KR20130109600A - Use of hdac2 as a diagnostic marker for gastic cancer - Google Patents

Abstract

PURPOSE: A histone deacetylase 2 (HDAC2) gene is provided to increase expression levels in gastric cancer tissues or cells compared with normal tissues or normal cells, thereby quickly and accurately diagnosing and predicting gastric cancer. CONSTITUTION: A composition for diagnosing gastric cancer contains a material which measures HDAC2 gene or protein levels. The material is a primer or a probe which amplifies HDAC2 gene. The material is an antibody which specifically recognizes HDAC2 protein. A method for predicting and diagnosing gastric cancer comprises the steps of: measuring HDAC2 gene or protein levels in a biological sample; and comparing the expression levels with HDAC2 gene or protein levels of a control group.

Description

Use of HDAC2 as a diagnostic marker for gastic cancer

The present invention relates to a novel gastric cancer diagnostic marker, gastric cancer diagnostic composition, gastric cancer diagnostic kit, microarray and gastric cancer diagnostic method that can effectively diagnose and predict gastric cancer early.

Stomach cancer is a very common cancer in Asia and one of the leading causes of cancer deaths worldwide. In the past few years, many attempts have been made to better understand the biological processes involved in the development of gastric cancer, as well as to improve understanding of the carcinogenesis mechanisms, as well as early diagnosis and treatment of gastric cancer. Phosphorus remains a subject of study.

On the other hand, histone acetylation is a major modification that affects gene transcription and is regulated by histone acetyltransferases (HATs). Histone deacetylases (HDACs) are enzymes that remove acetyl groups from hyperacetylated histones, returning histones to the ground state in response to the effects of HATs, and inhibiting gene transcription. (Marks P, Rifkind RA, Richon VM, Breslow R, Miller T, Kelly WK. Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer 2001; 1: 194-202). Mammalian HDACs can be divided into four different classes and contain 18 isoforms based on homology with yeast counterparts (Glozak MA, Seto E. Histone deacetylases and cancer.Oncogene 2007; 26: 5420-32).

Accordingly, Witt O, Deubzer HE, Milde T, Oehme I. HDAC family: What are the cancer relevant targets? According to Cancer Lett 2009; 277: 8-21, HATs and HDACs are disclosed to be involved in cell proliferation, differentiation and cell cycle regulation, and another prior publication, Yang XJ, Seto E. HATs and HDACs: from structure, function and regulation strategies for therapy and prevention. nnnkkOncogene 2007; 26: 5310-8 discloses that the pathological activity and deregulation of HDACs can lead to diseases such as cancer, immunological disorders and muscular dystrophy.

However, HDAC2, one of the HDACs family according to the present invention, can be used as a diagnostic marker for diagnosing gastric cancer, or little is known about the biological function related to gastric cancer development.

Only similar prior art documents, such as a gene marker for detecting the development of gastric cancer, including Korean Patent Nos. 0892588, Korean Patent Nos. 1019727 and 1009062 for gastric cancer diagnostic kits and chips using gastric cancer specific methylation marker genes Etc.

In this regard, the present inventors have performed experiments that can reveal a direct relationship between HDAC2 and gastric cancer, and have completed the present invention according to the results.

Therefore, an object of the present invention is to provide a composition for the diagnosis of gastric cancer markers consisting of the HDAC2 gene or a protein encoded from the gene.

In addition, another object of the present invention to provide a composition for diagnosing gastric cancer comprising a substance for measuring the level of the HDAC2 gene or HDAC2 protein.

In addition, another object of the present invention to provide a gastric cancer diagnostic kit and gastric cancer diagnostic microarray comprising the gastric cancer diagnostic composition of the present invention.

In addition, another object of the present invention is to provide a method for predicting and diagnosing gastric cancer comprising measuring the expression amount of HDAC2 gene or the amount of protein.

In order to achieve the above object of the present invention, the present invention provides a composition for a gastric cancer diagnostic marker consisting of HDAC2 (Histone deacetylase 2) gene or HDAC2 protein encoded from the gene.

In one embodiment of the present invention, the HDAC2 gene may be one having a nucleotide sequence of SEQ ID NO: 1.

In addition, the present invention provides a composition for diagnosing gastric cancer, comprising a substance for measuring the level of HDAC2 gene or HDAC2 protein.

In one embodiment of the invention, the material for measuring the level of the HDAC2 gene may be a primer or probe that can amplify the HDAC2 gene.

In one embodiment of the invention, the substance for measuring the level of the HDAC2 protein may be an antibody that specifically recognizes the HDAC2 protein.

Further, according to the present invention,

(a) measuring the amount of HDAC2 gene expression or the amount of HDAC2 protein present in the biological sample; And

(b) providing a method for predicting and diagnosing gastric cancer, comprising comparing the measurement result of step (a) with the amount of HDAC2 gene expression or the amount of HDAC2 protein in the control sample.

In one embodiment of the invention, the biological sample may be selected from the group consisting of tissue, cells, blood, serum, plasma, saliva and urine.

