KR20130136252A - A split luciferase complementation assay for studying in vivo protein-protein interactions in filamentous ascomycetes - Google Patents

Abstract

The present invention relates to a vector for analyzing protein interaction in assurgency ascomycete and a split luciferase complementation analyzing method using the same and, more particularly, to an analyzing method of protein interaction through split luciferase complementation analysis after inserting protein expressed genes into the vector to analyze protein interaction in assurgency ascomycete and to a vector used for the same. The vector for protein interaction analysis in assurgency ascomycete comprises: genes for encoding C terminus or N terminus of luciferase; Crp promoter; restriction enzyme; resistance gene of geneticin or hygromycin B; and HindIII restriction enzyme. Also, according to an analysis method in an embodiment of the present invention, genes coding analysis object protein are inserted into a vector, luciferase fluorescence intensity is measured through split luciferase analysis, and protein interaction in assurgency ascomycete can be analyzed.

Description

TECHNICAL FIELD The present invention relates to a vector for analyzing in vivo protein interactions and to a method for assaying split-luciferase complementation assays for in vivo protein-protein interactions in filamentous ascomycetes.

The present invention relates to a vector for analyzing protein interactions in filamentous aspergillus and to a method of split luciferase complementarity analysis using the same, and more particularly in filamentous aspergillus in In order to analyze the protein interaction in vivo , after inserting the nucleotide sequence for expressing the protein of the target gene into the vector, analysis for analyzing the interaction between proteins in vivo through the split luciferase complementarity analysis A method and a novel vector used therein.

Various types of protein-protein interactions play an important role in regulating basic cellular processes. Several techniques have been developed to elucidate these interactions in living cells (Barnard et al., 2007; Fige 20003; Meng et al. 32005). Among these methods, the yeast two-hybrid method has been widely used because of its sensitivity and wide applicability. However, this system based on the activity of reporter genes by transcription factors has several limitations. This is confined to protein interactions at the nucleus of yeast cells, since identification of the interaction region and interaction of proteins bound to the cell membrane are difficult to identify. In addition, in vivo vivo In-depth identification of protein interactions (ie intracellular protein interactions of the study) is required. Furthermore, bait proteins with potential self-transactivation activity can cause false positives, which is the most common limitation of such systems (Nolting and Poggeler 2006a).

To overcome these drawbacks, strategies for protein fragment-assisted complementation (PFAC, Michnick 2003) have been developed using dehydrofolate (Pelletier et al. 1998; Remy and Micknick 2004), beta -galactosidase It has been developed using a variety of reporter proteins including β-lactamase (Galerneau et al. 2002), green fluorescent protein (Hu and Kerppola 2002) and luciferase (Kaihara et al. 2003) come. In particular, fireflies ( Photinus PFAC strategies using split luciferases such as pyralis , Renilla , or Gaussia have lower background signals compared to other reporters (e.g., fluorescent reporters), which is why mammalian cells and live small animals Even cells have been developed as effective assays for protein-protein interactions on a broad scale. Recently, successful imaging of protein-protein interactions in original plant cells has been reported (Chen et al. 2008).

In the present invention, Gibberella , which has not previously been tried for split luciferase complementarity assays zeae (anamorph: Fusarium graminearum ) and Cochliobolus heterostrophus ( Bipolaris whether or not it can be used to identify protein interactions in filamentous filamentous aspergillus fungi such as maydis ). These fungal species cause dangerous diseases in major grain-related plants (eg, ear blight of wheat, barley and rice by G. zeae and corn sesame seed disease by C. heterostrophus ) (McMullen et al. 1997).

In addition to the economic importance of the plant diseases caused by them, the ease of their genetic and molecular research makes these species useful as molecular models of fungi in the molecular study of filamentous streptococci. As a protein pair known to interact with each other, newly discovered F-box protein labeled with FBP1 and SKP1 associated with it were selected (Han et al. 2007). Both FBP and SKP1 are known to be components of the Skp1-Cullin-F-box protein (SCF ^FBP1 ) E3 ligase complex, which is required for the degradation of proteins related to eutrophication and pathogenicity in G. zeae ; The interaction of FBP1 with SKP1 was confirmed in a yeast-to-hybrid assay (Han et al. 2007). As an example of novel protein binding that has not been found in most filamentous fungi, the inventors have chosen to bind the heterogeneous genes of the yeast chromosomal maintenance protein (MCM1) of G. zeaa and the heterodomain protein STE12. Two proteins known as transcription factors, one of which is a member of the MADS box family of electron-withdrawing genes, play an important role in regulating diverse cellular processes, including metastatic development in yeast and mating fungi (Shore and Sharroks, 1995; Rispail and Di Pietro, 2010).

However, yeast-to-interaction between these two proteins in sasangseong fungi using the hybrid method of the strong magnetic MCM1 - because activation activity (Nolting and Poggeler, 2006a), Sodaria Only in macrospora has been identified (Nolting and Poggeler, 2006b).

The object of the present invention is as follows: 1) To produce a multipurpose plasmid backbone having a gene encoding split luciferase under the strong promoter of fungi (N-terminal or C-terminal of firefly luciferase). 2) Insertion of a combination of FBP1 and SKP1 genes or a combination of GzMCM1 and FST12 genes into the constructs to produce a fungal transformation vector. 3) to confirm whether the fungal transformants with resistance to both agents exhibit a high fluorescence intensity-to-background ratio.

SUMMARY OF THE INVENTION Accordingly, it is an object of the present invention to provide a vector for analyzing protein interactions in vivo in mushroom fungus.

It is another object of the present invention to provide a method for analyzing the protein interactions in the vesicular filamentous fungi through the split luciferase complementarity analysis method using the vector.

