KR20140014042A - A primer for scuticociliate and a method for detecting scuticociliate using the same - Google Patents

A primer for scuticociliate and a method for detecting scuticociliate using the same Download PDF

Info

Publication number
KR20140014042A
KR20140014042A KR1020130161339A KR20130161339A KR20140014042A KR 20140014042 A KR20140014042 A KR 20140014042A KR 1020130161339 A KR1020130161339 A KR 1020130161339A KR 20130161339 A KR20130161339 A KR 20130161339A KR 20140014042 A KR20140014042 A KR 20140014042A
Authority
KR
South Korea
Prior art keywords
primer
seq
nucleotide sequence
pseudocohnilembus
scutica
Prior art date
Application number
KR1020130161339A
Other languages
Korean (ko)
Inventor
황일선
이제희
Original Assignee
제주대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 제주대학교 산학협력단 filed Critical 제주대학교 산학협력단
Priority to KR1020130161339A priority Critical patent/KR20140014042A/en
Publication of KR20140014042A publication Critical patent/KR20140014042A/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a primer for detecting scuticociliate amplifying cox1 gene of scuticociliate at the same time, a method for detecting scuticociliate, and a detecting kit. According to the present invention, the invention detects at least two kinds of scuticociliate at the same time, thereby quickly analyzing a scuticociliate infection and infectious kinds.

Description

스쿠티카섬모충 검출용 프라이머 및 이를 이용한 스쿠티카충 검출방법{A PRIMER FOR SCUTICOCILIATE AND A METHOD FOR DETECTING SCUTICOCILIATE USING THE SAME}Primer for detecting scutica ciliates and method for detecting scutica insects using the same {A PRIMER FOR SCUTICOCILIATE AND A METHOD FOR DETECTING SCUTICOCILIATE USING THE SAME}

본 발명은 미생물 검출용 프라이머 및 이를 이용한 미생물 검출방법에 관한 것이다.The present invention relates to a primer for detecting microorganisms and a method for detecting microorganisms using the same.

스쿠티카섬모충(scuticociliate)은 원생동물의 섬모류에 속하는 채찍섬모충 목(scuticociliatida order)의 섬모충을 말하며, 스쿠티카충이라고도 한다. 상기 스쿠티카섬모충은 덴마크의 저명한 동물연구가 오토 뮐러에 의하여 1773년에 발견되었다. 그 이후로 스쿠티카섬모충과에 속하는 미생물이 300 종 이상이 확인되었다. 서식지의 넓은 범위를 차지하고 있고, 다양한 구조, 행동 및 생물학적 특성을 가지고 있다. 그들 중에서 일부는 세계적인 양식 산업에서 심각한 기생 위험이 있는 것으로 여겨진다. 스쿠티카섬모충은 감염대상(host)이 되는 해양생물의 내부 기관에 빠르게 침입해서 군체를 형성하여 전체적으로 심각한 감염을 일으켜서, 넙치(Paralichthys olivaceus), 남방 참다랑어(Thunnus maccoyii), 가자미(Scophthalmus maximus), 농어(Dicentrachus labrax) 및 병어(Pampus argenteus)와 같은 어류의 집단 폐사를 야기한다.Scuticociliate refers to the ciliated worms of the scuticociliatida order belonging to the cilia of protozoa, and is also called the scuticociliate. The scutica ciliaryworm was discovered in 1773 by Otto Müller, a renowned Danish animal researcher. Since then, more than 300 species of microorganisms belonging to the family Scutica cilia have been identified. It occupies a wide range of habitats and has a variety of structural, behavioral and biological characteristics. Some of them are believed to be at serious parasitic risk in the global aquaculture industry. Surgical Utica ciliate is an entirely serious infection causes the formation of colonies by quickly entering the internal organs of marine organisms that infect the target (host), flounder (Paralichthys olivaceus ), Southern bluefin tuna ( Thunnus) maccoyii ), Scophthalmus maximus ), perch ( Dicentrachus labrax ) and pomp ( Pampus) argenteus ) causes mass mortality of fish.

넙치(P. olivaceus) 및 볼락(Sebastes schlegelii)은 한국에서 바다 양식 전체 생산량의 70% 이상을 차지하는 것으로 산업적으로 중요한 어종이다. 1990년대 초반에 처음으로 발견된 스쿠티카증(Scuticociliatosis)은 넙치나 볼락 양식에서 중요하고 지속적인 위험 대상으로 대표된다. 상기 스쿠티카증의 원인이 되는 매개체를 분리해서 동정하는데는 수 년이 소요됐다. 상기 스쿠티카증과 연관된 충으로는 유로네마 마리넘(Uronema marinum), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus) 및 미아미엔시스 아비더스(Miamiensis avidus(syn. Philasterides dicentrarchi)) 등이 보고되어 있다. 또한, 이전의 연구에서 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus)가 스쿠티카증에 걸린 볼락(S. schlegelii)에서 동정되었다.Flounder ( P. olivaceus ) and Rockfish ( Sebastes) schlegelii ) is an industrially important fish species, accounting for more than 70% of the total production of marine aquaculture in Korea. Scuticociliatosis, first discovered in the early 1990s, represents an important and persistent risk target in flounder and rockfish aquaculture. It took several years to isolate and identify the vector that causes the above scutikaosis. The worms associated with the above scutikaosis are Uronema marinum (Uronema). marinum ), Pseudocohnilembus persalinus ) and Miamiensis avidus ( syn.Philasterides dicentrarchi )), etc. have been reported. Also, in previous studies, Pseudocohnilembus Longisetters (Pseudocohnilembus longisetus ) was identified in rockfish (S. schlegelii) with scutikaosis.

스쿠티카섬모충과 같은 해양 병원성 종은 화학요법제(chemotherapeutant)를 사용하면 빨리 제거할 수도 있으나, 일단 감염대상(host) 에 침입하면 전체적인 감염을 일으키는데, 이를 치료할 수 있는 효과적인 화학요법제가 아직까지는 없다. 또한, 스쿠티카섬모충의 종류에 따라 그 피해 정도가 상이한 특징이 있으므로, 어종에 감염된 원인충을 구별하기 위한 신속한 방법이 요구되나, 아직까지 개발된 것이 없다. 따라서, 상기 스쿠티카증을 효과적으로 방지할 수 있는 일반적이고 더 신속한 방법의 개발이 양식업에서 요구되고 있다.Marine pathogenic species such as scutica ciliaryworm can be quickly eliminated with chemotherapeutants, but once they invade the host, they cause an overall infection, and there are no effective chemotherapeutic agents to treat it. In addition, since the degree of damage is different depending on the type of scutica ciliated insects, a rapid method for distinguishing the causative insects infected with fish species is required, but has not been developed yet. Therefore, there is a demand in the aquaculture industry to develop a general and faster method that can effectively prevent the scutikaosis.

이러한 요구를 해결하기 위한 첫 번째 단계는 넙치와 볼락에서 스쿠티카증을 유발하는 섬모충의 종을 정확하게 동정하는 것이다. 지금까지 스쿠티카섬모충에서 가장 일반적인 종인 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum) 및 미아미엔시스 아비더스(Miamiensis avidus)를 동정하는데 형태학적 특성 분석과 리보솜 소단위체 DNA(small subunit ribosomal DNA, SSU rDNA) 분석 방법이 사용되었다. 상기 섬모충의 형태학적 분석이 스쿠티카섬모충을 동정하기 위한 유용한 방법이기는 하지만, 많은 시간과 노력이 소요되고, 특성을 분석하는데 있어서 염색기술에 따라서 미묘한 차이가 잘 보이지 않게 되어 착오를 일으킬 수 있는 단점이 있다. 반면에, SSU rDNA 염기서열 분석 접근은 광범위하게 적용할 수 있는 기술이긴 하나, 연관관계가 가까운 종을 구별하는데 한계가 있다. The first step in addressing this need is to accurately identify the species of ciliated worms that cause scutikaosis in flounder and rockfish. Pseudocohnilembus (Pseudocohnilembus longisetus ), Pseudocohnilembus persalinus ), Euronema marinum (Uronema) marinum ) And To identify Miamiensis avidus , morphological characterization and small subunit ribosomal DNA (SSU rDNA) analysis were used. Although the morphological analysis of the ciliated worms is a useful method for identifying Scutica ciliated worms, it takes a lot of time and effort, and there is a disadvantage that subtle differences may not be easily seen depending on the dyeing technique in analyzing the characteristics, which may cause an error. have. On the other hand, although the SSU rDNA sequencing approach is a technique that can be widely applied, it has limitations in distinguishing species with close relations.

상기한 바와 같이, 스쿠티카섬모충은 감염 후 시일이 오래 지나면 치료가 어렵기 때문에, 스쿠티카증에 효과적으로 대응하기 위해서는 스쿠티카섬모충의 감염여부가 신속하게 검출되어야 한다. 특히 스쿠티카섬모충 중에서도 종에 따라 피해 정도가 상이해 지므로, 어느 스쿠티카섬모충에 감염되었는지 종 구분을 신속하게 확인하는 것이 중요하고, 따라서 감염된 스쿠티카섬모충의 종 구분을 신속하고 정확하게 수행할 수 있는 프라이머 및 이를 이용한 검출 키트나 검출방법의 개발에 대한 요구가 증대되고 있다.As described above, since it is difficult to treat Scutica cilia after a long period of time after infection, in order to effectively respond to Scutica disease, it is necessary to quickly detect whether or not Scutica cilia are infected. In particular, the degree of damage varies depending on the species among the Scutica cilia, so it is important to quickly identify the species classification of which Scutica cilia is infected, and thus, a primer that can quickly and accurately perform the species classification of the infected Scutica cilia. And there is an increasing demand for the development of a detection kit or a detection method using the same.

KRKR 10-084651110-0846511 BB KRKR 10-092097110-0920971 BB

이에 본 발명은 스쿠티카섬모충 검출용 프라이머를 제공하는 것을 목적으로 한다.Accordingly, an object of the present invention is to provide a primer for detecting scutica cilia.

또한, 본 발명은 상기 스쿠티카섬모충 검출용 프라이머를 이용한 스쿠티카섬모충 검출방법 및 검출키트를 제공하는 것을 목적으로 한다.In addition, it is an object of the present invention to provide a method and a detection kit for detecting Scutica cilia using the primers for detecting Scutica cilia.

상기 목적을 달성하기 위하여, 본 발명은 일 실시예에 따른 스쿠티카섬모충(scuticociliate) 검출용 프라이머를 제공한다. In order to achieve the above object, the present invention provides a primer for detecting scuticociliate according to an embodiment.

상기 스쿠티카섬모충 검출용 프라이머는 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍 및 이들의 조합으로 이루어진 군에서 선택된 어느 하나의 프라이머 쌍을 포함하는 것 일 수 있다. The primers for detecting Scutica cilia are a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 5 and a primer comprising a nucleotide sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7 and a base of SEQ ID NO: 8 A primer pair consisting of a primer comprising a sequence, a primer comprising a nucleotide sequence of SEQ ID NO: 9, and a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 10, a primer comprising a nucleotide sequence of SEQ ID NO: 11, and SEQ ID NO: 12 It may include any one primer pair selected from the group consisting of a primer pair consisting of a primer including the nucleotide sequence of and a combination thereof.

상기 스쿠티카섬모충은 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum), 미아미엔시스 아비더스(Miamiensis avidus) 및 이들의 조합으로 이루어진 군에서 선택된 어느 하나일 수 있다. The scutica ciliated caterpillar is Pseudocohnilembus longisetus, Pseudocohnilembus persalinus ), Euronema marinum (Uronema) marinum ), Miamiensis Abidas (Miamiensis avidus ) and combinations thereof.

상기 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 바람직하게는 상기 서열번호 5의 염기서열로 이루어진 프라이머 및 상기 서열번호 6의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍은 프라이머는 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus) 검출용 프라이머일 수 있고, 상기 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 바람직하게는 상기 서열번호 7의 염기서열로 이루어진 프라이머 및 상기 서열번호 8의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍은 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus) 검출용 프라이머일 수 있으며, 상기 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 바람직하게는 상기 서열번호 9의 염기서열로 이루어진 프라이머 및 상기 서열번호 10의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍은 유로네마 마리넘(Uronema marinum) 검출용 프라이머 일 수 있고, 상기 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 바람직하게는 상기 서열번호 11의 염기서열로 이루어진 프라이머 및 상기 서열번호 12의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍은 미아미엔시스 아비더스(Miamiensis avidus) 검출용 프라이머 일 수 있다. A primer pair consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 5 and a primer comprising the nucleotide sequence of SEQ ID NO: 6, preferably a primer consisting of the nucleotide sequence of SEQ ID NO: 5 and the nucleotide sequence of SEQ ID NO: 6 The primer pair consisting of primers is Pseudocohnilembus (Pseudocohnilembus). longisetus ) may be a detection primer, a primer pair consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 7 and a primer comprising the nucleotide sequence of SEQ ID NO: 8, preferably a primer consisting of the nucleotide sequence of SEQ ID NO: 7 and The primer pair consisting of the primers consisting of the nucleotide sequence of SEQ ID NO: 8 is Pseudocohnilembus persalinus ) may be a detection primer, a primer pair consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 9 and a primer comprising the nucleotide sequence of SEQ ID NO: 10, preferably a primer consisting of the nucleotide sequence of SEQ ID NO: 9, and The primer pair consisting of the primers consisting of the nucleotide sequence of SEQ ID NO: 10 is Euronema marinum (Uronema marinum ) may be a detection primer, a primer pair consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 11 and a primer comprising the nucleotide sequence of SEQ ID NO: 12, preferably a primer consisting of the nucleotide sequence of SEQ ID NO: 11, and The primer pair consisting of the primers consisting of the nucleotide sequence of SEQ ID NO: 12 may be a primer for detecting Miamiensis avidus.

또한, 본 발명의 스쿠티카섬모충 검출용 프라이머 세트는 서열번호 5의 염기서열로 이루어진 프라이머 및 서열번호 6의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍; 서열번호 7의 염기서열로 이루어진 프라이머 및 서열번호 8의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍; 서열번호 9의 염기서열로 이루어진 프라이머 및 서열번호 10의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍; 및 서열번호 11의 염기서열로 이루어진 프라이머 및 서열번호 12의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍으로 이루어진 것으로 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum) 및 미아미엔시스 아비더스(Miamiensis avidus)를 동시에 검출할 수 있는 프라이머일 수 있다. 상기 슈도코니렘버스 론지세터스, 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum) 및 미아미엔시스 아비더스(Miamiensis avidus)를 동시에 검출할 수 있는 프라이머는 프라이머 세트일 수 있다.In addition, the primer set for detecting Scutica cilia of the present invention includes a primer pair consisting of a primer consisting of a nucleotide sequence of SEQ ID NO: 5 and a primer consisting of a nucleotide sequence of SEQ ID NO: 6; A primer pair consisting of a primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a primer consisting of the nucleotide sequence of SEQ ID NO: 8; A primer pair consisting of a primer consisting of a nucleotide sequence of SEQ ID NO: 9 and a primer consisting of a nucleotide sequence of SEQ ID NO: 10; And a primer pair consisting of a primer consisting of a nucleotide sequence of SEQ ID NO: 11 and a primer consisting of a nucleotide sequence of SEQ ID NO: 12, Pseudocohnilembus longisetus ), Pseudocohnilembus persalinus ), Euronema marinum (Uronema) marinum ) and Miamiensis avidus may be a primer capable of simultaneously detecting. Pseudocohnilembus above, Pseudocohnilembus, Pseudocohnilembus persalinus ), Euronema marinum (Uronema) marinum ) and Miamiensis avidus primers capable of simultaneously detecting may be a primer set.

