the absorbency of at least one active ingredient or an active ingredient exhibiting the same or similar function in addition to the above-mentioned inhibitor.

In addition, the therapeutic agents of the present application may be used alone or in combination with methods using surgery, drug treatment and biological response modifiers for the treatment of diseases.

As mentioned, a composition comprising a fusion protein according to the present application can be used for the treatment of diseases such as cancer using the T lymphocyte activation ability of LFA3.

In this aspect, the present application also includes administering to a subject in need thereof a therapeutically effective amount of a target specific fusion protein, or a polynucleotide encoding the same, or a pharmaceutical composition comprising the same, to a subject in need thereof. Provides a way to treat it. The fusion protein according to the present invention is to treat cancer by inducing the death of cells to which the fusion protein is bound through the activity of the immune system, and to treat various cancers according to the factors recognized by the target specific polypeptide included in the fusion protein of the present application. It may be used, examples may refer to the above mentioned. In one embodiment according to the present invention the cancer to which the methods of the present invention may be used is any one of cancers overexpressing HER2 or CD2, such as breast cancer, ovarian cancer, uterine cancer and gastric cancer, or non-Hodgkin's lymphoma, which is a cancer in which CD20 is overexpressed, chronic It is preferably one of lymphocytic leukemia, rheumatoid arthritis and hairy cell leukemia, but is not limited thereto.

The fusion proteins, polynucleotides and compositions used in the methods herein, the dosages, the methods of administration, and the types of treatable cancers may be referred to those described above.

As used herein, the term "treatment" means any action that ameliorates or beneficially alters the symptoms of a disease by administration of a composition according to the present application. Those skilled in the art to which the present application belongs, will be able to determine the exact criteria of the disease, and determine the degree of improvement, improvement and treatment with reference to the data presented by the Korean Medical Association.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

Example 1. E. coli  Construction of a fusion protein comprising scFv and LFA3 that specifically binds to HER2 antigen using an expression system

1-1. E. coli  Synthesis of Optimized LFA3 Gene for Expression Systems

Residues 29- of wild-type LFA3 (LFA3 WT SEQ ID NO: 1)

The genes of the corresponding CD2 binding region (SEQ ID NO: 7) and the anti-HER2 single chain variable fragment (anti-HER2 scFv, SEQ ID NO: 33) were commissioned by COSMO genetech. At this time, the BamHI restriction enzyme site at the N-terminal part and the EcoRI restriction enzyme site at the C-terminal part were synthesized. In addition, the anti-HER2 scFv was synthesized by inserting a HindIII restriction enzyme site in both the N-terminal part and the C-terminal part, and the N- of the anti-HER2 scFv sequence for linker insertion between the LFA3 region and the anti-HER2 scFv region. The terminal portion was synthesized to include 13 flexible linkers (SEQ ID NO: 13: GGGGSGGSGSGGG).

1-2. Construction of a plasmid expressing a fusion protein comprising scFv and LFA3 that specifically binds to HER2 antigen

The gene synthesized as in Example 1-1 was prepared in the form inserted into the pUC57 vector, and the pUC57-LFA3WT and pUC57-anti-HER2 scFv plasmids inserted with the gene were HITTM-DH5αValue 108 (catalog no. RH617) manufactured by RBC. Were transformed according to the manufacturer's method.

Then using pUC57-LFA3WT, pUC57-anti-HER2 scFv, pRSET-A vector prepared as described above, pRSET-A-anti HER2- which is a recombinant vector for expressing a fusion protein including anti-HER2 scFv and LFA3 scFv-LFA3WT, pRSET-A-anti-HER2 scFv-LFA3-5 vectors were prepared. The specific method is as follows.

First, the synthesized anti-HER2 scFv was carried out by PCR with a template of the plasmid encoding the Anti-HER2 scFv protein using the primers described in Table 1 to replace HindIII at the N-terminus with EcoRΙ sites. The obtained PCR product was treated with EcoRl and HindIII.

SEQ ID NO: Sequence name order 34 EcoRIcFv-F CGGGAATTCGGCGGTGGAGGCT5 35 scFvHindIII NotI-R GGCCCGCGGCCGCAAGCTTTTATTTGA

Sewing PCR was carried out using pUC57-LFA3WT using the primers of the following [Table 2] LFA3 containing a ctg ccg tct ccg acc sequence corresponding to Leu-Pro-Ser-Pro-Thr at the C terminus of the sequence of SEQ ID NO: 12 -5 (LFA3 variant) was made. Specifically, sewing PCR synthesized forward and reverse primers in three parts using pUC57-LFA3WT as a template to synthesize a total of six primers. PCR was performed by pairing primers 1, 4, primers 5, 17, and primers 18, 8, respectively, to obtain three PCR products 1, 2, and 3. PCR products 1 and 2 were prepared using PCR 1, 17, and , PCR products 2 and 3 were further subjected to PCR using primers 5 and 8 to obtain PCR products 4 and 5. The newly obtained PCR products 4 and 5 were subjected to PCR using primers 1 and 8 to obtain final PCR products. The final PCR product LFA3-5 and LFA3WT used as templates were treated with BamHΙ and EcoRΙ. LFA3 variant 1, in which ctg ccg tct ccg acc sequence corresponding to Leu-Pro-Ser-Pro-Thr was added to SEQ ID NOs: 8, 9, 10 and 11 and the C terminus of each sequence by performing sewing PCR of the same method, 2, 3, 4 were obtained.

SEQ ID NO: Sequence name order 36 Primer 1 cccgcgaaattaatacgactcactataggg 37 Primer 4 acgacctttgaagtcagagaaagcacggaactcaga 38 Primer 5 tctgacttcaaaggtcgtgtttacctggacaccgtt 39 Primer 8 ccattcctcctcttccttcaatgaattcggc 40 Primer 17 gaagtcttccggctgcagagagttgatggtcagagaaccagaaac 41 Primer 18 ctgcagccggaagacttcggtgaatacgaaatggaatctccg

Each section treated with the restriction enzyme was isolated by 1% agarose gel electrophoresis and the pRSET-A vector was digested with EcoRI / BamHI.

The cleaved anti-HER2 scFv gene, the pRSET-A vector, and the cleaved LFA3WT or LFA3-5 were mixed in a ratio of 1: 1: 1, and the T4 DNA ligase (New England BioLabs) was used as the manufacturer's method. Gating was performed. The constructed plasmid was as described in FIG. 1, which was named pRSET-A-anti-HER2 scFv-LFA3WT and pRSET-A-anti-HER2 scFv-LFA3-5, and the structure of the inserted gene is shown in the schematic diagram of FIG. 2. same.

1-3. Optimization of Expression of Recombinant Fusion Proteins

PRSET-A-anti-HER2 scFv-LFA3WT and pRSET-A-anti-HER2 scFv-LFA3-5 constructed in Example 1-2 were transformed into pLysS (invitrogen), an E. coli-expressing cell line, to perform a protein expression test. In this case, the amino acid sequences of the expressed proteins are represented by SEQ ID NOs: 14 and 16, respectively.

As a result, as shown in FIG. 3, the recombinant plasmid was fused by anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 recombinant plasmids in pLysS competent cells through SDS-PAGE of the transformed intracellular protein. It was confirmed that the expression of the protein occurs efficiently.

1-4. Inclusion Body Wash and Protein Solubilization

LFA3 recombinant fusion protein was made by plasmids pRSET-A-anti-HER2 scFv-LFA3WT and pRSET-A-anti-HER2 scFv-LFA3-5, respectively, and expressed in pLysS of the host cell invitrogen. Since the expressed protein is produced as an inclusion body in the bacterial cell, it is washed, solublized, and then refolded to obtain an active recombinant protein. Specific methods of washing and solubilizing the inclusion body are obtained. Is as follows.

Bacteria were grown at 37 ° C. in a culture medium containing 50 μg / ml ampicillin in Novagen's LB broth miller medium (yeast extract 5 g, peptone from casein 10 g, sodium chloride 10 g). The final concentration of 0.5 mM IPTG was added at 1.4 in OD600 to induce the expression of recombinant proteins, followed by further incubation for 3 hours. Bacterial cells were centrifuged at 10,000 rpm, 4 ° C. for 10 minutes (BECKMAN COULTER, Avanti JE) and collected in precipitate form, followed by 50 ml of lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 5 mM DTT, Complete suspension in 1 mM EDTA), crush the cells with a 15 minute ultrasonic grinder (SONICS, Vibra-cell) and centrifuge for 10,000 rpm, 4 ° C. for 15 minutes by adding Phenyl Methane Sulfonyl Fluoride (PMSF) to a final concentration of 1 mM. Separation gave pellets.

Subsequently, after cell disruption, 1 mM PMSF was added and centrifuged at 10,000 rpm for 4 minutes at 4 ° C. to separate supernatant and precipitated pellet (ppt). The isolated pellet was washed with 20 ml of Wash Buffer I (50 mM Tris (pH 8.0), 100 mM NaCl, 2M Urea (FW = 60.1), 1 mM EDTA, 1 mM DTT) at room temperature for 30 minutes until the pellet was completely suspended. Rotated. After centrifugation at 10,000 rpm for 15 minutes at 4 ° C. to separate the supernatant and pellets, the separated pellet was washed with 20 ml of Wash Buffer II (based on 1 L cell culture, 50 mM Tris (pH 8.0), 2% Triton X-100, 100 mM NaCl). , 1mM EDTA, 1mM DTT) and then suspended at room temperature for 30 minutes and then centrifuged at 10,000rpm, 4 ℃ for 15 minutes to separate the supernatant and pellets. The resulting pellet was washed with Wash Buffer III (50 mM Tris-HCl, 100 mM NaCl, 1 mM EDTA, 1 mM DTT) at 20 ml per 1 L of culture volume and centrifuged at 10,000 rpm, 4 ° C. for 15 minutes to obtain pellets again. The resulting pellets were solubilized by stirring overnight at 4 ° C. with 20 ml per 1 L of culture volume in solubilization buffer (8 M Urea, 50 mM Tris-HCl, 5 mM DTT, 1 mM EDTA). Centrifuge at 14,000 rpm, 4 ° C for 30 minutes, take only the supernatant, quantify using protein assay dye reagent concentrate (Biorad, catalog no. 500-0006), and dispense at appropriate amounts for storage at -20 ° C until refolding is performed. It was.

1-5. Protein refolding optimization

Each solubilized protein (anti-HER2 scFv-LFA3WT, anti-HER2 scFv-LFA3-5) was refolded into 15 buffers in 1 ml using the QuickFold protein refolding kit (Athena ES) according to the manufacturer's method. .

In summary, each of the 15 buffers was dispensed 950 μl into microtubes. The protein solution that was solubilized in Example 1-4 was dissolved and the total volume was 50 μl, and the mixture was slowly incubated at 50 μg / ml to 1000 μg / ml and incubated for 1 hour while slowly shaking at room temperature. After incubation, 100 μl of the solution was placed in a well of a 96-well plate, and the turbidity was measured by an ELISA reader (Thermo Scientific, VarioSkan Flash) at 350 nm. The remaining solution was centrifuged (eppendorf, 5415) to visually check the degree of aggregation, and the supernatant was taken. Analysis by SDS-PAGE. After analysis, the gel was confirmed by staining with Coomassie blue (Coomasie blue 2g, EtOH 250ml, acetic acid 50ml, DDW 200ml) and bleached with a bleach solution (acetic acid 1L, EtOH 4L, DW 5L).

As a result, the turbidity did not increase significantly even at a concentration of 1000 μg / ml, and thus the band size did not decrease as compared with the denatured protein control (8M Urea solublized protein) as the protein concentration increased as a result of SDS-PAGE. In addition, anti-HER2 scFv-LFA3WT or anti-HER2 scFv-LFA3-5 had similar results to the 1ml refolding test even in large-capacity tests of several tens of ml, respectively, which resulted in an appropriate concentration of protein refolding of 400 μg / ml. Determined.

In addition, the refold buffer contains 50mM Tris-HCl, 9.6mM NaCl, 0.4mM KCl, 15mM β-mercaptoethanol, 1mM GSH, 0.1mM GSSH, protease inhibitor cocktail (protease inhibitor) containing significant refolding factors as a result of the refold test. cocktail EDTA-free, Roche). The protein solution dissolved in 8M Urea was dissolved in advance while stirring the prepared refolding buffer at 400 rpm or more, and then refolding at 4 ° C. overnight while slowly diluting to 400 μg / ml dropwise in the refolding buffer. The efficiency of refolding was measured by centrifugation the next day and the supernatant was collected and quantified by bradford assay and compared with 400μg / ml, the amount of protein at refolding. As a result, the average yield of refolding was 71-75% for anti-HER2 scFv-LFA3WT and more than 90% for anti-HER2 scFv-LFA3-5.