Thus, the vector for analyzing protein interactions of filamentous streptococci of the present invention comprises a gene encoding the N-terminus or C-terminus of firefly luciferase; Promoter of creeparin gene ( Crp ); Eco RI and Sac I restriction enzyme sites; Geneticin or hygromycin B resistance gene cassettes; And a Hin dIII restriction site (see FIG. 1).

In addition, the method for producing the vector comprises the step of digesting the promoter region of the plasmid (pUC19-nLUC or nUC19-cLUC) having the N-terminal (nLuc) or C-terminal (cLuc) of luciferase with Eco RI and Sac I ; Binding the cryparin gene promoter ( Crp ) to the Eco RI and Sac I truncation base sequences; Amplifying from pCHPHI using primer pair 1 (CCGAATTCCTCGAGACAGGACCAGAGA) and 2 (CGAGCTCTTTGATTGAAGTTTGGAG) to prepare pFNLuc or pFCLuc; And geneticin or hygromycin B resistance gene cassettes amplified from pBCGT and pBCATPH were amplified from the pFNluc and pFCLuc by one Hin dIII digestion using primers 3 and 4 (CCCAAGCTTAGGATTACCTCTAAACAAGTGTACC) and 4 (CCCAAGCTTAGAAGATGATATTGAAGGAGCACTT) Respectively, to prepare pFNLucG or pFCLucH, respectively.

In addition, a method for analyzing protein interactions in mosquitosaccharomyces according to a preferred embodiment of the present invention includes the steps of inserting a gene encoding a protein to be assayed into the vector of claim 1 and detecting the expression of luciferase And measuring the fluorescence intensity, thereby analyzing the interaction between the proteins in the mitochondria.

Protein-protein interactions play an important role in controlling many intracellular processes. To date, a number of techniques have been developed to explore protein-protein interactions in living cells, among which slit luciferase complemenatation has been applied to animal and plant cells. Here, the inventors have split luciferase analysis Gibberella zeae And Cochliobolus were used in fter- malous ascomycetes such as heterostrophus . Two strong existing in G. zeae interactive protein coding sequence of (F-box protein, FBP1 and its partner SKP1) is Cryphonectria terminal and C-terminal regions of firefly luciferase (luc), respectively, under the control of the cryparin promoter from C. prasitica. Each fused product inserted into the transformation vector of a fungus carrying a geneticin or hygromycin B resistance gene was transformed with both fungi. The inventors have detected the compensation of the split luciferase protein induced by the interaction of two fungal proteins with high fluorescence intensity ratio versus a high background only in fungal transformants expressing N-luc and C-luc fusion constructs . Using such a system, the inventors also confirmed new protein interactions between the transcription factors GzMCMa and FST12 in G. zeae , which have not been revealed by the two-hybrid method of yeast. This is the first demonstration that monitoring split-luciferase complementarity is a sensitive and effective method of studying protein-protein interactions in vivo in schistocytic fungi.

Figure 1 is a diagrammatic representation of the multipurpose vector backbone produced in the present invention. The multicloning site into which the gene of interest can be inserted is indicated by two thick bands containing several restriction enzyme sites.
Figure 2 shows insertion and homologous expression of the split luciferase gene in a fungal transformed strain. Figure 2a shows the PCR amplification of the split luciferase gene from the transformant genomic DNA of the fungus. The nLuc- (1.3 kb) and cLuc-SKPl-region (0.6 kb) in the transformed host were primers 13/14 (Upper panel) and 15/16 (lower panel) (see Table 2). In both panels, the WT column is the genomic DNA of the G. zeae Z03643 strain, the pFNLuc-FBP1G column is the primer pair 13/14, the genomic DNA of the GzFN strain containing only nLuc-FBP1 (Table 4), and the FCLuc-SKP1H column is Genomic DNA of GzCS containing only cLuc-SKP1 with primer pair 15/16 (Table 4). The names of the other columns indicate the transgenic strain shown in Table 4. DNA size markers are shown on the left side of the gel.
FIG. 2B shows the transcriptional amplification of the fusion gene by RT-PCR using total RNA from a strain containing positive vectors grown in CM (GZCM or CHCM) liquid medium for 3 days. The cLuc-SKP1- (0.6 kb, 1-5 columns) and FBP1-nLuc regions (0.58 kb, 6-10 columns) were amplified with primer pairs 15/16 and 17/18, respectively (Table 2). The WT column is total RNA from the G. zeae Z03643 strain, and the other column shows total RNA from the transformants shown in Table 4.
Figure 3 shows transcript amplification of GzMCM1 and FST12 fusion genes by RT-PCR using total RNA from strains containing pFNLuc-MCM1G and pFCLuc-FST12H vectors grown for 3 days in GzCM. The cLuc-FST12- (2.2 kb, columns 1-3) and the GzMCM1-nLuc-region (0.7 kb, rows 4-6) were amplified with primer pairs 23/24 and 25/26 (Table 2), respectively. WT column is G. zeae The total RNA from the Z03643 strain is shown and the other columns represent the total RNA from the transformants shown in Table 5.
Figure 4 shows the relative expression of the transgene in the fungal transformants identified by qPCR. Both nLuc- and cLuc-specific regions (denoted N and C respectively after the names of the transformants in the X-axis) were amplified by the primers shown in Table 3. For example, GzNC / N and GzNC / C represent the transcript levels of nLuc and cLuc amplified by the primer pair nLUC forRT / nLUC rev RT and cLUC for RT / cLUC rev RT, respectively, from the total RNA of the GzNC strain. GzCSN / N and GzCSN / C are transcripts of nLuc and cLuc-SKP1 amplified by the primer pair nLUC forRT / nLUC rev RT and cLUC forRTf / SKP1 revRT, respectively, from the GzCSN strain (Table 4).
Figure 5 is a Western blot hybridization with a polyclonal primary antibody against firefly luciferase [Luciferase (251-550): sc-32896, Santa Cruz Biotechnology]. Crude protein extract (~ 50 mg) was loaded in each column. Column 1 represents G. Z03643, column 2-3 represents G. zeae strains (FBP1-nLuc and cLuc-SKP1, Table 4, respectively) containing both FBP1-nLuc and cLuc-SKP1, and column 4 represents FBP1-nLuc (GzN G. zeae strain containing only), column 5 represents the G. zeae strain containing only cLuc-SKP1 (GzCS). The arrow on the blot represents the approximately 38 kDa signal of cLuc-SKP1. The protein size marker (kDa) is shown on the left of the blot. Non-specific signals of ~ 100 kDa are indicated on the same gel as loading controls on the lower panel.
Figure 6 shows the results of a Western blotting with a firefly luciferase antibody against another polyclonal primary antibody against Antibody for Luciferase-Aff-Purified (Acris) (Figure 6a) and Anti-Luciferase (Sigma) (Figure 6b and 6c) Blot hybridization. In FIG. 6A, column 1 shows G. zeae Z03643; Column 2 is GzFNCS-5 (Table 4); Columns 3-4 are G. zeae strains containing both GzMCMC1-nLuc and cLuc-FST12 (GzFSM-1 and GzFSM-6, Table 5, respectively). In Fig. 6B, the first column corresponds to G. Z03643; Column 2 is GzFNCS-5; Column 3 is GzN; Column 4 is GzCS; Column 5 represents GzFSM-1. The arrow indicates the approximately 38 kDa signal of cLuc-SKP1 and the asterisk indicates the ~ 94 kDa signal of cLuc-FST12. The gray arrows represent certain non-specific signals used as loading controls.