본 발명은 다른 일 실시예에 따라 상기 스쿠티카섬모충 검출용 프라이머를 이용하여 중합효소연쇄반응(Polymerase Chain Reaction, PCR)으로 스쿠티카섬모충을 탐지하는 단계를 포함하는 스쿠티카섬모충(scuticociliate) 검출 방법을 제공한다. According to another embodiment, the present invention provides a method for detecting scuticociliate, comprising the step of detecting Scuticociliate by polymerase chain reaction (PCR) using the primer for detecting Scutica ciliates according to another embodiment. to provide.

상기 스쿠티카섬모충 검출 방법은 서열번호 5의 염기서열로 이루어진 프라이머 및 서열번호 6의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍; 서열번호 7의 염기서열로 이루어진 프라이머 및 서열번호 8의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍; 서열번호 9의 염기서열로 이루어진 프라이머 및 서열번호 10의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍; 및 서열번호 11의 염기서열로 이루어진 프라이머 및 서열번호 12의 염기서열로 이루어진 프라이머로 이루어진 프라이머 쌍으로 이루어진 상기 슈도코니렘버스 론지세터스, 슈도코니렘버스 퍼살리너스, 유로네마 마리넘 및 미아미엔시스 아비더스를 동시에 검출할 수 있는 스쿠티카섬모충 검출용 프라이머를 이용하는 것일 수 있다. The method for detecting the scutica cilia includes a primer pair consisting of a primer consisting of a nucleotide sequence of SEQ ID NO: 5 and a primer consisting of a nucleotide sequence of SEQ ID NO: 6; A primer pair consisting of a primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a primer consisting of the nucleotide sequence of SEQ ID NO: 8; A primer pair consisting of a primer consisting of a nucleotide sequence of SEQ ID NO: 9 and a primer consisting of a nucleotide sequence of SEQ ID NO: 10; And the Pseudocony Rembus longisetters consisting of a primer pair consisting of a primer consisting of a nucleotide sequence of SEQ ID NO: 11 and a primer consisting of a nucleotide sequence of SEQ ID NO: 12, Pseudocony Rembus Fasalinas, Euronema Mariner and It may be to use a primer for detecting Scutica ciliated worms that can simultaneously detect Miamiensis avidus.

상기 스쿠티카섬모충 검출 방법은 상기 스쿠티카섬모충을 탐지하는 단계를 다중 중합효소연쇄반응(Multiplex Polymerase Chain Reaction)으로 수행하는 것일 수 있다.The method of detecting the scutica cilia may be performed by performing the step of detecting the scutica cilia by a multiplex polymerase chain reaction.

본 발명은 또 다른 일 실시예에 따라 중합효소연쇄반응(PCR)을 이용하여 스쿠티카섬모충을 검출하는 상기 스쿠티카섬모충 검출용 프라이머, 반응완충액, dNTP 및 Taq DNA 중합효소를 포함하는 스쿠티카섬모충(scuticociliate) 검출키트를 제공한다.According to another embodiment, the present invention uses a polymerase chain reaction (PCR) to detect the Scutica ciliaryworm detection primer, a reaction buffer, dNTP, and Scutica cilia including a Taq DNA polymerase ( scuticociliate) detection kit is provided.

본 발명의 발명자들은 스쿠티카섬모충의 피해를 줄이기 위하여, 신속하고 간편하게 감염 스쿠티카섬모충을 검출 할 수 있는 방법에 대하여 연구를 수행하여, 동시에 4개 종의 스쿠티카섬모충을 검출 할 수 있는 프라이머 셋트를 발명하였고, 실험을 통하여 동시에 4개의 미생물을 종을 구분하여 검출할 수 있음을 확인하여 본 발명을 완성 하였다. The inventors of the present invention conducted a study on a method that can quickly and easily detect infected Scutica cilia in order to reduce the damage of Scutica cilia, and developed a primer set capable of simultaneously detecting 4 species of Scutica cilia. It was invented, and the present invention was completed by confirming that four microorganisms can be detected by classifying species at the same time through an experiment.

이하, 본 발명을 보다 상세하게 설명한다. Hereinafter, the present invention will be described in more detail.

본 발명은 스쿠티카섬모충(scuticociliate)을 검출할 수 있는 프라이머에 관한 것이다. The present invention relates to a primer capable of detecting scuticociliate.

상기 스쿠티카섬모충은 스쿠티카증의 원인이 되는 채찍섬모충 목(scuticociliatida order)에 속하는 섬모충 일 수 있고, 바람직하게는 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum), 미아미엔시스 아비더스(Miamiensis avidus) 및 이들의 조합으로 이루어지는 군에서 선택된 어느 하나 일 수 있다. The scoutica ciliary worms may be ciliated worms belonging to the scuticociliatida order, which are the cause of scuticosis, and preferably Pseudocohnilembus (Pseudocohnilembus). longisetus ), Pseudocohnilembus persalinus ), Euronema marinum (Uronema) marinum ), Miamiensis Abidas (Miamiensis avidus ) and combinations thereof.

상기 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus)는 길고 가는 선단과 둥근 후부를 갖고, 서로 평행한 두 개의 막판(membranelle)과 지그재그형의 구연막(paroral membrane, PM)이 구강부에 위치하고 있으며, 9개의 섬모열(kinety), 3번과 4번 섬모열에 두 개의 수축포(contractile vacuole pore, CVP)를 가지고, 한 개의 대핵과 소핵이 세포의 중앙에 위치하는 형태학적 특성을 갖는다. Pseudocohnilembus above longisetus ) has a long, thin tip and a round posterior part, two parallel membranelles and a zigzag-shaped paroral membrane (PM) located in the oral cavity, 9 kinety, 3 It has two contractile vacuole pores (CVP) in the ciliary row of 4 and has a morphological characteristic in which one large nucleus and a micronucleus are located in the center of the cell.

상기 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus)는 둥근 후부를 갖고 있는 방추형이고, 3개의 막판(membranelle, M1, M2 및 M3)과 구연막(PM)이 구강부에 위치하고 있으며, M1과 M2는 서로 평행하고, M3는 PM의 중간에 위치하고 있다. 10개의 섬모열과 한 개의 수축포가 제2 섬모열 후단부에 존재하는 형태학적 특성을 갖는다. Pseudocohnilembus persalinus ) is a fusiform with a round posterior part, and three membrane plates (membranelle, M1, M2 and M3) and a citric membrane (PM) are located in the oral cavity, M1 and M2 are parallel to each other, and M3 is in the middle of the PM. Is located. Ten ciliary rows and one constricted cell have morphological characteristics present at the posterior end of the second ciliary row.

상기 유로네마 마리넘(Uronema marinum)은 뭉툭하고 점차 작아지는 선단과 둥근 후부를 갖고, 3개의 막판(membranelle, M1, M2 및 M3)과 구연막(PM)이 신장의 가운데에 구부기관을 형성하고 있으며, PM이 M2의 중간부까지 신장되어 있고, 섬모열은 11 내지 12개를 가지고, 수축포가 제2 섬모열의 후단부에 위치하고 있으며 한 개의 대핵과 소핵이 세포의 중간에 위치하는 형태학적 특성을 갖는다. The Uronema marinum has a blunt and gradually smaller tip and a round posterior, and three membrane plates (membranelle, M1, M2 and M3) and a citric membrane (PM) form a bent organ in the middle of the kidney. The PM is extended to the middle of M2, the ciliary row has 11 to 12, the contractile is located at the posterior end of the second ciliary row, and one large nucleus and micronucleus are located in the middle of the cell. Have.

상기 미아미엔시스 아비더스(Miamiensis avidus)는 뽀족한 선단과 둥근 후부를 갖는 두터운 난형으로 3개의 막판(membranelle, M1, M2 및 M3)과 두 개로 나뉘어진 구연막(PM1, PM2)이 구강부에 위치하고 평균적으로 13개의 섬모열을 가지며, 한 개의 수축포가 제2 섬포열 후단부에 위치하는 형태학적 특성을 갖는다. The Miamiensis avidus is a thick ovate with a pointed tip and a round posterior. Three membrane plates (membranelle, M1, M2, and M3) and a citric membrane divided into two (PM1, PM2) are formed in the oral cavity. It is located and has an average of 13 ciliated rows, and has a morphological characteristic in which one contraction is located at the rear end of the second ciliary row.

상기 프라이머(primer)는 사전적으로 특정 유전자 서열에 대하여 상보적인 짧은 단선의 유전자 서열로, DNA 중합효소에 의해 상보적인 유전자 서열이 합성될 때 전체 유전자 서열 중에서 상기 프라이머에서부터 합성이 시작되는 기시점을 의미 할 수 있다. 상기 본 발명의 프라이머는 정방향 프라이머 및 역방향 프라이머로 이루어진 프라이머 쌍 및 상기 프라이머 쌍을 2개 이상 포함하는 프라이머 세트를 포함한다. The primer is a short single-line gene sequence that is complementary to a specific gene sequence in advance, and when a complementary gene sequence is synthesized by DNA polymerase, it refers to the starting point of synthesis from the primer among the entire gene sequence. can do. The primer of the present invention includes a primer pair consisting of a forward primer and a reverse primer, and a primer set including two or more of the primer pairs.

상기 프라이머는 바람직하게는 스쿠티카섬모충의 특이 유전자를 탐지하여 스쿠티카섬모충을 검출할 수 있는 프라이머 쌍 일 수 있고, 상기 특이 유전자는 바람직하게는 스쿠티카섬모충의 cox1 유전자일 수 있다. The primers may preferably be a pair of primers capable of detecting the Scutica cilia by detecting a specific gene of the Scutica cilia, and the specific gene may preferably be a cox1 gene of the Scutica cilia.

상기 프라이머의 더욱 바람직한 형태는 2 종 이상의 스쿠티카섬모충의 검출을 위한 스쿠티카섬모충 검출용 프라이머 쌍을 포함하는 프라이머 세트 일 수 있고, 바람직하게는 4 종의 스쿠티카섬모충의 cox1 유전자를 동시에 탐지할 수 있는 프라이머 쌍을 포함하는 프라이머 세트 일 수 있다. A more preferred form of the primer may be a primer set comprising a pair of primers for detection of two or more types of scutica cilia, and preferably, cox1 genes of four types of scutica cilia can be simultaneously detected. It may be a primer set including a pair of primers.

상기 4 종의 스쿠티카섬모충은 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum)및 미아미엔시스 아비더스(Miamiensis avidus) 일 수 있다. The four types of scutica ciliated caterpillars are Pseudocohnilembus (Pseudocohnilembus). longisetus ), Pseudocohnilembus persalinus , Uronema marinum , and Miamiensis Abidas (Miamiensis avidus ) can be.

상기 cox1 유전자는 미토콘드리아 시토크롬 c 산화효소 1 유전자(mitochondrial cytochrome c oxidase 1 gene, cox1)를 의미한다. 상기 cox1 유전자의 초가변 영역은 상기 프라이머를 디자인 하는데 이용될 수 있다. The cox1 gene refers to a mitochondrial cytochrome c oxidase 1 gene (cox1). The hypervariable region of the cox1 gene may be used to design the primer.

구체적으로 상기 프라이머는 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 9 의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 11 의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍 및 이들의 조합으로 이루어진 군에서 선택된 어느 하나를 포함하는 것 일 수 있다. 상기 서열번호 5 내지 서열번호 12의 프라이머의 염기서열은 하기 표 1과 같다.Specifically, the primer includes a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 5 and a primer comprising a nucleotide sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7 and a nucleotide sequence of SEQ ID NO: 8 A primer pair consisting of a primer of SEQ ID NO: 9, a primer comprising a nucleotide sequence of SEQ ID NO: 9, and a primer pair consisting of a nucleotide sequence of SEQ ID NO: 10, a primer comprising the nucleotide sequence of SEQ ID NO: 11, and a nucleotide sequence of SEQ ID NO: 12 It may include any one selected from the group consisting of a primer pair consisting of a primer comprising a and a combination thereof. The base sequences of the primers of SEQ ID NOs: 5 to 12 are shown in Table 1 below.

미생물microbe 위치location 서열
번호order
number 명칭designation 염기서열 (5'- 3')Base sequence (5'-3') 크기(bp)Size (bp) P. P. longisetuslongisetus 255255 55 OX09-148OX09-148 AAATCAAATCATAGAAATAATAGAGAATTTTTAAATGAAATCAAATCATAGAAATAATAGAGAATTTTTAAATG 341341 595595 66 OX09-149OX09-149 GCTCCAACACCAGTATATTTAATGGCTCCAACACCAGTATATTTAATG P. P. persalinuspersalinus 254254 77 OX09-146OX09-146 TAAATCTAATCATCGTAATAATAGAGAATTGTTAGTAAATCTAATCATCGTAATAATAGAGAATTGTTAG 229229 482482 88 OX09-147OX09-147 CTTATCGATACGACTAACTGCATCTTATCGATACGACTAACTGCAT U. U. marinummarinum 262262 99 OX09-144OX09-144 AACATAGAGCATATAGAGAGTACTCTAAAACATAGAGCATATAGAGAGTACTCTAA 285285 546546 1010 OX09-145OX09-145 TTCATCCAGCTGTTGTTAATGTTTCATCCAGCTGTTGTTAATGT M. M. avidusavidus 258258 1111 OX09-142OX09-142 AGTAATAATAGAACATTTAACGAATTTAATAACACAGTAATAATAGAACATTTAACGAATTTAATAACAC 422422 679679 1212 OX09-143OX09-143 CGTCTTGTAATTAATAAATTTGTAAACGATACCGTCTTGTAATTAATAAATTTGTAAACGATAC

상기 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍은 구체적으로는 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus) 검출용 프라이머 일 수 있다. The primer pair consisting of the primer including the nucleotide sequence of SEQ ID NO: 5 and the primer including the nucleotide sequence of SEQ ID NO: 6 is specifically Pseudocohnilembus longisetus ) may be a primer for detection.

서열번호 5(OX09-148): 5'-AAATCAAATCATAGAAATAATAGAGAATTTTTAAATG-3'SEQ ID NO: 5 (OX09-148): 5'-AAATCAAATCATAGAAATAATAGAGAATTTTTAAATG-3'

서열번호 6(OX09-149): 5'-GCTCCAACACCAGTATATTTAATG-3'SEQ ID NO: 6 (OX09-149): 5'-GCTCCAACACCAGTATATTTAATG-3'

상기 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 슈도코니렘버스 론지세터스 검출용 프라이머는 상기 슈도코니렘버스 론지세터스의 cox1 유전자를 인식하여 상기 슈도코니렘버스 론지세터스의 특이 유전자를 약 341bp로 증폭시킬 수 있다. 상기 슈도코니렘버스 론지세터스 검출용 프라이머는 통상적인 중합효소 연쇄반응에 사용될 수 있고, 바람직하게는 다중 중합효소연쇄반응(Multiplex Polymerase Chain Reaction)에 사용될 수 있다. The Pseudoconi Rembus longisetters detection primer consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 5 and a primer comprising a nucleotide sequence of SEQ ID NO: 6 recognizes the cox1 gene of the Pseudoconi Rembus longisetters, and the The specific gene of Pseudoconi Rembus longisetters can be amplified to about 341 bp. The primer for detection of Pseudoconi Rembus longisetters may be used in a conventional polymerase chain reaction, and preferably may be used in a multiplex polymerase chain reaction.