In one embodiment of the invention, the measurement is reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, Western blot, Northern blot, ELISA (enzyme linked) It may be selected from the group consisting of immunosorbent assay, radioimmunoassay (RIA), radioimmunodiffusion, immunoprecipitation assay, and immunohistochemical analysis.

As the HDAC2 gene according to the present invention has been found to have increased expression in tissues or cells of gastric cancer compared to non-gastric cancer tissues or cells, when the HDAC2 gene is used as a marker for diagnosing gastric cancer, gastric cancer can be rapidly and accurately diagnosed and predicted early. It is effective, and furthermore, it can be used as a target for the development of gastric cancer treatments.

1 is a photograph showing abnormal HDAC2 expression in human gastric cancer cells. (A) Expression of HDAC2 expression in a subset of gastric cancer tissue, (B) Analysis of HDAC2 expression in various gastric cancer cell lines by RT-PCR and Western blot analysis, (C) qRT-PCR ( It is a graph showing other quantitative expression patterns of HDAC in MKN-1 cells via real time quantitative RT-PCR.
Figure 2 p16 ^INK4a in gastric cancer cells It is a graph showing the epigenetic inactivating mechanism of genes.
3 is a graph showing that HDAC2 induces the growth of gastric cancer cells beyond the regulation of cell cycle proteins.
4 is a graph confirming that cellular apoptosis and autophagic cell death are induced through HDAC2 inhibition in gastric cancer cells.
5 is a graph investigating the effect of HDAC2 on metastatic potential in gastric cancer cells.
FIG. 6 is a graph showing that tumorigenic potential is reduced through continuous inhibition of HDAC2 in MKN-1 cells.
Figure 7 shows the results confirmed in vivo experiments to reduce the tumor formation through the continuous inhibition of HDAC2 in MKN-1 cells.

The present invention confirms whether abnormal expression of HDAC2 in gastric cancer tissue is related to gastric cancer development, and confirms that the expression of HDAC2 gene is overexpressed in gastric cancer tissue and gastric cancer cell compared to normal tissue and normal cell gastric cancer. It is characterized by the fact that it can be used as a biomarker for diagnosis.

In other words, the present inventors found that, in relation to the biological function of HDAC2 in gastrocarcinomagenesis, p16 ^INK4a and HDAC2 by ^abnormal methylation of ^HDAC2 enables malignant traits of gastric cancer cells and DNA methylation associated therewith. Exclusive mutual gene regulation mechanisms were identified. In addition, the use of cell lines deficient in HDAC2 in vitro and in vivo confirmed that HDAC2 has the potential to cause tumor development.

According to one embodiment of the invention, it was demonstrated that the HDAC2 gene was overexpressed in a subset of human gastric cancer tissues and found the anti-growth effect of HDAC2 inactivation in gastric cancer cell lines (see FIG. 1).

According to one embodiment of the invention, HDAC2 and via its promoter methylation is regulated expression of p16 ^INK4a, it was found to appear mutually exclusive inert gene of p16 ^INK4a in gastric cancer cells (see Fig. 2).

According to another embodiment of the present invention, it was confirmed that the inhibition targeting HDAC2 in gastric cancer cells inhibits the expression of the pro-apoptotic proteins Bax, AIF, Apaf-1 and Bcl-2 at the same time (FIG. 3). And 4).

According to another embodiment of the present invention, it is understood that inhibition targeting HDAC2 induces both mitochondrial-mediated apoptosis and caspase-independent autophagic cell death, and this synergistic effect provides very potent tumorigenic potential. In addition, it was found that down-regulation of genes related to tumor permeability, such as cell motility and invasion (see FIG. 5).

In addition, according to one embodiment of the present invention, HDK2 deficient MKN-1 cells in both in vitro and in vivo experiments confirmed that growth is delayed and cellular aging is increased (see FIGS. 6 and 7).

As a result, the inventors have found that with the fact that HDAC2 is overexpressed in gastric cancer, the p16 ^INK4A promoter methylation in p16 ^INK4A By mediating mutual epigenetic gene inactivation, selective inhibition of HDAC2 induced cell division defects, leading to gastric cancer cell death.

Therefore, the HDAC2 gene can be used as a biomarker for diagnosing gastric cancer, and it can be seen that gastric cancer can be treated using a molecular substance that selectively inhibits HDAC2.

Therefore, the present invention can provide a novel gastric cancer diagnostic marker comprising the HDAC2 gene or the HDAC2 protein encoded from the gene.

Preferably, the HDAC2 gene may have a nucleotide sequence represented by SEQ ID NO: 1.

In the present invention, the term diagnosis refers to confirming a pathological condition. For the purpose of the present invention, the diagnosis means confirming the expression of gastric cancer diagnostic markers and confirming the onset of gastric cancer. Diagnosis in the present invention includes determining whether the gastric cancer diagnostic markers are expressed and the degree of expression, and determining whether the gastric cancer is developed, developed, and reduced.

