KR20130091061A - Composition for maturation of dendritic cell comprising mycobacterium tuberculosis rv2005c - Google Patents

Abstract

PURPOSE: A composition for inducing maturation of dendritic cells including Rv2005c protein of tuberculous bacillus as an active ingredient is provided to effectively mature dendritic cells by promoting Rv2005c to differentiate immature dendritic cells, and thus immune response of body is effectively enhanced. CONSTITUTION: A composition for inducing maturation of dendritic cells including Rv2005c protein of tuberculous bacillus as an active ingredient is provided. The Rv2005c protein is a protein derived from mycobacterium tuberculosis. The Rv2005c protein is included at a concentration of 1μg/ml to 20 μg/ml. A method of inducing maturation of immature dendritic cells includes differentiating immature dendritic cells to mature dendritic cells by treating with Rv2005c onto the immature dendritic cells.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for inducing the maturation of dendritic cells comprising the Rv2005c protein of Mycobacterium tuberculosis as an effective ingredient. [0002] The present invention relates to a composition for inducing the maturation of dendritic cells comprising Mycobacterium tuberculosis Rv2005c,

The present invention is Mycobacterium Mycobacterium tuberculosis- derived Rv2005c protein as an active ingredient, and a method for differentiating immature dendritic cells into mature dendritic cells using the same.

Dendritic cells or dendritic cells (DCs) are immune cells that form part of the immune system of mammals. These cells act as antigen-expressing cells that process the antigenic material and make it appear on the surface so that other cells in the immune system can recognize it. Dendritic cells are mainly present in small amounts in tissues that contact the external environment, such as the inner walls of the skin, nose, lungs, stomach, and intestine, and in particular, the cells in the skin are called Langerhans cells. Dendritic cells can be found immature in blood and, when activated, migrate to the lymphatic organs and interact with T cells and B cells to initiate an immune response. At certain stages of development they extend into processes called dendrites.

Dendritic cells are derived from hematopoietic bone marrow progenitor cells. These progenitor cells initially turn into immature dendritic cells and are characterized by high endocytosis and T-cell activity. Immature dendritic cells constantly feed on pathogens such as viruses and bacteria in their surroundings. This is possible through pattern recognition receptors (PRRs) such as toll-like receptors (TLRs). TLRs recognize certain chemical features found on a subset of pathogens, and immature dendritic cells devour cell membranes through a process called nibbling from living autologous cells. When they come into contact with existing antigens, they are activated into mature dendritic cells and migrate to lymph nodes. Immature dendritic cells devour pathogens and break down their proteins into small pieces that, when mature, appear on the cell surface using major histocompatibility complex (MHC) molecules. At the same time, it increases cell surface receptors that act as co-receptors in T-cell activation, such as Cluster of Differentiation (CD) 80, CD86, and CD40. They display antigens derived from pathogens with non-antigenic specific costimulatory signals to activate B cells as well as helper T-cells, killer T-cells.

All helper T-cells are specific for one particular antigen. Only specialized antigen expressing cells (macrophages, B lymphocytes and dendritic cells) activate the remaining helper T-cells when the correct antigen is present. However, macrophages and B lymphocytes can only activate memory T-cells, while dendritic cells are the most potent antigen-expressing cells because they can activate both memory and naive T-cells.

Mature dendritic cells can be derived from monocytes, white blood cells that circulate in the body, which can be converted into dendritic cells or macrophages according to appropriate signals. Monocytes are derived from stem cells of bone marrow. Monocyte-derived dendritic cells can be produced from peripheral blood mononuclear cells (PBMC) in a laboratory. PBMCs can be planted in tissue culture flasks to allow monocytes to attach, which can be differentiated into immature dendritic cells by treatment with IL-4 and granulocyte-macrophage colony stimulating factor (GM-CSF). Subsequent treatment with TNF-α differentiates immature dendritic cells into mature dendritic cells.

Fully mature dendritic cells differ qualitatively and quantitatively from immature DCs. Fully mature DC expresses high levels of Major Histocompatibility Complex (MHC) type I and II antigens, and high levels of T cell costimulatory molecules, namely CD80 and CD86. These changes increase dendritic cells' ability to activate T cells, which not only increases the antigen density on the cell surface, but also increases the amount of T cell activation through counterparts of costimulatory molecules on T cells, such as, for example, CD28. Because it increases. In addition, mature DCs produce large amounts of cytokines, which stimulate and induce T cell responses. Two of these cytokines are interleukin 10 (IL-10) and interleukin 12 (IL-12). These cytokines have the opposite effect on the direction of the induced T cell response. The production of IL-10 induces a Th-2 type response, while the production of IL-12 induces a Th-1 type response. The latter response is particularly preferred if, for example, a cellular immune response is required. The Th-1 type response induces and polarizes cytotoxic T lymphocytes (CTLs), which are the mechanism of attack of the cellular immune system. This effector attack is most effective in inhibiting tumor growth. IL-12 also induces the growth of natural killer (NK) cells and has anti-angiogenic activity, all of which are effective anti-tumor attack means. Therefore, the use of dendritic cells producing IL-12 is theoretically optimally suitable for use in immunostimulation.