상기 슈도코니렘버스 론지세터스 검출용 프라이머를 상기 서열번호 7의 염기서열을 포함하는 프라이머 및 상기 서열번호 8의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍, 서열번호 9의 염기서열을 포함하는 프라이머 내지 서열번호 10의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍, 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍 및 이들의 조합으로 이루어진 군에서 선택된 어느 하나와 함께 상기 다중 중합효소 연쇄반응에 사용하는 경우 각 프라이머 쌍 마다 명확히 구분되는 특정 길이의 절편을 생산하여, 2 종 이상의 스쿠티카섬모충을 종을 구분하여 동시에 검출할 수 있게 되므로, 위해성이 높은 스쿠티카증의 감염 여부 및 상기 스쿠티카증의 감염 종의 종류를 신속하게 알 수 있게 한다.The Pseudoconi Rembus longisetters detection primer is a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 7 and a primer comprising a nucleotide sequence of SEQ ID NO: 8, a primer comprising a nucleotide sequence of SEQ ID NO: 9 To a primer pair consisting of a primer containing the nucleotide sequence of SEQ ID NO: 10, a primer pair consisting of a primer containing the nucleotide sequence of SEQ ID NO: 11 and a primer containing the nucleotide sequence of SEQ ID NO: 12, and combinations thereof When used in the multiple polymerase chain reaction together with any one, a specific length fragment is produced for each primer pair, and two or more types of Scutica cilia can be detected at the same time by separating the species.Therefore, the risk is high. It makes it possible to quickly know whether or not the infection is infected with scutikaosis and the type of the infected species of the scutikaosis.

상기 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍은 구체적으로는 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus) 검출용 프라이머 일 수 있다. The primer pair consisting of a primer including the nucleotide sequence of SEQ ID NO: 7 and a primer including the nucleotide sequence of SEQ ID NO: 8 is specifically Pseudocohnilembus persalinus ) It may be a primer for detection.

서열번호 7(OX09-146): 5'-TAAATCTAATCATCGTAATAATAGAGAATTGTTAG-3'SEQ ID NO: 7 (OX09-146): 5'-TAAATCTAATCATCGTAATAATAGAGAATTGTTAG-3'

서열번호 8(OX09-147): 5'-CTTATCGATACGACTAACTGCAT-3'SEQ ID NO: 8 (OX09-147): 5'-CTTATCGATACGACTAACTGCAT-3'

상기 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 슈도코니렘버스 퍼살리너스 검출용 프라이머는 상기 슈도코니렘버스 퍼살리너스의 cox1 유전자를 인식하여 상기 슈도코니렘버스 퍼살리너스의 특이 유전자를 약 229bp로 증폭시킬 수 있다. 상기 슈도코니렘버스 퍼살리너스 검출용 프라이머는 통상적인 중합효소 연쇄반응에 사용될 수 있고, 바람직하게는 다중 중합효소연쇄반응(Multiplex Polymerase Chain Reaction)에 사용될 수 있다. The primer for detecting Pseudoconi Rembus pasalinus , consisting of a primer including the nucleotide sequence of SEQ ID NO: 7 and a primer including the nucleotide sequence of SEQ ID NO: 8, recognizes the cox1 gene of the Pseudoconi Rembus pasalinus, and the It is possible to amplify the specific gene of Pseudoconi Rembus pasalinus to about 229bp. The primer for detection of Pseudoconi Rembus pasalinus may be used in a conventional polymerase chain reaction, and preferably may be used in a multiplex polymerase chain reaction.

상기 슈도코니렘버스 퍼살리너스 검출용 프라이머를 상기 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍, 상기 서열번호 9의 염기서열을 포함하는 프라이머 및 상기 서열번호 10의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍, 상기 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍 및 이들의 조합으로 이루어진 군 중에서 선택된 어느 하나와 함께 상기 다중 중합효소 연쇄반응에 사용하는 경우 각 프라이머 쌍 마다 명확히 구분되는 특정 길이의 절편을 생산하여, 2 종 이상의 스쿠티카섬모충을 종을 구분하여 동시에 검출할 수 있게 되므로, 위해성이 높은 스쿠티카증의 감염 여부 및 상기 스쿠티카증의 감염 종의 종류를 신속하게 알 수 있게 한다. The Pseudoconi Rembus pasalinus detection primer is a primer pair comprising a primer comprising a nucleotide sequence of SEQ ID NO: 5 and a primer comprising a nucleotide sequence of SEQ ID NO: 6, and a primer comprising a nucleotide sequence of SEQ ID NO: 9 And a primer pair consisting of a primer including the nucleotide sequence of SEQ ID NO: 10, a primer pair consisting of a primer including the nucleotide sequence of SEQ ID NO: 11, and a primer including the nucleotide sequence of SEQ ID NO: 12, and a combination thereof. When used in the multiple polymerase chain reaction with any one selected from among, it is possible to simultaneously detect two or more types of Scutica cilia by producing a segment of a specific length that is clearly distinguished for each primer pair. This makes it possible to quickly know whether or not there is an infection with high scutikaosis and the kind of infectious species of the scutikaosis.

상기 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍은 바람직하게는 유로네마 마리넘(Uronema marinum) 검출용 프라이머 일 수 있다.The primer pair consisting of a primer including the nucleotide sequence of SEQ ID NO: 9 and a primer including the nucleotide sequence of SEQ ID NO: 10 is preferably Euronema marinum (Uronema marinum ) may be a primer for detection.

서열번호 9(OX09-144): 5'-AACATAGAGCATATAGAGAGTACTCTAA-3'SEQ ID NO: 9 (OX09-144): 5'-AACATAGAGCATATAGAGAGTACTCTAA-3'

서열번호 10(OX09-145): 5'-TTCATCCAGCTGTTGTTAATGT-3'SEQ ID NO: 10 (OX09-145): 5'-TTCATCCAGCTGTTGTTAATGT-3'

상기 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 유로네마 마리넘 검출용 프라이머는 상기 유로네마 마리넘의 cox1 유전자를 인식하여 상기 유로네마 마리넘의 특이 유전자를 약 285bp로 증폭시킬 수 있다. 상기 유로네마 마리넘 검출용 프라이머는 통상적인 중합효소 연쇄반응에 사용될 수 있고, 바람직하게는 다중 중합효소연쇄반응(Multiplex Polymerase Chain Reaction)에 사용될 수 있다. The euronema marinum detection primer consisting of a primer including the nucleotide sequence of SEQ ID NO: 9 and a primer including the nucleotide sequence of SEQ ID NO: 10 recognizes the cox1 gene of the euronema marinum, The gene can be amplified to about 285 bp. The primer for detecting euronema marinum may be used in a conventional polymerase chain reaction, and preferably may be used in a multiplex polymerase chain reaction.

상기 유로네마 마리넘 검출용 프라이머를 상기 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍, 상기 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍, 상기 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍 및 이들의 조합으로 이루어진 군 중에서 선택된 어느 하나와 함께 상기 다중 중합효소 연쇄반응에 사용하는 경우 각 프라이머 쌍 마다 명확히 구분되는 특정 길이의 절편을 생산하여, 2 종 이상의 스쿠티카섬모충을 종을 구분하여 동시에 검출할 수 있게 되므로, 위해성이 높은 스쿠티카증의 감염 여부 및 상기 스쿠티카증의 감염 종의 종류를 신속하게 알 수 있게 한다.The euronema marinum detection primer is a primer pair comprising a primer comprising a nucleotide sequence of SEQ ID NO: 5 and a primer comprising a nucleotide sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7 and a sequence number Any one selected from the group consisting of a primer pair consisting of a primer containing the nucleotide sequence of 8, a primer pair consisting of a primer containing the nucleotide sequence of SEQ ID NO: 11, and a primer containing the nucleotide sequence of SEQ ID NO: 12, and combinations thereof When used in the multiple polymerase chain reaction together with the multiple polymerase chain reaction, it is possible to simultaneously detect two or more types of Scutica cilia by producing segments of a specific length that are clearly distinguished for each primer pair. It makes it possible to quickly know whether the disease is infected and the type of the infected species of Scutika disease.

상기 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍은 바람직하게는 미아미엔시스 아비더스(Miamiensis avidus) 검출용 프라이머 일 수 있다.The primer pair consisting of a primer including the nucleotide sequence of SEQ ID NO: 11 and a primer including the nucleotide sequence of SEQ ID NO: 12 is preferably Miamiensis avidus (Miamiensis avidus ) It may be a primer for detection.

서열번호 11(OX09-142): 5'-AGTAATAATAGAACATTTAACGAATTTAATAACAC-3'SEQ ID NO: 11 (OX09-142): 5'-AGTAATAATAGAACATTTAACGAATTTAATAACAC-3'

서열번호 12(OX09-143): 5'-CGTCTTGTAATTAATAAATTTGTAAACGATAC-3'SEQ ID NO: 12 (OX09-143): 5'-CGTCTTGTAATTAATAAATTTGTAAACGATAC-3'

상기 서열번호 11의 염기서열을 포함하는 프라이머 및 상기 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 미아미엔시스 아비더스 검출용 프라이머는 상기 미아미엔시스 아비더스의 cox1 유전자를 인식하여 상기 미아미엔시스 아비더스의 특이 유전자를 약 422bp로 증폭시킬 수 있다. 상기 미아미엔시스 아비더스 검출용 프라이머는 통상적인 중합효소 연쇄반응에 사용될 수 있고, 바람직하게는 다중 중합효소연쇄반응(Multiplex Polymerase Chain Reaction)에 사용될 수 있다. The miamiensis avidus detection primer consisting of a primer including the nucleotide sequence of SEQ ID NO: 11 and a primer including the nucleotide sequence of SEQ ID NO: 12 recognizes the cox1 gene of the Miamiensis avidus, and the miamiensis Avidus specific gene can be amplified to about 422bp. The primer for detecting Miamiensis Abides may be used in a conventional polymerase chain reaction, and preferably may be used in a multiplex polymerase chain reaction.

상기 미아미엔시스 아비더스 검출용 프라이머를 상기 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍, 상기 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍, 상기 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어지는 프라이머 쌍 및 이들의 조합으로 이루어진 군 중에서 선택된 어느 하나와 함께 상기 다중 중합효소 연쇄반응에 사용하는 경우 각 프라이머 쌍마다 명확히 구분되는 특정 길이의 절편을 생산하여, 2 종 이상의 스쿠티카섬모충을 종을 구분하여 동시에 검출할 수 있게 되므로, 위해성이 높은 스쿠티카증의 감염 여부 및 상기 스쿠티카증의 감염 종의 종류를 신속하게 알 수 있게 한다.The Miamiensis avidus detection primer is a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 5 and a primer comprising a nucleotide sequence of SEQ ID NO: 6, a primer and a sequence comprising the nucleotide sequence of SEQ ID NO: 7 Any selected from the group consisting of a primer pair consisting of a primer containing the nucleotide sequence of number 8, a primer pair consisting of a primer containing the nucleotide sequence of SEQ ID NO: 9, and a primer containing the nucleotide sequence of SEQ ID NO: 10, and combinations thereof When used in the multiple polymerase chain reaction together with one, it is possible to simultaneously detect two or more types of Scutica cilia by producing segments of a specific length that are clearly distinguished for each primer pair. It makes it possible to quickly know whether or not ticarosis is infected and the type of infectious species of scutikaosis.

상기 스쿠티카섬모충 검출용 프라이머는 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍 및 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍으로 이루어진 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum) 및 미아미엔시스 아비더스(Miamiensis avidus)를 동시에 검출할 수 있는 것을 가장 바람직하게 사용할 수 있다.The primers for detecting Scutica cilia are a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 5 and a primer comprising a nucleotide sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7 and a base of SEQ ID NO: 8 A primer pair consisting of a primer comprising a sequence, a primer comprising a nucleotide sequence of SEQ ID NO: 9, and a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 10, and a primer comprising a nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12 Pseudocohnilembus (Pseudocohnilembus) consisting of a primer pair consisting of a primer containing the nucleotide sequence of longisetus ), Pseudo conical raised RAM bus buffer Nurse (Pseudocohnilembus persalinus), passage over nematic grains (Uronema marinum ) and Most preferably, those capable of simultaneously detecting Miamiensis avidus can be used.

본 발명은 다른 일 실시예에 따른 상기 스쿠티카섬모충 검출용 프라이머를 이용한 스쿠티카섬모충 검출 방법에 관한 것이고, 또 다른 일 실시예에 따른 상기 스쿠티카섬모충 검출용 프라이머를 포함하는 스쿠티카섬모충 검출키트에 관한 것이다. The present invention relates to a method for detecting Scutica cilia using the primer for detecting Scutica cilia according to another embodiment, and to a Scutica cilia detection kit comprising the primer for detecting Scutica cilia according to another embodiment. About.

상기 스쿠티카섬모충 검출용 프라이머 및 상기 스쿠티카섬모충에 대한 기재는 상기 스쿠티카섬모충(scuticociliate)을 검출할 수 있는 프라이머에 관한 기재와 같다. The primers for detecting the Scutica cilia and the descriptions for the Scutico Ciliates are the same as those for the primers capable of detecting the Scuticociliate.

상기 검출 방법 및 검출 키트는 스쿠티카섬모충에 감염될 수 있는 어류를 대상으로 할 수 있고, 바람직하게는 스쿠티카섬모충에 감염될 수 있는 양식 대상 어종일 수 있으며, 더욱 바람직하게는 병어, 넙치, 참돔, 돌돔, 농어, 조피볼락, 자주복 및 이들의 조합으로 이루어진 군에서 선택된 어느 하나 일 수 있다. The detection method and detection kit may target fish that may be infected with Scutica cilia, and preferably may be aquaculture target fish species that may be infected with Scutica cilia, and more preferably poultry, flounder, and red snapper. , Dolphin, sea bass, rockfish, self-propelled bokah, and may be any one selected from the group consisting of a combination thereof.

상기 스쿠티카섬모충 검출방법은 상기 스쿠티카섬모충 검출용 프라이머를 이용하여 중합효소연쇄반응(Polymerase Chain Reaction, PCR)으로 스쿠티카섬모충을 탐지하는 단계를 포함하는 것일 수 있다. The method for detecting the scutica cilia may include the step of detecting the scutica cilia by using a polymerase chain reaction (PCR) using the primer for detecting the scutica cilia.

상기 중합효소연쇄반응(Polymerase Chain Reaction, PCR)은 중합효소를 이용하여 표적 유전자에 특이적으로 결합하는 프라이머 쌍으로부터 표적 유전자를 증폭하는 방법이다. 상기 중합효소연쇄반응은 당업계에서 잘 알려진 방법으로 수행할 수 있고, 상업적으로 이용 가능한 키트를 이용할 수도 있다.The polymerase chain reaction (PCR) is a method of amplifying a target gene from a pair of primers that specifically bind to the target gene using a polymerase. The polymerase chain reaction may be performed by a method well known in the art, and a commercially available kit may be used.