In addition, the diagnostic marker (diagnosis marker) means a substance capable of diagnosing the cells of gastric cancer from normal cells, polypeptides or nucleic acids (eg, mRNA, etc.) showing an increase or decrease in the cells of gastric cancer compared to normal cells ), Lipids, glycolipids, glycoproteins, organic biomolecules such as sugars (monosaccharides, disaccharides, oligosaccharides, and the like) and the like. Gastric cancer diagnostic markers provided by the present invention may be an HDAC2 gene or protein in which the expression amount of gastric cancer cells is increased compared to normal cells.

In addition, the present invention provides a composition for diagnosing gastric cancer, comprising a substance for measuring the level of HDAC2 gene or the level of HDAC2 protein.

In the present invention, the level of the HDAC2 gene, preferably means the mRNA level, that is, the amount of mRNA, the expression of the HDAC2 gene, and the material capable of measuring the level may include a primer or probe specific for the HDAC2 gene. Can be. In the present invention, the primer or probe specific for the HDAC2 gene may be a primer or probe capable of specifically amplifying the entire HDAC2 gene or a specific region of the gene represented by SEQ ID NO: 1, wherein the primer or probe is known in the art. You can design it through the method.

The term primer in the present invention refers to a single-strand that can serve as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in suitable buffers. Oligonucleotides. The appropriate length of the primer may vary depending on various factors, such as temperature and use of the primer. In addition, the sequence of the primer does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient that the primer has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer. Therefore, the primer in the present invention does not need to have a sequence that is perfectly complementary to the nucleotide sequence of the HDAC2 gene, which is a template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing to the gene sequence and acting as a primer. In addition, it is preferable that the primer according to the present invention can be used for gene amplification reaction, and most preferably, primer pairs of SEQ ID NO: 2 and SEQ ID NO: 3.

The amplification reaction refers to a reaction for amplifying a nucleic acid molecule. The amplification reactions of these genes are well known in the art, and examples thereof include polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR) (LCR), electron mediated amplification (TMA), nucleic acid sequencing substrate amplification (NASBA), and the like.

In the present invention, the term probra refers to a linear oligomer of natural or modified monomers or linkages, and includes deoxyribonucleotides and ribonucleotides and can specifically hybridize to a target nucleotide sequence, and is present naturally. Or artificially synthesized. The probe according to the invention may be single chain, preferably oligodioxyribonucleotides. Probes of the invention can include natural dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), nucleotide analogs or derivatives. In addition, the probe of the present invention may also include a ribonucleotide. For example, the probes of the present invention can be used in combination with a framework-modified nucleotide such as a peptide nucleic acid (PNA) (M. Egholm et al., Nature, 365: 566-568 (1993)), phosphorothioate DNA, phosphorodithioate DNA, phosphoamidate DNA, amide-linked DNA, MMI-linked DNA, 2'-O-methyl RNA, alpha-DNA and methylphosphonate DNA, sugar modified nucleotides such as 2'- 2'-O-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl DNA, hexose DNA, pyranosyl RNA, and anhydrohexy Tolyl DNA, and nucleotides with base modifications such as C-5 substituted pyrimidines wherein the substituents are fluoro, bromo, chloro, iodo-, methyl-, ethyl-, vinyl-, formyl-, 7-deazapurines having C-7 substituents (the substituents being fluoro, bromo, chloro, bromo, chloro, , Iodo-, me -, ethyl-, vinyl-, formyl-, alkynyl -, alkenyl-, quinolyl and quinoxalyl thiazol-, quinolyl and quinoxalyl imidazolidin -, pyridyl-), inosine, and may include a diamino purine.

In addition, the substance that can measure the level of the HDAC2 protein in the present invention may include antibodies such as polyclonal antibodies, monoclonal antibodies and recombinant antibodies that can specifically bind to the HDAC2 protein.

In addition, in the present invention, as described above, since HDAC2 protein has been identified as a marker protein for diagnosing gastric cancer, a method for producing an antibody using the protein uses techniques known to those skilled in the art. It can be manufactured easily. For example, in the case of polyclonal antibodies, HDAC2 antigen can be produced by methods well known in the art that inject the animals and collect blood from the animals to obtain serum comprising the antibodies, which polyclonal antibodies are goat, rabbit, sheep. Can be produced from any animal species host such as, monkey, horse, pig, cow, dog, and the like. In the case of monoclonal antibodies, the hybridoma method (Kohler et al., European Jounral of Immunology, 6, 511-519, 1976) to be prepared, or phage antibody libraries using (Clackson et al, Nature, 352 , 624-628, 1991, Marks et al, J. Mol Biol, 222:.. 58 , ≪ / RTI > 1-597, 1991). In addition, the antibodies according to the invention may comprise functional fragments of antibody molecules, as well as complete forms having two full length light chains and two full length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.

The present invention also provides a kit for diagnosing gastric cancer, comprising a composition for diagnosing gastric cancer capable of measuring the expression level of an HDAC2 protein or a gene encoding the same.

Gastric cancer diagnostic composition included in the kit for diagnosing gastric cancer of the present invention may include a primer, a probe or an antibody capable of measuring the expression level of HDAC2 protein or a gene encoding the same, and the definition thereof is as described above.