Hereinafter, the present invention will be described in detail with reference to examples. It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention. The scope of the present invention is not limited by these variations and modifications.

[ Example  1: strain and culture condition]

All strains were grown in 25% glycerol stock cultures stored at -80 ° C and grown in potato dextrose, complete medium for G. zeae (GzCM; Leslie and Summerell 2006) or C. heterostrophus (ChCM; Leach et al., 1982) And maintained in Oz plate medium (PDA; Difco Laboratories). The GZ03643 strain used in the present invention was derived from the self-reproducing wild-type (WT) strain (Kim et al. 2008) and all the transgenic G. zeae strains from Z03643. For total RNA and genomic DNA extraction, strains were grown in PD liquid medium. For plant growth-related growth, strains were grown on PDA or GzCM. For peritrophic formation and sporulation, fungal strains were grown in carrot plate medium and CMC liquid medium, respectively, as described above (Han et al., 2007; Leslie and Summerell, 2006). C. heterostrophus WT strain C4 (MAT1-2, ATCC 48331) and its xenograft derivative strains were grown in ChTM and ChCM containing antibiotics used for strain selection, respectively. Escherichia coli strains were grown on Luria-Bertani plate or liquid medium containing antibiotics required for strain selection.

[ Example  2: plasmid, primer , PCR  And nucleic acid manipulation]

Plasmids used for vector construction in the present invention are listed in Table 1. The PCR primers used in the present invention (FIGS. 2 and 3) were provided by the Bioneer Oligonucleotide Synthesis Facility, suspended in distilled water at a concentration of 100 μM, and stored at -20 ° C. General PCR was performed as described above (Kim et al. 2008). Genomic DNA and total RNA of fungi were extracted as described above (Chi et al 2009; Kim et al. 2008). Plasmid DNA was prepared using 5-plasma E. coli using a plasmid DNA purification kit (NucleoGen Biotech). Purified from the culture. Restriction enzyme digestion, ligation, agarose gel electrophoresis and E. coli transformation were performed according to standard procedures (Sambrook and Russell 2001). Quantitative real-time PCR (qPCR) was performed with SYBR Green Super Mix (Bio-Rad) using primary sequence cDNA synthesized from total RNA (Kim and Yun, 2011). Gene expression was measured in two independent samples using three technical replicates. The G. zeae EF1A gene (FGSG_08811.3) was used as an endogenous control for data generalization. The amount of nLuc transcript from the three day mycelial sample of the GzNC strain grown in GzCM medium (Table 4) was used as a reference for comparison.

The plasmid used in the present invention name Characteristics pUC19-nLUC (35S :: Nluc) The N-terminal domain (amino acid 2-416) of the firefly luciferase (Luc) inserted between the Cauliflower Mosaic Virus (CaMV) 345S promoter and the small subunit (rbs) terminus of Rubisco was cloned into pUC19. pUC19-cLUC (35S :: Cluc) The C-terminal domain of Luc inserted between the 35S promoter and the rbs terminus (amino acids 398-550) was cloned into pUC19. pCHPH1 Cryphonectria The 188-bp fragment of the creeparin promoter ( Crp ) from parasitica is fused with hygromycin B resistance gene ( hyg ) at pDH25 (Cullen et al., 1987). pSP-luc + NF fusion vector Firefly ( Photinus pyralis ) Full-length sequence encoding the luciferase gene PEGFC The full-length coding sequence of FBP1 amplified from Z03643 cDNA was
pEG202 (Golemis et al., 1996). PACTgzskp The full-length coding sequence of SKP1 amplified from Z03643 cDNA was introduced into pACT2 (Clontech). PBCATPH Aspergillus nidulans The hygromycin resistance gene ( hygB ) under the control of the Trp promoter and terminator (Hamer and Timberlake 1987) was introduced into pBCSK (-) (Clontech). pBCGT The resistance gene ( gen ) was introduced into pBCSK (-) (Clontech) under the control of A. nidulans Trp promoter and terminator.