상기 중합효소연쇄반응은 한 번에 하나의 표적 유전자만을 증폭하는 단일 중합효소연쇄반응과 한 번에 복수의 표적을 증폭하는 다중 중합효소연쇄반응(Multiplex Polymerase Chain Reaction)을 포함한다. 상기 다중 중합효소연쇄반응에서는 복수의 프라이머 쌍이 이용된다. The polymerase chain reaction includes a single polymerase chain reaction in which only one target gene is amplified at a time and a multiplex polymerase chain reaction in which a plurality of targets are amplified at a time. In the multiple polymerase chain reaction, a plurality of primer pairs are used.

상기 다중 중합효소연쇄반응으로 상기 스쿠티카섬모충 검출용 프라이머를 이용하여 스쿠티카섬모충을 탐지하는 경우 각 프라이머 쌍에 따라 증폭하여 생산하는 절편의 길이가 상이하므로, 2 종 이상의 병원성 스쿠티카섬모충을 동시에, 종을 구별하여 검출할 수 있다.In the case of detecting Scutica cilia using the primers for detecting Scutica cilia by the multiple polymerase chain reaction, the length of the fragments produced by amplification is different according to each primer pair, so that two or more kinds of pathogenic Scutica cilia are simultaneously, Species can be distinguished and detected.

상기 스쿠티카섬모충 검출방법의 일 예로, 검색 시료를 수득하는 단계, 상기 수득한 검색시료 및 상기 스쿠티카섬모충 검출용 프라이머를 이용하여 중합효소연쇄반응을 수행하는 단계 및 상기 중합효소연쇄반응의 증폭산물을 분석하여 스쿠티카섬모충을 탐지하는 단계를 포함하는 것 일 수 있다. As an example of the method for detecting the scutica ciliated worms, obtaining a search sample, performing a polymerase chain reaction using the obtained search sample and the primer for detecting the scutica cilia, and an amplification product of the polymerase chain reaction It may be to include the step of detecting the scutica cilia by analyzing.

본 발명의 일 실시예에서, 상기 검색 시료를 수득하는 단계는 어류로부터 스쿠티카섬모충을 분리해낸 뒤, 스쿠티카섬모충의 genomic DNA를 추출하는 방법 또는 어류의 특정 부위에 대하여 임의로 genomic DNA를 추출하는 방법으로 수행할 수 있다. 상기 방법으로 수득한 검색 시료는 중합효소연쇄반응에 사용되는 주형 DNA(PCR template DNA)로 사용될 수 있다. 상기 어류의 특정 부위는 일 예로, 아가미, 궤양소, 뇌, 근육 또는 내장기관 일 수 있으나, 이에 한정되는 것은 아니다.In one embodiment of the present invention, the step of obtaining the screening sample is a method of extracting genomic DNA of a Scutica cilia from a fish, or a method of arbitrarily extracting genomic DNA for a specific region of a fish. Can be done with The search sample obtained by the above method can be used as a template DNA (PCR template DNA) used in the polymerase chain reaction. The specific portion of the fish may be, for example, a gill, an ulcer, a brain, a muscle, or an internal organ, but is not limited thereto.

상기 주형 DNA로 사용되는 genomic DNA를 추출하는 방법은 통상의 DNA 추출법으로 수행할 수 있으며, 상기 DNA 추출법은 일 예로, 알카라인 추출법(Alkaline extraction method), 열수추출법, 컬럼(Column) 추출법 또는 페놀/클로로포름(Phenol/Chloroform) 추출법일 수 있으나, 이에 한정되는 것은 아니다.The method of extracting genomic DNA used as the template DNA can be performed by a conventional DNA extraction method, and the DNA extraction method is, for example, an alkaline extraction method, a hot water extraction method, a column extraction method, or a phenol/chloroform method. (Phenol/Chloroform) may be an extraction method, but is not limited thereto.

상기 중합효소연쇄반응을 수행하는 단계는 상기 검색 시료를 주형 DNA로 하고, 상기 스쿠티카섬모충 검출용 프라이머를 프라이머로 이용하여, DNA를 증폭하는 방법으로 수행할 수 있다. 상기 중합효소연쇄반응은 통상의 중합효소연쇄반응 일 수 있고, 일 예로 다중 중합효소연쇄반응 일 수 있다.The step of performing the polymerase chain reaction may be performed by amplifying DNA by using the search sample as a template DNA, and using the primer for detecting Scutica cilia as a primer. The polymerase chain reaction may be a conventional polymerase chain reaction, and for example, may be a multiple polymerase chain reaction.

상기 중합효소연쇄반응을 수행하는 단계에서 상기 프라이머는 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 7의 염기서열을 포함하는 프라이머 및 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍 및 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍으로 이루어진 것을 바람직하게 사용할 수 있다. In the step of performing the polymerase chain reaction, the primer is a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 5 and a primer comprising a nucleotide sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7, and And a primer pair consisting of a primer including the nucleotide sequence of SEQ ID NO: 8, a primer pair consisting of a primer including the nucleotide sequence of SEQ ID NO: 9, and a primer including the nucleotide sequence of SEQ ID NO: 10, and a nucleotide sequence of SEQ ID NO: 11 A primer pair consisting of a primer and a primer comprising the nucleotide sequence of SEQ ID NO: 12 may be preferably used.

상기 스쿠티카섬모충 검출방법에서 상기 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍 그리고 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍으로 이루어진 프라이머를 이용하여 다중 중합효소연쇄반응을 수행하는 경우 상기 각 프라이머 쌍마다 상이한 특정 길이의 절편을 생산하고, 상기 길이의 차이에 의하여 2 종 이상의 스쿠티카섬모충을 종을 구분하여 동시에 검출할 수 있게 되므로, 위해성이 높은 스쿠티카증의 감염 여부 및 상기 스쿠티카증의 감염 종의 종류를 신속하게 알 수 있게 한다.In the method for detecting Scutica cilia, a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 5 and a primer comprising a nucleotide sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7 and a base of SEQ ID NO: 8 A primer pair consisting of a primer comprising a sequence, a primer comprising a nucleotide sequence of SEQ ID NO: 9, and a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 10, and a primer comprising a nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12 When performing multiple polymerase chain reaction using a primer consisting of a primer pair consisting of a primer comprising the nucleotide sequence of, a fragment of a specific length different for each primer pair is produced, and two or more types of sculls are produced according to the difference in length. Since it is possible to detect the Tica cilia by classifying the species at the same time, it is possible to quickly know whether or not the high-risk scutticosis has been infected and the type of the infected species of the scuticosis.

상기 중합효소연쇄반응의 반응조건은 상기 중합효소연쇄반응의 종류, 중합효소연쇄반응용 기기의 종류 및 프라이머의 종류에 따라 통상의 반응조건을 선택하거나 적절하게 일부 변형된 조건을 선택될 수 있다.The reaction conditions for the polymerase chain reaction may be selected from conventional reaction conditions or appropriately modified conditions depending on the type of the polymerase chain reaction, the type of equipment for the polymerase chain reaction, and the type of primer.

상기 중합효소연쇄반응의 반응조건의 일 예로 94 ℃에서 2분 동안 초기변성(pre-denaturation)하고, 증폭과정을 94 ℃에서 30초, 50 ℃에서 30초, 그리고 72 ℃에서 40초 동안 실시하고 최종 연장(final extension)을 72 ℃에서 5분 동안 실시 하는 조건으로 할 수 있으나, 본 발명이 상기 조건에 한정되는 것은 아니다.As an example of the reaction conditions of the polymerase chain reaction, pre-denaturation was performed at 94°C for 2 minutes, and the amplification process was performed at 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 40 seconds. The final extension may be performed at 72° C. for 5 minutes, but the present invention is not limited to the above conditions.

상기 중합효소연쇄반응의 증폭산물을 분석하여 스쿠티카섬모충을 탐지하는 단계는 상기 중합효소연쇄반응의 결과물, 바람직하게는 증폭된 DNA 산물의 크기를 확인하거나 상기 증폭된 DNA 산물이 특정 서열을 가지고 있는 것인지 확인하는 방법으로 수행할 수 있다. The step of analyzing the amplification product of the polymerase chain reaction to detect the Scutica cilia is a result of the polymerase chain reaction, preferably confirming the size of the amplified DNA product, or in which the amplified DNA product has a specific sequence. This can be done by checking if it is.

일 예로 해당 프라이머와 검출 대상 스쿠티카섬모충의 유전자를 이용하여 DNA를 증폭할 경우 예상되는 DNA 절편의 크기를 중합효소연쇄반응에서 증폭된 DNA 산물의 크기와 비교하여 확인하거나, 해당 프라이머와 검출 대상 스쿠티카섬모충의 유전자를 이용하여 DNA를 증폭할 경우 예상되는 DNA의 폴리뉴클레오티드 서열을 중합효소연쇄반응에서 증폭된 DNA 산물의 폴리뉴클레오티드 서열과 비교하는 방법으로 수행할 수 있다. 상기 증폭된 DNA 산물의 크기확인은 상기 증폭된 DNA 산물을 전기영동하여 수행할 수 있다.For example, when DNA amplification is performed using the primer and the gene of the target Scutica cilia, the size of the expected DNA fragment is compared with the size of the DNA product amplified in the polymerase chain reaction, or In the case of amplifying DNA using the gene of Tikkacilidae, it can be performed by comparing the polynucleotide sequence of the expected DNA with the polynucleotide sequence of the DNA product amplified in the polymerase chain reaction. Checking the size of the amplified DNA product may be performed by electrophoresis of the amplified DNA product.

상기 예상되는 DNA 절편의 크기는 상기 스쿠티카섬모충이 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus)인 경우 예상되는 DNA 증폭산물의 크기는 341bp, 상기 스쿠티카섬모충이 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus)인 경우 예상되는 DNA 증폭산물의 크기는 229bp, 상기 스쿠티카섬모충이 유로네마 마리넘(Uronema marinum)인 경우 예상되는 DNA 증폭산물의 크기는 285bp, 그리고 상기 스쿠티카섬모충이 미아미엔시스 아비더스(Miamiensis avidus)인 경우 예상되는 DNA 증폭산물의 크기는 422bp일 수 있다.The expected size of the DNA fragment is 341 bp when the Scutica ciliated caterpillar is Pseudocohnilembus longisetus (Pseudocohnilembus longisetus), the size of the expected DNA amplification product is 341 bp, and the Scutica ciliated caterpillar is Pseudocohnilembus Pseudocohnilembus. persalinus ), the expected size of the DNA amplification product is 229 bp, the size of the expected DNA amplification product is 285 bp when the Scutica ciliaryworm is Uronema marinum, and the Scutica ciliaryworm is Miamiensis Avidus In the case of ( Miamiensis avidus ), the size of the expected DNA amplification product may be 422bp.

상기 스쿠티카섬모충 검출키트는 상기 스쿠티카섬모충(scuticociliate) 검출용 프라이머, 반응완충액, dNTP 및 Taq DNA 중합효소를 포함하는 것 일 수 있다.The kit for detecting Scuticociliate may include a primer for detecting scuticociliate, a reaction buffer, dNTP and Taq DNA polymerase.

본 발명의 스쿠티카섬모충 검출키트는 상기 스쿠티카섬모충 검출용 프라이머 및 중합효소연쇄반응을 이용한 미생물 검출키트의 통상적인 구성성분을 포함하는 것일 수 있다. The scutica ciliaryworm detection kit of the present invention may include the conventional components of the primer for detecting the scutica cilia and a microorganism detection kit using a polymerase chain reaction.

상기 검출 키트의 일 예로, 상기 스쿠티카검출용 프라이머는 상기 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍, 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍 및 이들의 조합으로 이루어진 군에서 선택된 어느 하나, Taq DNA 중합효소(polymerase)을 포함하는 2X PCR Master Mix; 및 주형 DNA 즉, 어류로부터 분리된 스쿠티카섬모충의 genomic DNA 또는 어류의 특정 부위의 genomic DNA인 시료 DNA를 포함하는 것일 수 있다. 또한, 상기 중합효소연쇄반응은 통상의 중합효소연쇄반응용 기기를 사용하여 실시할 수 있으며, 일 예로 열 블록 중합효소연쇄반응(Thermal Block PCR)용 기기 또는 마이크로 중합효소연쇄반응(Micro PCR)용 기기 등 일 수 있으나, 이에 한정되는 것은 아니다.As an example of the detection kit, the primer for detecting scutica is a primer pair consisting of a primer including a nucleotide sequence of SEQ ID NO: 5 and a primer including a nucleotide sequence of SEQ ID NO: 6, and a nucleotide sequence of SEQ ID NO: 7 A primer pair consisting of a primer and a primer comprising a nucleotide sequence of SEQ ID NO: 8, a primer pair consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 9 and a primer comprising a nucleotide sequence of SEQ ID NO: 10, a nucleotide sequence of SEQ ID NO: 11 2X PCR Master Mix containing any one selected from the group consisting of a primer pair and a combination thereof consisting of a primer comprising a primer and a primer comprising the nucleotide sequence of SEQ ID NO: 12, Taq DNA polymerase; And template DNA, that is, genomic DNA of Scutica cilia isolated from fish or sample DNA, which is genomic DNA of a specific portion of fish. In addition, the polymerase chain reaction can be carried out using a conventional polymerase chain reaction device, for example, a thermal block polymerase chain reaction device or a micro polymerase chain reaction device (Micro PCR). It may be a device or the like, but is not limited thereto.

상기 중합효소연쇄반응용 혼합물(Mixture)은 상기 중합효소연쇄반응용 기기에 따라 적절한 조성으로 제조될 수 있다. 상기 혼합물의 일 예로, 각 프라이머 쌍 5 pmol, LA Taq 중합효소(Takara) 2.5 U, 염화마그네슘 2.5 mM 및 4 ㎕ dNTPs에 주형 DNA 즉, 유전체 DNA 각 12.5 ng을 포함하는 조성으로 제조될 수 있으나, 이에 한정되는 것은 아니다.
The polymerase chain reaction mixture (Mixture) may be prepared in an appropriate composition according to the polymerase chain reaction device. As an example of the mixture, each primer pair 5 pmol, LA Taq Polymerase (Takara) 2.5 U, magnesium chloride 2.5 mM, and 4 µl dNTPs may be prepared in a composition containing 12.5 ng each of template DNA, that is, genomic DNA, but is not limited thereto.

본 발명은 스쿠티카 목에 속하는 4종의 스쿠티카섬모충을 신속하고 정확하게 검출하기 위한 것으로, 해양생물체로부터 분리된 스쿠티카섬모충의 cox1 유전자의 염기서열을 분석하고, 상기 염기서열을 이용하여 신속하게 각 스쿠티카섬모충의 종을 구분하여 검출할 수 있는 프라이머를 제작하였고, 상기 프라이머를 이용하여 다중 중합효소연쇄반응을 통해 신속하게 2 종 이상의 스쿠티카섬모충의 종을 구분하여 검출할 수 있다.The present invention is for rapidly and accurately detecting four types of Scutica ciliated worms belonging to the order Scutica, by analyzing the nucleotide sequence of the cox1 gene of Scutica ciliated isolated from marine organisms, and quickly using the nucleotide sequence. A primer capable of distinguishing and detecting the species of Scutica cilia was prepared, and using the above primers, two or more species of Scutica cilia can be quickly identified and detected through a multiple polymerase chain reaction.

