KR20140018501A - Composition comprising 4-dimethylamino-2-methoxy-6- ( (methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol for anti-inflammation - Google Patents

Abstract

The present invention relates to a pharmaceutical composition, a food composition, and a cosmetic composition containing 4-dimethylamino-2-methoxy-6-((methyl-[2-(4-nitrophenyl)ethyl]methyl) phenol as an active ingredient for anti-inflammation. The compositions in the present invention have an excellent anti-inflammation effect by basically decreasing the formation of TNF-α, PGE2, and NO from the transcription step. Also the compositions show no cytotoxicity even in case of high-dose treatment, thereby being applicable for medicine, foods, and cosmetics safely. Thus, the compositions are expected to be importantly applicable as an anti-inflammatory drug.

Description

An anti-inflammatory composition comprising 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol (Composition comprising 4-Dimethylamino- 6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol for anti-inflammation}

The present invention relates to an antiinflammatory composition containing 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol as an active ingredient.

An inflammatory response is a mechanism for repairing and repairing an injury site when an invasion that causes any organic change in the body or tissue, such as physical action, chemicals, or bacterial infection, is applied. Inflammatory responses can lead to a variety of serious diseases, such as cancer, vascular disorders and diabetes, which are normal defense mechanisms that protect our bodies from external stimuli, or in severe or chronic cases.

Recent studies indicate that the functional significance of tissue-associated macrophages in inflammatory responses is increasingly emphasized. Macrophages have been reported to invade chronically inflamed tissues and aggressively regulate various inflammatory molecules and promote inflammatory tissue damage (Ohno S, Inagawa H, Dhar DK, Fujii T, Ueda S, Tachibana M, et. (TAM) in advanced gastric carcinoma: the impact on FasL-mediated counterattack. Anticancer Res 2005; 25: 463-70.). Therefore, it is conceivable that a compound capable of regulating macrophages is likely to be an anti-inflammatory agent.

Until now, steroidal anti-inflammatory drugs or nonsteroidal anti-inflammatory drugs (NSAIDs), which act as mechanisms such as bradykinin antagonists and COX inhibitors, have been widely used. However, long-term use of steroidal antiinflammatory drugs causes serious side effects such as resistance and menstruation, and long-term administration of nonsteroidal anti-inflammatory drugs may lead to secondary anemia due to gastrointestinal peptic ulcer bleeding, inhibition of platelet function, , Side effects to the kidneys, liver damage, and hypersensitivity reactions. Therefore, in order to overcome the side effects of these drugs, there is an urgent need for the development of a therapeutic agent having a low side effect and excellent anti-inflammatory effect on the human body.

4-Dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino] (4-nitrophenyl) ethyl] amino) methyl) phenol) is a cell permeable ortho-hydroxybenzylamino compound that is known to have an anticancer effect by strongly inhibiting selective action against CDC25 phosphatase. The inventors of the present invention have found that 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol is a potent antiinflammatory agent, It has been found that there is almost no cytotoxicity while having an anti-inflammatory effect, and thus the present invention has been completed.

The present invention has been conceived to overcome the limitations of conventional antiinflammatory agents. The present invention relates to a method for the preparation of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) A food composition and a cosmetic composition for preventing or treating an inflammatory disease, which comprises a pharmaceutically acceptable salt thereof as an active ingredient.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention relates to a pharmaceutical composition comprising as an active ingredient 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol or a pharmaceutically acceptable salt thereof, A pharmaceutical composition for preventing or treating disease, a food composition and a cosmetic composition.

In one embodiment of the present invention, the 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) α (tumor necrosis factor-α) or PGE ₂ (prostaglandin E ₂ ).

In another embodiment of the present invention, the inflammatory disease is selected from the group consisting of dermatitis, allergy, gastric ulcer, duodenal ulcer, hepatitis, esophagitis, gastritis, enteritis, pancreatitis, colitis, nephritis, gastric cancer, systemic edema, local edema and combinations thereof . However, the type of inflammation is no longer limited.

The composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the above-described effective ingredients for administration.