1-6. E. coli  Purification of Proteins Produced by Expression Systems

After refolding, dialysis was performed using a 10,000 kDa MWCO dialysis membrane in a buffer in which 1 mM GSH and 0.1 mM GSSH were removed from the refold buffer. Centrifugation was performed at 12,000 rpm and 4 ° C. for 30 minutes to remove precipitates formed during dialysis. Only the supernatant was collected and filtered through a 0.45 μm pore size cellulose filtration membrane and loaded onto a nickel affinity chromatography column previously equilibrated with equilibration buffer. Binding fractions eluted near 150mM imidazole were collected, the bands were confirmed by 12% SDS-PAGE, concentrated by ultrafiltration, and the buffer was exchanged with 1X PBS. The obtained protein was removed by adding Triton X-114 in about 1% of the protein volume to remove endotoxin, and then removing the final protein. The final protein was obtained using protein assay dye reagent concentrate (Biorad, catalog no. 500-0006). Final protein amount was quantified.

1-7. E. coli  Binding Assay for Specific Antigens of Proteins Produced in Expression Systems

The LFA3 region included in the fusion protein of the present invention is a region that binds to CD2 on the surface of T lymphocytes, and the anti-HER2 scFv region is encoded by the ERBB2 gene and designed to bind to ERBB2, also known as Human Epidermal Growth Factor Receptor2 (HER2). It was. In this case, ELISA was performed to confirm the affinity of the fusion protein produced in the present invention with respect to the HER2 antigen (purchased from A & Al Ceraputix), and the specific method is as follows.

The HER2 antigen was diluted in 50 mM Bicarbonate / Carbonate coating buffer and dispensed into each well of a 96 well plate at 1 μg / well and incubated for 1 hour at room temperature. Five washes were performed with PBST buffer (PBS, 0.05% Tween-20) using a well washer (Thermo Scientifics, Wellwash Plus) and blocking nonspecific binding for 1 hour with ELISA blocking buffer. The anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 were then diluted to 10 μg / ml, 1 μg / ml, and 0.1 μg / ml in sample dilution buffer and dispensed into each well of a 96-well plate. Incubated for hours.

Subsequently, after washing five times with PBST using a well washer, anti-human kappa chain HRP (Sigma) was diluted 3000: 1 with a sample dilution buffer, and 100 μl per well was incubated at room temperature for 1 hour. After washing 5 times with PBST buffer, TMB (Tetramethylbenzidine substrate solution, sigma, K-T0440-1) was treated and reacted for 15 minutes. The reaction was stopped with 1.8 N sulfuric acid and the absorbance was measured at 450 nm with an ELISA reader.

As a result, as shown in Figure 4, it was confirmed that the purified fusion protein of the present invention binds to the HER2 antigen in a concentration-dependent manner, the difference according to the form of LFA3 wild type or variant was not large. The binding assay of the fusion protein to the CD2 antigen was confirmed through the following CD2-positive cell-based ELISA.

1-8. E. coli  Binding Assay for Nonspecific Antigens of Proteins Produced in Expression Systems

In order to confirm indirectly whether the protein refolding performed properly, it was confirmed by binding to a protein other than the HER2 antigen or CD2 antigen to which the fusion protein binds. The randomly selected proteins were named as proteins A and B possessed by the inventors, and specific experimental methods for ELISA are as follows.

Each of Proteins A and B was diluted to 1 μg / well in 50 mM Bicarbonate / Carbonate coating buffer and incubated for 1 hour at room temperature, followed by ELISA as in Example 1-7.

As a result, as shown in FIG. 5, the purified anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 did not show specific binding to both A and B proteins selected randomly.

1-9. E. coli  Binding Assay for Specific Cells of Proteins Produced in Expression Systems

Cell-based ELISA was performed to confirm the affinity of the purified fusion proteins of the present invention for cells having a specific antigen. The cells used in the experiment were Jurkat T cells having the surface of the CD2 antigen binding to the LFA3 region of the purified fusion protein and SKBR3 cells having the surface of the HER2 antigen binding to the anti-HER2 scFv region of the purified fusion protein, CT26- Her2 / neu cells, A431 cells were used.

First, 50 μg / ml of poly-D-lysine was added to each well of a 96 well microplate at 50 μl and coated in a 50 ° C. dry oven for 2 hours. The plate was cooled to room temperature at room temperature, and 200 μl of Jurkat T cells (1.5X10 ⁵ cells / ml), SKBR3 cells, CT26-Her2 / neu cells, and A431 cells (1X10 ⁵ cells / ml) were added to the wells for one day. Incubated in a 37 ℃ incubator. The next day, the cells were adhered well, the medium was removed from the plate, and washed three times with PBST (PBS, 0.05% Tween-20). Subsequently, 100 μl of methanol / acetone (1: 1) mixture was added to fix the cells, and the cells were washed five times with PBST buffer. To prevent nonspecific binding, the cells were blocked with 3% skim milk solution at room temperature for 1 hour and washed 4 times with PBST. 10 μg / ml, 1 μg / ml, 0.1 μg / ml, 0.01 μg / ml, and 0.001 μg / ml of purified fusion protein were added to the wells 100 μl each, reacted at room temperature for 2 hours, and then washed three times with PBST. It was. 100 μl of anti-human kappa chain-HRP was added at 3000: 1 and reacted at room temperature for 1 hour, followed by washing three times with PBST. 100 μl of Tetramethylbenzidine substrate solution (sigma, K-T0440-1) was added to each well and reacted for 10-15 minutes, and then 100 μl of 1.8N sulfuric acid was added to each well to stop the reaction, and the absorbance was measured at 450 nm with an ELISA reader. It was.

As a result, as shown in FIG. 6, it was confirmed that each of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 binds CD2 expressing Jurkat T cells in a concentration-dependent manner, and the difference according to LFA3 wild type or variant. Was not big. In addition, as shown in Fig. 7, 8 and 9, it was confirmed that the purified fusion protein also binds in a concentration-dependent manner in SKBR3 cells, CT26-Her2 / neu cells, A431 cells expressing HER2, even at this time LFA3 The difference between wild type or variant was not large.

1-10. E. coli Of proteins produced by expression systems CD4 (+) T lymphocyte proliferation experiment ( Mixed  Lymphocyte Reaction ; MLR )

In order to confirm whether the purified fusion protein of the present invention binds to CD2 on the surface of T lymphocytes and activates T lymphocytes, the following experiment was performed.

This assay is based on the activation of T lymphocytes that occur when antigen presenting cells in peripheral blood present antigen to T lymphocytes. This activation occurs by cell-to-cell adhesion and is mediated by CD2 antigen on the surface of T lymphocytes and LFA3 molecules on the surface of antigen presenting cells. It is an analysis to confirm whether the LFA3 region which a fusion protein has has the T lymphocyte activation effect which LFA3 of an antigen presenting cell surface has.

PBMCs for obtaining T lymphocytes were isolated from 30 ml of blood from healthy donors by the Ficoll-Paque (GE Healthcare) concentration gradient method. Blood was diluted in PBS buffer at a 1: 1 ratio and used, and a Ficoll concentration gradient (30 ml blood PBS mixture: 10 ml Ficoll) at a 3: 1 ratio was used. Cells were centrifuged at 2,000 rpm, 20 ° C. for 30 minutes. Each intermediate layer containing the cells was collected by about 25 ~ 30ml, PBS buffer was mixed and washed by centrifugation for 1,500rpm, 4 ℃, 5 minutes. The supernatant was discarded and the cells suspended and used in RPMI medium (GIBCO RPMI, 10% FBS). In particular, the cells obtained in the case of MLR was performed by separating only CD4-positive T lymphocytes using CD4 microbead (Miltenyi Biotec).

The day before PBMC separation, the protein was coated by concentration to remove the protein solution of 96F immuneplate (Nunc, catalog no. NUN-439454) stored at 4 ° C., and then washed twice with sterile PBS buffer. The isolated CD4-positive T lymphocytes were prepared by suspending in RPMI at 2 × 10 ⁶ cells / ml, then aliquoting 100 μl into each well, and incubating the plates in a humidified 37 ° C., 5% CO ₂ incubator for 3 days. Radioactivity was measured after pulses with 1 μCi Thymidine for 18 hours.

As a result, as shown in FIG. 10, both anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 fusion proteins had an effect of proliferating T lymphocytes in a concentration-dependent manner at 1 μg / ml and 10 μg / ml, and 10 μg / ml Anti-HER2 scFv-LFA3-5 was more effective than anti-HER2 scFv-LFA3WT.

1-11. E. coli Toxicity Test on Cancer Cells of Proteins Produced by Expression System

In order to determine whether human PBMCs activated by the fusion protein prepared in the present invention inhibit target cancer cells, the following experiment was performed. In experiments, SKBR3 (ATCC No. HTB-30) cells with HER2 overexpressed were used as target cancer cells for anti-HER2 scFv-LFA3, and human cells were used as effector cells to remove these cancer cells through an immune activation reaction. Peripheral blood mononuclear cells (huPBMC) isolated from blood were used. 100 ml of human blood is diluted 1: 1 with 1x PBS (Biophase, P2007P), and then 40 ml of the mixed solution is loaded into layers of 50 ml containing 10 ml ficoll (BD, 17-1440-03). loading), followed by centrifugation (Vision, VS-550) at 2,000 rpm for 30 minutes using a centrifuge at -20 ° C. Thereafter, the obtained leukocyte layer (buffy coat) was separated, washed once with 1 × PBS, and then centrifuged at 1500 rpm 4 ° C. for 5 minutes to separate PBMCs. The obtained PBMC was incubated at 1 x 10 ⁶ cells / ml in RPMI (Gibc) medium containing 10% FBS (Gibco). SKBR3 to be used as cancer cells was incubated with RPMI containing 10% FBS at 37 ° C., 5% CO ₂ incubator at 10,000 cells / well in 96 well-plates one day before the experiment.

To test the toxicity of cancer cells, put huPBMC into 1:40 (Target cell: Effector cell) in the cultured SKBR3, 0.1 μg / ml of anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 fusion proteins, respectively, After treatment at 1μg / ml, 10μg / ml conditions were incubated for 4 hours at 37 ℃, 5% CO ₂ incubator. To measure the viability of cancer cells after culture, the CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega, G1780) was used according to the manufacturer's method, and huPBMC activated with anti-HER2 scFv-LFA3WT or anti-HER2 scFv-LFA3-5. When cancer cells were destroyed by, the LDH (Lactate Dehydrogenase) ejected from the dead cells was measured according to a prescribed protocol.

For this purpose, after centrifugation at 250C for 4 minutes at 4 ° C., 50 μl of the medium was mixed with 50 μl of the substrate buffer, and then reacted at room temperature for 30 minutes. After the reaction was terminated with 50 μl of the stop solution, the absorbance was measured at 490 nm. It was. At this time, the cytotoxicity was calculated by the following equation, and the results are shown in FIG. 11.

As a result, as shown in FIG. 11, the anti-CD3 antibody (ab86883) used as a positive control showed SKBR3 cell killing effect of 71% at 10 μg / ml, 39% at 1 μg / ml, and 23% at 0.1 μg / ml. When only huPBMC and SKBR3 cells were added as a negative control, it was determined that there was no cytotoxicity.

The fusion protein anti-HER2 scFv-LFA3WT showed specific cancer cell destruction of 15%, 13% and 5% at 10μg / ml, 1μg / ml and 0.1μg / ml, respectively, and anti-HER2 scFv-LFA3-5 At 10 μg / ml, 1 μg / ml, and 0.1 μg / ml, they showed specific cancer cell destruction of 43%, 17%, and 0%, respectively. In three replicates, the cytotoxicity (%) values varied with the blood donors used in the experiment, but the pattern was similar. Anti-HER2 scFv-LFA3-5 of the purified protein showed a similar effect to the cytotoxic effect of 1 μg / ml of anti-CD3 antibody used as a positive control at 10 μg / ml, which is superior to the anti-HER2 scFv-LFA3WT. It was.

1-12. E. coli  Of proteins produced by expression systems IL -2 cytokines ELISA  analysis

Human cytokine (human cytokine) is the most representative method for testing PBMC activation to determine whether human PBMCs are activated by anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5. ELISA for IL-2 (Interleukin-2) was performed.

IL-2 is one of the representative immune cytokines, and in particular, is known to be involved in the growth and differentiation of T lymphocytes. Therefore, activation of T lymphocytes can be indirectly confirmed by measuring the expression level of IL-2 in PBMC. In the following experiments, peripheral blood mononuclear cells (huPBMCs) isolated from human blood were activated using the fusion proteins anti-HER2 scFv-LFA3WT and anti-HER2 scFv-LFA3-5 of the present invention. The amount of IL-2 expressed was measured using a -2 cytokine ELISA kit (R & D Systems, DY202) according to the manufacturer's method, specific methods are as follows.