도 1은 4 개 종의 스쿠티카섬모충 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus , GQ500580), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus , GQ500579), 유로네마 마리넘(Uronema marinum , GQ500578) 및 미아미엔시스 아비더스(Miamiensis avidus, GQ855300)의 cox1 유전자의 뉴클레오티드 염기서열 얼라인을 나타내는 그림이다. 밑줄쳐진 염기서열은 일반적으로 사용되는 프라이머의 염기서열을 나타낸다. 검은색으로 하이라이트된 흰색 글씨의 염기서열이 유전자 다중증폭(multiplex PCR)에 사용된 8개의 종-특이적 프라이머 염기서열을 나타낸다.
도 2는 cox1 유전자의 계통수를 나타낸다. 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus)(GenBank GQ500580), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus)(GenBank GQ500579), 유로네마 마리넘(Uronema marinum)(GenBank GQ500578) 및 미아미엔시스 아비더스(Miamiensis avidus)(GenBank GQ855300) 종은 염기서열이 밝혀졌다. 각각의 마디의 수는 1000 유전정보에 대한 부트스트랩 퍼센테이지를 나타낸다.
도 3은 새롭게 개발된 프라이머를 이용하여 스쿠티카섬모충 종을 구분하여 동정하는 유전자 다중증폭(multiplex PCR)의 결과를 나타내는 사진이다. 레인 1 및 레인 7은 분자량 마커를 나타내고, 레인 2는 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus)의 종-특이적 절편, 레인 3은 유로네마 마리넘(Uronema marinum) 의 종-특이적 절편, 레인 4는 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus) 의 종-특이적 절편, 레인 5는 미아미엔시스 아비더스(Miamiensis avidus)의 종-특이적 절편을 나타낸다. 레인 6은 혼합된 샘플에서 4개 종의 동시에 감지한 것을 나타낸다.Fig. 1 shows four species of Scutica ciliated Pseudoconylembus longisetters (Pseudocohnilembus). longisetus , GQ500580), Pseudocohnilembus persalinus , GQ500579), Euronema Marinem marinum , GQ500578) and This figure shows the alignment of the nucleotide sequence of the cox1 gene of Miamiensis avidus (GQ855300). The underlined nucleotide sequence represents the nucleotide sequence of a commonly used primer. The nucleotide sequences in white letters highlighted in black represent the eight species-specific primer sequences used in gene multiplex PCR.
Figure 2 is cox1 Represents the genealogy tree. Pseudocohnilembus longisetus ) (GenBank GQ500580), Pseudocohnilembus persalinus ) (GenBank GQ500579), Uronema marinum (GenBank GQ500578) and The base sequence of the species Miamiensis avidus (GenBank GQ855300) was found. The number of each node represents the bootstrap percentage for 1000 genetic information.
3 is a photograph showing the results of gene multiplex PCR to identify and differentiate Scutica ciliated species using newly developed primers. Lanes 1 and 7 represent molecular weight markers, lane 2 is a species-specific fragment of Pseudocohnilembus persalinus , lane 3 is Euronema marinum (Uronema). marinum ) Species-specific fragment of, lane 4 is Pseudocohnilembus longisetus ) The species-specific fragment of, lane 5 represents the species-specific fragment of Miamiensis avidus. Lane 6 shows the simultaneous detection of 4 species in the mixed sample.

하기 실시예는 본발명을 예시하기 위한 것일 뿐 본발명이 하기 실시예에 한정되는 것은 아니다
The following examples are for illustrative purposes only, and the present invention is not limited to the following examples.

실시예1Example 1 . . 섬모충의Ciliated 분리 및 기내 배양 Isolation and in-flight culture

2002년부터 2005년 까지 대한민국 제주도의 어류 양식장에서 양식되는 넙치와 볼락 중에서 스쿠티카증에 감염된 넙치와 볼락의 뇌와 아가미 조직으로부터 스쿠티카섬모충(Scuticociliates)을 분리하였다. 보다 구체적으로 볼락(S. schlegelii)으로부터 균주 1을 분리하고, 넙치(P. olivaceus)로부터 균주 2 내지 균주 4를 분리하여, 총 4개 종의 섬모충을 분리하였다. 분리된 섬모충은 1% 효모 추출물(yeast extract)과 1% 프로테오스 펩톤(proteose peptone)을 포함하는 살균된 해수에서 15 ℃로 초대배양(primary culture)을 하였다. 5일 배양 후, 96-well 조직-배양 플레이트의 각 웰(well)에 싱글(single) 섬모충만 남을 때까지 상기 초대 배양물을 연속 희석하여 섬모충을 여러 번 복제하고, 상기 복제된 섬모충을 두 가지 종류의 배지1 및 배지2 에서 각각 배양하였다. From 2002 to 2005, Scuticociliates were isolated from the brain and gill tissues of flounder and rockfish infected with scutikaosis among flounder and rockfish farmed in a fish farm in Jeju Island, Korea. More specifically, strain 1 was isolated from rockfish (S. schlegelii ), and strains 2 to 4 were isolated from flounder (P. olivaceus ), and a total of 4 species of ciliated worms were isolated. The isolated ciliated worms were primary cultured at 15°C in sterilized seawater containing 1% yeast extract and 1% proteose peptone. After 5 days of incubation, the primary culture was serially diluted until only a single ciliate remained in each well of a 96-well tissue-culture plate to replicate the ciliated worms several times, and the replicated ciliated worms were used as two types. They were cultured in medium 1 and medium 2, respectively.

상기 배지1은 Millport S로, 증류수 100 ml 당 1.5g NaCl, 0.25g MgCl2 ·6H2O, 0.04g KCl, 0.012g CaSO4 그리고 비브리오 속(Vibrio sp.)의 2% brain heart infusion broth(final concentration of 0.5%)으로 구성하였다.The medium 1 is Millport S, 1.5g NaCl, 0.25g MgCl 2 · 6H 2 O, 0.04g KCl, 0.012g CaSO 4 per 100 ml of distilled water And it was composed of 2% brain heart infusion broth (final concentration of 0.5%) of Vibrio sp.

또한 상기 배지 2는 Eagle's MEM로 10% 소태아혈청(fetal bovine serum, FBS), 항생제로 암피실린(ampicillin) 100 IU/ml와 100 mg/ml 스트렙토마이신(streptomycin) 그리고 왕연어 배아-214 세포(Chinook salmon embryo-214, CHSE-214)로 구성하였다.
In addition, the medium 2 is 10% fetal bovine serum (FBS) with Eagle's MEM, 100 IU/ml of ampicillin and 100 mg/ml of streptomycin as an antibiotic, and salmon embryo-214 cells (Chinook salmon embryo-214, CHSE-214).

실시예2Example 2 . 분리된 . Separate 섬모충의Ciliated 동정 - 형태학적 특성 Identification-Morphological Characteristics

상기에서 분리된 4개 종의 섬모충을 동정하기 위하여 형태학적 특성을 분석하였다. 상기 분석은 통상적으로 사용되는 질산은 함침법(silver nitrate impregnation method)과 탄산은 함침법(silver carbonate impregnation method)을 사용하여 실시하였다.Morphological characteristics were analyzed to identify the four species of ciliated worms isolated above. The analysis was performed using a commonly used silver nitrate impregnation method and a silver carbonate impregnation method.

보다 구체적으로 질산은 함침법과 관련하여, 섬모충류(ciliates)를 2000 rpm 속도로 5분 동안 원심 분리하여 농축하고, Champy's fixative로 고정한 후에 DaFano's fixative로 세척하였다. 글라스 슬라이드는(glass slide)는 슬라이드 워머(slide warmer) 위에서 35 내지 45 ℃로 데운 후, 상기 섬모충 농축물 한 방울과 녹인 젤라틴을 데워진 슬라이드 위에 떨어뜨렸다. 상기 슬라이드 상의 액체상태의 시료를 냉각하여 고체화한 후, 증류수로 헹구었다. 슬라이드를 차가운 1% 질산은 용액에 담가 30분 동안 인큐베이트 하고, 그 다음 차가운 증류수로 세척한 후, 슬라이드의 시료가 금색 또는 갈색으로 변할 때까지 10 내지 15 분 동안 자외선(<254 nm)을 조사하였다. 그 후, 상기 시료를 30%, 70% 및 100% 알코올로 탈수 시키고, 자일렌(xylene)으로 제거하고 고정하였다.More specifically, with respect to the silver nitrate impregnation method, ciliates were concentrated by centrifugation at 2000 rpm for 5 minutes, fixed with Champy's fixative, and washed with DaFano's fixative. The glass slide was heated to 35 to 45° C. on a slide warmer, and then a drop of the ciliated worms concentrate and the melted gelatin were dropped onto the heated slide. The liquid sample on the slide was cooled to solidify, and then rinsed with distilled water. The slide was immersed in a cold 1% silver nitrate solution and incubated for 30 minutes, then washed with cold distilled water, and then irradiated with ultraviolet (<254 nm) for 10 to 15 minutes until the sample on the slide turned gold or brown. . Thereafter, the samples were dehydrated with 30%, 70% and 100% alcohol, removed with xylene, and fixed.

또 탄산은 함침법과 관련하여, 상기 섬모충 농축물을 10% 포르말린(formalin)으로 고정하고, Fernandez-Galiano's 용액에서 염색하였다. 상기 염색은 60 ℃로 예열 된 핫플레이트 위에서 상기 용액이 황금갈색으로 변할 때까지 5분 동안 실시하였다. 5% 싸이오황산나트륨(Na2S2O3)을 가하여 상기 반응을 종결시켰다.In addition, with respect to the silver carbonate impregnation method, the ciliated worms concentrate was fixed with 10% formalin and stained in Fernandez-Galiano's solution. The dyeing was performed on a hot plate preheated to 60° C. for 5 minutes until the solution turned golden brown. The reaction was terminated by adding 5% sodium thiosulfate (Na 2 S 2 O 3 ).

상기 각각의 방법에 의하여 염색된 섬모충을 광학현미경, 접안 마이크로미터와 이미지-분석 소프트웨어(Image-Pro Plus 3.0, USA)를 이용하여 형태학적 특성을 측정 및 분석하였다.Ciliates stained by each of the above methods were measured and analyzed for morphological characteristics using an optical microscope, an eyepiece micrometer, and image-analysis software (Image-Pro Plus 3.0, USA).

상기 분리된 섬모충의 형태학적 분석 결과는 하기 표 2에 나타낸 바와 같다. 상기 형태학적 특성을 공지의 균주와 비교하여 본 결과, 균주 1은 Thompson(1965)과 Whang et al.(2011)에 공지된 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus)와 유사하여 상기 균주로 추정하였고, 균주 2는 Evans & Corliss(1964), Song(2000) 및 Whang et al.(2011)에 공지된 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus)와 유사한 특성을 나타태어 상기 균주로 추정하였다. 균주 3은 Thompson(1964), Cheung et al.(1980) 및 Ma et al.(2004)에 공지된 유로네마 마리넘(Uronema marinum)와 유사하여 상기 균주로 추정하였고, 균주 4는 Thompson & Moewus(1964), Dragesco et al.(1995) 및 Jung et al.(2007)에 공지된 미아미엔시스 아비더스(Miamiensis avidus)와 유사한 특성을 나타내어 상기 균주로 추정하였다.The morphological analysis results of the isolated ciliated worms are shown in Table 2 below. As a result of comparing the morphological characteristics with known strains, strain 1 is Thompson (1965) and Whang et al . (2011) was similar to Pseudocohnilembus longisetus , and was estimated to be the strain, and strain 2 was Evans & Corliss (1964), Song (2000) and Whang et al. al . (2011) showed similar characteristics to Pseudocohnilembus persalinus , and was assumed to be the strain. Strain 3 is Thompson (1964), Cheung et al . (1980) and Ma et al . (2004), which was similar to Uronema marinum and was estimated to be the strain, and strain 4 was Thompson & Moewus (1964), Dragesco et al. al . (1995) and Jung et al . (2007) Miamiensis avidus (Miamiensis avidus) showed similar characteristics and was estimated to be the strain.

특성characteristic 균주 1Strain 1 균주 2Strain 2 균주 3Strain 3 균주 4Strain 4 신체용적Body volume 길이Length 34.4 (30.6-39.2)±2.07 (n=35)34.4 (30.6-39.2)±2.07 (n=35) 26.6 (21.8- 32.4)±2.40 (n=32)26.6 (21.8- 32.4)±2.40 (n=32) 26.2 (19.5-32.8)±2.64 (n=40)26.2 (19.5-32.8)±2.64 (n=40) 37.9 (32.7-43.9) ±2.67 (n=39)37.9 (32.7-43.9) ±2.67 (n=39) 너비width 12.7(10.8-14.9)±0.92 (n=35)12.7(10.8-14.9)±0.92 (n=35) 13.8 (11.2-16.1)±1.34 (n=32)13.8 (11.2-16.1)±1.34 (n=32) 12.2 (8.8-16.3)±1.30 (n=40)12.2 (8.8-16.3)±1.30 (n=40) 24.4 (19.6-28.8)±2.35 (n=39)24.4 (19.6-28.8)±2.35 (n=39) Somatic ciliatureSomatic ciliature Kinety 개수Kinety count 9 (9-10)±0.33 (n=30)9 (9-10)±0.33 (n=30) 10 (9-10)±0.18 (n=30)10 (9-10)±0.18 (n=30) 12 (11-13)±0.64 (n=25)12 (11-13)±0.64 (n=25) 13 (12-14)±0.61 (n=34)13 (12-14)±0.61 (n=34) caudal cilium 길이caudal cilium length 14.3 (13-15.5)±0.79 (n=10)14.3 (13-15.5)±0.79 (n=10) 12 (11.1-13.6)±0.77 (n=13)12 (11.1-13.6)±0.77 (n=13) -- 9.2 (6.5-11.4)±1.28 (n=30)9.2 (6.5-11.4)±1.28 (n=30) Oral ciliature
Oral ciliature
 M11 )의 길이Length of M1 1 ) 8.2 (6.8-9.2)±0.58 (n=31)8.2 (6.8-9.2)±0.58 (n=31) 7.6 (6.6-8.7)±0.63 (n=28)7.6 (6.6-8.7)±0.63 (n=28) 2.0 (1.4-2.9)±0.37 (n=29)2.0 (1.4-2.9)±0.37 (n=29) 3.3 (2.8-4)±0.27 (n=30)3.3 (2.8-4)±0.27 (n=30) M2M2 1One )) 의 길이Length of 13.9 (11.7-16.1)±1.19 (n=31)13.9 (11.7-16.1)±1.19 (n=31) 12 (10.5-15.1)±0.85 (n=27)12 (10.5-15.1)±0.85 (n=27) 1.7 (1.3-2.2)±0.24 (n=27)1.7 (1.3-2.2)±0.24 (n=27) 3.3 (2.8-3.9)±0.28 (n=30)3.3 (2.8-3.9)±0.28 (n=30) M3M3 1One )) 의 길이Length of -- 0.5 (0.4-0.7)±0.12 (n=18)0.5 (0.4-0.7)±0.12 (n=18) 1.4 (0.9-1.7)±0.20 (n=20)1.4 (0.9-1.7)±0.20 (n=20) 0.8 (0.5-1.2)±0.19 (n=30)0.8 (0.5-1.2)±0.19 (n=30) 구연막(PM)Oral membrane (PM) 22 )) 7.6 (6.2-9.5)±0.77 (n=25)7.6 (6.2-9.5)±0.77 (n=25) 6 (4.7-7.8)±0.78 (n=30)6 (4.7-7.8)±0.78 (n=30) 7.3 (5.7-8.7)±0.67 (n=30)7.3 (5.7-8.7)±0.67 (n=30) 4.9 (4.1-6.1)±0.50 (n=29) (4.9 (4.1-6.1)±0.50 (n=29) ( PM1PM1 )) 5.8 (4-7.4)±0.79 (n=27) (5.8 (4-7.4)±0.79 (n=27) ( PM2PM2 )) buccal field 길이3) buccal field length 3) 17.6 (15.6-19.9)±1.16 (n=22)17.6 (15.6-19.9)±1.16 (n=22) 15.8 (14.2-16.8)±0.70 (n=18)15.8 (14.2-16.8)±0.70 (n=18) 17.9(14.6-20.7)±1.49 (n=32)17.9(14.6-20.7)±1.49 (n=32) 16.5 (14.6-18.5)±1.10 (n=34)16.5 (14.6-18.5)±1.10 (n=34) 수축액포(CVP)4) Contraction liquid bubble (CVP) 4) 개수Count 22 1 (1-2)1 (1-2) 1One 1One 위치location EndEnd ofof kinetykinety 3 & 4 3 & 4 EndEnd ofof kinetykinety 3 (kinety 3 & 4) 3 (kinety 3 & 4) EndEnd ofof kinetykinety 2 2 EndEnd ofof KinetyKinety 2 2 지역area Jeju, KoreaJeju, Korea Jeju, KoreaJeju, Korea Jeju, KoreaJeju, Korea Jeju, KoreaJeju, Korea