The pharmaceutical compositions of the present invention may be administered orally or parenterally (eg, applied intravenously, subcutaneously, intraperitoneally or topically) according to the desired method, and the dosage is based on the weight, age, sex, The range varies depending on the state of health, diet, administration time, administration method, excretion rate and severity of the disease. For example, from 0.1 mg / kg (body weight) to 500 mg / kg (body weight), 0.1 mg / kg (body weight) to 400 mg / kg body weight or 1 mg / kg body weight based on a daily active ingredient To 300 mg / kg body weight, and may be administered once or divided into several. The dose is not intended to limit the scope of the invention in any way.

The composition of the present invention can be added to a health functional food for the purpose of prevention and improvement of inflammation. Mixing amounts may be appropriately determined depending on the purpose of use (prevention, health or therapeutic treatment). In general, it can be added in an amount of up to 15% by weight, preferably up to 10% by weight based on the raw materials in the manufacture of food or beverage. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount exceeding the above range. There are no particular restrictions on the type of food.

The composition of the present invention can be added to cosmetics for the purpose of preventing and improving inflammation. The cosmetic composition may be used as a cosmetic composition for basic cosmetics, makeup cosmetics, body cosmetics, hair cosmetics, scalp cosmetics, shaving cosmetics or oral cosmetics. The active ingredient may be contained in an amount of 0.001 to 50% by weight, and preferably 0.01 to 20% by weight, based on the total weight of the cosmetic composition, but the content is preferably such that the content of components other than the active ingredient contained in the formulation or cosmetic composition , And the content of the active ingredient contained in the present invention is not limited by the above content.

An antiinflammatory pharmaceutical composition comprising a 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) And cosmetic composition have an excellent anti-inflammatory effect by fundamentally reducing the production of inflammatory factors such as TNF-a, PGE ₂ , and NO from the transcription stage. In addition, it does not show cytotoxicity even when treated at a high concentration, and thus can be safely applied to medicines, foods and cosmetics. Therefore, it is expected that it can be importantly applied as an anti-inflammatory agent.

Brief Description of the Drawings Figure 1 is a graph showing the results of the measurement of the concentration of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethylamino) methyl) phenol (commercial code BN82002) 0.0 > (NO) < / RTI >
Figure 2 shows the production of TNF-a in RAW264.7 cells treated with LPS in the presence of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) Fig.
FIG. 3 is a graph showing the effect of inhibiting TNF-.alpha. Production in the presence of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) , prednisolone and genistein.
Figure 4 shows the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethylamino) methyl) phenol on PGE ₂ production in RAW264.7 cells treated with LPS It is the figure which shows the effect.
Figure 5 shows the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on cell viability.
6 is in RAW264.7 cells treated with LPS 4-dimethylamino-2-methoxy-6 - a - ([2- (4-nitrophenyl) ethyl] amino) methyl (methyl) phenol NO and PGE ₂ (INOS, COX-2) and mRNA of TNF-α were quantified by real-time PCR and expressed as a percentage of the control group. Figure 6A is for iNOS, Figure 6B is for COX-2, and Figure 6C is for TNF- [alpha].
Figure 7 shows that in RAW264.7 cells treated with LPS, 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) COX-2) on the expression of mRNA was quantified by RT-PCR.
Figure 8 shows the effect of 4-dimethylamino-2-methoxy-6- ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on the nuclear transcription factor of RAW264.7 cells treated with LPS The effect was confirmed by immunoblotting. Figure 8a is for c-fos and Figure 8b is for c-fos and c-jun.
9 shows the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethylamino) methyl) phenol on luciferase activity of AP- Fig.
Figure 10 shows the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on NF-κB production and IκB expression Fig. Fig. 10a is for p65, a subunit of NF-kB, and Fig. 10b is a graph showing the expression of IκBα, which inactivates NF-κB, in the presence of 4-dimethylamino-2-methoxy- Phenyl) ethyl] amino) methyl) phenol and also increases the amount of phosphorylated IκBα (p-IκBα), which is an active form.
11 shows the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on luciferase activity of NF- . FIG. 11A is a view showing the presence or absence of the PMA, FIG. 11B showing the presence of the TRIF, and FIG. 11C showing the presence of the MyD88.
FIG. 12 shows the results of the administration of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethylamino) methyl) It is a photograph observing the mucosal lesion of the sex.
FIG. 13 is a graph showing the results of immunohistochemical staining of the gastric mucosa after administering 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethylamino) methyl) phenol and ranitidine, (Mm 2) of erosive mucosal erosion lesion were measured and compared with a pixel-counter.

The structural formula of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol is shown below.