When the kit for diagnosing gastric cancer of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as buffers, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth) ), Thermus filiformis, Thermis flavus, Thermococcus literalis or thermally stable DNA polymerase obtained from Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs, wherein the kit for diagnosing gastric cancer of the present invention is applied to immunoassay. In the case, the kit of the present invention may optionally comprise a substrate of a secondary antibody and a label.

Further, the kit according to the present invention may be manufactured from a number of separate packaging or compartments containing the reagent components described above.

In addition, the present invention provides a gastric cancer diagnostic microarray comprising a composition for diagnosing gastric cancer capable of measuring the expression level of HDAC2 protein or a gene encoding the same.

In the microarray of the present invention, primers, probes or antibodies capable of measuring the expression level of the HDAC2 protein or gene encoding it are used as a hybridizable array element and immobilized on a substrate. Preferred substrates may include, for example, membranes, filters, chips, slides, wafers, fibers, magnetic beads or nonmagnetic beads, gels, tubing, plates, polymers, microparticles and capillaries, as suitable rigid or semi-rigid supports have. The hybridization array elements are arranged and immobilized on the substrate, and such immobilization can be performed by chemical bonding methods or covalent bonding methods such as UV. For example, the hybridization array element can be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bonded by UV at the polylysine coating surface. In addition, the hybridization array element can be coupled to the substrate via a linker (e.g., ethylene glycol oligomer and diamine).

On the other hand, when the sample to be applied to the microarray of the present invention is a nucleic acid, it may be labeled and hybridized with an array element on a microarray.

Hybridization conditions may vary, and detection and analysis of hybridization degree may be variously performed depending on the labeled substance.

In addition, the present invention can provide a method for providing information for predicting and diagnosing gastric cancer by measuring the expression level or HDAC2 protein level of the HDAC2 gene, the method (a) expression of the HDAC2 gene present in a biological sample Measuring the amount or amount of protein; And (b) comparing the measurement result of step (a) with the expression amount or protein amount of the HDAC2 gene of the control sample. The method of measuring the expression level or HDAC2 protein level of the HDAC2 gene in the above may be carried out including a known process for separating mRNA or protein from biological samples using known techniques.

In the present invention, the "biological sample" refers to a sample collected from a living body, wherein the expression level or protein level of the HDAC2 gene is different from a normal control group according to the incidence or progression of gastric cancer. But not limited to, tissue, cells, blood, serum, plasma, saliva, urine, and the like.

Determination of the expression level of the HDAC2 gene is preferably to measure the level of mRNA, the method of measuring the level of mRNA reverse transcription polymerase chain reaction (RT-PCR), real-time reverse transcription polymerase chain reaction, RNase protection assay, Northern blots and DNA chips, and the like, but is not limited thereto.

The measurement of the HDAC2 protein level can use an antibody, in which case the HDAC2 marker protein in the biological sample and the antibody specific to it form a binding, i.e., an antigen-antibody complex, and the amount of antigen-antibody complex formation is detected. Quantitative measurements can be made through the magnitude of the signal on the label. Such detection labels can be selected from the group consisting of enzymes, minerals, ligands, emitters, microparticles, redox molecules and radioisotopes, but is not limited thereto.

Analytical methods for measuring protein levels include, but are not limited to, Western blot, ELISA, radioimmunoassay, radioimmunoassay, oukteroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, Complement fixation assays, FACS, protein chips, and the like.

Therefore, the present invention can determine the amount of HDAC2 mRNA expression or protein in the control group and the amount of HDAC2 mRNA expression or protein in gastric cancer patients or suspected gastric cancer patients, and the degree of the expression amount through the detection method as described above By comparing with, it is possible to predict and diagnose the incidence, progression or prognosis of gastric cancer.

Meanwhile, as described above, the present inventors analyzed whether the HDAC2 gene may act as a carcinogenic factor through the fact that the expression of the HDAC2 gene is significantly overexpressed in gastric cancer tissues and cells compared to normal tissues and cells. When the gene was selectively inhibited (knocked out), it was confirmed that the growth of cancer cells was effectively inhibited.

Therefore, the overexpression of the HDAC2 gene according to the present invention has a very close effect on the growth, proliferation, and migration of gastric cancer cells. A composition including a nucleic acid molecule capable of inhibiting HDAC2 gene expression may be used as a composition for treating gastric cancer. have.

Therefore, the present inventors have found a use as a marker to determine the occurrence of gastric cancer in the HDAC2 gene through the embodiments performed, and confirmed the potential as a target gene for gastric cancer treatment.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited to these examples.