1) M1,2,3: 막판(membranelles) 1, 2, 3 1) M1,2,3: Membranelles 1, 2, 3

2) PM: 구연막(paroral membrane)2) PM: paroral membrane

3) buccal field 길이: 구연막의 apex에서 posterior end까지의 거리.3) buccal field length: distance from apex to posterior end of the oral cavity

4) CVP: 수축액포(Contractile vacuole pores)
4) CVP: Contractile vacuole pores

실시예3Example 3 . 분리된 . Separate 섬모충의Ciliated 동정 - Sympathy - SSUSSU rDNArDNA 분석 analysis

상기에서 분리된 각 섬모충에 대한 형태학적 동정이 맞는지 확인하기 위하여 SSU rDNA 염기서열 분석을 수행하였다. 배양된 섬모충(ciliates)을 원심 분리(1000×g, 10 분)하고, 살균된 해수로 세척하였다. DNeasy Blood & Tissue kit(Qiagen, Dusseldorf, Germany)를 이용하여 유전체 DNA(Genomic DNA)를 추출하고, SmartSpec Plus Spectrophotometer(Bio-Rad, Hercules, CA, USA)로 총 유전체 DNA의 농도를 측정하였다. SSU rDNA를 증폭하기 위하여, GenBank에 등록된 스쿠티카섬모충의 SSU rDNA 염기서열(accession number Z22881 Uronema marinum, AY103190 Uronema elegans 및 U83128 Uronema acuminata)을 기초로 프라이머를 디자인하였다(표 3). PCR은 각 프라이머 20 pmol, Ex Taq 중합효소(Takara, Shiga, Japan) 2.5 U 및 유전체 DNA 50 ng을 포함하는 50 ㎕ PCR 반응 혼합물에서 실시하였다. Takara PCR Thermal cycler(TP650)를 사용하여 95 ℃에서 5분 동안 초기변성(pre-denaturation)하고, 다음으로 증폭과정(amplication)을 95 ℃에서 30초, 55 ℃ 에서 30초 그리고 72 ℃에서 2분 동안 수행하고 상기 과정을 30번 반복하였다. 상기 반응의 반응물을 1% 아가로스에서 전기영동으로 분석하고, AccuprepTM Gel 정제 키트(Bioneer, Daejeon, Korea)를 이용해서 정제하였다. 부분적인 염기서열 분석은 정방향과 역방향으로 ABI 377 DNA sequencer(Applied Biosystems by Life Technologies, USA) 장비로 분석하였고, 키트는 standard ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit를 사용하였으며, 그 방법은 상기 키트 및 장비의 사용방법에 따랐다. 상기 분석을 통하여 새롭게 서열이 밝혀진SSU rDNA 유전자를 GenBank/EMBL 데이터베이스의 염기서열과 비교하였다. 보다 구체적으로은 P, persalinus SSU rDNA(AY835669), 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus) SSU rDNA(FJ899594), 유로네마 마리넘(Uronema marinum) SSU rDNA(DQ867072) 및 미아미엔시스 아비더스(Miamiensis avidus) SSU rDNA(AY550080)와 비교하였다.SSU rDNA sequencing was performed to confirm whether the morphological identification of each ciliated worms isolated above was correct. The cultured ciliates were centrifuged (1000×g, 10 minutes) and washed with sterilized seawater. Genomic DNA was extracted using a DNeasy Blood & Tissue kit (Qiagen, Dusseldorf, Germany), and the concentration of total genomic DNA was measured with a SmartSpec Plus Spectrophotometer (Bio-Rad, Hercules, CA, USA). In order to amplify SSU rDNA, the SSU rDNA nucleotide sequence (accession number Z22881 Uronema) of Scutica cilia registered in GenBank marinum , AY103190 Uronema eleg ans and U83128 Uronema acuminata ) was designed based on the primer (Table 3). PCR is 20 pmol of each primer, Ex Taq It was carried out in a 50 μl PCR reaction mixture containing 2.5 U of polymerase (Takara, Shiga, Japan) and 50 ng of genomic DNA. Pre-denaturation at 95 ℃ for 5 minutes using a Takara PCR Thermal cycler (TP650), and then amplification at 95 ℃ 30 seconds, 55 ℃ 30 seconds and 72 ℃ 2 minutes. And the process was repeated 30 times. The reaction product of the above reaction was analyzed by electrophoresis in 1% agarose , and purified using Accuprep TM Gel purification kit (Bioneer, Daejeon, Korea). Partial sequencing was performed in the forward and reverse directions with an ABI 377 DNA sequencer (Applied Biosystems by Life Technologies, USA) equipment, and the kit used the standard ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit, and the method was the kit. And according to the method of use of the equipment. The SSU rDNA gene whose sequence was newly identified through the above analysis was compared with the nucleotide sequence of the GenBank/EMBL database. More specifically, P, persalinus SSU rDNA (AY835669), Pseudocohnilembus longisetus ) SSU rDNA (FJ899594), Uronema marinum SSU rDNA (DQ867072) and Miamiensis avidus (Miamiensis avidus ) SSU rDNA (AY550080).

프라이머 염기서열(5'-3')Primer sequence (5'-3') 정방향(SSUF)Forward (SSUF) 5'-AACCTGGTTGATCCTGCCAG-3'5'-AACCTGGTTGATCCTGCCAG-3' 역방향(SSUR)Reverse (SSUR) 5'-GATCYWTCTGCAGGTTCACCTAC-3'5'-GATCYWTCTGCAGGTTCACCTAC-3'

상기 분리된 섬모충 각각은 균주 1이 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus , FJ899594), 균주 2가 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus , AY835669), 균주 3이 유로네마 마리넘(Uronema marinum, DQ867072) 및 균주 4가 미아미엔시스 아비더스(Miamiensis avidus , AY550080)의 보관된 염기서열에 대하여 100%, 99.8%, 100% 그리고 100% 상동성을 보였다. Each of the isolated ciliated worms was strain 1 Pseudocohnilembus longisetters (Pseudocohnilembus longisetus , FJ899594), strain 2 Pseudocohnilembus Pseudocohnilembus persalinus , AY835669), strain 3 is Uronema marinum ( DQ867072) and strain 4 is Miamiensis avidus (Miamiensis) avidus , AY550080) showed 100%, 99.8%, 100% and 100% homology to the stored nucleotide sequence.

따라서 상기에서 분리된 섬모충은 형태학적 분석의 결과와 동일하게, 균주 1이 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 균주 2가 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 균주 3이 유로네마 마리넘(Uronema marinum) 그리고 균주 4가 미아미엔시스 아비더스(Miamiensis avidus) 임을 확인 하였다.
Therefore, the ciliated worms isolated above were the same as the results of morphological analysis, and strain 1 was Pseudocohnilembus longisetters (Pseudocohnilembus). longisetus ), Pseudocohnilembus strain bivalent Pseudocohnilembus persalinus ), strain 3 is Uronema marinum (Uronema marinum ) and the strain tetravalent Miamiensis avidus (Miamiensis avidus ).

실시예4Example 4 . . cox1cox1 유전자의 Genetic PCRPCR 및 염기서열 분석 And sequencing

테트라히메나 테모필라(Tetrahymena thermophila , GenBank accession numbers AF396436)와 짚신벌레(Paramecium aurelia , NC_001324)의 cox1 유전자의 얼라인 시퀀스를 이용하여 하기의 프라이머1 내지 2를 디자인 하였다(표 4). 디제너레이트 PCR 프라이머 MOU08-121과 MOU08-122를 디자인 하는데 상응하는 뉴클레오티드 포지션을 이용하였다(표 4). PCR반응은 각 프라이머 10 pmol, LA Taq 중합효소(Takara) 0.5 U 및 유전체 DNA 50 ng을 포함하는 50 ㎕ PCR 반응 혼합물에서 실시하였다. PCR은 94 ℃에서 2분 동안 초기변성(pre-denaturation)하고, 다음으로 증폭과정을 94 ℃에서 30초, 50 ℃ 에서 30초, 그리고 72 ℃에서 2분 동안 수행하고 상기 단계를 30번 반복하였다. 증폭 산물은 1% 아가로스에서 전기영동으로 분석하였다. Tetrahymena thermophila , GenBank accession numbers AF396436) and Paramecium aurelia , NC_001324), the following primers 1 to 2 were designed using the alignment sequence of the cox1 gene (Table 4). The corresponding nucleotide positions were used to design degenerate PCR primers MOU08-121 and MOU08-122 (Table 4). PCR reaction is 10 pmol each primer, LA Taq It was carried out in a 50 μl PCR reaction mixture containing 0.5 U of polymerase (Takara) and 50 ng of genomic DNA. PCR was pre-denatured at 94° C. for 2 minutes, and then the amplification process was performed at 94° C. for 30 seconds, 50° C. for 30 seconds, and 72° C. for 2 minutes, and the above steps were repeated 30 times. . The amplification product was analyzed by electrophoresis on 1% agarose.

프라이머 1 내지 2를 이용하여 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum) 및 미아미엔시스 아비더스(Miamiensis avidus)로 부터 길이가 945bp로 예상되는 강한 PCR signal을 생산했으나, 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus)로부터는 생산하지 못했다. 따라서 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus)를 포함하는 상기 4개 모든 종으로부터 PCR 산물을 생산할 수 있는 새로운 프라이머 세트를 만들 필요가 있으므로, 3개 종의 PCR 산물을 제거하고 Accuprep Gel 정제 키트를 이용하여 정제하였다. 정제된 산물을 각각 pGEM®-T Easy 벡터(Promega, Madison, WI, USA)에 삽입하고, 이를 이용하여Escherichia coli DH5 cells (Stratagene/Agilent, Inc., USA)를 전환하였다. AccuprepTM 플라스미드 추출 키트를 이용하여 알칼라인 라이시스법(alkaline lysis method)을 이용하여 재조합 플라스미드를 준비하고, 일반적인 프라이머 M13F-pUC(-40) 및 M13R-pUC(-40)를 사용하여 부분적인 염기서열을 확인 하였다. 상기에서 확인된 염기서열에 근거하여, 하기의 프라이머 3(OX09-26) 내지 4(OX09-27)를 디자인 하였다. OX09-26 및 OX09-27는 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus) 및 유로네마 마리넘(Uronema marinum)로 부터 716bp 그리고 미아미엔시스 아비더스(Miamiensis avidus)로 부터 719bp 길이의 미토콘드리아 cox1 유전자 절편을 증폭시킬 수 있을 것으로 예상하였다(표 4). PCR 조건은 94 ℃에서 2분 동안 초기변성(pre-denaturation)하고, 다음으로 증폭과정을 94 ℃에서 30초, 48 ℃에서 30초 그리고 72 ℃에서 1분 동안 실시하고 상기 과정을 30번 반복하였고, 72 ℃에서 5분 동안 최종 연장(final extension)을 실시 하였다. cox1과 SSU rDNA 염기서열은 ClustalW web-based query program(v1.80)을 이용하여 얼라인 하였다. Kimura two-parameter (K2P) distance model을 이용하여 cox1과 SSU rDNA 염기서열에 대한 염기서열 차이를 측정하였다. MEGA(v4)를 이용한 sequence evolution의 K2P모델로 측정된 cox1 염기서열의 추정 유전적 거리를 기초로 neighbor-joining(NJ) 계통수를 작성하였다. NJ 계통수에서 신뢰추정(confidence estimate)은 1000개 유전정보(replicates)의 부트스트랩 제너레이션(bootstrap generation)을 통해서 결정하였다. Pseudocohnilembus (Pseudocohnilembus) using primers 1 to 2 persalinus ), Euronema Marinem marinum ) And Miamiensis avidus (Miamiensis avidus) produced a strong PCR signal expected to be 945bp in length, but Pseudocohnilembus longisetus ). Therefore, since it is necessary to create a new primer set capable of producing PCR products from all four species, including Pseudocohnilembus longisetus, three species of PCR products are removed and the Accuprep Gel purification kit is used. It was purified using. Each purified product was inserted into pGEM ® -T Easy vector (Promega, Madison, WI, USA), and Escherichia coli DH5 cells (Stratagene/Agilent, Inc., USA) were converted. Accuprep TM Using a plasmid extraction kit, a recombinant plasmid was prepared using an alkaline lysis method, and a partial nucleotide sequence was confirmed using general primers M13F-pUC(-40) and M13R-pUC(-40). I did. Based on the nucleotide sequence identified above, the following primers 3 (OX09-26) to 4 (OX09-27) were designed. OX09-26 and OX09-27 are Pseudocohnilembus longisetus ), Pseudocohnilembus persalinus ) and It was expected to be able to amplify a mitochondrial cox1 gene fragment of 716 bp from Uronema marinum and 719 bp from Miamiensis avidus (Table 4). PCR conditions were pre-denaturation at 94°C for 2 minutes, and then the amplification process was performed at 94°C for 30 seconds, 48°C for 30 seconds and 72°C for 1 minute, and the above process was repeated 30 times. , Final extension was performed at 72° C. for 5 minutes. The cox1 and SSU rDNA sequences were aligned using the ClustalW web-based query program (v1.80). Using the Kimura two-parameter (K2P) distance model , the nucleotide sequence difference between cox1 and SSU rDNA nucleotide sequences was measured. Cox1 measured by K2P model of sequence evolution using MEGA (v4) The neighbor-joining (NJ) phylogenetic tree was created based on the estimated genetic distance of the sequence. Confidence estimates in the NJ tree were determined through bootstrap generation of 1000 replicates.