Because dendritic cells are rare and difficult to isolate, only the approximate formation and development of dendritic cells of different types and subsets and their interrelationship are known. Dendritic cells are in constant communication with other cells in the body. This communication can take the form of direct cell-to-cell contact based on the interaction of cell surface proteins.

The cytokines produced by dendritic cells depend on the type of cell. Lymphoblastic dendritic cells can produce large amounts of type 1 IFN, which collects more activated macrophages to enable phagocytosis. Lymphoblastic dendritic cells are involved in central and peripheral immune regulation, and myeloid dendritic cells are known to be involved in inducing immunity to foreign antigens or infections. Therefore, when the dendritic cells do not function normally, autoimmune diseases such as diabetes, rheumatoid arthritis, and allergic hypersensitivity reactions may occur, or normal immune responses may not occur to infectious diseases or cancers.

In cancer patients, the function of dendritic cells is reduced and it is difficult to induce normal anticancer immunity. Until now, many substances (LPS, TNF-α, IL-1β) that regulate (activate) the differentiation of dendritic cells are known, but as a side effect of biotoxicity, there are many problems in direct application to the living body.

Mycobacterium genus includes not only species that cause serious diseases in humans and animals, such as tuberculosis, tuberculosis and leprosy, but also species called opportunistic bacteria, About 72 species are known to date, including saprophytic species found in the natural environment, of which 25 are known to be associated with human diseases.

M. tuberculosis , M. bovis , M. africanum and M. microti ( M. tuberculosis ), which are classified as M. tuberculosis complex (TB complex) (M. tuberculosis) is the most common and important causative organism. Tuberculosis is still an important disease in Korea, and it is reported that approximately 8 million new cases occur worldwide each year.

As described above, dendritic cells play an important role in enhancing the body's own immune function. Therefore, dendritic cells promote the differentiation and maturation of dendritic cells. Has become an important challenge for cellular immune therapy using dendritic cells

The inventors of the present invention have found that Rv2005c derived from Mycobacterium tuberculosis effectively matured dendritic cells, thereby completing the present invention.

The present invention provides a composition for inducing maturation of immature dendritic cells comprising Rv2005c protein as an active ingredient, which can mature easily and effectively immature dendritic cells.

The present invention also provides a method for inducing maturation of immature dendritic cells, characterized in that immature dendritic cells are treated with Rv2005c to mature into mature dendritic cells.

The present invention also provides a composition for inducing dendritic cell maturation comprising the composition for immunity.

In order to solve the above problems, the present invention provides a composition for inducing cellular maturation of dendritic cells comprising Rv2005c protein as an active ingredient.

The present invention also provides a method for inducing the maturation of immature dendritic cells that matured into immature dendritic cells into mature dendritic cells by treating Rv2005c.

The present invention also provides a composition for enhancing immunity comprising the composition for inducing dendritic cell maturation.

According to the present invention, Rv2005c promotes the differentiation of immature dendritic cells, thereby effectively matured dendritic cells, thereby effectively enhancing the immune response of the body.

FIG. 1 is a graph showing the results of an experiment for measuring the survival rate of dendritic cells treated with Rv2005c.
FIG. 2 is an analysis of expression of CD80, CD86, MHC I and MHCII, which are specific protein surface factors in dendritic cells treated with Rv2005c. It can be seen that Rv2005c treatment increases the expression of each surface factor in a dose dependent manner.
3 is a graph showing secretion of cytokines by dendritic cell maturation. It was confirmed that the release of cytokines from dendritic cells was increased by treatment with Rv2005c as compared with the control group.
FIG. 4 is a graph showing the measurement of dextran-FITC (Fluorescein isothiocyanate) spermatogens at 37 ° C and 4 ° C using a flow cytometer FACs Canto (BD Biosciences) after treatment with 5 or 10 μg / ml of Rv2005c and 50 ng / Fig. The numbers in the graph represent the percentage of CD11c + cells. The experimental group treated with Rv2005c showed a decrease in dextrane predatory ability compared to the control group.
FIG. 5 is a graph showing the results of observing the expression of TNF-.alpha. And IL-6 in WT and TLR4.sup .- / - in order to measure the relationship between dendritic cell maturation and TLR by Rv2005c. Rv2005c markedly increased the expression of TNF-α and IL-6 in dendritic cells isolated from WT.
Figure 6 is a diagram showing the differentiation of T cells by dendritic cells activated by Rv2005c. IFN-y was significantly increased in dendritic cells treated with Rv2005c as compared to the other treatment groups.