< Example  1>

HDAC2 Overexpression in Gastric Cancer Cells

<1-1> Cell Culture and Pharmaceutical Treatment

Human stomach cancer cells (MKN-1, SNU-1, -216, -484, -620, -638, -668 and -719) used in this example are KCLB (Korean Cell Line Bank, Seoul). , South Korea), and AGS, NIH-3T3 / Ras and HT1080 cells were purchased from ATCC (Manassas, VA, USA). Each cell line was incubated in PMI1640 or DMEM medium supplemented with 10% fetal bovine serum (FBS, Sigma, St Louis, MO) and a medium containing both 100 units / ml penicillin and streptomycin. And incubated at 37 ° C. in a humidified incubator with 5% carbon dioxide. Transfection was performed using oligofectamine reagent (Invirtogen, Carlsbad, Calif.) According to the manufacturer's instructions. To inhibit DNA methylation of tumor cells, cells were treated with 2 μM of 5-aza-deoxycytidine (5-aza-dC, Sigma) for 5 days and fresh medium was supplemented every 24 hours. To induce an autophagic response in cells, 10 μM ceramide (N-acetyl-d-erythro-sphingosine; Calbiochem Co., La Jolla, Calif.) Was added to DMSO. Cells were treated with nocodazole (50 ng / ml; Sigma) for 20 hours to co-generate cells in the metaphase / anaphase of phase M of the cell cycle, and nocodazole- to return to the cell cycle after washing the cells. Resuspend in free culture medium.

<1-2> Through Immunohistochemical Analysis HDAC2 Expression Analysis of

To confirm abnormal expression of HDAC2 in gastric cancer cells, we performed immunoblotting of HDAC2 in 12 randomly selected human gastric tumor tissues.

As a result, as shown in FIG. 1A, HDAC2 was overexpressed at a very high level compared to the case of non-tumor tissue in 9 of 12 gastric cancer tissue samples. In addition, as shown in FIG. 1B, the HDAC2 protein was overexpressed in human gastric cancer cell lines except for a few exceptions. In addition, as shown in FIG. 1C, the analysis of HDACs through qRT-PCR using specific primers (see Table 1) of the genes belonging to the HDAC families in MKN-1 cells confirmed that the most expression of HDAC2 was observed. .

Therefore, the present inventors found that HDAC2 exhibited the most significant histone deacetylase activity in gastric cancer cells, and it was confirmed that HDAC2 gene was overexpressed in gastric cancer cell lines, thus confirming the use of HDAC2 gene as a diagnostic marker for gastric cancer diagnosis. Could.

Primer sets of genes belonging to the HDAC family gene Forward primer
(Forward primer) Reverse primer
(Reverse primer) Product size (bp) HDAC1 GGATCGGTTAGGTTGCTTCA CAGGCAATTCGTTTGTCAGA 428 HDAC2 GACAGGGTCATCCCATGAAG AATTCAAGGATGGCAAGCAC 418 HDAC3 CTTTTCCAGCCGGTTATCAA CAGCCTCATCAGTCCTGTCA 490 HDAC4 CAGAGTTCTCCACCCCAGAG AGGATGGCGATGTGTAGAGG 429 HDAC5 TAAAGCTGAGGCTCCAGGAA GAGCATCTCAGTGGGGATGT 495 HDAC6 ACCAGGCAGCGAAGAAGTAG GTGCTTCAGCCTCAAGGTTC 405 HDAC7 GACAGTCTCTGAGCCCAACC TTAAGGACTGGGCAAAGTGG 566 HDAC8 CGACGGAAATTTGAGCGTAT ATAGCCTCCTCCTCCCAAAA 429 GAPDH CGACCACTTTGTCAAGCTCA GGGTCTTACTCCTTGGAGGC 102

< Example  2>

HDAC2 Through P16 ^{INK4 alpha} Mutual Post-sexual ( mutual epigenetic A) gene inactivation assay

<2-1> Gastric cancer tissue and cell line preparation

Gastric cancer tissue was selected from nine selected gastric cancer tissues from patients undergoing gastric cancer surgery. Human gastric cancer cell line AGS and monkey kidney fibroblast cell line COS-1 as a control were treated with American Type Culture Collection (ATCC; Manassas, VA). , SNU-216, SNU-484, SNU-638, SNU-668, SNU-719, MKN-1, MKN-28 and MKN-74 as human gastric cancer cell lines (KCLB, Purchased in Korea). Each of these cell lines was either RPMI 1640 or DMEM medium supplemented with 10% fetal bovine serum (Sigma, St Louis, MO, USA) and 1 mg / ml penicillin / streptomycin (Invitrogen, Carlsbad, CA, USA). Incubated in the.

<2-2> analysis result

Haston acetylation and DNA methylation are known as epigenetic modifications, which are essential for the regulation of chromatin structure and gene expression. In malignant gastric tumors, several genes such as p16INK4a , E- cadherin , and hMLH1 are often found to be abnormal methylation. Thus, the present inventors attempted to determine whether epigenetic gene silencing through promoter methylation in gastric cancer causes mitogenic potential due to histone deacetylation.

Thus, we found that among the genes associated with the CpG island methylation phenotype in gastric cancer, p16I ^NK4a in gastric cancer cells. It is hypothesized that the activity of the gene is inactivated by hypermethylation of the promoter region or otherwise through histone deacetylation by HDAC2.