In summary, 2 x 10 ⁶ cells per well were put into 48 well plates of PBMCs isolated in the same manner as in <Example 1-11>, and the fusion proteins were prepared at concentrations of 0.1 μg / ml, 1 μg / ml, and 10 μg / ml, respectively. Put in. Afterwards it was incubated for 21 hours at 37 ℃, 5% CO ₂ incubator. Capture antibody (R & D Systems, Part 840104) in a 96 well-plate for IL-2 ELISA at 100 μl, 4 ° C. overnight at a concentration of 4 μg / ml, followed by blocking solution (1% BSA in PBS with 0.05% NaN 3) was incubated at 300 μl for 1 hour at room temperature. Subsequently, 10 μg / ml, 1 μg / ml, and 0.1 μg / ml protein-treated PBMC medium were placed in 96 well-plates, and incubated at room temperature for 2 hours, followed by 27 μg / of detection antibody (R & D Systems, Part 840105). 100 μl in ml, incubated for 2 hours at room temperature. Subsequently, Streptavidin-HRP (R & D Systems, Part 890803) was diluted 1: 200 and treated at 100 μl for 20 minutes at room temperature, followed by 100 μl treatment of Tetramethylbenzidine substrate solution (sigma, K-T0440-1) to detect detection signals. Confirmed. Absorbance was measured at 450nm and 540nm, respectively, and was calculated by subtracting the 540nm measurement from the 450nm measurement according to the method given in the kit's manual for calibration.

As a result, as shown in Figure 12, the secretion of IL-2 in 5μg / ml PWM (pokeweed mitogen, sigma) used as a positive control was measured above 8000pg / ml, only human PBMC and fusion protein IL-2 was not measured at all in the negative control 1 and the negative control 2 which measured only the culture medium. Anti-HER2 scFv-LFA3WT was measured to induce production of IL-2 at 838 pg / ml, 1500 pg / ml and 3005 pg / ml at concentrations of 0.1 μg / ml, 1 μg / ml and 10 μg / ml, respectively. In addition, Anti-HER2 scFv-LFA3-5 was measured to induce the production of IL-2 of 1300pg / ml, 2203pg / ml, 2224pg / ml at concentrations of 0.1μg / ml, 1μg / ml, 10μg / ml, respectively.

The fusion proteins Anti-HER2 scFv-LFA3WT and Anti-HER2 scFv-LFA3-5 prepared in the present invention activate T lymphocytes to secrete IL-2, and the secreted IL-2 is involved in the growth and differentiation of T lymphocytes. This effect indicates that T lymphocytes can be proliferated as shown in FIG. 10.

Example 2 Construction of Fusion Proteins Containing scFv and LFA3 Specific for HER2 Antigen Using a Mammalian Expression System

2-1. Gene synthesis optimized for expression in mammalian cells

Since LFA3 is originally of human origin, it was performed by codon optimization COSMOgentech in mammals for production in mammalian cells, especially Chinese Hamster Ovary (CHO) cells, A base sequence corresponding to 1 to 369 of SEQ ID NO: 17 encoding the LFA3 CD2 binding region corresponding to the 1 to 123 amino acid residue was synthesized and confirmed as shown in FIG. 13. The synthesized sequence was optimized for the expression of mammalian cells, Xho I and Not I restriction sites, kozak sequence, signal sequence (nt 1 to 84 of SEQ ID NO: 17), ectodomain 1 (SEQ ID NO: 17 of LFA3 CD2 binding region) nt 29 to 369), a linker, an anti-HER2 scFv sequence, a TEV cleavage site, and a 6X HIS site.

The amino acid sequence of the protein produced by the gene of the present invention optimized expression in the mammalian cell is shown in SEQ ID NO: 15, a simple structural diagram of the protein produced is shown in FIG.

SEQ ID NO: order 17 Nucleotide sequence of anti-HER2 scFv-LFA3 gene optimized by Mammalian expression system 15 Amino acid sequence of anti-HER2 scFv-LFA3 synthesized by Mammalian expression system 17 nt 1 to 369 Gene base sequence of LFA3 optimized by Mammalian expression system Residues 1 to 123 of SEQ ID NO: 15 Amino acid sequence of LFA3 optimized by Mammalian expression system (residues 29-123)

2-2. Plasmid Construction for Protein Production Optimized for Expression in Mammalian Cells

In order to temporarily express the gene synthesized in <Example 2-1> in COS-7 cells, a mammalian cell expression vector pCIneo vector was used, and the synthesized gene was cloned into pCIneo vector using XhoI and NotI, The produced vector is shown in FIG. In addition, the cloned plasmid was identified as shown in FIG. 16 by treating the restriction enzyme, and the size of the cloned plasmid was about 100bp from that of the anti-HER2 scFv-LFA3 gene for expression in E. coli synthesized in Example 1. Was confirmed in [FIG. 17].

The recombinant plasmid for expression in the produced mammal was subjected to sequencing using the universal T3 primer, pCIneo-F primer, and pCIneo-R primer of the following [Table 4]. As a result, the mutation was not confirmed. It was.

SEQ ID NO: Primer Base sequence 42 T3 ATTAACCCTCACTAAAG 43 pCIneo-R TACAAATAAAGCAATAGCAT 44 pCIneo-F CACTTTGCCTTTCTCTCCAC

2-3. Production of Protein Optimized for Expression in Mammalian Cells in COS7 Cells

The anti-HER2 scFv-LFA3 plasmid prepared in 2-2 was transiently transduced into COS7 cells to produce a fusion protein in a mammalian system.

Specifically, COS7 cells were grown to about 70-80% fill in T175 flasks. 70 μg of DNA was diluted to a total volume of 4.3 ml in Opti-MEM I media (BD Bioscience), and lipofectamine 2000 (invitrogen) was used as a transduction reagent, and 175 μl of lipofectamine 2000 was used as Opti-MEM I medium. Was diluted to 4.3ml and reacted for 5 minutes at room temperature. The DNA / lipofectamine 2000 mixture was allowed to react at room temperature for 20 minutes and then placed in a flask with COS7 cells. After incubation at 37 ° C. for 5-7 hours, the medium was changed to a serum-free medium, and after 3 days, the medium was collected and Western blot analysis was performed on the stock solution and 1/20 concentrate. Western blot detection antibodies were used as polyclonal anti-CD58 antibody (sc-20925), anti-human kappa chain antibody (Sigma), and anti-C term HIS HRP antibody (INV-R931-25). Expression was confirmed with all three antibodies, and the results of the expression with the anti-human kappa chain antibody (Sigma) are shown in FIG. 18. At this time, the glycosylation (Glycosylation) was confirmed that the size is larger than the protein expressed using the E. coli expression system.

2-4. Early cell line construction producing proteins optimized for expression in mammalian cells in CHO cells

As described above, transient expression of anti-HER2 scFv-LFA3 was confirmed in COS-7 cells, cloned into pAD15 vector for stable expression, and then transformed into CHO cells in the same manner as in Example 2-3 to select HT and Initial cell lines were generated via MTX amplification for selected colonies with limited dilution.

2-5. Purification of Proteins Expressed in Mammalian Cells

After 3 days of transient delivery to COS-7 cells, the cells were collected and centrifuged at 2000 rpm, 4 ° C. for 3 minutes, and the obtained cells were filtered through a 0.45 μm pore size cellulose filtration membrane and previously equilibrated with equilibration buffer. Loaded into a chromatography column. The eluted binding fractions were collected, the bands were confirmed by 12% SDS-PAGE, concentrated by ultrafiltration, and buffer exchange was performed with 1X PBS. The obtained protein was removed by adding Triton X-114 in about 1% of the protein volume to remove endotoxin, and then removing the final protein. The final protein was obtained using protein assay dye reagent concentrate (Biorad, catalog no. 500-0006). Final protein amount was quantified.

2-6. Binding assays for specific and nonspecific antigens

The binding method of HER2, a specific cancer antigen, was determined by the experimental method of Examples 1-7. The experiment was carried out with a culture medium 10 times concentrated with a 10 kDa cut off column (millipore), a culture medium sample, a 1/10 diluted sample, a 1/100 diluted sample, and the control medium E. Anti-HER2 scfv-LFA3WT produced and purified in coli was used.

As a result, as shown in FIG. 19, it was confirmed that anti-HER2 scFv-LFA3 expressed in mammalian cells also bound to the HER2 antigen in a concentration-dependent manner. Although the effect seems superior to the fusion protein expressed in E. coli, the effect of concentration cannot be directly compared because protein produced in mammalian cells is used without quantification. However, since the effect of the protein before purification is the same as that of Figure 19, if the purification process, the activity is expected to increase further.

Whether the protein transiently expressed in COS-7 binds to a nonspecific antigen was determined by the experimental method of Examples 1-8. The experiment was carried out with a culture medium 10 times concentrated with a 10 kDa cut off column (millipore), a stock medium sample, a 1/10 diluted sample, a 1/100 diluted sample before the purification. It was confirmed by ELISA whether the fusion protein binds to proteins A and B that were randomly selected to bind to proteins other than HER2 antigen or CD2 antigen.

As a result, as shown in FIG. 20, anti-HER2 scFv-LFA3 produced in mammalian cells also did not show nonspecific binding to both randomly selected A and B proteins.

2-7. Dual Binding Assay of Multispecific Proteins Produced in COS-7 Cells

Before purifying the culture medium containing the anti-HER2 scFv-LFA3 transiently expressed in COS-7 cells, it was confirmed whether ELISA and CD2 antigen can be simultaneously bound by ELISA as follows. .

Specifically, HER2 antigen was diluted in 50 mM Bicarbonate / Carbonate coating buffer and dispensed into 96 well plates at 1 μg / well and incubated for 1 hour at room temperature. It was washed five times with PBST buffer (PBS, 0.05% Tween-20) using a well washer (Thermo Scientifics, Wellwash Plus) and blocked nonspecific binding for 1 hour with ELISA blocking buffer. After washing 5 times with PBST using a well washer, the medium sample was concentrated 10-fold with anti-HER2 scFv-LFA3 culture medium on a 10 kDa cut off column (millipore), the stock medium sample, the 1/10 diluted sample, and the 1/100 dilution. One sample, 1/1000 diluted samples were dispensed into 96 well plates and incubated at room temperature for 2 hours. After washing five times with PBST using a well washer, 50000 Jurkat T cells were added per well and incubated at 37 ° C. for 1 hour. Jurkat T cells remaining after washing three times with PBST were labeled with calcein AM for 30 minutes. Fluorescence was measured at 490 nm / 520 nm with an ELISA reader.

As a result, as shown in Figure 21, it was confirmed that the concentration of anti-HER2 scFv-LFA3 binds to Jurkat T cells having a CD2 antigen at the same time as the HER2 antigen, the effect is on the purified protein expressed in E. coli Although it is superior, the protein expressed in COS-7 is not purified and quantitatively used, so accurate comparison is difficult. However, since the effect of the protein before purification is the same as [Fig. 21], if the purification process is expected, the activity is expected to increase further.

Example 3 Construction of anti-CD20 Fab-LFA3 and anti-CD20 scFv-LFA3 Fusion Proteins

3-1. Anti-CD20 scFv-LFA3 Fusion Protein Construction and Activity of E. coli Expressed Proteins

In this embodiment, anti-CD20 scFv was converted to anti-CD20 scFv by recognizing a cancer antigen of Anti-HER2 scFv-LFA3, which was developed as a HER2 (+) cancer therapeutic agent, to prepare an anti-CD20 scFv-LFA3 fusion protein to produce B-cell lymphoma. application as a treatment for lymphoma.

Anti-CD20 scFv used in this Example was synthesized by Cosmogenetech Co., Ltd. as follows.

The sequence of the existing synthesized LFA3 wild type and variants is as described above. The anti-CD20 scFv contains the EcoR I site in the N-terminal region and the Hind III restriction enzyme site in the C-terminal region. Finally, the anti-CD20 scFv-LFA3 wild type and variants were cloned into the pRSET-A vector. A vector as shown in FIG. 22 was constructed. The base sequence of each expressed protein is as shown in SEQ ID NOs: 25, 26, 27, 28, 29 and 30, and the amino acid sequence is as shown in SEQ ID NOs: 31, 32, 33, 34, 35 and 36. 5]. At this time, the protein expressed in E. coli was produced and obtained in the same manner as the anti-HER2 scFv-LFA3s purification process of Example 1-6.

SEQ ID NO: order 27 Anti-CD20 scFv-LFA3 WT Sequence 28 Anti-CD20 scFv-LFA3-1 Sequence 29 Anti-CD20 scFv-LFA3-2 Sequence 30 Anti-CD20 scFv-LFA3-3 Sequence 31 Anti-CD20 scFv-LFA3-4 Sequence 32 Anti-CD20 scFv-LFA3-5 Sequence 18 Anti-CD20 scFv-LFA3 WT Amino Acid Sequence 19 Anti-CD20 scFv-LFA3-1 amino acid sequence 20 Anti-CD20 scFv-LFA3-2 amino acid sequence 21 Anti-CD20 scFv-LFA3-3 amino acid sequence 22 Anti-CD20 scFv-LFA3-4 amino acid sequence 23 Anti-CD20 scFv-LFA3-5 amino acid sequence

The anti-CD20 scFv-LFA3-1 protein of the present invention purified through the above method was bound to CD20-positive Raji cells and CD2-positive Jurkat T cells as shown in FIGS. 23 and 24, respectively. Each cell was used as poly-D-lysine by attaching 2 X 10 ⁶ cells per well of a 96 well plate, and the FcR blocker (Miltenyibiotec, catalog no. 130-059-901) 1: 500 prior to binding to the fusion protein. Diluted with, treated to plates and tested. As a detection antibody, anti-6X HIS tag-HRP antibody (ab1187) was diluted 1: 3000 and used.