* Table 2 is created after Table 3.

The primers used in the present invention name Sequence (5 → 3) Amplified gene size
nLUC forRT CCGCTTCCCCGACTTCCTTAGAGA nLuc 139bp nLUC rev RT CCGCTTCCCCGACTTCCTTAGAGA cLUC for RT CTTCCCGCCGCCGTTGTTGTTT cLuc 208bp cLUC rev RT CGATCTTTCCGCCCTTCTTG MCM1 forRT CAAAGCTACGTACAACGAAATCAG GzMCM1 - nLuc 204bp nLUC revRTf CTCTCCAGCGGTTCCATCTTCC cLUC forRTf CGCGGAGGAGTTGTGTTTGTGGAC cLuc - SKP1 223bp SKP1 revRT TGTTTGCGCTGTCATTAGAGG Ste12 revRT AGAGCTTGCTGGGCCTCAGTGC cLuc - FST12 242bp FBP forRT ACTGGTGCAAGCACGGCGACGA FBP1 - nLuc 189 bp

 The primers used in the present invention Name ¹ Original Sequence (5 → 3) Amplified
gene Enzyme site One Promoter / for CCGAATTCCTCGAGACAGGACCAGAGA PCrp ³ EcoRI 2 Promoter-S / rev CGAGCTCTTTGATTGAAGTTTGGAG SacI 3 HygB-H / for CCCAAGCTTAGGATTACCTCTAAACAAGTGTACC gen ⁴ or hygB ⁴ HindIII 4 HygB-H / rev CCCAAGCTTAGAAGATGATATTGAAGGAGCACTT 5 FBP1nLUC / for AAGCTCGAGTAGTCGACATGGCCGCTGCTGCCACTCCT FBP1 SalI 6 FBP1nLUC / rev CGTACGAGATCTGGTCGACGTTCATCGAGTCAGATTGAT 7 Skp1cLUC / for CGTCCCGGGGCGGTACCTCTGAGTCTACATCTCCTCAGAA SKP1 KpnI 8 Skp1cLUC / rev TTGGATCCCCGGGTACCTTAGCGGTCCTCAGCCCACTCGTT 9 FBP1cLUC / for TCCCGGGGCGGTACCGCCGCTGCTGCCACTCCTACT FBP1 KpnI 10 FBP1cLUC / rev Gt; 11 SKP1nLUC / for GAAGCTCGAGTAGTCGACATGTCTGAGTCTACATCTCCT SKP1 SalI 12 SKP1nLUC / rev TACGAGATCTGGTCGACGCGGTCCTCAGCCCACTCGTT 13 nLUCfor CAGATCTCGTACGCGTCCCGGG nLuc ^-6 14 nLUCtailN GCTCTAGTCATCCATCCTTGTCAATCAAG - 15 cLUCskp1 / for CGGAGGAGTTGTGTTTGTGGAC cLuc - SKP1 - 16 cLUCskp1 / rev CTCGGGAGTGAAATCGTTGGTA - 17 nLUC_cDNA5 ACGGTAGTGAGATGGTTGTGGATG FBP1 - nLuc - 18 nLUC_cDNA3 CTGCATACGACGATTCTGTGATTT - 19 MCM1nLUC / for AGCTCGAGTAGTCGACATGGCCGACATCACAGATCAG GzMCM1 SalI 20 MCM1nLUC / rev TACGAGATCTGGTCGACCGACTGGTGATGGCT 21 FST12cLUC / for TCCCGGGGCGGTACCTATTCGCAACACTCCGCA FST12 KpnI 22 FST12cLUC / rev GGATCCCCGGGTACCTTACATCATGCCACTAGC 23 cLUCfor3 CGAAAAAGTTGCGCGGAGGAG cLuc - FST12 - 24 FCFST12 / Rev GGATCCCCGGGTACCTTACATCATGCCACTAGC - 25 FNMCM1 / for AGCTCGAGTAGTCGACATGGCCGACATCACAGATCAG GzMCM1 - nLuc - 26 Nluc3R GATAGAATGGCGCCGGGCCTT - ¹ The names of the primers have been described in the Examples of the invention to be described later.
^{2 < / RTI >} linear vector.
³ PCrp is the 188 bp promoter region of Crp.
⁴ is promoter and A. nidulans Gene cassettes under the control of the ends of Trp are shown.
^{5 When} the recognition site of the restriction enzyme is present in the primer sequence, it is indicated as a colored part.
⁶ - are not included.