프라이머primer 위치location 염기서열 (5'-3')Base sequence (5'-3') 크기(bp)Size (bp) 1One MOU08-121MOU08-121 119 of T. thermophila cox1 119 of T. thermophila cox1 TCAGGAGCTGCMTTAGCHACYATGTCAGGAGCTGC M TTAGC H AC Y ATG 945945 22 MOU08-122MOU08-122 1143 of T. thermophila cox1 1143 of T. thermophila cox1 TARTATAGGATCMCCWCCATAAGCTA R TATAGGATC M CC W CCATAAGC 33 OX09-26OX09-26 278 of T. thermophila cox1 278 of T. thermophila cox1 GDTAYTTACAAGTWATTACYGCWCATGGG D TA Y TTACAAGT W ATTAC Y GC W CATGG 716,
M. avidus는 719716,
M. avidus is 719 44 OX09-27OX09-27 993 of T. thermophila cox1 993 of T. thermophila cox1 TAAAACYCTYCTATGYCTCATACCTAAAAC Y CTYCTATG Y CTCATACC

cox1-특이적 증폭 프라이머인 프라이머 3(OX09-26)과 프라이머 4(OX09-27)는 분리된 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum) 및 미아미엔시스 아비더스(Miamiensis avidus)로부터 길이 720bp이하의 단일 DNA 밴드를 생산하였다. 각 PCR 산물을 복제하고, 예상 분자량을 확인하기 위하여 클론의 PCR 스크리닝을 하고, 클론을 선발하여 서열을 밝혔다. The cox1 -specific amplification primers, Primer 3 (OX09-26) and Primer 4 (OX09-27), were separated from Pseudocohnilembus. longisetus ), Pseudocohnilembus persalinus ), Uronema marinum And A single DNA band of 720 bp or less in length was produced from Miamiensis avidus. Each PCR product was duplicated, PCR screening of the clone was performed to confirm the expected molecular weight, and the sequence was identified by selecting a clone.

슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus) 및 유로네마 마리넘(Uronema marinum)에서 얻어진 염기서열은 716bp(프라이머 52bp를 제외하고 정확하게 664bp) 이고(도 1), GenBank에 기탁하여 각각에 대한 기탁번호(accession numbers) GQ500580, GQ500579 및 GQ500578를 부여 받았다. Pseudocohnilembus longisetus ), Pseudocohnilembus persalinus ) and The nucleotide sequence obtained from Uronema marinum is 716 bp (exactly 664 bp excluding the primer 52 bp) (Fig. 1), and was deposited with GenBank to receive accession numbers GQ500580, GQ500579 and GQ500578 for each. .

미아미엔시스 아비더스(Miamiensis avidus)의 부분적인 cox1 염기서열은 719bp(프라이머 52bp를 제외하고 정확하게 667bp) 이고, GenBank에서 기탁번호 GQ855300를 부여받았다. 미아미엔시스 아비더스(Miamiensis avidus)의 cox1 염기서열은 공지된 염기서열(GenBank EU831221)과 99.7% 상동성을 보였다. Partial cox1 of Miamiensis avidus The nucleotide sequence was 719bp (exactly 667bp excluding primer 52bp), and was given the accession number GQ855300 from GenBank. Cox1 of Miamiensis avidus The nucleotide sequence showed 99.7% homology with the known nucleotide sequence (GenBank EU831221).

cox1 유전자 사이의 평균 염기서열 차이는 23.5% 였고, 범위는 18.8에서 27.5% 였다(표 4). 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum) 및 미아미엔시스 아비더스(Miamiensis avidus)의 cox1 유전자의 진화적 위치를 확인하기 위하여 계통발생수를 작성하여 도 2에 나타내었다.
The average nucleotide sequence difference between the cox1 genes was 23.5%, and the range was 18.8 to 27.5% (Table 4). Pseudocohnilembus longisetus ) , Pseudocohnilembus persalinus) , Euronema Marinem ( Uronema) marinum ) And Of Miamiensis avidus In order to confirm the evolutionary position of the cox1 gene, a phylogenetic tree was created and shown in FIG. 2.

실시예5Example 5 . 다중 중합효소연쇄반응(. Multiple polymerase chain reaction ( multiplexmultiplex PCRPCR ))

cox1 염기서열 비교 데이터를 기초로, 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum) 및 미아미엔시스 아비더스(Miamiensis avidus)를 구별할 수 있는 새로운 종-특이적 프라이머 세트를 만들기 위한 초가변영역을 선택하였다. Based on the cox1 sequence comparison data, Pseudocohnilembus longisetus ), Pseudocohnilembus persalinus , Euronema Marinem marinum ) And A hypervariable region was selected to create a new species-specific primer set capable of distinguishing Miamiensis avidus.

정방향 프라이머는 cox1 유전자의 종-특이적 지역에서 set 시작점 염기서열 세트에 상보적인 반면에, 역방향 프라이머는 각각의 프라이머가 다른 길이의 최종 PCR 절편을 생산하도록 디자인하였다. 다중 중합효소연쇄반응(multiplex PCR)에 사용된 정방향 및 역방향 프라이머 각각의 염기서열과 위치는 하기의 표 5와 같다.The forward primer was designed to be complementary to the set starting point sequence set in the species-specific region of the cox1 gene, while the reverse primer was designed so that each primer produced a final PCR fragment of a different length. The base sequence and position of each of the forward and reverse primers used in the multiplex PCR are shown in Table 5 below.

미생물microbe 위치location 서열
번호order
number 명칭designation 염기서열 (5'-3')Base sequence (5'-3') 크기(bp)Size (bp) P. P. longisetuslongisetus 255255 55 OX09-148OX09-148 AAATCAAATCATAGAAATAATAGAGAATTTTTAAATGAAATCAAATCATAGAAATAATAGAGAATTTTTAAATG 341341 595595 66 OX09-149OX09-149 GCTCCAACACCAGTATATTTAATGGCTCCAACACCAGTATATTTAATG P. P. persalinuspersalinus 254254 77 OX09-146OX09-146 TAAATCTAATCATCGTAATAATAGAGAATTGTTAGTAAATCTAATCATCGTAATAATAGAGAATTGTTAG 229229 482482 88 OX09-147OX09-147 CTTATCGATACGACTAACTGCATCTTATCGATACGACTAACTGCAT U. U. marinummarinum 262262 99 OX09-144OX09-144 AACATAGAGCATATAGAGAGTACTCTAAAACATAGAGCATATAGAGAGTACTCTAA 285285 546546 1010 OX09-145OX09-145 TTCATCCAGCTGTTGTTAATGTTTCATCCAGCTGTTGTTAATGT M. M. avidusavidus 258258 1111 OX09-142OX09-142 AGTAATAATAGAACATTTAACGAATTTAATAACACAGTAATAATAGAACATTTAACGAATTTAATAACAC 422422 679679 1212 OX09-143OX09-143 CGTCTTGTAATTAATAAATTTGTAAACGATACCGTCTTGTAATTAATAAATTTGTAAACGATAC

PCR 반응은 각 프라이머 5 pmol, LA Taq 중합효소(Takara) 0.25 U, 염화마그네슘 2.5 mM 및 4 ㎕ dNTPs(각2.5 mM)에 단일 PCR을 하는 경우 주형 DNA 25 ng을 포함하고, 다중 중합효소연쇄반응(multiplex PCR)을 하는 경우 주형 DNA 12.5 ng을 포함하는 25 ㎕ PCR 반응 혼합물(PCR Mix)에서 실시하였다. PCR 반응 조건은 94 ℃에서 2분 동안 초기변성(pre-denaturation)하고, 증폭과정을 다음으로 94 ℃에서 30초, 50 ℃에서 30초, 그리고 72 ℃에서 40초 동안 실시하고 상기 단계를 30번 반복하였고, 72 ℃에서 5분 동안 최종 연장(final extension)을 실시하였다. 증폭 산물은 1% 아가로스 겔에서 전기 영동으로 분석하였고, 절편이 크기는 Takara 100 bp DNA Ladder와 비교하여 알아냈다. PCR 산물의 사이즈는 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus)는 229bp, 유로네마 마리넘(Uronema marinum)는 285bp, 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus)는 341bp 그리고 미아미엔시스 아비더스(Miamiensis avidus)는 422bp 였다. PCR reaction was performed with each primer 5 pmol, LA Taq Polymerase (Takara) 0.25 U, magnesium chloride 2.5 mM and 4 µl dNTPs (2.5 mM each) contain 25 ng of template DNA for single PCR, and 12.5 of template DNA for multiplex PCR It was carried out in 25 μl PCR reaction mixture (PCR Mix) containing ng. PCR reaction conditions were pre-denaturation at 94°C for 2 minutes, followed by amplification process at 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 40 seconds, and the above steps were performed 30 times. Repeatedly, a final extension was performed at 72° C. for 5 minutes. The amplification product was analyzed by electrophoresis on a 1% agarose gel, and the size of the fragment was determined by comparison with the Takara 100 bp DNA Ladder. The size of the PCR product is Pseudocohnilembus (Pseudocohnilembus). persalinus ) is 229bp, Uronema marinum is 285bp, Pseudocohnilembus longisetus ) was 341 bp and Miamiensis avidus was 422 bp.

슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus)에 특이적인 프라이머인 서열번호 7(OX09-146) 및 서열번호8(OX09-147)의 프라이머 쌍은PCR 산물은 229bp를 나타냈다(도 3, 레인 2). Pseudocohnilembus persalinus ), the primer pairs of SEQ ID NO: 7 (OX09-146) and SEQ ID NO: 8 (OX09-147), which are specific primers, exhibited 229 bp for PCR products (Fig. 3, lane 2).

유로네마 마리넘(Uronema marinum)에 상보적인 PCR 산물은 285bp이고, 서열번호 9(OX09-144) 및 서열번호10(OX09-145)의 프라이머 쌍을 이용하였다(도 3, 레인 3). The PCR product complementary to Uronema marinum was 285 bp, and a primer pair of SEQ ID NO: 9 (OX09-144) and SEQ ID NO: 10 (OX09-145) was used (FIG. 3, lane 3).

슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus)에 특이적인 정방향 프라이머로 서열번호 5(OX09-148) 및 역방향 프라이머로 서열번호 6(OX09-149)의 프라이머 쌍을 이용한 경우 산물은341bp의 절편을 생산하였다(도 3, 레인 4). Pseudocohnilembus longisetus ), when using a primer pair of SEQ ID NO: 5 (OX09-148) as a specific forward primer and SEQ ID NO: 6 (OX09-149) as a reverse primer, the product produced a 341 bp fragment (Fig. 3, lane 4).

미아미엔시스 아비더스(Miamiensis avidus) 특이적인 프라이머인 서열번호 11(OX09-142) 및 서열번호 12(OX09-143)의 프라이머 쌍은 422bp 절편을 생산하였다(도 3, 레인 5). Miamiensis Abidas (Miamiensis avidus ) The primer pairs of SEQ ID NO: 11 (OX09-142) and SEQ ID NO: 12 (OX09-143), which are specific primers, produced a 422 bp fragment (Fig. 3, lane 5).

4개 종의 DNA가 혼합된 시료를 단일 반응에서 상기 각 프라이머를 같은 양의 몰로 사용하여 다중 중합효소연쇄반응(multiplex PCR)법으로 분석한 결과, 명확히 구별되는 4개의 PCR 산물을 얻었다. 상기 프라이머 세트를 이용하는 경우 특정 절편 길이에 근거하여, 슈도코니렘버스 론지세터스(Pseudocohnilembus longisetus), 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus), 유로네마 마리넘(Uronema marinum) 및 미아미엔시스 아비더스(Miamiensis avidus)를 한 번의 탐지를 수행하여 구분할 수 있음을 확인 하였다(도 3, 레인 6). 상기 프라이머 셋트를 이용하여 상기 스쿠티카섬모충의 감염여부 및 감염종을 신속하고 정확하게 검출할 수 있는바, 양식업에 문제가 되는 스쿠티카증의 진단을 신속하게 하여 어류의 집단폐사를 막을 수 있을 것이다.
A sample in which four types of DNA were mixed was analyzed by a multiplex PCR method using the same amount of moles of each of the primers in a single reaction, and as a result, four clearly distinguishable PCR products were obtained. When using the above primer set, based on a specific fragment length, Pseudocohnilembus Longisetters (Pseudocohnilembus longisetus ), Pseudocohnilembus persalinus ), Euronema marinum (Uronema) marinum ) And It was confirmed that Miamiensis avidus can be distinguished by performing one detection (FIG. 3, lane 6). By using the primer set, it is possible to quickly and accurately detect the presence of infection and infectious species of the Scutica ciliated caterpillar, and thus it will be possible to prevent collective death of fish by promptly diagnosing Scuticosis, which is a problem in the aquaculture industry.