In addition, T lymphocyte proliferation assay (MLR) was performed with the purified protein anti-CD20 scFv-LFA3-1. As a result, as shown in FIG. 25, T lymphocyte proliferation was equivalent to 0.1 μg / ml of the anti-CD3 antibody used as a positive control. Confirmed.

In addition, the most representative method for testing PBMC activation to determine whether human PBMC is activated by anti-CD20 scFv-LFA3WT produced by E. coli for IL-2 (Interleukin-2), one of the human cytokines Cytokine ELISA was performed in the same manner as described in Examples 1-12 using a human IL-2 cytokine ELISA kit (R & D Systems, DY202).

As a result, as shown in FIG. 26, IL-2 was not measured at all in the negative control group containing only human PBMC but not the fusion protein, and the anti-CD20 scFv-LFA3WT contained more than 3000 pg / ml of IL at 1 μg / ml. It was determined that the production of -2.

These results suggest that Anti-CD20 scFv-LFA3WT activates T lymphocytes to secrete IL-2, and secreted IL-2 affects the growth and differentiation of T lymphocytes, thereby proliferating T lymphocytes as shown in FIG. 25. To indicate.

3-2. Expression-optimized anti-CD20 Fab-LFA3 and anti-CD20 scFv-LFA3 Fusion Proteins in Mammalian Expression Systems and Expression of Proteins in Mammalian Cells

The Anti-CD20 Fab sequence and the anti-CD20 scFv sequence refer to DrugBank Rituximab (Accession number DB00073), and the LFA3 sequence used is the same sequence used for the production of anti-HER2 scFv-LFA3 for expression in mammalian cells.

The amino acid sequence of the fusion protein of Anti-CD20 Fab and LFA3 is shown in SEQ ID NO: 25 (anti-CD20 VH-CH-LFA3), SEQ ID NO: 26 (anti-CD20 VL-CL), and Anti-CD20 scFv and LFA3 The amino acid sequence of the fused protein is shown in SEQ ID NO: 24. The three sequences were synthesized by Genescript. DNA quantification, transformation, DNA purification and cloning of the synthesized gene are the same as in Example 2. Schematic diagrams of the anti-CD20 scFv-LFA3 and the anti-CD20 Fab-LFA3 inserted into the final plasmid are shown in FIGS. 28 and 29, respectively.

Example 4. Anti-cancer Drug Evaluation of Anti-HER2 scFv-LFA3 in Human Ovarian Cancer (SKOV3) Transplantation Model

Anti-cancer activity was verified by intravenous injection of anti-HER2 scFv-LFA3 to an animal model in which SKOV3 cells with HER2 antigen were xenografted in nude mice.

The first animal experiment involved a delayed treatment model that induces cancer and then treated the drug. The mice used in the experiment were BALB / C-specific pathogen-free (SPF) nude mice (Nara Biotech Co.), and SKOV3 cancer cells were suspended at 1 × 10 ⁷ cells / ml and 0.3 ml (ie, 3 × 10 ⁶⁾ per mouse. cells / mouse) were injected subcutaneously into the fluid and area between the right shoulder and chest wall. SKOV3 cancer cells and PBMC mixed transplant group were each made up of twice the concentration and mixed 1: 1, and the same amount was injected by the same method. When the size of the cancer mass reached 60 mm ³ , anti-HER2 scFv-LFA3 was injected intravenously once daily for 5 days at 0.2 ml per mouse (day 0-4). All animals observed general symptoms of body weight and administration to determine the toxicity of anti-HER2 scFv-LFA3. No specific general symptoms were observed during the test period, and no significant weight loss was observed. As a result, as shown in FIG. 30a, it was confirmed that the anti-HER2 scFv-LFA3 administration group had a tumor growth inhibition effect of 38.3% compared to the solvent control group and the solvent + PBMC control group on the last day of the experiment.

Next, an early treatment model was performed to treat drugs simultaneously with cancer cells. The mice used in the experiments and the experimental methods were the same as those in the first animal experiments, except that they were treated with cancer cells, PBMCs, and anti-HER2 scFv-LFA3 simultaneously. Anti-HER2 scFv-LFA3 was administered in three concentrations of 10 μg, 50 μg and 100 μg. All animals observed general symptoms of body weight and administration to determine the toxicity of anti-HER2 scFv-LFA3. No specific general symptoms were observed during the test period, and no significant weight loss was observed. As a result, as shown in Figure 30b, it was confirmed that the anti-HER2 scFv-LFA3 highest concentration group has a tumor growth inhibitory effect of 37.4% compared to the solvent control on the last day of the experiment. In addition, the tumor weight of the last day in the 10 μg group, 50 μg group, and 100 μg group was decreased by 8.2%, 17.0% (p <0.01), and 35.2% (p <0.001), respectively, compared to the solvent control group.

Example 5 Antitumor Drug Evaluation of anti-CD20 scFv-LFA3 in Human-derived Blood Cancer (Raji) Transplantation Model

Anti-cancer activity was verified by intravenous injection of anti-CD20 scFv-LFA3 in an animal model in which xenograft Raji hematological cancer cells with CD20 antigen were xenografted in NOD.CB17 / scid mice.

An early treatment model was developed to treat the drug with cancer cells. The mice used in the experiment were NOD.CB17 / scid mice (5W, female) produced by ARC (Perth, WA, Australia), and Raji cancer cells were adjusted to 1.65 × 10 ⁷ cells / ml per mouse. 0.3 ml (ie 5 × 10 ⁶ cells / mouse) were injected subcutaneously into the fluid and area between the right shoulder and chest wall. Raji cancer cells and PBMC mixed transplant groups were each made up of double concentration, mixed 1: 1, and injected in the same way. Anti-CD20 scFv-LFA3 was injected once daily for 0.2 ml per mouse for 5 days (day 0-4). Anti-CD20 scFv-LFA3 was administered in three concentrations of 2 μg, 20 μg and 200 μg. All animals observed general symptoms of body weight and administration to determine the toxicity of anti-CD20 scFv-LFA3.As a result, animals with lower paraplegia developed in the solvent control group on the last day, whereas anti-CD20 scFv-LFA3 No adverse symptoms were observed in the administration group and no significant weight loss was observed. As a result, as shown in Figure 31, the final concentration of the anti-CD20 scFv-LFA3 administration group compared to the solvent control group was confirmed that the tumor growth inhibitory effect of 75.6% (p <0.001). In addition, compared with the solvent control group, aCD20 scFv-LFA3 200μg / mouse treatment group showed a 68.2 (p <0.01)% reduction in tumor weight.

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative and non-restrictive in every respect.