[Formula 1]

The present inventors have found that the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino] methyl) phenol on various inflammation- And the anti-inflammatory effect was confirmed. RAW 264.7 cells were treated with LPS to increase the production of inflammation-related proteins, followed by the addition of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) The effect was confirmed. Lipopolysaccharide (LPS) is a cell wall component of Gram-negative bacteria that acts as an endotoxin and activates macrophages.

Example 1 confirms the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on NO production.

NO is one of the factors involved in inflammation that plays a role in dilating blood vessels. When macrophages are stimulated, NO is produced from macrophages by the production of nitric oxide (NO) in the process of converting L-arginine into L-citrulline by an enzyme called inducible nitric oxide synthase (iNOS).

Example 2 confirms the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on TNF-a.

TNF-α is a cytokine produced by macrophages and T lymphocytes and mediates actions such as increased COX activity, induction of fibroblast proliferation, increase of acute phase protein production, and increase of MHC molecule expression. At low concentrations, they provide adequate hemostasis and defense, but at high concentrations they cooperate with cytokines such as IL-1 to exacerbate the inflammatory response, resulting in shock.

In FIG. 3, pentoxyfylline, prednisolone, and genistein, which are the substances used to compare the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) Are anti-circulatory drugs, steroidal anti-inflammatory drugs, and antioxidants, all of which have the effect of reducing the secretion of TNF-α.

Example 3 confirms the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on PGE ₂ .

Prostaglandin E ₂ (PGE ₂ ) is a substance in which arachidonic acid liberated by phospholipase A2 is catalyzed by an enzyme called cyclooxygenaes (COXs). PGE ₂ is known to be deeply involved in the development of cancer, including inflammation, inflammation, immune response, and angiogenesis, such as pain and fever.

Example 4 confirms the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on cell viability.

Example 5 shows the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino] methyl) phenol on the production of inflammation- INOS, which catalyzes the production of NO, mRNA levels of COX-2 and TNF-α, which catalyze the production of PGE2.

Example 6 confirms the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on AP-1.

AP-1 (Activating protein-1) is a transcription factor that plays an important role in the expression of various genes. In particular, AP-1 is known to play an important role in the expression of inflammatory factors. The expression of AP-1 is up-regulated by a dimer of c-fos and c-jun proteins.

In this experiment, TRIF was co-transfected to induce AP-1 expression. TRIF (TIR-domain-containing adapter-inducing interferon-β) is an adapter molecule that causes signaling by the TLR, a receptor that detects the entry of an antigen.

Example 7 confirms the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol on NF-kB.

  NF-kB is also an important transcriptional regulator that regulates the expression of inflammatory genes. The promoters of iNOS, TNF-α, and COX-2 genes have a common NF-kB binding site, which regulates the expression of these genes by activation of NF-kB. The most common forms of NF-KB are p50 and p65 heterodimers. The activity of NF-kB is regulated by IkB, which acts to inactivate NF-kB. IkB is activated through phosphorylation.

In this experiment, PMA, TRIF and MyD88 were co-transfected to induce NF-kB expression. MyD88 (Myeloid differentiation primary response gene 88) can inhibit the activity of IκB, a protein that inhibits the activity of NF-κB, thereby enhancing the activity of NF-κB.

Example 8 confirms the effect of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino] methyl) phenol on gastritis-induced mice. Ranitidine, a drug used in the comparative group, acts as an H2 blocker and is used as a drug for treating gastritis.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples.

Example  One : RAW264 .7 Within the cell NO Production measurement of

1-1. Cell culture

Rat macrophage cell lines (RAW264.7 cells) were maintained in RPMI1640 medium supplemented with 100 U / ml penicillin, 100 μg / ml streptomycin and 10% FBS. Cells were incubated in 37 ° C., 5% CO ₂ humid air.

1-2. RAW264 Lt; RTI ID = 0.0 > 4-dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Nitric oxide of phenol ( NO ) Inhibitory effect

RAW264.7 cells (1 x 10 ⁶ cells / ml) were preincubated for 18 hours, and the pre-cultured cells were treated with 4-dimethylamino-2-methoxy-6 - ((methyl- [2- Phenyl) ethyl] amino) methyl) phenol (0, 6.25, 12.5, 25, 50, 100 μM) for 30 minutes and further incubated with LPS (1 μg / ml) for 24 hours. The supernatant was collected and the concentration of nitric oxide (NO) in the supernatant was measured with Griess reagent.