Luminescent activity in fungal cell isolates ¹ Bacterium Characteristics Activity ² Z03643 G. zeae wild strain 8.3 ± 3.8 Z03643 ³ G. zeae wild strain 7.4 ± 4.2 ⁴ C4 C. heterostrophus strain 5.0 ± 2.0 GzN A transforming G. zeae strain containing only pFNLucG 5.0 ± 1.0 GzC G. zeae for transformation containing only pFCLucH Strain 8.0 ± 1.0 GzNC A transforming G. zeae strain containing both empty vectors pFNLucG and pFCLucH 13.3 ± 5.1 GzFN A transforming G. zeae strain containing only pFNLuc-FBP1G 8.0 ± 3.5 GzFNC A transforming G. zeae strain containing pFNLuc-FBP1G and empty vector pFCLucH 18.1 ± 3.2 GzCS A transforming G. zeae strain containing only pFCLuc-SKP1H 10.0 ± 2.6 GzCSN pFCLuc-SKP1H and the empty vector pFNLucG for transfection G. zeae Strain 7.5 ± 1.3 GzFNCS-1 A transforming G. zeae strain containing both pFNLuc-FBP1G and pFCLuc-SKP1H 64,098.3 ± 14,171.7
GzFNCS-3 Transgenic G. zeae containing both pFNLuc-FBP1G and pFCLuc-SKP1H Strain 86,223.0 ± 30,147.2
GzFNCS-5 A transforming G. zeae strain containing both pFNLuc-FBP1G and pFCLuc-SKP1H 101,781.3 ± 20,907.2
GzSNCF-2 A transforming G. zeae strain containing both pFCLuc-FBP1H and pFNLuc-SKP1G 43,338.0 + 14,662.8
GzSNCF-4 A transforming G. zeae strain containing both pFCLuc-FBP1H and pFNLuc-SKP1G 61,418.7 ± 4,171.8
GzFL The transformed G. zeae strain (full-length firefly luciferase gene) containing pPcrp-LUC, 325,586.4 ± 50,528.1 ChFNCS-1 Transgenic C. heterostrophus strains containing both pFNLuc-FBP1G and pFCLuc-SKP1H 23,207.0 ± 3,324.7
ChFNCS-7 Transgenic C. heterostrophus strains containing both pFNLuc-FBP1G and pFCLuc-SKP1H 17,322.7 ± 3,107.3
GzFNCS-1 ³ A transforming G. zeae strain containing both pFNLuc-FBP1G and pFCLuc-SKP1H 3,521.3 ± 1,555.1 ⁴
GzFNCS-3 ³ A transforming G. zeae strain containing both pFNLuc-FBP1G and pFCLuc-SKP1H 2,667.7 ± 947.5 ^4
1 obtained from 3 replicates.
² per minute per microgram protein relative light units (RLUs)
³ Fungal fluid culture after 5 min exposure to luciferin
RLUs per ⁴ ml / 10 ⁶ fungus Conidia spores

The luminescent activity induced by the interaction between GzMCM1 and FST12 in G. zeae ¹ Strain Characteristics Active ² Z03643 G. zeae wild strain 6.3 ± 2.5 GzFNCS-1 Transgenic G. zeae containing both pFNLuc-FBP1G and pFCLuc-SKP1H Strain 19,178.3 ± 1,455.3
GzFM-1 A transforming G. zeae strain containing only pFNLuc-MCM1G 7.7 ± 1.5 GzFMC pFNLuc-MCM1G and an empty vector pFCLucH for transformation G. zeae Strain 11.8 ± 2.4 GzFS-1 A transforming G. zeae strain containing only pFCLuc-FST12H 8.0 ± 4.0 GzFSN pFLuc-FST12H and an empty vector pFNLucG for transformation G. zeae Strain 13.7 ± 1.6 GzFSM-1 Transgenic G. zeae containing both pFNLuc-MCM1G and pFCLuc-FST12H Strain 795.3 ± 42.3 GzFSM-6 Transgenic G. zeae containing both pFNLuc-MCM1G and pFCLuc-FST12H Strain 479.3 + 49.2 GzFST-SKP-1 Transgenic G. zeae containing both pFNLuc-MCM1G and pFCLuc-SKP1H Strain 12.1 ± 3.5 GzFST-SKP-3 Transgenic G. zeae containing both pFNLuc-MCM1G and pFCLuc-SKP1H Strain 9.7 ± 3.4 ¹ obtained from three replicates of fungal cell separations.
² per minute per microgram protein relative light units (RLUs)

[ Example  3: Western blot hybridization ]

For protein extraction, eachG. zeae The strain was shaken in GzCM liquid medium at 25 ° C. for 4 days. The collected mycelium was aliquoted from liquid nitrogen and extracted according to the method described above (Bridge et al., 2004). Proteins are isolated by SDS / PAGE, firefly luciferase [Luciferase (251-550) (sc-32896; Santa Cruz Biothecnology), Anti-Luciferase (cat # L0159; Sigma) and Antibody for Luciferase-Aff-Purified ( AP21341PU-N, Acris Antibodies GmbH)] were blotted by three polyclonal primary antibodies and used as probes. After hybridization with the corresponding HRP-conjugated secondary antibody, the recombinant luciferase protein was purified by ECL^TM Observable with primary western blotting reagent (GE healthcare).

[ Example  4 : split Luciferase  Plasmids used for analysis DNA Generation of "

Multipurpose vector Backbone pFNLucG And pFCLucH: As starting materials for the preparation of vectors, the inventors have been used to prepare firefly luciferase compensation assays (Chen et al. 2008) in plant protoplasts or tissues, and luciferase fragments N-terminal (nLuc) and C- respectively. Plasmids pUC19-nLUC and pUC19-cLUC with terminal (cLuc) were used (Table 1). To replace the 35S promoter region in both plasmids with the fungus' strong promoter, eachEcoRI andSheetSimultaneously cut with I, which isCryphonectria parasiticaCryparin gene from (Kwon et al. 2009)Crp) 188 bp of the promoter, which was amplified from pCHPH1 (Table 1) using primer pairs 1 and 2,EcoRI-SheetAfter I cleavage, they were made with pFNLuc or pFCLuc, respectively. To introduce selective markers of the fungus into these plasmids, using primers 3 and 4, gene cassettes resistant to geneticin or hygromycin B amplified from pBCGT and pBCATPH are selected from pFNluc and one in pFCLucHinInserted into the dIII site, finally producing pFNLucG and pFCLucH, respectively (FIG. 1).

Because these constructs can be fused in the translation process from the plasmid to the respective splice luciferase gene using a simple gene cloning procedure as described below, the fungal gene pair of interest can be used as a backbone of a multipurpose vector for splice luciferase analysis in fungi Can be used.

pFNLuc - FBP1G and pFCLuc - SKP1H : G. zeae The FBP1 gene (denoted as FGSG_02095.3 in the F. graminearum genomic database (http://www.broadinstitute.org/annotation/genome/fusarium_graminearum/MultiHome.html)) corresponds to amino acid positions 1-703 and primer pair 5 And 6 (Table 2), amplified from plasmid pEGFC (Table 1).