<110> Handok Inc. <120> LFA3 derivative and fusion protein comprising target specific          polypeptide linked to the LFA3 variant or LFA3 CD2 binding region          and use thereof <130> DP201306002P <150> 2012/0087477 <151> 2012-08-09 <160> 44 <170> Kopatentin 2.0 <210> 1 <211> 240 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE (222) (1) .. (240) <223> Amino acid sequence of full length wild type LFA3 <220> <221> SIGNAL <222> (1) (28) <223> Signal sequence <400> 1 Met Val Ala Gly Ser Asp Ala Gly Arg Ala Leu Gly Val Leu Ser Val   1 5 10 15 Val Cys Leu Leu His Cys Phe Gly Phe Ile Ser Cys Phe Ser Gln Gln              20 25 30 Ile Tyr Gly Val Val Tyr Gly Asn Val Thr Phe His Val Pro Ser Asn          35 40 45 Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys Asp Lys Val Ala      50 55 60 Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Ser Phe Lys Asn Arg  65 70 75 80 Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile Tyr Asn Leu Thr                  85 90 95 Ser Ser Asp Glu Asp Glu Tyr Glu Met Glu Ser Pro Asn Ile Thr Asp             100 105 110 Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Leu Pro Ser Pro Thr         115 120 125 Leu Thr Cys Ala Leu Thr Asn Gly Ser Ile Glu Val Gln Cys Met Ile     130 135 140 Pro Glu Tyr Tyr Asn Ser His Arg Gly Leu Ile Met Tyr Ser Trp Asp 145 150 155 160 Cys Pro Met Glu Gln Cys Lys Arg Asn Ser Thr Ser Ile Tyr Phe Lys                 165 170 175 Met Glu Asn Asp Leu Pro Gln Lys Ile Gln Cys Thr Leu Ser Asn Pro             180 185 190 Leu Phe Asn Thr Thr Ser Ser Ser Ile Leu Thr Thr Cys Ile Pro Ser         195 200 205 Ser Gly His Ser Arg His Arg Tyr Ala Leu Ile Pro Ile Pro Leu Ala     210 215 220 Val Ile Thr Thr Cys Ile Val Leu Tyr Met Asn Gly Met Tyr Ala Phe 225 230 235 240 <210> 2 <211> 95 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of CD2 binding region of derivative LFA3-1 <400> 2 Phe Ser Gln Gln Ile Tyr Gly Thr Trp Lys Gly Asp Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Asp          35 40 45 Phe Lys Gly Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Asn Ser Leu Gln Ser Glu Asp Phe Gly Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser                  85 90 95 <210> 3 <211> 101 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of CD2 binding region of derivative LFA3-2 <400> 3 Phe Ser Gln Gln Ile Tyr Gly Lys Lys Gly Asp Thr Val Thr Phe Thr   1 5 10 15 Cys Thr Ala Ser Gln Lys Lys Ser Ile Glu Val Leu Trp Lys Lys Gln              20 25 30 Lys Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser          35 40 45 Ser Phe Lys Asn Arg Ala Asp Ser Arg Arg Ser Leu Trp Asp Gln Gly      50 55 60 Asn Phe Pro Leu Thr Ile Tyr Asn Leu Lys Ile Glu Asp Glu Asp Glu  65 70 75 80 Tyr Glu Met Glu Ser Pro Asn Ile Thr Asp Thr Met Lys Phe Phe Leu                  85 90 95 Tyr Val Leu Glu Ser             100 <210> 4 <211> 95 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of CD2 binding region of derivative LFA3-3 <400> 4 Phe Ser Gln Gln Ile Tyr Gly Pro Trp Lys Gly Asp Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Arg          35 40 45 Phe Lys Gly Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Asn Ser Leu Gln Arg Glu Asp Thr Gly Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser                  85 90 95 <210> 5 <211> 95 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of CD2 binding region of derivative LFA3-4 <400> 5 Phe Ser Gln Gln Ile Tyr Gly Thr Trp Lys Gly Asp Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Asp          35 40 45 Phe Lys Gly Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Asn Asn Leu Arg Ala Glu Asp Met Gly Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser                  85 90 95 <210> 6 <211> 95 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of CD2 binding region of derivative LFA3-5 <400> 6 Phe Ser Gln Gln Ile Tyr Gly Val Val Tyr Gly Asn Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Asp          35 40 45 Phe Lys Gly Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Asn Ser Leu Gln Pro Glu Asp Phe Gly Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser                  85 90 95 <210> 7 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of wild type LFA3 CD2 binding region for          E.coli expression <400> 7 ttctctcagc agatctacgg tgttgtttac ggtaacgtta ccttccacgt tccgtctaac 60 gttccgctga aagaagttct gtggaaaaaa cagaaagaca aagttgctga actggaaaac 120 tctgagttcc gtgctttctc ttctttcaaa aaccgtgttt acctggacac cgtttctggt 180 tctctgacca tctacaacct gacctcttct gacgaagacg aatacgaaat ggaatctccg 240 aacatcaccg acaccatgaa attcttcctg tacgttctgg aatctctgcc gtctccgacc 300                                                                          300 <210> 8 <211> 285 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of CD2 binding region of derivative LFA3-1 <400> 8 ttctctcagc agatctacgg tacctggaaa ggtgacgtta ccttccacgt tccgtctaac 60 gttccgctga aagaagttct gtggaaaaaa cagaaagaca aagttgctga actggaaaac 120 tctgagttcc gtgctttctc tgacttcaaa ggtcgtgttt acctggacac cgtttctggt 180 tctctgacca tcaactctct gcagtctgaa gacttcggtg aatacgaaat ggaatctccg 240 aacatcaccg acaccatgaa attcttcctg tacgttctgg aatct 285 <210> 9 <211> 303 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of CD2 binding region of derivative LFA3-2 <400> 9 ttctctcagc agatctacgg taaaaaaggt gacaccgtta ccttcacctg caccgcttct 60 cagaaaaaat ctatcgaagt tctgtggaaa aaacagaaag acaaagttgc tgaactggaa 120 aactctgagt tccgtgcttt ctcttctttc aaaaaccgtg ctgactctcg tcgttctctg 180 tgggaccagg gtaacttccc gctgaccatc tacaacctga aaatcgaaga cgaagacgaa 240 tacgaaatgg aatctccgaa catcaccgac accatgaaat tcttcctgta cgttctggaa 300 tct 303 <210> 10 <211> 285 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of CD2 binding region of derivative LFA3-3 <400> 10 ttctctcagc agatctacgg tccgtggaaa ggtgacgtta ccttccacgt tccgtctaac 60 gttccgctga aagaagttct gtggaaaaaa cagaaagaca aagttgctga actggaaaac 120 tctgagttcc gtgctttctc tcgtttcaaa ggtcgtgttt acctggacac cgtttctggt 180 tctctgacca tcaactctct gcagcgtgaa gacacgggtg aatacgaaat ggaatctccg 240 aacatcaccg acaccatgaa attcttcctg tacgttctgg aatct 285 <210> 11 <211> 285 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of CD2 binding region of derivative LFA3-4 <400> 11 ttctctcagc agatctacgg tacctggaaa ggtgacgtta ccttccacgt tccgtctaac 60 gttccgctga aagaagttct gtggaaaaaa cagaaagaca aagttgctga actggaaaac 120 tctgagttcc gtgctttctc tgacttcaaa ggtcgtgttt acctggacac cgtttctggt 180 tctctgacca tcaacaacct gcgtgctgaa gacatgggtg aatacgaaat ggaatctccg 240 aacatcaccg acaccatgaa attcttcctg tacgttctgg aatct 285 <210> 12 <211> 285 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of CD2 binding region of derivative LFA3-5 <400> 12 ttctctcagc agatctacgg tgttgtttac ggtaacgtta ccttccacgt tccgtctaac 60 gttccgctga aagaagttct gtggaaaaaa cagaaagaca aagttgctga actggaaaac 120 tctgagttcc gtgctttctc tgacttcaaa ggtcgtgttt acctggacac cgtttctggt 180 tctctgacca tcaactctct gcagccggaa gacttcggtg aatacgaaat ggaatctccg 240 aacatcaccg acaccatgaa attcttcctg tacgttctgg aatct 285 <210> 13 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Flexible peptide linker for fusion protein <400> 13 Gly Gly Gly Gly Ser Gly Gly Ser Gly Ser Gly Gly Gly   1 5 10 <210> 14 <211> 355 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-HER2 scFv-wt LFA3 CD2 binding region          for prokaryotic cell expression <400> 14 Phe Ser Gln Gln Ile Tyr Gly Val Val Tyr Gly Asn Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Ser          35 40 45 Phe Lys Asn Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Tyr Asn Leu Thr Ser Ser Asp Glu Asp Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Leu                  85 90 95 Pro Ser Pro Thr Gly Gly Gly Gly Ser Gly Gly Ser Gly Ser Gly Gly             100 105 110 Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly         115 120 125 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Ile Lys Asp     130 135 140 Thr Tyr Ile His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp 145 150 155 160 Val Ala Arg Ile Tyr Pro Thr Asn Gly Tyr Thr Arg Tyr Ala Asp Ser                 165 170 175 Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala             180 185 190 Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr         195 200 205 Cys Ser Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly     210 215 220 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 225 230 235 240 Gly Gly Ser Gly Gly Gly Ser Gly Asp Ile Gln Met Thr Gln Ser Pro                 245 250 255 Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg             260 265 270 Ala Ser Gln Asp Val Asn Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro         275 280 285 Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser     290 295 300 Gly Val Pro Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr Asp Phe Thr 305 310 315 320 Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys                 325 330 335 Gln Gln His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val             340 345 350 Glu Ile Lys         355 <210> 15 <211> 388 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-HER2 scFv-wt LFA3 CD2 binding region          for eukaryotic cell expression <400> 15 Met Val Ala Gly Ser Asp Ala Gly Arg Ala Leu Gly Val Leu Ser Val   1 5 10 15 Val Cys Leu Leu His Cys Phe Gly Phe Ile Ser Cys Phe Ser Gln Gln              20 25 30 Ile Tyr Gly Val Val Tyr Gly Asn Val Thr Phe His Val Pro Ser Asn          35 40 45 Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys Asp Lys Val Ala      50 55 60 Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Ser Phe Lys Asn Arg  65 70 75 80 Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile Tyr Asn Leu Thr                  85 90 95 Ser Ser Asp Glu Asp Glu Tyr Glu Met Glu Ser Pro Asn Ile Thr Asp             100 105 110 Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Gly Gly Gly Gly Ser         115 120 125 Gly Gly Ser Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu     130 135 140 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ser Ser Gly Phe 145 150 155 160 Asn Ile Lys Asp Thr Tyr Ile His Trp Val Arg Gln Ala Pro Gly Lys                 165 170 175 Gly Leu Glu Trp Val Ala Arg Ile Tyr Pro Thr Asn Gly Tyr Thr Arg             180 185 190 Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser         195 200 205 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr     210 215 220 Ala Val Tyr Tyr Cys Ser Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met 225 230 235 240 Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly                 245 250 255 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Asp Ile Gln Met             260 265 270 Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr         275 280 285 Ile Thr Cys Arg Ala Ser Gln Asp Val Asn Thr Ala Val Ala Trp Tyr     290 295 300 Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser 305 310 315 320 Phe Leu Tyr Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Arg Ser Gly                 325 330 335 Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala             340 345 350 Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Pro Thr Phe Gly Gln         355 360 365 Gly Thr Lys Val Glu Ile Lys Glu Asn Leu Tyr Phe Gln Gly His His     370 375 380 His His His His 385 <210> 16 <211> 355 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-HER2 scFv LFA3-5 CD2 binding region          for prokaryotic expression <400> 16 Phe Ser Gln Gln Ile Tyr Gly Val Val Tyr Gly Asn Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Asp          35 40 45 Phe Lys Gly Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Asn Ser Leu Gln Pro Glu Asp Phe Gly Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Leu                  85 90 95 Pro Ser Pro Thr Gly Gly Gly Gly Ser Gly Gly Ser Gly Ser Gly Gly             100 105 110 Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly         115 120 125 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Ile Lys Asp     130 135 140 Thr Tyr Ile His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp 145 150 155 160 Val Ala Arg Ile Tyr Pro Thr Asn Gly Tyr Thr Arg Tyr Ala Asp Ser                 165 170 175 Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala             180 185 190 Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr         195 200 205 Cys Ser Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly     210 215 220 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 225 230 235 240 Gly Gly Ser Gly Gly Gly Ser Gly Asp Ile Gln Met Thr Gln Ser Pro                 245 250 255 Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg             260 265 270 Ala Ser Gln Asp Val Asn Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro         275 280 285 Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser     290 295 300 Gly Val Pro Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr Asp Phe Thr 305 310 315 320 Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys                 325 330 335 Gln Gln His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val             340 345 350 Glu Ile Lys         355 <210> 17 <211> 1167 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of Anti-HER2 scFv-wt LFA3 CD2 binding          region for eukaryotic expression <400> 17 atggttgcag gatcagatgc tggacgagcg ctgggagtcc tgagcgtggt gtgcttgctg 60 cactgcttcg ggtttatcag ttgcttttca caacagattt acggcgtggt ttacggaaat 120 gtgacattcc acgtaccctc taacgtgcca ctgaaggaag tgctgtggaa gaagcagaaa 180 gacaaggtgg ccgaactcga aaacagtgag ttccgagcgt tcagtagctt caagaaccgg 240 gtatacctcg acaccgtttc tggatcactc accatctata acctgacctc aagcgatgag 300 gacgagtacg agatggagag cccaaatatt accgatacca tgaaattctt cttgtatgta 360 ttggaatccg gaggtggagg gagcgggggt tcagggagcg aggtgcagct ggttgaatct 420 gggggcggtc ttgtccagcc tggcggctct ctcagactca gttgtgctgc ctctggcttc 480 aacataaaag atacttacat tcactgggtg cggcaggccc caggcaaagg cttggagtgg 540 gtggcacgga tctatcccac taatgggtac acgcgctacg ccgatagcgt caagggaaga 600 tttacaataa gtgccgacac ctccaagaat actgcgtatc tgcaaatgaa ctccctgagg 660 gccgaggaca ccgccgtcta ctattgctcc agatggggcg gtgatggatt ttatgctatg 720 gattattggg gccaaggtac tcttgtcaca gtgtcatccg ggggtggggg atctggcggg 780 ggagggagtg gtggcggtag cggggacatt cagatgaccc agtctcctag ctccctgtcc 840 gcatctgtcg gggacagggt gacgatcaca tgtcgcgcaa gccaggacgt gaatacagca 900 gtcgcttggt atcagcagaa acctggcaaa gccccaaaac ttcttatcta ctctgcttcc 960 tttctgtact