The results are shown in Fig. The NO production inhibitory effect was expressed as a percentage of the control without adding any sample.

As shown in FIG. 1, 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol inhibited increased NO production by LPS treatment . When 25 uM treatment was performed, the NO production was reduced to about 70%, and the NO content was continuously decreased in the concentration-dependent manner, compared with the control group without any treatment. Respectively.

Example  2. RAW264 .7 Within the cell TNF -α production and comparison experiment

2-1. RAW264 Lt; RTI ID = 0.0 > 4-dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl Phenolic TNF -α production inhibitory effect

RAW264.7 cells (1 x 10 ⁶ cells / ml) were preincubated for 18 hours, and the pre-cultured cells were treated with 4-dimethylamino-2-methoxy-6 - ((methyl- [2- Phenyl) ethyl] amino) methyl) phenol (0, 5, 10, 20, 40 μM) for 30 minutes and further incubated with LPS (1 μg / ml) for 24 hours. The supernatant was collected and the concentration of TNF-a in the supernatant was measured by ELISA kit. The results are shown in Fig. The inhibitory effect of TNF-α production was expressed as a percentage of the control to which no sample was added.

As shown in Fig. 2, RAW264.7 cells were cultured in RAW264.7 cells in the presence of 5, 10 (mol) of 4-dimethylamino-2-methoxy- , 20 and 40 μM, respectively, the TNF-α content decreased by 40% when treated with 5 μM and decreased by 80% when treated with 20 μM.

2-2. Comparison with other drugs

The inhibition of TNF-α production by 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol was compared with pentoxifylline, prednisolone and genistein. RAW264.7 cells (1 x 10 ⁶ cells / ml) were preincubated for 18 hours, and the pre-cultured cells were treated with 4-dimethylamino-2-methoxy-6 - ((methyl- [2- Phenyl) ethyl] amino) methyl) phenol, pentoxifylline, prednisolone and genistein for 30 minutes and then incubated with LPS (1 μg / ml) for 24 hours. The supernatant was collected and the concentration of TNF-a in the supernatant was measured by ELISA kit. The results are shown in FIG.

As shown in Figure 3, the IC ₅₀ for the TNF-a production of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) value was 10.3 μM, and the IC ₅₀ values for pentoxifylline, prednisolone and genistein were 457, 40 and 56, respectively, and the values of 4-dimethylamino-2-methoxy-6- (methyl- [2- (4-nitrophenyl) Ethyl] amino) methyl) phenol was found to be excellent in inhibiting TNF-α production.

Example  3. RAW264 .7 Within the cell Prostaglandin E ₂ ( PGE ₂ ) Inhibitory effect

RAW264.7 cells (1 x 10 ⁶ cells / ml) were preincubated for 18 hours, and the pre-cultured cells were treated with 4-dimethylamino-2-methoxy-6 - ((methyl- [2- Phenyl) ethyl] amino) methyl) phenol (0, 5, 10, 20, 40 μM) for 30 minutes and further incubated with LPS (1 μg / ml) for 24 hours. The supernatant was collected and the concentration of PGE _{2 in} the supernatant was measured with an EIA kit.

The results are shown in FIG. The inhibitory effect of PGE ₂ production was expressed as a percentage of the control to which no sample was added.

As shown in FIG. 4, the production of PGE ₂ was inhibited as the concentration increased in RAW264.7 cells treated with LPS.

Example  4. RAW264 .7 Measurement of cytotoxicity in cells

RAW 264.7 cells (1 × 10 ⁶ cells / ml) were pre-cultured for 18 hours, and then the above (3.125, 6.25, 12.5, 25, 50, 100 μM) was added to the cell suspension and cultured for 24 hours. The cytotoxic effect was then measured by the general MTT assay. That is, 10 ml of MTT solution (10 mg / ml in phosphate buffer, pH 7.4) was added 3 hours before the end of the culture, and the cells were continuously cultured until the end of the assay. 15% SDS (sodium dodecyl sulphate) was added to each well, the culture was stopped by dissolving the formazan, and the absorbance was measured at 570-630 nm (OD _{570 -630} ) using a Spectramax 250 microplate reader.

The results are shown in Fig. The survival rate of the cells was determined by adding no sample

And expressed as a percentage of the control (control).