Similarly, the SKP1 (FGSG_06922.3) region (aa2-170) was amplified from pACTgzskp (Table 1) using primer pairs 7 and 8 (Table 2). Two PCR products are introduced into the Sal I site or pFCLucH the Kpn I site of pFNLucG, using the In-Fusion® HD Cloning Kit (Clontech ), it was prepared each by pFNLuc-FBP1G and pFCLuc-SKP1H. Each PCR product is due to the linear vector have a 17-19bp additional nucleotide sequence in the complementary 5 'and 3' ends at the ends of (a cut with a pFCLucH pFNLucG or Kpn I digested with Sal I), 17-19bp complementary to the PCR product Can be inserted into the corresponding vector through recombination between the additional base sequences and the vector. In addition, both genes are inserted back into the same vector ( pFLuc and pFNLucG on SKF1 in pFCLucH ) to generate pFLuc-FBP1H and pFNLuc-SKP1G, respectively.

To this end, FBP1 domain (aa 2-704) and SKP1 domain (aa 1-169), is amplified from pEGFC pACTgzskp and using the respective primer pairs 9/10, and 11/12, (Table 2), each of Kpn I It was cut to the recombination with the pFNLucG pFCLucH and Sal I to cut. The in-frame translation fusion of the fungal gene and the luciferase fragment was confirmed by nucleotide sequencing of the structural vector.

pFNLuc - MCM1G and pFCLuc - FST12H : Saccharomyces of G. zeae (GzMCM1) The cerevisiae MCM1 heterologous gene (FGSG_08696.3) and the S. cerevisiae STE12 heterologous gene of G. zeae ( FST12 ; FGSG_07310.3) ( FST12 ; FGSG_07310.3) (Lee et al., 2006), respectively, were primer pairs 19 /. 20, and 21/22 were used to amplify from the total RNA of the G. zeae Z03643 strain. The PCR product was introduced into Sal I site of pFNLucG or pFCLucH the Kpn I site, was, respectively pFNLuc-MCM1G and pFCLuc-FST12H as described above.

pPcrp - FLUC : The Crp promoter of C. parasitica amplified from pCHPH1 (Table 1) is fused to the entire sequence of the firefly luciferase gene from the pSP-luc + NF fusion vector (Progmega) and to the pGEM-T vector (Promega). Inserted into pPcrp-FLUC. For the transformation of fungi, as pPcrp-FLUC and selective marker, a pBCGT containing gen was used as a fungal protoplasts (Table 1).

[ Example  5: Fungal transformation]

For the transformation of G. zeae , the fungus conidia collected from the CMC liquid medium for 3 days were inoculated with 50 ml of YPG liquid medium (Han et al. 2007) at a concentration of 10 ⁶ / ml, Lt; / RTI > for 24 hours. It was inoculated with 1 M NH4 Cl in 80 ml ₄ containing; (Desert Biologicals 10 mg / ml ) fungal minutes a little collected mycelium and give Cellar dehydratase (Driselase) for protoplast formation (protoplasting) derived from a living person. For C. heterostrophus , young hyphae collected from ChCM liquid cultures of fungal progeny grown by shaking culture at 25 ° C and 150 rpm for 18 hours were digested with Driselase at 0.7 M NaCl. Polyethylene glycol-mediated transformation using all other fungal protoplasts was performed as described above (Kim et al. 2008). Fungal transformation was selected in regeneration medium containing 70 mg / ml hygromycin B or 50 mg / ml geneticin or both.

[ Example  6: Luciferase  Verify Active]

The fungal cell separations obtained from mycelia grown on GzCM or ChCM liquid medium for 3 days were dropped into 96-well microtiter plates (40 μl per well) as described above (Lee et al. 2009), and luciferin (Sigma) 20 ≪ / RTI > Alternatively, 96-well plates filled with l50 [mu] l GzCM or ChCM liquid medium were inoculated with fungus spores (10 < ⁶ > / ml) taken from GzCM or ChCM plate media and analyzed prior to analysis et al., 2003) and cultured at 25 ° C for 1 day. Luciferase activity was measured using a GloMax 96 Microplate Luminometer (Promega) for 10 seconds (both cell separations and fungal liquid cultures) or luciferin for 5 minutes (fungal liquid culture) for 1-2 s intervals . The measurement was performed using the Bradford method (1976), and the total protein concentration was measured and standardized in the cell lysate, and relative light per unit micrograms per minute (RLUs) (Paulmurugan and Gambhir 2007) or per ml of fungal culture Expressed as RLU per 10 ⁶ spores.

Plasmid DNA prepared according to the above was transformed into wild strains of G. zeae and C. heterostrophus alone or by various combinations. The introduction of the plasmid DNA into the genome of the fungal transformant was confirmed by PCR amplification of the split luciferase gene (Fig. 2A) as well as fungal growth for the drug depending on the resistance gene present in each plasmid DNA. Expression of the transgene gene in the fungal transformants was confirmed by RT-PCR in fungal transformants (Figures 2 and 3). Also, qPCR analysis confirmed the relative transcript amount of the nLuc or cLuc fragment or the amount of the relative transcript fused to the fungal gene in the transformant. The average PCR efficiency of the primer set of each gene (Table 3) is 1.92-1.97. The transcript level of the transgene gene varies to about six times that of the investigated fungal transformants, indicating the potential effect of the transgene on the gene expression.