First, the methylation status of the promoter region of p16I ^NK4a gene in gastric cancer cell lines was confirmed through a methylation-specific PCR (MSP) assay. For MSP analysis, two types of primers (ie p16-150 and p16-234) can be located in the region around the transcrition start site of the p16I ^NK4a gene and in the region associated with the loss of gene expression. It was. At first, experiments were conducted with MKN-1 and SNU-484 cells. As a result, it was confirmed that growth was slowed by HDAC2 deletion, and a non-methylated form of the p16I ^NK4a gene promoter region was found. In contrast, the other two cell lines, SNU-216 and SNU-719, had no effect on growth due to HDAC2 deletion, but hypermethylation was observed in the p16I ^NK4a gene promoter region as shown in FIG. 2A. . This explains why the two types of gastric cancer cells differ in their response to tumor cell growth upon HDAC2 inhibition.

We then examined ^whether HDAC2 deletion restores the expression of p16I ^NK4a gene in gastric cancer cells with the p16I ^NK4a gene promoter region in a non-methylated state.

In other words, as a result of examining the effect of HDAC2 deletion on p16I ^NK4a gene expression in MKN-1 and SNU-484 cells, the expression of p16I ^NK4a gene was restored as expected by the present inventors, and 5-aza-dC (DNA). There was no effect on the methyltransferase inhibitor. In contrast, as in FIG. 2B, inhibition of DNA methyltransferase strongly restored expression of the p16I ^NK4a gene in SNU-216 and SNU-719 cells.

Through the above results, the present inventors have a dual mechanism in which histone acetylation and promoter methylation respectively regulate gene transcriptional activity, and regulate the expression of p16I ^NK4a gene in malignant gastric tumor formation. I found out.

To further prove this fact, we analyzed p16I ^NK4a gene expression and promoter methylation in human gastric cancer tissues. From the subset of the gastric cancer tissues tested, three pairs having relatively no difference in HDAC2 expression between the four pairs of gastric tumors, normal and tumors corresponding to HDAC2 overexpressed non-tumor tissues in tumor cancer cells were selected. It was. As shown in FIG. 2C, all selected gastric cancer tumor tissues were found to exhibit no p16I ^NK4a gene expression in obvious cancer tissues.

Furthermore, the tissues were analyzed for methylation status of the p16I ^NK4a gene promoter region. Normal gastric mucous tissues appeared in mixed form with both non-methylated or methylated forms of the p16I ^NK4a gene promoter region.

However, gastric tumor tissue exhibited HDAC2-overexpression when cancerous, resulting in an intact non-methylated form of the p16I ^NK4a gene promoter region. In contrast, tumor samples (# 592, # 805, and # 1033) showed no change in HDAC2 expression in the cancer, as in FIG. 2D, and showed a methylated form of the p16I ^NK4a gene promoter region. Finally, as shown in FIG. 2E, chromatin immunoprecipitaion assay of MKN-1 cells with specific primers of the p16I ^NK4a gene promoter region results in HDAC2 leading to deacetylation of histone H4 in the same promoter region. The protein was found to be associated with the p16I ^NK4a gene proximal promoter region.

<Example 3>

HDAC2 To Intermediary G1 / S cell cycle protein expression Unsuitable  Abnormal proliferation of gastric cancer cells through

In order to analyze the results of abnormal overexpression of HDAC2 in gastric cancer formation, the present inventors conducted a large-scale gene expression analysis to identify molecular markers that influence the formation of cancer cell characteristics. Differently expressed genes in MKN-1 cells transfected with HDAC2 siRNAs were analyzed and molecular markers related to typical cancer characteristics were analyzed.

First, as a result of gene inhibition targeting HDAC2 induces growth inhibition of gastric cancer cells, specific genetic factors related to cellular growth and death pathways were found as shown in FIGS. 3A and 3B. Among the genetic markers associated with the cell cycle, we found that p16 expression leads to inhibition of CDK4 expression, suggesting that HDAC2 overexpression interferes with the G1 / S cycle through cell cycle regulatory protein deregulation. I could suggest that.

Thus, the role of HDAC2 in cell cycle progression could be identified. We treated nocodazole on HDAC2-knockout MKN-1 cells to align all cells simultaneously to the G2 / M cycle. The percentage of G1-cycle cells was analyzed after nocodazole block and release.

As a result, as shown in Figure 3C, HDAC2 inhibition was found to induce the arrest of the G1 / S cycle and to delay cell cycle shift. Based on these results, it was found that proliferative defects and / or growth inhibition of MKN-1 cells due to HDAC2 deficiency were induced by specific G1 detention in cell cycle regulation.

In addition, G1 / from the transition to the second stage ^{p15 INK4B, p16 INK4A, p18 INK4C} , p19I NK4D, p27 Kip1 and p21 ^{WAF1 / Cip1} and negative cell cycle regulators, such as those who inhibit the cyclin D1 / CDK4 and 6 or Cyclin E / CDK2 complexes It was found that the main adjuster. In experimenting with these cell cycle regulators, we found that only p16INK4a was selectively induced in MKN-1 cells by HDAC2 deficiency.

In addition, HDAC2 deficiency (see Fig. 3D) CDK4 and at the same time leading to inhibited and CDK2, these results HDAC2 overexpression is hammyeo cause inhibition negative cell cycle regulation party, such as p16 ^INK4a, at the same time G1 / S of MKN-1 cells It was found that the transition to stages induces the expression of their specific regulators, cyclin D1 and CDK4. Therefore, HDAC2 inhibition was confirmed to make the Rb protein hyperphosphorylated (see FIG. 3D).