ccggcgtgcc ctcccggttt agcggctcca ggagtgggac tgatttcaca 1020 ctgacaatta gctcattgca gcctgaggac tttgccacct attactgtca gcaacattac 1080 acgactccgc ccacctttgg acaaggcact aaggttgaga tcaaggaaaa cctctatttc 1140 cagggccatc atcaccacca tcactag 1167 <210> 18 <211> 357 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-CD20 scFv wt LFA3 CD2 binding region          for prokaryotic expression <400> 18 Phe Ser Gln Gln Ile Tyr Gly Val Val Tyr Gly Asn Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Ser          35 40 45 Phe Lys Asn Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Tyr Asn Leu Thr Ser Ser Asp Glu Asp Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Leu                  85 90 95 Pro Ser Pro Thr Glu Phe Gly Gly Gly Gly Ser Gly Gly Ser Gly Ser             100 105 110 Gly Gly Gly Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys         115 120 125 Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe     130 135 140 Thr Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly Arg Gly Leu 145 150 155 160 Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn                 165 170 175 Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser             180 185 190 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val         195 200 205 Tyr Tyr Cys Ala Arg Ser Thr Tyr Tyr Gly Gly Asp Trp Tyr Phe Asn     210 215 220 Val Trp Gly Ala Gly Thr Thr Val Thr Val Ser Ala Gly Gly Gly Gly 225 230 235 240 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Ser                 245 250 255 Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met             260 265 270 Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Ile His Trp Phe Gln Gln         275 280 285 Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu     290 295 300 Ala Ser Gly Val Pro Val Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser 305 310 315 320 Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr                 325 330 335 Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro Thr Phe Gly Gly Gly Thr             340 345 350 Lys Leu Glu Ile Lys         355 <210> 19 <211> 357 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-CD20 scFv LFA3-1 CD2 binding region          for prokaryotic expression <400> 19 Phe Ser Gln Gln Ile Tyr Gly Thr Trp Lys Gly Asp Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Asp          35 40 45 Phe Lys Gly Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Asn Ser Leu Gln Ser Glu Asp Phe Gly Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Leu                  85 90 95 Pro Ser Pro Thr Glu Phe Gly Gly Gly Gly Ser Gly Gly Ser Gly Ser             100 105 110 Gly Gly Gly Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys         115 120 125 Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe     130 135 140 Thr Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly Arg Gly Leu 145 150 155 160 Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn                 165 170 175 Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser             180 185 190 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val         195 200 205 Tyr Tyr Cys Ala Arg Ser Thr Tyr Tyr Gly Gly Asp Trp Tyr Phe Asn     210 215 220 Val Trp Gly Ala Gly Thr Thr Val Thr Val Ser Ala Gly Gly Gly Gly 225 230 235 240 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Ser                 245 250 255 Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met             260 265 270 Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Ile His Trp Phe Gln Gln         275 280 285 Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu     290 295 300 Ala Ser Gly Val Pro Val Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser 305 310 315 320 Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr                 325 330 335 Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro Thr Phe Gly Gly Gly Thr             340 345 350 Lys Leu Glu Ile Lys         355 <210> 20 <211> 363 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-CD20 scFv LFA3-2 CD2 binding region          for prokaryotic expression <400> 20 Phe Ser Gln Gln Ile Tyr Gly Lys Lys Gly Asp Thr Val Thr Phe Thr   1 5 10 15 Cys Thr Ala Ser Gln Lys Lys Ser Ile Glu Val Leu Trp Lys Lys Gln              20 25 30 Lys Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser          35 40 45 Ser Phe Lys Asn Arg Ala Asp Ser Arg Arg Ser Leu Trp Asp Gln Gly      50 55 60 Asn Phe Pro Leu Thr Ile Tyr Asn Leu Lys Ile Glu Asp Glu Asp Glu  65 70 75 80 Tyr Glu Met Glu Ser Pro Asn Ile Thr Asp Thr Met Lys Phe Phe Leu                  85 90 95 Tyr Val Leu Glu Ser Leu Pro Ser Pro Thr Glu Phe Gly Gly Gly Gly             100 105 110 Ser Gly Gly Ser Gly Ser Gly Gly Gly Gln Val Gln Leu Gln Gln Pro         115 120 125 Gly Ala Glu Leu Val Lys Pro Gly Ala Ser Val Lys Met Ser Cys Lys     130 135 140 Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Asn Met His Trp Val Lys Gln 145 150 155 160 Thr Pro Gly Arg Gly Leu Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn                 165 170 175 Gly Asp Thr Ser Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr             180 185 190 Ala Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr         195 200 205 Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Ser Thr Tyr Tyr Gly     210 215 220 Gly Asp Trp Tyr Phe Asn Val Trp Gly Ala Gly Thr Thr Val Thr Val 225 230 235 240 Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly                 245 250 255 Ser Gln Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro             260 265 270 Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr         275 280 285 Ile His Trp Phe Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile     290 295 300 Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Val Arg Phe Ser Gly 305 310 315 320 Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala                 325 330 335 Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro             340 345 350 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys         355 360 <210> 21 <211> 357 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-CD20 scFv LFA3-3 CD2 binding region          for prokaryotic expression <400> 21 Phe Ser Gln Gln Ile Tyr Gly Pro Trp Lys Gly Asp Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Arg          35 40 45 Phe Lys Gly Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Asn Ser Leu Gln Arg Glu Asp Thr Gly Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Leu                  85 90 95 Pro Ser Pro Thr Glu Phe Gly Gly Gly Gly Ser Gly Gly Ser Gly Ser             100 105 110 Gly Gly Gly Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys         115 120 125 Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe     130 135 140 Thr Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly Arg Gly Leu 145 150 155 160 Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn                 165 170 175 Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser             180 185 190 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val         195 200 205 Tyr Tyr Cys Ala Arg Ser Thr Tyr Tyr Gly Gly Asp Trp Tyr Phe Asn     210 215 220 Val Trp Gly Ala Gly Thr Thr Val Thr Val Ser Ala Gly Gly Gly Gly 225 230 235 240 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Ser                 245 250 255 Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met             260 265 270 Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Ile His Trp Phe Gln Gln         275 280 285 Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu     290 295 300 Ala Ser Gly Val Pro Val Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser 305 310 315 320 Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr                 325 330 335 Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro Thr Phe Gly Gly Gly Thr             340 345 350 Lys Leu Glu Ile Lys         355 <210> 22 <211> 357 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-CD20 scFv LFA3-4 CD2 binding region          for prokaryotic expression <400> 22 Phe Ser Gln Gln Ile Tyr Gly Thr Trp Lys Gly Asp Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Asp          35 40 45 Phe Lys Gly Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Asn Asn Leu Arg Ala Glu Asp Met Gly Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Leu                  85 90 95 Pro Ser Pro Thr Glu Phe Gly Gly Gly Gly Ser Gly Gly Ser Gly Ser             100 105 110 Gly Gly Gly Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys         115 120 125 Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe     130 135 140 Thr Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly Arg Gly Leu 145 150 155 160 Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn                 165 170 175 Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser             180 185 190 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val         195 200 205 Tyr Tyr Cys Ala Arg Ser Thr Tyr Tyr Gly Gly Asp Trp Tyr Phe Asn     210 215 220 Val Trp Gly Ala Gly Thr Thr Val Thr Val Ser Ala Gly Gly Gly Gly 225 230 235 240 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Ser                 245 250 255 Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met             260 265 270 Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Ile His Trp Phe Gln Gln         275 280 285 Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu     290 295 300 Ala Ser Gly Val Pro Val Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser 305 310 315 320 Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr                 325 330 335 Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro Thr Phe Gly Gly Gly Thr             340 345 350 Lys Leu Glu Ile Lys         355 <210> 23 <211> 357 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-CD20 scFv LFA3-5 CD2 binding region          for prokaryotic expression <400> 23 Phe Ser Gln Gln Ile Tyr Gly Val Val Tyr Gly Asn Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Asp          35 40 45 Phe Lys Gly Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Asn Ser Leu Gln Pro Glu Asp Phe Gly Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Leu                  85 90 95 Pro Ser Pro Thr Glu Phe Gly Gly Gly Gly Ser Gly Gly Ser Gly Ser             100 105 110 Gly Gly Gly Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys         115 120 125 Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe     130 135 140 Thr Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly Arg Gly Leu 145 150 155 160 Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn                 165 170 175 Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser             180 185 190 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val         195 200 205 Tyr Tyr Cys Ala Arg Ser Thr Tyr Tyr Gly Gly Asp Trp Tyr Phe Asn     210 215 220 Val Trp Gly Ala Gly Thr Thr Val Thr Val Ser Ala Gly Gly Gly Gly 225 230 235 240 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Ser                 245 250 255 Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met             260 265 270 Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Ile His Trp Phe Gln Gln         275 280 285 Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu     290 295 300 Ala Ser Gly Val Pro Val Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser 305 310 315 320 Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr                 325 330 335 Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro Thr Phe Gly Gly Gly Thr             340 345 350 Lys Leu Glu Ile Lys         355 <210> 24 <211> 375 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of Anti-CD20 scFv wt LFA3 CD2 binding region          for eukaryotic expression <400> 24 Met Val Ala Gly Ser Asp Ala Gly Arg Ala Leu Gly Val Leu Ser Val   1 5 10 15 Val Cys Leu Leu His Cys Phe Gly Phe Ile Ser Cys Phe Ser Gln Gln              20 25 30 Ile Tyr Gly Val Val Tyr Gly Asn Val Thr Phe His Val Pro Ser Asn          35 40 45 Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys Asp Lys Val Ala      50 55 60 Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Ser Phe Lys Asn Arg  65 70 75 80 Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile Tyr Asn Leu Thr                  85 90 95 Ser Ser Asp Glu Asp Glu Tyr Glu Met Glu Ser Pro Asn Ile Thr Asp             100 105 110 Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Gly Gly Gly Gly Ser         115 120 125 Gly Gly Ser Gly Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu     130 135 140 Val Lys Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr 145 150 155 160 Thr Phe Thr Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly Arg                 165 170 175 Gly Leu Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser             180 185 190 Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser         195 200 205 Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser     210 215 220 Ala Val Tyr Tyr Cys Ala Arg Ser Thr Tyr Tyr Gly Gly Asp Trp Tyr 225 230 235 240 Phe Asn Val Trp Gly Ala Gly Thr Thr Thr Val Thr Val Ser Ala Gly Gly                 245 250 255 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val             260 265 270 Leu Ser Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly Glu Lys Val         275 280 285 Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Ile His Trp Phe     290 295 300 Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr Ala Thr Ser 305 310 315 320 Asn Leu Ala Ser Gly Val Pro Val Arg Phe Ser Gly Ser Gly Ser Gly                 325 330 335 Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu Asp Ala Ala             340 345 350 Thr Tyr Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro Thr Phe Gly Gly         355 360 365 Gly Thr Lys Leu Glu Ile Lys     370 375 <210> 25 <211> 335 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of anti-CD20 VH-CH-wt LFA3 CD2 binding region <400> 25 Phe Ser Gln Gln Ile Tyr Gly Val Val Tyr Gly Asn Val Thr Phe His   1 5 10 15 Val Pro Ser Asn Val Pro Leu Lys Glu Val Leu Trp Lys Lys Gln Lys              20 25 30 Asp Lys Val Ala Glu Leu Glu Asn Ser Glu Phe Arg Ala Phe Ser Ser          35 40 45 Phe Lys Asn Arg Val Tyr Leu Asp Thr Val Ser Gly Ser Leu Thr Ile      50 55 60 Tyr Asn Leu Thr Ser Ser Asp Glu Asp Glu Tyr Glu Met Glu Ser Pro  65 70 75 80 Asn Ile Thr Asp Thr Met Lys Phe Phe Leu Tyr Val Leu