However, the level of transcripts fused to the nLuc and cLuc genes in a single transformant (including the transcript levels of the nLuc and cLuc genes in strains carrying the complete firefly luciferase gene) varies by a factor of 2 or less 4), indicating that the two splice luciferase genes are expressed at a relatively constant rate in one cell. Accumulation of recombinant proteins in the fungal transformants was confirmed by immunoblotting analysis. The specific signal for cLuc fused to SKP1 is the fungal strain and FBP1-nLuc and cLuc-SKP1 (GzFNCS-3 and GzFNCS-5 in Table 4), which are fungal strains expressing only fungal strain cLuc-SKP1 (GzCS in Table 4) Lt; RTI ID = 0.0 > fungal < / RTI >

Expression of cLuc-FST12 was also detected in transformants containing both GzMCM1-nLuc and cLuc-FST12 (GzFSM-1 and GzFSM-6 of Table 5) (Figures 5 and 6). However, despite the use of three different anti-luciferase antibodies, none of the nLuc-fusion proteins were detected, indicating that this antibody is specific for the cLuc region of firefly luciferase. There was no difference in the irradiated transformants when compared to their wild type strains in various characteristics such as mycelial growth, pigmentation and sporulation (data not shown).

As a negative control, the inventors have found that only the fused transformants (i.e., pFNLucG and / or pFCLucH) and one fused gene containing an empty vector having only the split luciferase gene and the corresponding empty vector 5). ≪ / RTI >

All cell separations and the fungal liquid medium from the negative control are xenograft genes with one empty vector (GzN or GzC), with 1 fusion gene (GzFN or GzCS) or one corresponding empty vector (GzFNC or GzCSN) exhibit background-level luciferase activity similar to wild-type strains that do not have a vector (Table 4). Also, the flanking traits of two flanking vectors (pFNLucG and pFCLucH) The transformant (GzNC) expresses two splice luciferase fragments together, showing similar levels to the other negative controls (Table 4).

These results indicate that not only are each of the split luciferase fragments small and not sufficient, but also that in splittable fungi as previously reported in animals (Luker et al., 2004) Indicating that spontaneous binding of the luciferase fragment does not occur.

Conversely, all irradiated fungal transformants FBP1-nLuc and cLuc-SKP1 expressing together the two fused proteins exhibited a strong luciferase that exhibited at least 5,000-fold increase in cell separations compared to that of negative control (Table 4) It shows the activity of the azeotrope. The level of luciferase activity in these transformants is about three times less than in the GzFL strain expressing approximately full length firefly luciferase under the same promoter (Table 4), indicating that FBP1 and SKP1 accumulated in fungal cells Indicating that most of the proteins participate in protein-interaction. In particular, changes in the number of luciferase activities in cell separations were significantly reduced when compared to beta- galactosidase activity between the same protein combinations in yeast-to-hybrid assay (100-180 fold; Han et al. 2007) Indicating that split-luciferase provides an amplified signal for detection from mute fungi to weak protein interactions.

In addition, the protein interactions of FBP1 and SKP1 fused in opposite directions to split luciferase, respectively (ie cLuc-FBP1 and SKP1-nLuc), are also similar to the interactions of FBP1-nLuc and cLuc-SKP1 in G. zeae . And strong luciferase activity (Table 4), indicating the versatility of split luciferase fragments used in the study of protein-protein interactions in filamentous fungi. Reduced luciferase activity in C. heterostrophus transformants, including both FBP1-nLuc and cLuc-SKP1, may contribute to interactions between heterologous proteins in different genetic backgrounds.

As in the FBP1-SKP1 interaction described above, only the cell separations of the fungal transformants expressing the two fusion proteins GzMCM1-nLuc and cLuc-FST12 coexisted with Lucifera, about 60-130 times higher than the background level of the negative control, (Table 5). This clearly indicates that GzMCM1 interacts with FST12 in G. zeae , as in S. macrospora (Nolting and Poggeler, 2006b).

However, fluorescence intensity in G. zeae co-expressing both proteins was consistent with G. zeae co-expressing FBP1-nLuc and cLuc-SKP1. Much lower than the strain (approximately 24 times lower). Given the level of transcript and protein accumulation of the fused gene between the two transformants, this weak interaction signal may contribute to the possible location and / or specificity of the GzMCM1 and FST12 interactions, which are FBP1 in G. zeae . And SKP1 interaction.

First, Son et al (2011) identified both GzMCM1 and FST12 as transcription factors belonging to the MADS box- and homeomain-family, respectively, and confirmed that each protein coding gene is essential for spore development by gene deletion analysis Respectively. This means that the interaction between GzMCM1-nLuc and cLuc-FST12 proteins may be limited to gene regulation in the nucleus of the fungal transformant, whereas FBP1 and SKP interactions occur in the cytoplasm, which is G. This is because it is required for SCF (SKP1-Cullin-F-box protein), a complex for proteasome-dependent degradation of various proteins in zeae (Han et al., 2007).

Second, in contrast to the components of the SCF complex, GzMCM1 may have more interacting partners besides FST12, since MCM1 is known to interact with a range of transcription factors to regulate a variety of cellular event events in fungi (Messenguy and Dubois, 2003, Nolting and Pogments, 2006a). Similarly, FST12 can have other interacting proteins, like yeast STE12 and its homologous genes of the mating fungus, which are responsible for the joining process, pseudohyphal growth, cell wall biosynthesis, pathogenicity and sporulation in MAP kinase signal transduction (Li et al., 2005; Rispail and Di Pietro, 2010; Tsuji et al., 2003; Vallim et al., 2000). In addition, background levels of luciferase activity in the species containing GzMCM1-nLuc and Cluc-SKP1 demonstrate that interactions between proteins that do not interact naturally with each other can not be detected in split-luciferase assays ).