<Example 4>

Gastric cancer cells HDAC2 Through the inhibition of Cellular Apoptosis  And self-exploration ( autophagic cell death Phenomenon analysis

As shown in Fig. 4A, the inventors found that HDAC2 inactivation selectively induces Bax, AIF and Apaf-1 expression, and simultaneously inhibits Bcl-2 protein expression. These results indicate that HDAC2 inactivation inhibits Bcl-2, which normally activates Bax and Apaf-1 (pre-apoptotic factor) by normally inhibiting Bcl-2 (anti-apoptotic regulator). there was.

As in FIG. 4B, we found significant induction of apoptotic cells in HDAC2 knockdown cells compared to the control. In addition, compared with the group treated with the scrambled sequence (si-Scr) of the apoptotic cells (4.97%), the experimental group of the present invention HDAC2 siRNA transfectant increased 8.14%. These results indicate that HDAC2 overexpression unregulates apoptosis protein, which implies resistance to apoptotic signals in gastric cancer.

The results indicate that HDAC2 inhibition induces Bcl-2 inhibition, which means crosstalk between apoptosis and autophagic signaling. As in FIG. 4C, HDAC2 deletion inhibited Bcl-2 expression and caused an increase in LC3B II (typical feature of autophagic activity). These results were confirmed through the treatment of 20μM ceramide, the inducer of autophagic cell death. In other words, it was found that inhibition targeting HDAC2 induces Bcl-2 inhibition and frees Beclin 1 to enable autologic activity.

In addition, the present inventors confirmed the cell ultrastructure through TEM of HDAC2 knockout MKN-1 cells in order to clarify the autophasic activity through HDAC2 inhibition. As expected, as in FIG. 4D, approximately 40-45% of cells transfected with HDAC2 siRNA developed autophagy vacuoles after 48 hours of post-transfection, some of which Accumulated with larger vacuoles. At higher magnifications, most vacuoles contained electron dense material and degraded organelles. In contrast, cells transfected with control siRNA (si-Scr) produced little vacuoles, and fewer cells were observed to contain vacuoles in the cytoplasm.

These results indicate that HDAC2-targeted inhibition induces both mitochondrial mediated apoptosis and caspase-independent autophasic cell death.

<Example 5>

Relationship between Abnormal HDAC2 Expression and Metastatic Characteristics of Gastric Cancer Cells

In order to identify how genetic expression of HDAC2 is abnormally related to the metastatic properties of gastric cancer cells, the present inventors have described the microfactors in a known manner regarding genetic factors enabling metastatic properties of cancer cells from gene expression data of HDAC2 knockdown cells. Arrays were run and analyzed.

As a result, as shown in FIG. 5A, a heatmap was obtained listing the genetic factors related to the metastatic pathway. In addition, among the genes involved in mobility and permeability, HDAC2 inhibition has been shown to induce down-regulation of collagens, matrix metallopeptidases, TGF-signaling related genes and caplains ( See FIG. 5B).

To more accurately confirm the microarray results, we conducted an in vitro tumorigenicity assay using HDAC2 knockdown cells. As a result, as shown in FIGS. 5C and 5D, when HDAC2 expression was suppressed, tumor cell motility and invasion were confirmed by the Boyden chamber assay, and HDAC2 deficiency caused tumors. It can be seen from FIG. 5E that the cell's ability to reduce anchorage-independent growth is reduced.

<Example 6>

HDAC2 Continuous suppression of sustained - supression Tumor formation according to Inhibition  analysis

To determine whether stable inhibition of HDAC2 induces malignant gastric oncogenesis inhibition, two stable HDAC2 knockout cell lines (HDAC2 KD1 and HDAC2 KD2) were constructed, and as shown in FIG. 6A, p16INK4a induction detection and manufactured cells A decrease in the cyclin D1 line confirmed HDAC2 deficiency. The cells also showed a reduced growth rate compared to either control (MKN-1) cells or MOCK-transfectant (see FIG. 6B).

Based on these results, the present inventors have determined in vitro tumorigenic assays such as anchorage-independent colony assay, cell migration and invasion assay. assay). As a result, sustained suppression of HDAC2, as in FIGS. 6C, D and E, lowered cell motility, invasive properties, and the ability of MKN-1 cells to colonize.

From transient transfection studies, we found that HDAC2 disrupted the G1 / S cell cycle. One of the biological consequences of G1 / S cell cycle disruption is cellular senescence. Thus, the present inventors confirmed whether HDAC2 deficiency enhances cellular deterioration of stable cell lines through SA-β-Gal staining (senescence-associated-β-galactosidase staining). As in FIG. 6F, it was observed that HDAC2 deficient cell lines such as HDAC2 KD1 and HDAC2 KD2 produced increased cellular senescence compared to Mock or MKN-1 cells.