Glu Ser Gly                  85 90 95 Gly Gly Gly Ser Gly Gly Ser Gly Ser Gln Val Gln Leu Gln Gln Pro             100 105 110 Gly Ala Glu Leu Val Lys Pro Gly Ala Ser Val Lys Met Ser Cys Lys         115 120 125 Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Asn Met His Trp Val Lys Gln     130 135 140 Thr Pro Gly Arg Gly Leu Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn 145 150 155 160 Gly Asp Thr Ser Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr                 165 170 175 Ala Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr             180 185 190 Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Ser Thr Tyr Tyr Gly         195 200 205 Gly Asp Trp Tyr Phe Asn Val Trp Gly Ala Gly Thr Thr Val Thr Val     210 215 220 Ser Ala Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser 225 230 235 240 Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys                 245 250 255 Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu             260 265 270 Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu         275 280 285 Tyr Ser Leu Ser Ser Val Val Thr Val Ser Ser Ser Leu Gly Thr     290 295 300 Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val 305 310 315 320 Asp Lys Lys Val Glu Pro Lys Ser Cys His His His His His His                 325 330 335 <210> 26 <211> 213 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of anti CD20 VL-CL polypeptide <400> 26 Gln Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly   1 5 10 15 Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Ile              20 25 30 His Trp Phe Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr          35 40 45 Ala Thr Ser Asn Leu Ala Ser Gly Val Val Pro Val Arg Phe Ser Gly Ser      50 55 60 Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu  65 70 75 80 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro Thr                  85 90 95 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala Ala Pro             100 105 110 Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr         115 120 125 Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys     130 135 140 Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu 145 150 155 160 Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser                 165 170 175 Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala             180 185 190 Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe         195 200 205 Asn Arg Gly Glu Cys     210 <210> 27 <211> 1182 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of Anti-CD20 scFv-wt LFA3 CD2 binding          region for prokaryotic expression <400> 27 atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatgactgg tggacagcaa 60 atgggtcggg atctgtacga cgatgacgat aaggatcgat ggggatcctt ctctcagcag 120 atctacggtg ttgtttacgg taacgttacc ttccacgttc cgtctaacgt tccgctgaaa 180 gaagttctgt ggaaaaaaca gaaagacaaa gttgctgaac tggaaaactc tgagttccgt 240 gctttctctt ctttcaaaaa ccgtgtttac ctggacaccg tttctggttc tctgaccatc 300 tacaacctga cctcttctga cgaagacgaa tacgaaatgg aatctccgaa catcaccgac 360 accatgaaat tcttcctgta cgttctggaa tctctgccgt ctccgaccga attcggcggt 420 ggcggtagcg gcggttctgg tagtggcggt ggccaagtgc agctgcagca gccgggtgca 480 gaactggtga aaccgggtgc aagtgttaaa atgagctgca aagcatctgg ctataccttt 540 acgagctaca acatgcattg ggttaaacag acgccgggcc gtggtctgga atggattggt 600 gcgatctatc cgggcaacgg tgataccagc tacaatcaga aattcaaagg caaagcaacc 660 ctgacggcgg ataaaagctc tagtacggcg tatatgcagc tgagctctct gaccagcgaa 720 gattctgcgg tgtattactg cgcccgctct acgtattacg gtggcgattg gtactttaat 780 gtttggggcg cgggtaccac ggtgaccgtt agcgccggtg gcggtggctc tggtggcggt 840 ggcagtggtg gcggtggcag ccagattgtg ctgagccagt ctccggccat cctgagtgca 900 agcccgggtg aaaaagtgac catgacgtgt cgtgccagta gctctgttag ctatattcac 960 tggtttcagc agaaaccggg tagtagcccg aaaccgtgga tctacgcaac cagtaacctg 1020 gcgagcggcg tgccggttcg tttctctggc agtggtagcg gcacctctta tagtctgacg 1080 atttctcgcg ttgaagcaga agatgcggcc acctattact gtcagcagtg gaccagtaat 1140 ccgccgacgt tcggtggcgg taccaaactg gaaatcaaat aa 1182 <210> 28 <211> 1182 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of Anti-CD20 scFv LFA3-1 CD2 binding region          for prokaryotic expression <400> 28 atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatgactgg tggacagcaa 60 atgggtcggg atctgtacga cgatgacgat aaggatcgat ggggatcctt ctctcagcag 120 atctacggta cctggaaagg tgacgttacc ttccacgttc cgtctaacgt tccgctgaaa 180 gaagttctgt ggaaaaaaca gaaagacaaa gttgctgaac tggaaaactc tgagttccgt 240 gctttctctg acttcaaagg tcgtgtttac ctggacaccg tttctggttc tctgaccatc 300 aactctctgc agtctgaaga cttcggtgaa tacgaaatgg aatctccgaa catcaccgac 360 accatgaaat tcttcctgta cgttctggaa tctctgccgt ctccgaccga attcggcggt 420 ggcggtagcg gcggttctgg tagtggcggt ggccaagtgc agctgcagca gccgggtgca 480 gaactggtga aaccgggtgc aagtgttaaa atgagctgca aagcatctgg ctataccttt 540 acgagctaca acatgcattg ggttaaacag acgccgggcc gtggtctgga atggattggt 600 gcgatctatc cgggcaacgg tgataccagc tacaatcaga aattcaaagg caaagcaacc 660 ctgacggcgg ataaaagctc tagtacggcg tatatgcagc tgagctctct gaccagcgaa 720 gattctgcgg tgtattactg cgcccgctct acgtattacg gtggcgattg gtactttaat 780 gtttggggcg cgggtaccac ggtgaccgtt agcgccggtg gcggtggctc tggtggcggt 840 ggcagtggtg gcggtggcag ccagattgtg ctgagccagt ctccggccat cctgagtgca 900 agcccgggtg aaaaagtgac catgacgtgt cgtgccagta gctctgttag ctatattcac 960 tggtttcagc agaaaccggg tagtagcccg aaaccgtgga tctacgcaac cagtaacctg 1020 gcgagcggcg tgccggttcg tttctctggc agtggtagcg gcacctctta tagtctgacg 1080 atttctcgcg ttgaagcaga agatgcggcc acctattact gtcagcagtg gaccagtaat 1140 ccgccgacgt tcggtggcgg taccaaactg gaaatcaaat aa 1182 <210> 29 <211> 1200 <212> DNA <213> Artificial Sequence <220> Nucleic acid sequence of Anti-CD20 scFv LFA3-2 CD2 binding region          for prokaryotic expression <400> 29 atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatgactgg tggacagcaa 60 atgggtcggg atctgtacga cgatgacgat aaggatcgat ggggatcctt ctctcagcag 120 atctacggta aaaaaggtga caccgttacc ttcacctgca ccgcttctca gaaaaaatct 180 atcgaagttc tgtggaaaaa acagaaagac aaagttgctg aactggaaaa ctctgagttc 240 cgtgctttct cttctttcaa aaaccgtgct gactctcgtc gttctctgtg ggaccagggt 300 aacttcccgc tgaccatcta caacctgaaa atcgaagacg aagacgaata cgaaatggaa 360 tctccgaaca tcaccgacac catgaaattc ttcctgtacg ttctggaatc tctgccgtct 420 ccgaccgaat tcggcggtgg cggtagcggc ggttctggta gtggcggtgg ccaagtgcag 480 ctgcagcagc cgggtgcaga actggtgaaa ccgggtgcaa gtgttaaaat gagctgcaaa 540 gcatctggct atacctttac gagctacaac atgcattggg ttaaacagac gccgggccgt 600 ggtctggaat ggattggtgc gatctatccg ggcaacggtg ataccagcta caatcagaaa 660 ttcaaaggca aagcaaccct gacggcggat aaaagctcta gtacggcgta tatgcagctg 720 agctctctga ccagcgaaga ttctgcggtg tattactgcg cccgctctac gtattacggt 780 ggcgattggt actttaatgt ttggggcgcg ggtaccacgg tgaccgttag cgccggtggc 840 ggtggctctg gtggcggtgg cagtggtggc ggtggcagcc agattgtgct gagccagtct 900 ccggccatcc tgagtgcaag cccgggtgaa aaagtgacca tgacgtgtcg tgccagtagc 960 tctgttagct atattcactg gtttcagcag aaaccgggta gtagcccgaa accgtggatc 1020 tacgcaacca gtaacctggc gagcggcgtg ccggttcgtt tctctggcag tggtagcggc 1080 acctcttata gtctgacgat ttctcgcgtt gaagcagaag atgcggccac ctattactgt 1140 cagcagtgga ccagtaatcc gccgacgttc ggtggcggta ccaaactgga aatcaaataa 1200                                                                         1200 <210> 30 <211> 1182 <212> DNA <213> Artificial Sequence <220> Nucleic acid sequence of Anti-CD20 scFv LFA3-3 CD2 binding region          for prokaryotic expression <400> 30 atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatgactgg tggacagcaa 60 atgggtcggg atctgtacga cgatgacgat aaggatcgat ggggatcctt ctctcagcag 120 atctacggtc cgtggaaagg tgacgttacc ttccacgttc cgtctaacgt tccgctgaaa 180 gaagttctgt ggaaaaaaca gaaagacaaa gttgctgaac tggaaaactc tgagttccgt 240 gctttctctc gtttcaaagg tcgtgtttac ctggacaccg tttctggttc tctgaccatc 300 aactctctgc agcgtgaaga cacgggtgaa tacgaaatgg aatctccgaa catcaccgac 360 accatgaaat tcttcctgta cgttctggaa tctctgccgt ctccgaccga attcggcggt 420 ggcggtagcg gcggttctgg tagtggcggt ggccaagtgc agctgcagca gccgggtgca 480 gaactggtga aaccgggtgc aagtgttaaa atgagctgca aagcatctgg ctataccttt 540 acgagctaca acatgcattg ggttaaacag acgccgggcc gtggtctgga atggattggt 600 gcgatctatc cgggcaacgg tgataccagc tacaatcaga aattcaaagg caaagcaacc 660 ctgacggcgg ataaaagctc tagtacggcg tatatgcagc tgagctctct gaccagcgaa 720 gattctgcgg tgtattactg cgcccgctct acgtattacg gtggcgattg gtactttaat 780 gtttggggcg cgggtaccac ggtgaccgtt agcgccggtg gcggtggctc tggtggcggt 840 ggcagtggtg gcggtggcag ccagattgtg ctgagccagt ctccggccat cctgagtgca 900 agcccgggtg aaaaagtgac catgacgtgt cgtgccagta gctctgttag ctatattcac 960 tggtttcagc agaaaccggg tagtagcccg aaaccgtgga tctacgcaac cagtaacctg 1020 gcgagcggcg tgccggttcg tttctctggc agtggtagcg gcacctctta tagtctgacg 1080 atttctcgcg ttgaagcaga agatgcggcc acctattact gtcagcagtg gaccagtaat 1140 ccgccgacgt tcggtggcgg taccaaactg gaaatcaaat aa 1182 <210> 31 <211> 1182 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of Anti-CD20 scFv LFA3-4 CD2 binding region          for prokaryotic expression <400> 31 atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatgactgg tggacagcaa 60 atgggtcggg atctgtacga cgatgacgat aaggatcgat ggggatcctt ctctcagcag 120 atctacggta cctggaaagg tgacgttacc ttccacgttc cgtctaacgt tccgctgaaa 180 gaagttctgt ggaaaaaaca gaaagacaaa gttgctgaac tggaaaactc tgagttccgt 240 gctttctctg acttcaaagg tcgtgtttac ctggacaccg tttctggttc tctgaccatc 300 aacaacctgc gtgctgaaga catgggtgaa tacgaaatgg aatctccgaa catcaccgac 360 accatgaaat tcttcctgta cgttctggaa tctctgccgt ctccgaccga attcggcggt 420 ggcggtagcg gcggttctgg tagtggcggt ggccaagtgc agctgcagca gccgggtgca 480 gaactggtga aaccgggtgc aagtgttaaa atgagctgca aagcatctgg ctataccttt 540 acgagctaca acatgcattg ggttaaacag acgccgggcc gtggtctgga atggattggt 600 gcgatctatc cgggcaacgg tgataccagc tacaatcaga aattcaaagg caaagcaacc 660 ctgacggcgg ataaaagctc tagtacggcg tatatgcagc tgagctctct gaccagcgaa 720 gattctgcgg tgtattactg cgcccgctct acgtattacg gtggcgattg gtactttaat 780 gtttggggcg cgggtaccac ggtgaccgtt agcgccggtg gcggtggctc tggtggcggt 840 ggcagtggtg gcggtggcag ccagattgtg ctgagccagt ctccggccat cctgagtgca 900 agcccgggtg aaaaagtgac catgacgtgt cgtgccagta gctctgttag ctatattcac 960 tggtttcagc agaaaccggg tagtagcccg aaaccgtgga tctacgcaac cagtaacctg 1020 gcgagcggcg tgccggttcg tttctctggc agtggtagcg gcacctctta tagtctgacg 1080 atttctcgcg ttgaagcaga agatgcggcc acctattact gtcagcagtg gaccagtaat 1140 ccgccgacgt tcggtggcgg taccaaactg gaaatcaaat aa 1182 <210> 32 <211> 1182 <212> DNA <213> Artificial Sequence <220> Nucleic acid sequence of Anti-CD20 scFv LFA3-5 CD2 binding region          for prokaryotic expression <400> 32 atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatgactgg tggacagcaa 60 atgggtcggg atctgtacga cgatgacgat aaggatcgat ggggatcctt ctctcagcag 120 atctacggtg ttgtttacgg taacgttacc ttccacgttc cgtctaacgt tccgctgaaa 180 gaagttctgt ggaaaaaaca gaaagacaaa gttgctgaac tggaaaactc tgagttccgt 240 gctttctctg acttcaaagg tcgtgtttac ctggacaccg tttctggttc tctgaccatc 300 aactctctgc agccggaaga cttcggtgaa tacgaaatgg aatctccgaa catcaccgac 360 accatgaaat tcttcctgta cgttctggaa tctctgccgt ctccgaccga attcggcggt 420 ggcggtagcg gcggttctgg tagtggcggt ggccaagtgc agctgcagca gccgggtgca 480 gaactggtga aaccgggtgc aagtgttaaa atgagctgca aagcatctgg ctataccttt 540 acgagctaca acatgcattg ggttaaacag acgccgggcc gtggtctgga atggattggt 600 gcgatctatc cgggcaacgg tgataccagc tacaatcaga aattcaaagg caaagcaacc 660 ctgacggcgg ataaaagctc tagtacggcg tatatgcagc tgagctctct gaccagcgaa 720 gattctgcgg tgtattactg cgcccgctct acgtattacg gtggcgattg gtactttaat 780 gtttggggcg cgggtaccac ggtgaccgtt agcgccggtg gcggtggctc tggtggcggt 840 ggcagtggtg gcggtggcag ccagattgtg ctgagccagt ctccggccat cctgagtgca 900 agcccgggtg aaaaagtgac catgacgtgt cgtgccagta gctctgttag ctatattcac 960 tggtttcagc agaaaccggg tagtagcccg aaaccgtgga tctacgcaac cagtaacctg 1020 gcgagcggcg tgccggttcg tttctctggc agtggtagcg gcacctctta tagtctgacg 1080 atttctcgcg ttgaagcaga agatgcggcc acctattact gtcagcagtg gaccagtaat 1140 ccgccgacgt tcggtggcgg taccaaactg gaaatcaaat aa 1182 <210> 33 <211> 729 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence of anti-HER2 scFv for E. coli expression <400> 33 gaagttcagc tggttgaatc tggtggtggt ctggttcagc cgggtggttc tctgcgtctg 60 tcttgcgctg cttctggttt caacatcaaa gacacctaca tccactgggt tcgtcaggct 120 ccgggtaaag gtctggaatg ggttgctcgt atctacccga ccaacggtta cacccgttac 180 gctgactctg ttaaaggtcg tttcaccatc tctgctgaca cctctaaaaa caccgcttac 240 ctgcagatga actctctgcg tgctgaagac accgctgttt actactgctc tcgttggggt 300 ggtgacggtt tctacgctat ggactactgg ggtcagggta ccctggttac cgtttcttct 360 ggtggtggtg gttctggtgg tggtggttct ggtggtggtt ctggtgacat ccagatgacc 420 cagtctccga gctctctgtc tgcttctgtt ggtgaccgtg ttaccatcac ctgccgtgct 480 tctcaggacg ttaacaccgc tgttgcttgg taccagcaga aaccgggtaa agctccgaaa 540 ctgctgatct actctgcttc tttcctgtac tctggtgttc cgtctcgttt ctctggttct 600 cgttctggta ccgacttcac cctgacgata tcttctctgc agccggaaga cttcgctacc 660 tactactgcc agcagcacta caccaccccg ccgaccttcg gtcagggtac caaagttgaa 720 atcaaataa 729 <210> 34 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> EcoR I scFv-F primer sequence <400> 34 cgggaattcg gcggtggagg ct 22 <210> 35 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> scFv HindIII NotI-R primer sequence <400> 35 ggcccgcggc cgcaagcttt tatttga 27 <210> 36 <211> 30 <212> DNA <213> Artificial Sequence <220> Primer 1 for Sewing PCR <400> 36 cccgcgaaat taatacgact cactataggg 30 <210> 37 <211> 36 <212> DNA <213> Artificial Sequence <220> Primer 4 for Sewing PCR <400> 37 acgacctttg aagtcagaga aagcacggaa ctcaga 36 <210> 38 <211> 36 <212> DNA <213> Artificial Sequence <220> Primer 5 for Sewing PCR <400> 38 tctgacttca aaggtcgtgt ttacctggac accgtt 36 <210> 39 <211> 31 <212> DNA <213> Artificial Sequence <220> Primer 8 for Sewing PCR <400> 39 ccattcctcc tcttccttca atgaattcgg c 31 <210> 40 <211> 45 <212> DNA <213> Artificial Sequence <220> Primer 17 for Sewing PCR <400> 40 gaagtcttcc ggctgcagag agttgatggt cagagaacca gaaac 45 <210> 41 <211> 42 <212> DNA <213> Artificial Sequence <220> Primer 18 for Sewing PCR <400> 41 ctgcagccgg aagacttcgg tgaatacgaa atggaatctc cg 42 <210> 42 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Universal T3 primer <400> 42 attaaccctc actaaag 17 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pCIneo-R primer <400> 43 tacaaataaa gcaatagcat 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pCIneo-F primer <400> 44 cactttgcct ttctctccac 20