Split luciferase assays have several advantages over the yeast two-hybrid method. First, it can be readily used to identify binding proteins of proteins that can have a self-transcriptional promoting activity such as transcription factors, since this assay is useful for promoting the transcription of reporter genes induced by bait- Is not required. In the present invention, the successful complementation of the splice luciferase fragments induced by the interaction of GzMCM1 and FST12 provides direct evidence that this assay can overcome the major limitations of the yeast two-hybrid method. In S. macrospora , it is difficult to identify protein interactions between MCM1 and STE12 (the homolog of FST12) using the yeast two-hybrid method because of the strong self-transcriptional activity of the entire MCM1 protein, and the MCM1 N-terminus is used as a bait. Only when it is possible to identify yeast two-hybrid (Nolting and Poggeler, 2006b).

Second, since the luciferase complemented in both the cell separator and the fungus cell can catalyze the in vivo luminescence reaction, the protein interaction can be detected regardless of the cell position occurring. In this regard, the present invention provides positive results that protein-protein interactions are available even if they occur in different organelles such as intracellular (FBP1-SKP1) and intracellular (GzMCM1-FST12). The latter case also shows that split-luciferase assays can provide amplified signals to detect even mild protein interactions in mating fungi.

Third, split luciferase assays can be performed directly in fungal cells to identify protein-protein interactions. vivo There is no need for further experimentation because of the status.

Finally, the luciferase activity measured directly from fungal cell cultures is sufficient to detect protein-protein interactions, which is faster to analyze because there is no need to make cell separations from fungal cultures. Furthermore, since the luciferase activity measured immediately after the start of the reaction with luciferin is not different from that after the 5-minute reaction, no additional reaction of the fungal culture to luciferin is required (Table 4). Due to this advantage, as well as the detection of individual protein-protein interactions, the split-luciferase assay developed here can be used to prepare a fusion library with split-luciferase in mating fungi, followed by high-speed mass spectrometry (high-throughput analysis). Protein-protein high-throughput analysis has been developed in Arabidopsis protoplasts based on this analysis (Fujikawa and Kato, 2007). Furthermore, if the nLuc- or cLuc-fusion protein is expressed under the control of the original promoter instead of the over-expressed promoter ( PCrp ) used in the present invention, the original temporal and / or spatial interaction between the proteins can be investigated. Recently, the inventors have revealed that the natural promoter of the fungus (TRI6 promoter, which encodes a transcription factor that modulates the production of trichothecene) produces luciferase activity in G. zeae , which is clearly a luminometer. Was detected, but was found to be about 200-fold lower than in the GzFL strain expressing full-length firefly luciferase under PCrp (Table 4, Kim et al., Unpublished data). Indicating that it may be sensitive enough to detect protein-protein interactions with the relatively weak original promoter in fungi.

In addition, luminescence can be visualized at the cellular level using an in vivo microscopy imaging system (eg, LV200; Olympus). Furthermore, no external light stimulus is required and a high signal-to-noise ratio (S / N) , Split-luciferase assays may be sufficiently effective and sensitive than BiFC using fluorescent reporters. Despite the positive results provided by the present invention, further studies are needed to confirm the application of split-luciferase assays.

The strong protein interactions demonstrated in this study are based on the formation of SCF complexes for proteolysis in G. zeae (Han et al., 2007). Because such interactions occur within the cytoplasm, it is relatively easy to detect using the yeast two-hybrid approach. Therefore, the versatility of the split-luciferase complementarity assay method should be tested for more diverse protein interactions at various intracellular locations. Moreover, fusion between the protein of interest and split luciferase can affect the success of protein interactions, including the function of the original protein, in luciferase complementarity, luciferase activity, and / or fungal cells. Therefore, it will be necessary to confirm whether the fused protein can function as the original molecule by genetic complementation with the gene encoding the original protein-free fungal protein. It is also necessary to test other kinds of protein interactions, such as protein-to-protein bonds that can be separated under the same conditions, or proteins that do not naturally bind to each other (tested as interactions between GzMCM1-nLuc and cLuc-SKP1 in the present invention) . Nevertheless, in both G. zeae and C. heterostrophus , the successful supplementation of split luciferase fragments makes this method a very useful tool for research for protein-protein interactions in filamentous fungi.

Claims (3)

A gene encoding the N-terminus or C-terminus of firefly luciferase; Promoter of creeparin gene (Crp); EcoRI And SacI Restriction enzyme sites; Geneticin or hygromycin B resistance gene cassettes; And HindIII A vector for analyzing protein interactions of filamentous streptococci comprising restriction enzyme sites. The promoter region of the plasmid (pUC19-nLUC or nUC19-cLUC) having the N-terminus (nLuc) or the C-terminus (cLuc) of luciferase was named EcoRI And SacI ;
The EcoRI and Binding the cryparin gene promoter ( Crp ) to SacI degradation site;
Amplifying from pCHPHI using primer pair 1 (CCGAATTCCTCGAGACAGGACCAGAGA) and 2 (CGAGCTCTTTGATTGAAGTTTGGAG) to produce pFNLuc or pFCLuc; and
A geneticin or hygromycin B resistance gene cassette amplified from pBCGT and pBCATPH was inserted into one HindIII site in pFNluc and pFCLuc using primers 3 (CCCAAGCTTAGGATTACCTCTAAACAAGTGTACC) and 4 (CCCAAGCTTAGAAGATGATATTGAAGGAGCACTT) To produce pFNLucG or pFCLucH, respectively;
Wherein the method comprises the steps of: A method for analyzing interactions between proteins in a mycotic fungus by inserting a gene encoding a protein to be analyzed into the vector of claim 1 and measuring the fluorescence intensity of the luciferase expressed by the split luciferase assay.

Images