In order to confirm the contribution of HDAC2 overexpression to in vivo malignant gastric tumor formation, we injected subcutaneous injections of these cell lines (ie HDAC2 KD1 and HDAC2 KD2) into athymic nude mice. After 1 day, tumor masses were found in the mock or control group, whereas mice injected with the cell lines found tumor masses only 14 days after injection.

In addition, the total tumor growth rate in the HDAC2 deficient cell line was significantly reduced compared to Mock or MKN-1 cells as in FIG. 7A (P ≦ 0.05). Oncogenesis also occurred in all 9 animals injected with both the control and Mock groups, but only 7 or 8 of the 9 injected animals showed HDAC2 deficient cell lines.

Tumor mean volume at the time of sacrifice was significantly less in the group injected with HDAC2 deficient cell lines than Mock or MKN-1 cells (see FIG. 7B). Reduced tumor volume in HDAC2 deficient cell lines was demonstrated by detecting low expression of HDAC2 and increased p16INK4a gene expression in xenograft tumor tissues (see FIG. 7C).

So far I looked at the center of the preferred embodiment for the present invention.

It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Catholic University <120> Use of HDAC2 as a diagnostic marker for gastric cancer <130> NP11-1249 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 1467 <212> DNA <213> Artificial Sequence <220> <223> HDAC2 cDNA sequence <400> 1 atggcgtaca gtcaaggagg cggcaaaaaa aaagtctgct actactacga cggtgatatt 60 ggaaattatt attatggaca gggtcatccc atgaagcctc atagaatccg catgacccat 120 aacttgctgt taaattatgg cttatacaga aaaatggaaa tatataggcc ccataaagcc 180 actgccgaag aaatgacaaa atatcacagt gatgagtata tcaaatttct acggtcaata 240 agaccagata acatgtctga gtatagtaag cagatgcaga gatttaatgt tggagaagat 300 tgtccagtgt ttgatggact ctttgagttt tgtcagctct caactggcgg ttcagttgct 360 ggagctgtga agttaaaccg acaacagact gatatggctg ttaattgggc tggaggatta 420 catcatgcta agaaatcaga agcatcagga ttctgttacg ttaatgatat tgtgcttgcc 480 atccttgaat tactaaagta tcatcagaga gtcttatata ttgatataga tattcatcat 540 ggtgatggtg ttgaagaagc tttttataca acagatcgtg taatgacggt atcattccat 600 aaatatgggg aatactttcc tggcacagga gacttgaggg atattggtgc tggaaaaggc 660 aaatactatg ctgtcaattt tccaatgaga gatggtatag atgatgagtc atatgggcag 720 atatttaagc ctattatctc aaaggtgatg gagatgtatc aacctagtgc tgtggtatta 780 cagtgtggtg cagactcatt atctggtgat agactgggtt gtttcaatct aacagtcaaa 840 ggtcatgcta aatgtgtaga agttgtaaaa acttttaact taccattact gatgcttgga 900 ggaggtggct acacaatccg taatgttgct cgatgttgga catatgagac tgcagttgcc 960 cttgattgtg agattcccaa tgagttgcca tataatgatt actttgagta ttttggacca 1020 gacttcaaac tgcatattag tccttcaaac atgacaaacc agaacactcc agaatatatg 1080 gaaaagataa aacagcgttt gtttgaaaat ttgcgcatgt tacctcatgc acctggtgtc 1140 cagatgcaag ctattccaga agatgctgtt catgaagaca gtggagatga agatggagaa 1200 gatccagaca agagaatttc tattcgagca tcagacaagc ggatagcttg tgatgaagaa 1260 ttctcagatt ctgaggatga aggagaagga ggtcgaagaa atgtggctga tcataagaaa 1320 ggagcaaaga aagctagaat tgaagaagat aagaaagaaa cagaggacaa aaaaacagac 1380 gttaaggaag aagataaatc caaggacaac agtggtgaaa aaacagatac caaaggaacc 1440 aaatcagaac agctcagcaa cccctga 1467

Claims (6)

Gastric cancer diagnostic composition comprising a substance for measuring the level of the HDAC2 gene or HDAC2 protein. The method of claim 1,
The substance for measuring the level of the HDAC2 gene is a stomach cancer diagnostic composition, characterized in that the primer or probe that can amplify the HDAC2 gene. The method of claim 1,
The substance for measuring the level of the HDAC2 protein is a gastric cancer diagnostic composition, characterized in that the antibody that specifically recognizes the HDAC2 protein. (a) measuring the amount of HDAC2 gene expression or the amount of HDAC2 protein present in the biological sample; And
(b) a method of predicting and diagnosing gastric cancer comprising comparing the measurement result of step (a) with the amount of HDAC2 gene expression or the amount of HDAC2 protein in the control sample. 5. The method of claim 4,
And said biological sample is selected from the group consisting of tissue, cells, blood, serum, plasma, saliva, and urine. 5. The method of claim 4,
The measurement is reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA). : Method for predicting and diagnosing gastric cancer, characterized in that selected from the group consisting of radioimmunoassay, radioimmunodiffusion, immunoprecipitation assay, and immunohistochemical analysis.

Images