Claims (28)

A CD2 binding polypeptide of modified LFA3, wherein the CD2 binding polypeptide comprises 29 to 123 amino acid residues based on the sequence of SEQ ID NO: 1, wherein the modification is performed at any of the following positions to any one of the amino acids described below at each position Modified LFA3 CD2 binding polypeptide, which is substituted:
The 36th amino acid is selected from Thr, Lys, Pro or Val in Val;
The 37th amino acid is Val in Trp, Lys or Val;
The 38th amino acid is Lys or Gly at Tyr;
40th amino acid is selected from Asp or Thr in Asn;
The 76th amino acid is Ser to Asp, or Arg;
The 79th amino acid is Gly to Asn;
93 th amino acid is Asn in Tyr;
The 94th amino acid is Ser in Asn;
96th amino acid is selected from Thr in Gln, Lys, or Arg; or
97th amino acid is substituted by Ile, Arg, Ala or Pro The modified LFA3 CD2 binding polypeptide of claim 1, wherein said substitution additionally comprises one or more modifications:
The 39th amino acid is Gsp in Asp;
The 44th amino acid is Thr in His;
The 45th amino acid is from Cys in Val;
The 46th amino acid is selected from Thr in Pro;
The 47th amino acid is Ala in Ser;
The 48th amino acid is Ser in Asn;
The 50th amino acid is Lys in Pro;
The 51st amino acid is Leu to Ser;
The 52nd amino acid is Lys in Ile;
The 81st amino acid is Val in Ala;
The 82nd amino acid is Asp at Tyr;
The 83rd amino acid is Leu to Trp;
The 85th amino acid is Gln at Thr;
The 86th amino acid is Gly at Val;
The 87th amino acid is Ser in Asn;
The 88 th amino acid is Gly Phe;
The 89th amino acid is Pro in Ser;
The 98th amino acid is Glu at Ser;
The 101st amino acid is substituted for Aly by Gly; or
Insertion of Gln at the 48th site or
Polypeptide insertion of the Ser-Arg-Arg-Ser-Leu sequence at the 82nd site. The modified LFA3 CD2 binding polypeptide of claim 3, wherein the modified CD2 binding polypeptide is represented by any one of SEQ ID NOs: 2-6.
A polynucleotide encoding the CD2 binding polypeptide of the modified LFA3 according to any one of claims 1 to 3.
The polynucleotide of claim 4, wherein the polynucleotide is any one of SEQ ID NOs: 8-12.
A fusion protein comprising at least one modified CD2 binding polypeptide of LFA3 according to any one of claims 1 to 3 or a wild type polypeptide thereof and a target specific polypeptide.
The fusion protein of claim 6, wherein the fusion protein further comprises a linker. 8. The fusion protein of claim 7, wherein said linker is a polypeptide.
The fusion protein according to claim 8, wherein the linker is represented by SEQ ID NO: 13.
The fusion protein of claim 6, wherein the CD2 binding polypeptide is located at the N-terminus or C-terminus of the fusion protein.
The fusion protein of claim 6, wherein the target specific polypeptide is an antibody, antigen-binding fragment, antibody mimetic, aptamer, or receptor.
The antibody of claim 11, wherein the antibody comprises a chimeric antibody or a humanized antibody of the antibody, wherein the antigen-binding fragment is scFv, BITE, TandAb, Immunobody, Flexibody, Nanobody, Triomab, Troybody, Pepbody, Vaccibody, SMIP, Fab (fragment) antigen binding), mAb ² , UniBody, Fv (fragment variable), dAB, scFv-Fc, Diabody, Tetrabody, Minibody, scFab (single chain Fab), or Fcab.
The fusion protein of claim 11, wherein the antibody mimetic comprises DARPin, Tetranectin, Affibody, Transbody, Anticalin, AdNectin, Affilin, Microbody, Peptide aptamer, Phylomer, Stradobody, Avimer, Maxibodiy, Evibody, or Fynomer .
The fusion protein of claim 6, wherein the target is a factor present on the cell surface.
15. The fusion protein of claim 14, wherein said cell is a cancer cell.
The fusion protein of claim 14, wherein the factor is HER2 (Human Epidermal Growth factor 2) or CD20.
The fusion protein of claim 16, wherein the polypeptide targeting HER2 or CD20 is an scFv or Fab that specifically binds to HER2 or CD20.
The method of claim 17, wherein the scFv fusion protein targeting HER2 is represented by SEQ ID NO: 14, 15, or 16, scFv fusion protein targeting the CD20 is represented by any one of SEQ ID NOs: 18 to 24, Fab fusion proteins targeting CD20 are shown in SEQ ID NOs: 25 and 26.
A polynucleotide encoding a fusion protein according to any one of claims 6 to 18.
The polynucleotide of claim 20, wherein the polynucleotide is targeted to HER2, is represented by SEQ ID NO: 17, or the polynucleotide is targeted to CD20, is represented by any one of SEQ ID NOs: 27 to 32. Nucleotides.
A method for disintegrating a target cell in vitro, T-cell mediated, comprising contacting the target cell with a fusion protein according to any one of claims 6 to 18 or a polynucleotide encoding the same. Wherein the protein expressed by the fusion protein or polynucleotide specifically recognizes a factor present on the surface of the target cell.
The method of claim 21, wherein the target cells are cancer, rheumatoid arthritis, systemic lupus erythematosus, type 1 diabetes, multiple sclerosis, autoimmune diseases including anti-neutrophil cytoplasmic antibody-associated vasculitis, or tuberculosis, listeria. A cell that is associated with microbial infections including Listeriosis, Legionnaires'disease, candidiasis, or infectious mononucleosis.
The method of claim 22, wherein the target cells are ovarian cancer, breast cancer, colon cancer, prostate cancer, melanoma, Hodgkins lymphoma, lymphoma including non-Hodgkins lymphoma, leukemia (acute myeloid leukemia, chronic myelogenous leukemia, acute lymphocytic) Leukemia, leukemia including chronic lymphocytic leukemia, gastric cancer, renal cell carcinoma, colon cancer, colon cancer, lung cancer, brain cancer, cervical cancer, esophageal cancer, or liver cancer.
The method of claim 21, wherein the factor is associated with cancer.
The method of claim 24, wherein the factor is CD2, CD4, CD19, CD20, CD22, CD23, CD30, CD33, CD37, CD40, CD44v6, CD52, CD56, CD70, CD74, CD79a, CD80, CD98, CD138, EGFR (Epidermal). growth factor receptor (VGF), Vascular endothelial growth factor (VEGF), Vascular endothelial growth factor receptor (VEGFRI), Platelet-derived growth factor receptor (PDGFR), Receptor activator of nuclear factor kappa-B ligand (RANKL), Transmembrane glycoprotein (GPNMB) Neuromedin B), Ephrin type-A receptor 2 (EphA2), a novel tumor-associated protein (MN), Prostate-specific membrane antigen (PSMA), Cryptic family protein 1B (Cripto), Epihelial cell adhesion molecule (EpCAM), CTLA4 (Cytotoxic T-Lymphocyte Antigen 4), IGF-IR (Type 1 insulin-like growth factor receptor), GP3 (M13 bacteriophage), GP9 (Glycoprotein IX (platelet), CD42a, GP40 (Glycoprotein 40kDa) TRAILRI (Tumor necrosis factor-) related apoptosis-inducing ligand receptor I, TRAILRII (Tumor necrosis factor-related apoptosis-inducing ligand receptor II), type II transmembra ne protein), PS (phosphatidyl serine) lipid, Gal GlNac Gal N-linked, Muc1 (Mucin 1, cell surface associated, PEM), Muc18 CD146, A5B1 integrin (α5β1), α4β1 integrin, αv integrin (Vitronectin Receptor), Chondrolectin , Carbonic anhydrase IX, gene G250 / MN-encoded transmembrane protein (CAIX), GD2 gangloside, GD3 gangloside, GM1 gangloside, Lewis Y, Mesothelin, HER2 (Human Epidermal Growth factor 2), HER3, FN14 (Fibroblast Growth Factor Inducible 14) , CS1 (Cell surface glycoprotein, CD2 subset 1, CRACC, SLAMF7, CD319), 41BB CD137, SIP (Siah-1 Interacting Protein), CTGF (Connective tissue growth factor), HLADR (MHC class II cell surface receptor), PD- Programmed Death 1, Type I membrane protein, IL-2 (Interleukin-2), IL-8 (Interleukin-8), IL-13 (Interleukin-13), PIGF (Phosphatidylinositol-glycan biosynthesis class F protein), NRP1 (Neuropilin-1), ICAM1 CD54, GC182 (Claudin 18.2), Claudin, Hepatocyte growth factor (HGF), Carcinoembryonic antigen (CEA), lymphotoxin β receptor (LTβR), Kappa Myeloma, Folar e Receptor alpha, GRP78 (BIP, 78 kDa Glucose-regulated protein), A33 antigen, Prostate-specific antigen (PSA), Cancer antigen 125 or carbohydrate antigen 125 (CA125), CA19.9, CA15.3, CA242, Leptin, Prolactin, Osteopontin, Insulin-like growth factor 2 (IGF-II), Fascin, sPIgR (secreted chain of the polymorphic immunoglobulin receptor), 14-3-3 protein eta. 5T4 oncofetal protein, Epithelial Tumor Antigen (ETA), Melanoma-associated antigen (MAG), Melanoma-associated proteoglycan (NG2), Vimentin, Early prostate cancer antigen-2 (EPCA-1), TAG-72 (Tumor-associated) glycoprotein 72), Factor VIII, Neprilysin (Membrane metallo-endopeptidase) and at least one selected from the group consisting of 17-1A (Epithelial cell surface antigen 17-1A).
A pharmaceutical composition for disintegrating T-cell mediated target cells comprising a fusion protein according to any one of claims 6 to 18 or a polynucleotide encoding the same.
The pharmaceutical composition according to claim 26, wherein the target cell is a cancer cell expressing a cancer cell specific factor on its surface.
The method of claim 27, wherein the cancer cell specific factors are CD2, CD4, CD19, CD20, CD22, CD23, CD30, CD33, CD37, CD40, CD44v6, CD52, CD56, CD70, CD74, CD79a, CD80, CD98, CD138, Epidermal growth factor receptor (EGFR), Vascular endothelial growth factor (VEGF), Vascular endothelial growth factor receptor I (VEGFRI), Platelet-derived growth factor receptor (PDGFR), Receptor activator of nuclear factor kappa-B ligand (RANKL), GPNMB (Transmembrane glycoprotein Neuromedin B), Ephin type-A receptor 2 (EphA2), a novel tumor-associated protein (MN), prostate-specific membrane antigen (PSMA), cryptic family protein 1B (Cripto), epihelial cell adhesion molecule (EpCAM) ), Cytotoxic T-Lymphocyte Antigen 4 (CTLA4), Type 1 insulin-like growth factor receptor (IGF-IR), M13 bacteriophage (GP3), Glycoprotein IX (platelet), CD42a, GP40 (Glycoprotein 40kDa) TRAILRI (GP40) Tumor necrosis factor-related apoptosis-inducing ligand receptor I), TRAILRII (TAILRII) Type II transmembrane protein, PS lipid, Gal GlNac Gal N-linked, Muc1 (Mucin 1, cell surface associated, PEM), Muc18 CD146, A5B1 integrin (α5β1), α4β1 integrin, αv integrin (Vitronectin Receptor), Chondrolectin , Carbonic anhydrase IX, gene G250 / MN-encoded transmembrane protein (CAIX), GD2 gangloside, GD3 gangloside, GM1 gangloside, Lewis Y, Mesothelin, HER2 (Human Epidermal Growth factor 2), HER3, FN14 (Fibroblast Growth Factor Inducible 14) , CS1 (Cell surface glycoprotein, CD2 subset 1, CRACC, SLAMF7, CD319), 41BB CD137, SIP (Siah-1 Interacting Protein), CTGF (Connective tissue growth factor), HLADR (MHC class II cell surface receptor), PD- Programmed Death 1, a Type I membrane protein, IL-2 (Interleukin-2), IL-8 (Interleukin-8), IL-13 (Interleukin-13), and PIGF (Phosphatidylinositol-glycan biosynthesis class F protein) , NRP1 (Neuropilin-1), ICAM1 CD54, GC182 (Claudin 18.2), Claudin, Hepatocyte growth factor (HGF), Carcinoembryonic antigen (CEA), lymphotoxin β receptor (LTβR), Kappa Myeloma, Fo lare Receptor alpha, GRP78 (BIP, 78 kDa Glucose-regulated protein), A33 antigen, Prostate-specific antigen (PSA), Cancer antigen 125 or carbohydrate antigen 125 (CA125), CA19.9, CA15.3, CA242, Leptin, Prolactin, Osteopontin, Insulin-like growth factor 2 (IGF-II), Fascin, sPIgR, 14-3-3 eta. 5T4, Epithelial Tumor Antigen (ETA), Melanoma-associated antigen (MAG), Melanoma-associated proteoglycan (NG2), Vimentin, Early prostate cancer antigen-2 (EPCA-1), Tumor-associated glycoprotein 72 ), Factor VIII, Neprilysin (Membrane metallo-endopeptidase) and at least one selected from the group consisting of 17-1A (Epithelial cell surface antigen 17-1A).

Images