<110> Cheju National University Industry-Academic Cooperation Foundation <120> A PRIMER FOR SCUTICOCILIATE AND A METHOD FOR DETECTING SCUTICOCILIATE USING THE SAME <130> DP20130566 <160> 12 <170> KopatentIn 2.0 <210> 1 <211> 664 <212> DNA <213> Pseudocohnilembus longisetus <400> 1 tttaattatg gtattttttg ttgttgtacc tttaattttt ggtgcttttg caaatttttt 60 aattccttac catatcggtt ctaaagacgt agcataccca cgtttgaata gtattggttt 120 ttgaattcaa ccttgtggtt ttattttagt atcaaaaatt gcctttttaa gacctcaata 180 ttgaagatat tacgataaag tagcatatta ttttcctttg ttaagcaaat caaatcatag 240 aaataataga gaatttttaa atgaaaatcc tttacaattg caagcattga aaaggtattt 300 agtagacgac catactattt catttaaacc taaggtttca actaaataca gtgattatga 360 taactattca ggtttaccat gaaaattatt actttgaaaa gatatcgtta attatccaga 420 atctttttgg tatgtagtta gtcgtattga taaagtaagg cgtaaaaagg tttattttac 480 aaaatgttct aacagagttt taactacagc aggttgaact tttattaccc cattctcatc 540 taacattaaa tatactggtg ttggagctca ggatttatta ttagtttctg ttgtttttgc 600 tggtttaagc tctactgttt cttttactaa tttattaatt accagaagaa ctttatgtat 660 gcct 664 <210> 2 <211> 664 <212> DNA <213> Pseudocohnilembus persalinus <400> 2 ccttattatg gtatttttcg ttgttgtacc tataatattt ggtgcttttg caaatttttt 60 aatcccatac catatcggtt caaaagacgt agcttaccca cgtttaaata gtatcggttt 120 ttgaattcaa ccatgtggtt ttattttagt atcaaaaata gcttttttaa ggccacaata 180 ttgaagatac tacgataaag tctcttacta ttttccatta ctaagtaaat ctaatcatcg 240 taataataga gaattgttag gtgataatcc attccaacta caagctttaa aaagatattt 300 agtcgacgaa catactattt ttttcaaacc taaaattaaa tcaaaatatt cagattatga 360 aaattattca ggattacctt gaaaattatt attatgaaag gatatagtaa attatcctga 420 atctttttga tatgcagtta gtcgtatcga taaggttaga cgtaagaaag tatactttac 480 taagtgttct aatagaacat taacaactgc tggttgaaca ttcattactc cattttcatc 540 taatacaaaa tatacaggtg taggtgcaca agacttatta cttgtttcag tagtgtttgc 600 tggacttagc tcaactgttt cttttacaaa tttattaatt acaagaagaa cattgtgtat 660 gcct 664 <210> 3 <211> 664 <212> DNA <213> Uronema marinum <400> 3 tttaattatg gtattttttg tagttgttcc tattattttt ggagcatttg ctaatttttt 60 aataccttac catattggtt caaaagatgt agcataccca agattaaata gtatagcttt 120 ttgaattcaa ccttgtggtt ttattttagt agctaaaatt gctttcttaa ggcctcaatt 180 ttgaaggtat tatgataaaa cagcttatta ctttccttta ttagataggg gtcaacatag 240 agcatataga gagtactcta atgaaaatat ttttcaattt agagctttaa aaagatacgt 300 tttagatgag cattcattat tctgaaaagc taaaacaaaa gaaaaattta gtaactattc 360 tgattattct ggaattcctt taaaattatt attttgaaaa gatgttatta attatccgga 420 atcattttga tatgtagtta gccgtattaa taaagtaaga cgtaaaaaag tatactttac 480 aaaatgttct aatagaacat taacaacagc tggatgaact tttattacac ctttctcatc 540 taatatcaaa tatacaggta ttggagctca agatttatta ttagtaggag tagtttttgt 600 aggaattagt tctacaactg gttttactaa tttattaatt acaagaagaa ctctatgtat 660 gcca 664 <210> 4 <211> 667 <212> DNA <213> Miamiensis avidus <400> 4 tttaattatg gtattttttg atgtagttcc tgttattttt ggggcttttg caaatttttt 60 aataccgtac catattggtt ctaaagatgt ggcttaccct agactaaata gtataggttt 120 ttgaattcaa ccttgtggtt ttattttagt atctaaaata gcatttttaa ggccacaata 180 ctgaagatac tatgataaag cttcttacta ttttccttta cttgataaaa gtaataatag 240 aacatttaac gaatttaata acactaataa catttttcag tttagagcat tacaaaggta 300 tgctttagac gaacatacgc tattttgaaa acctaaacta acaaataaat atacaaatta 360 tgaaaattat tctggaattc ctttaaaatt attattttga aaagatatta ttaactaccc 420 agaatctttt tgatacgttg taagtcgtat taatagagta cgtagaaaaa aagtatattt 480 tactaaatgt tctaacagaa ccttaactac agctggttga acttttatta caccatttgc 540 atcaaatgta aaatatacag gtattggtgc tcaagattta ctattagtat cagttgtttt 600 tgctggtatt agttctacag tatcgtttac aaatttatta attacaagac gtactttatg 660 tatgcct 667 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> P. longisetus cox1 F-primer <400> 5 aaatcaaatc atagaaataa tagagaattt ttaaatg 37 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P. longisetus cox1 R-primer <400> 6 gctccaacac cagtatattt aatg 24 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> P. persalinus cox1 F-primer <400> 7 taaatctaat catcgtaata atagagaatt gttag 35 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P. persalinus cox1 R-primer <400> 8 cttatcgata cgactaactg cat 23 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> U. marinum cox1 F-primer <400> 9 aacatagagc atatagagag tactctaa 28 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> U. marinum cox1 R-primer <400> 10 ttcatccagc tgttgttaat gt 22 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> M. avidus cox1 F-primer <400> 11 agtaataata gaacatttaa cgaatttaat aacac 35 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> M. avidus cox1 R-primer <400> 12 cgtcttgtaa ttaataaatt tgtaaacgat ac 32 <110> Cheju National University Industry-Academic Cooperation Foundation <120> A PRIMER FOR SCUTICOCILIATE AND A METHOD FOR DETECTING SCUTICOCILIATE USING THE SAME <130> DP20130566 <160> 12 <170> KopatentIn 2.0 <210> 1 <211> 664 <212> DNA <213> Pseudocohnilembus longisetus <400> 1 tttaattatg gtattttttg ttgttgtacc tttaattttt ggtgcttttg caaatttttt 60 aattccttac catatcggtt ctaaagacgt agcataccca cgtttgaata gtattggttt 120 ttgaattcaa ccttgtggtt ttattttagt atcaaaaatt gcctttttaa gacctcaata 180 ttgaagatat tacgataaag tagcatatta ttttcctttg ttaagcaaat caaatcatag 240 aaataataga gaatttttaa atgaaaatcc tttacaattg caagcattga aaaggtattt 300 agtagacgac catactattt catttaaacc taaggtttca actaaataca gtgattatga 360 taactattca ggtttaccat gaaaattatt actttgaaaa gatatcgtta attatccaga 420 atctttttgg tatgtagtta gtcgtattga taaagtaagg cgtaaaaagg tttattttac 480 aaaatgttct aacagagttt taactacagc aggttgaact tttattaccc cattctcatc 540 taacattaaa tatactggtg ttggagctca ggatttatta ttagtttctg ttgtttttgc 600 tggtttaagc tctactgttt cttttactaa tttattaatt accagaagaa ctttatgtat 660 gcct 664 <210> 2 <211> 664 <212> DNA <213> Pseudocohnilembus persalinus <400> 2 ccttattatg gtatttttcg ttgttgtacc tataatattt ggtgcttttg caaatttttt 60 aatcccatac catatcggtt caaaagacgt agcttaccca cgtttaaata gtatcggttt 120 ttgaattcaa ccatgtggtt ttattttagt atcaaaaata gcttttttaa ggccacaata 180 ttgaagatac tacgataaag tctcttacta ttttccatta ctaagtaaat ctaatcatcg 240 taataataga gaattgttag gtgataatcc attccaacta caagctttaa aaagatattt 300 agtcgacgaa catactattt ttttcaaacc taaaattaaa tcaaaatatt cagattatga 360 aaattattca ggattacctt gaaaattatt attatgaaag gatatagtaa attatcctga 420 atctttttga tatgcagtta gtcgtatcga taaggttaga cgtaagaaag tatactttac 480 taagtgttct aatagaacat taacaactgc tggttgaaca ttcattactc cattttcatc 540 taatacaaaa tatacaggtg taggtgcaca agacttatta cttgtttcag tagtgtttgc 600 tggacttagc tcaactgttt cttttacaaa tttattaatt acaagaagaa cattgtgtat 660 gcct 664 <210> 3 <211> 664 <212> DNA <213> Uronema marinum <400> 3 tttaattatg gtattttttg tagttgttcc tattattttt ggagcatttg ctaatttttt 60 aataccttac catattggtt caaaagatgt agcataccca agattaaata gtatagcttt 120 ttgaattcaa ccttgtggtt ttattttagt agctaaaatt gctttcttaa ggcctcaatt 180 ttgaaggtat tatgataaaa cagcttatta ctttccttta ttagataggg gtcaacatag 240 agcatataga gagtactcta atgaaaatat ttttcaattt agagctttaa aaagatacgt 300 tttagatgag cattcattat tctgaaaagc taaaacaaaa gaaaaattta gtaactattc 360 tgattattct ggaattcctt taaaattatt attttgaaaa gatgttatta attatccgga 420 atcattttga tatgtagtta gccgtattaa taaagtaaga cgtaaaaaag tatactttac 480 aaaatgttct aatagaacat taacaacagc tggatgaact tttattacac ctttctcatc 540 taatatcaaa tatacaggta ttggagctca agatttatta ttagtaggag tagtttttgt 600 aggaattagt tctacaactg gttttactaa tttattaatt acaagaagaa ctctatgtat 660 gcca 664 <210> 4 <211> 667 <212> DNA <213> Miamiensis avidus <400> 4 tttaattatg gtattttttg atgtagttcc tgttattttt ggggcttttg caaatttttt 60 aataccgtac catattggtt ctaaagatgt ggcttaccct agactaaata gtataggttt 120 ttgaattcaa ccttgtggtt ttattttagt atctaaaata gcatttttaa ggccacaata 180 ctgaagatac tatgataaag cttcttacta ttttccttta cttgataaaa gtaataatag 240 aacatttaac gaatttaata acactaataa catttttcag tttagagcat tacaaaggta 300 tgctttagac gaacatacgc tattttgaaa acctaaacta acaaataaat atacaaatta 360 tgaaaattat tctggaattc ctttaaaatt attattttga aaagatatta ttaactaccc 420 agaatctttt tgatacgttg taagtcgtat taatagagta cgtagaaaaa aagtatattt 480 tactaaatgt tctaacagaa ccttaactac agctggttga acttttatta caccatttgc 540 atcaaatgta aaatatacag gtattggtgc tcaagattta ctattagtat cagttgtttt 600 tgctggtatt agttctacag tatcgtttac aaatttatta attacaagac gtactttatg 660 tatgcct 667 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> P. longisetus cox1 F-primer <400> 5 aaatcaaatc atagaaataa tagagaattt ttaaatg 37 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P. longisetus cox1 R-primer <400> 6 gctccaacac cagtatattt aatg 24 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> P. persalinus cox1 F-primer <400> 7 taaatctaat catcgtaata atagagaatt gttag 35 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P. persalinus cox1 R-primer <400> 8 cttatcgata cgactaactg cat 23 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> U. marinum cox1 F-primer <400> 9 aacatagagc atatagagag tactctaa 28 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> U. marinum cox1 R-primer <400> 10 ttcatccagc tgttgttaat gt 22 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> M. avidus cox1 F-primer <400> 11 agtaataata gaacatttaa cgaatttaat aacac 35 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> M. avidus cox1 R-primer <400> 12 cgtcttgtaa ttaataaatt tgtaaacgat ac 32

Claims (3)

서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 프라이머 쌍으로 이루어진 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus) 검출용 프라이머.SEQ ID NO salicylate buffer pseudo conical RAM bus consisting of a pair of primers consisting of a primer comprising a primer and a base sequence of SEQ ID NO: 8 comprising the nucleotide sequence of the seven bonus (Pseudocohnilembus persalinus ) detection primer. 제1항에 따른 슈도코니렘버스 퍼살리너스 검출용 프라이머를 이용하여 중합효소연쇄반응(Polymerase Chain Reaction, PCR)으로 슈도코니렘버스 퍼살리너스를 탐지하는 단계를 포함하는 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus) 검출 방법.Pseudo-Conny Rembus Persali comprising the step of detecting Pseudorenibus Persalinas by Polymerase Chain Reaction (PCR) using the Pseudorenibus Persalinas detection primer according to claim 1 Method of detecting Pseudocohnilembus persalinus . 제1항에 따른 슈도코니렘버스 퍼살리너스 검출용 프라이머, 반응완충액, dNTP 및 Taq DNA 중합효소를 포함하는 슈도코니렘버스 퍼살리너스(Pseudocohnilembus persalinus) 검출키트. Pseudocohnilembus comprising a primer for detecting pseudoconifers persalinus according to claim 1, a reaction buffer, dNTP and Taq DNA polymerase persalinus ) detection kit.
KR1020130161339A 2013-12-23 2013-12-23 A primer for scuticociliate and a method for detecting scuticociliate using the same KR20140014042A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130161339A KR20140014042A (en) 2013-12-23 2013-12-23 A primer for scuticociliate and a method for detecting scuticociliate using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130161339A KR20140014042A (en) 2013-12-23 2013-12-23 A primer for scuticociliate and a method for detecting scuticociliate using the same

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020120017182A Division KR20130095593A (en) 2012-02-20 2012-02-20 A primer for scuticociliate and a method for detecting scuticociliate using the same

Publications (1)

Publication Number Publication Date
KR20140014042A true KR20140014042A (en) 2014-02-05

Family

ID=50264277

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130161339A KR20140014042A (en) 2013-12-23 2013-12-23 A primer for scuticociliate and a method for detecting scuticociliate using the same

Country Status (1)

Country Link
KR (1) KR20140014042A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110396552A (en) * 2019-09-05 2019-11-01 大连海洋大学 Molecular labeling, primer and the method for based on PCR identification water droplet puppet health fibre worm

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110396552A (en) * 2019-09-05 2019-11-01 大连海洋大学 Molecular labeling, primer and the method for based on PCR identification water droplet puppet health fibre worm
CN110396552B (en) * 2019-09-05 2023-02-10 大连海洋大学 Molecular marker, primer and method for identifying pseudocercospora fusca based on PCR

Similar Documents

Publication Publication Date Title
Lasa et al. Dynamics of the Pacific oyster pathobiota during mortality episodes in Europe assessed by 16S rRNA gene profiling and a new target enrichment next‐generation sequencing strategy
Vardić Smrzlić et al. Molecular characterisation of Anisakidae larvae from fish in Adriatic Sea
Whang et al. Identification of scuticociliates (Pseudocohnilembus persalinus, P. longisetus, Uronema marinum and Miamiensis avidus) based on the cox1 sequence
Cammà et al. Confirmation of crayfish plague in Italy: detection of Aphanomyces astaci in white clawed crayfish
Castro et al. Evaluation of four polymerase chain reaction primer pairs for the detection of Edwardsiella tarda in turbot
Güven et al. Molecular identification of Eimeria species of broiler chickens in Turkey
Mullen et al. Nuclear small-subunit ribosomal RNA gene-based characterization, molecular phylogeny and PCR detection of the Neoparamoeba from western Long Island Sound lobster
Amalina et al. Recent update on the prevalence of Vibrio species among cultured grouper in Peninsular Malaysia
Heckman et al. Multilocus sequence analysis of diverse Streptococcus iniae isolates indicates an underlying genetic basis for phenotypic heterogeneity
Rasmussen et al. Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout
Wang et al. Morphological and molecular confirmation of the validity of Trichuris rhinopiptheroxella in the endangered golden snub-nosed monkey (Rhinopithecus roxellana)
Lara-Flores et al. Identification of Mycobacterium agent isolated from tissues of Nile tilapia (Oreochromis niloticus)
Oakey et al. Differentiation of Aeromonas genomospecies using random amplified polymorphic DNA polymerase chain reaction (RAPD‐PCR)
Aparna et al. Phylogenetic analysis of bovine Theileria spp. isolated in south India.
CN112176081B (en) SNP molecular marker related to chicken coccidian decoquinate drug resistance and application thereof
Chi et al. High genetic diversities between isolates of the fish parasite Cryptocaryon irritans (Ciliophora) suggest multiple cryptic species
Jeong et al. Transmission of iridovirus from freshwater ornamental fish (pearl gourami) to marine fish (rock bream)
Sakai et al. Morphological and molecular genetic characterization of Kudoa konishiae n. sp.(Myxosporea: Multivalvulida) in the muscle of Japanese Spanish mackerel (Scomberomorus niphonius)
Tanaka et al. Complete elimination of endosymbiotic algae from Paramecium bursaria and its confirmation by diagnostic PCR
Matthews et al. Saprolegnia parasitica zoospore activity and host survival indicates isolate variation in host preference
KR20130095593A (en) A primer for scuticociliate and a method for detecting scuticociliate using the same
KR20140014042A (en) A primer for scuticociliate and a method for detecting scuticociliate using the same
KR20140003366A (en) A primer for scuticociliate and a method for detecting scuticociliate using the same
Modarres et al. Phenotypic and genetic diversity of motile aeromonads isolated from diseased fish and fish farms
Ek-Huchim et al. Non-lethal detection of DNA from Cichlidogyrus spp.(Monogenea, Ancyrocephalinae) in gill mucus of the Nile tilapia Oreochromis niloticus

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
E902 Notification of reason for refusal
E601 Decision to refuse application