As shown in FIG. 5, even when 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol was treated, LPS- There was no decrease in cell viability and no cytotoxicity.

Example  5: 4-Dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Phenol is an anti-inflammatory cytokine mRNA Effect on

Determination of inhibition of nitrogen monoxide (NO), PGE ₂ production of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethylamino) methyl) Amino) methyl) phenol in RAW264.7 cells treated with LPS, iNOS and COX-2 (2-methoxy-6- MRNA levels of the cells. The amount of mRNA of TNF-α was also measured.

First, RAW264.7 cells (5 × 10 ⁶ cells / ml) were treated with or without treatment with LPS (1 μg / ml) to give 4-dimethylamino-2-methoxy- -Nitrophenyl) ethyl] amino) methyl) phenol for 6 hours. Total RNA was then isolated from RAW 264.7 cells treated with TRIzol reagent (Gibco BRL) according to the manufacturer's instructions and stored at -70 ° C until use. Real-time RT-PCR was performed with SYBR Premix Ex Taq using a real-time thermocycler (Bio-Rad, USA) according to the manufacturer's instructions (Takara, Japan) Respectively. The results are presented as relative density ratios relative to GAPDH. The primers used were obtained from Bioneer (Daejeon, Korea) and are shown in Table 1 below. The results are shown in FIG. 6 and FIG.

primer Sequences (5 '-> 3') iNOS Forward GGA GCC TTT AGA CCT CAA CAGE Reverse TGA ACG AGG AGG GTG GTG TNF-a Forward     TGC CTA TGT CTC AGC CTC TTC Reverse GAG GCC ATT TGG GAA CTT CT COX-2 Forward CACTACATCCTGACCCACTT Reverse ATGCTCCTGCTTGAGTATGT GAPDH Forward CAA TGA ATA CGG CTA CAG CAA C Reverse AGG GAG ATG CTC AGT GTT GG

As shown in FIG. 6 and FIG. 7, as the concentration of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) -α and COX-2 mRNA expression levels were significantly decreased. These results show that the production of nitrogen monoxide (NO) and PGE ₂ by 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) Was found to occur at the transcriptional level.

Example  6. 4-Dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Phenol AP -1

6-1. 4-dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Phenol AP -1 on the transcription factor

First, RAW264.7 cells (5 × 10 ⁶ cells / ml) were treated with or without treatment with LPS (1 μg / ml) to give 4-dimethylamino-2-methoxy- -Nitrophenyl) ethyl] amino) methyl) phenol was treated and cultured for 6 hours. Cellular fractions and nuclear extracts of RAW264.7 cells were obtained as described in Byeon, et al. (Archives of Pharmacal Research 32, 1565-1572 (2009)). Immunoblot analysis was performed to confirm the nuclear content of c-Jun and c-Fos as described by Lee et al (British Journal of Pharmacology 154, 852-863 (2008)). The result of the observation is shown in Fig.

As shown in FIG. 8, when the 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol was treated, The decrease in the content was confirmed when the sample was treated for 60 minutes longer than when it was treated.

6-2. 4-dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Phenol AP -1 on the activity of

According to the manufacturer's protocol (Jin et al., 2009), a PEI method was applied to a 12-well plate

1 占 퐂 plasmid containing AP-1-Luc was transfected into HEK293 (1 占¹⁰⁶ cells / ml) cells with and without TRIF (TIR-domain-containing adapter-inducing interferon- After 48 hours of incubation, AP-1 activity was measured using Luciferase assays. The luciferase assay was performed according to the Luciferase assay system (Promega C) reported in the manufacturer's protocol (Jung et al., 2009).

The results are shown in Fig. FIG. 9 shows that treatment of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino] methyl) phenol inhibited the activity of AP- Lt; RTI ID = 0.0 > luciferase < / RTI > activity is markedly inhibited.

Example  7. 4-Dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Phenol NF -KB

7-1. 4-dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Phenol NF of -KB subunit Effect on

First, RAW264.7 cells (5 × 10 ⁶ cells / ml) were treated with or without treatment with LPS (1 μg / ml) to give 4-dimethylamino-2-methoxy- -Nitrophenyl) ethyl] amino) methyl) phenol was treated and cultured for 6 hours. Cellular fractions and nuclear extracts of RAW264.7 cells were obtained as described in Byeon, et al. (Archives of Pharmacal Research 32, 1565-1572 (2009)). Immunoblot analysis was performed to confirm the nuclear content of p65 as described by Lee et al (British Journal of Pharmacology 154, 852-863 (2008)). The above observation results are shown in Fig. 10A.

7-2. 4-dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Effect of phenol on IκB

RAW264.7 cells (5 x 10 6 cells / ml) were treated with or without treatment with LPS (1 μg / ml) to give 4-dimethylamino-2-methoxy- Phenyl) ethyl] amino) methyl) phenol for 6 hours. Cell lysates were then prepared and the contents of I [kappa] B [alpha] and phosphorylated I [kappa] B [alpha] were confirmed by immunoblotting.

The results are shown in FIG. It can be seen that 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol phosphorylates IκBα to activate it.

7-3. 4-dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Phenol NF on the activity of -KB

According to the manufacturer's protocol (Jin et al., 2009), a PEI method was applied to a 12-well plate

Amino-methyl) phenol was treated with 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) 1 μg of each plasmid containing each of Luc was transfected into HEK293 cells (1 × 10 ⁶ cells / ml), cultured for 48 hours, and assayed for AP-1 activity using Luciferase assays Respectively. The luciferase assay was performed according to the Luciferase assay system (Promega C) reported in the manufacturer's protocol (Jung et al., 2009).

The results are shown in Fig. Figure 11 shows that treatment of 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino] methyl) phenol inhibited the activity of NF- Lt; RTI ID = 0.0 > luciferase < / RTI > activity is markedly inhibited.

Example  8: In vivo inflammation model 4-dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Identification of anti-inflammatory activity of phenol

8-1. Induced gastritis and 4-dimethylamino-2- Methoxy -6-(( methyl -[2- (4- Nitrophenyl ) Ethyl] amino) methyl ) Phenol, ranitidine administration

Induced inflammation of ICR mice with ethanol / hydrochloric acid according to known methods [Okabe S, Miyake H, Awane Y. Cytoprotective effects of NC-1300 and omeprazole on HCl ethanol-induced gastric lesions in rats. Jpn J Pharmacol 1986; 42: 123-33.). Fasted ICR mice (7 rats) were injected with 4-dimethylamino-2-methoxy-6 ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol (10 and 30 mg / kg) or ranitidine (40 mg / kg) was orally administered for 3 days. After 30 minutes, 400 μl of 60% ethanol in 150 mM hydrochloric acid was orally administered. Each experimental animal was anesthetized and sacrificed by lethal doses of urethane 1 hour after necrosis.

 8-2. Lesion site observation

The stomach was incised and then rinsed carefully with running tap water. After opening the stomach along the Taiwan and spreading on the board, the area (mm 2) of the erosive mucosal corrosion lesion was measured using a pixel-counter. In addition, photographs of mucosal erosion lesions were taken and visually observed.

The results are shown in FIG. 12 and FIG. 12 and 13, 4-dimethylamino-2-methoxy-6 - ((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol was obtained from gastritis- / Hydrochloric acid.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the embodiments described above are in all respects illustrative and not restrictive.

Claims (5)

Prevention of inflammatory diseases comprising 4-dimethylamino-2-methoxy-6-((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol or a pharmaceutically acceptable salt thereof as an active ingredient or Therapeutic pharmaceutical composition.
The method of claim 1,
The 4-dimethylamino-2-methoxy-6-((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol is nitric oxide (NO), TNF-α (Tumor necrosis factor). -α) or PGE ₂ (prostaglandin E _{2 )} , characterized in that the inhibition of the production of a pharmaceutical composition for preventing or treating inflammatory diseases.
The method of claim 1,
Wherein the inflammation is selected from the group consisting of dermatitis, allergy, gastric ulcer, duodenal ulcer, hepatitis, esophagitis, gastritis, enteritis, pancreatitis, colitis, nephritis, gastric cancer, systemic edema and local edema Composition.
Prevention of inflammatory diseases comprising 4-dimethylamino-2-methoxy-6-((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol or a pharmaceutically acceptable salt thereof as an active ingredient or Improvement food composition.
Prevention of inflammatory diseases comprising 4-dimethylamino-2-methoxy-6-((methyl- [2- (4-nitrophenyl) ethyl] amino) methyl) phenol or a pharmaceutically acceptable salt thereof as an active ingredient or Improvement cosmetic composition.

Images