The present invention relates to a composition for inducing maturation of dendritic cells comprising Rv2005c as an active ingredient.

Rv2005c is a protein derived from Mycobacterium tuberculosis, consisting of 888 nucleotide sequences and 295 amino acid sequences. The function of Rv2005c is unclear and is classified as a hypothetical protein, and the gene ID of NCBI is 888831.

The present invention can provide a composition for inducing dendritic cell maturation by cloning a gene for M. tuberculosis and isolating and purifying the same using an E. coli expression system.

Immature dendritic cells mature to form mature dendritic cells. Mature dendritic cells lose the ability to exhibit up-regulated expression of various cytokines and cell surface molecules that capture and co-stimulate antigens. In particular, mature dendritic cells express MHC type I and type II antigens at higher levels than immature dendritic cells and regulate Cluster of Differentiation (CD) 80+, CD83 +, CD86 + and CD14-. Induces an increase in antigenic density on the dendritic cell surface with more MHC expression, whereas upregulation of the co-stimulatory molecules CD80 and CD86 leads to T cell activation through co-stimulatory molecular counterparts such as CD28 on T cells Strengthen the signal.

The present invention may facilitate differentiation into mature dendritic cells through a composition comprising Rv2005c. Rv2005c produced by an effective recombinant method can be included in the composition at a concentration of 1 / / ml to 20 / / ml, preferably 5 / / ml to 10 / / ml, though not limited thereto.

The present invention also provides a method for inducing maturation of immature dendritic cells, characterized by treating immature dendritic cells with Rv2005c.

The Rv2005c protein of the present invention can be treated at a concentration of 1 占 퐂 / ml to 20 占 퐂 / ml, preferably 5 占 퐂 / ml to 10 占 퐂 / ml. The present invention can cultivate cells treated with Rv2005c to induce maturation by treating Rv2005c with immature dendritic cells. In order to induce differentiation into an appropriate mature dendritic cell, the cells may be cultured for a period of 12 hours to 36 hours, but not limited thereto.

Matured dendritic cells promoted through Rv2005c protein treatment in the present invention can express general characteristics of mature dendritic cells. That is, according to the present invention, immature dendritic cells are differentiated into mature dendritic cells by treating Rv2005c with immature dendritic cells, and more preferably TNF-α, IL-12p70, IL-6 and IL- Can be converted to increased mature dendritic cells.

In addition, the present invention can provide a composition for immuno-enhancement comprising a composition for inducing dendritic cell maturation comprising Rv2005c as an active ingredient. According to the present invention, immature dendritic cells are treated with Rv2005c to mature immature dendritic cells, and dendritic cell maturation may increase the expression of surface protein markers. More specifically, according to the composition for enhancing immunity of the present invention, the dendritic cells can be matured through the treatment with Rv2005c, which is an effective ingredient, and as a result, the T cell activity can be induced to increase the immune response.

Maturation of dendritic cells can be monitored by methods known in the art and cell surface markers can be detected by assays familiar to the art such as flow cytometry and immunohistochemistry. The cells can also be monitored via cytokine production (eg, ELISA, FACS and other immune assays).

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be noted, however, that the following examples are provided to further illustrate the present invention and are not intended to limit the scope of the present invention.

Example  1. Isolation and Recombination of Dendritic Cells Rv2005c Cloning

1.1 Isolation and Derivation of Dendritic Cells

Femoral bone marrow was harvested using a bone marrow harvesting injection from C57BL / 6 mice. After the collected bone marrow was washed, red blood cells were removed using ammonium chloride. Separated cells were cultured in 6-well plates in RPMI 1640 (10% FBS (Fetal bovine serum, calf serum), 2 mM L-glutamine, 100 U / ml penicillin / streptomycin, 50 μM mercaptoethanol, , 1 mM sodium pyruvate, 20 ng / ml GM-CSF and 20 ng / ml IL-4) were added and cultured for 8 days. GM-CSF and IL-4 were used to induce differentiation into dendritic cells.

1.2 Recombination Rv2005c of Cloning

Rv2005c was isolated from Mycobacterium tuberculosis genomic DNA and cloned. The Rv2005c region was amplified using a forward primer (CGC CATATG TCTAAACCCCGCAAGCAGCAC) and a reverse primer (CCC AAGCTT CGACTGCCGTGCCACGATCAC). The PCR product was digested with NdeI and HindIII enzymes and inserted into the expression vector pET-22b (+) vector (Novagen, Madison, WI). E. coli BL21 transformed with the pET-22b (+) vector into which the Rv2005c gene was inserted was cultured at 37 DEG C at an absorbance (OD) at 600 nm of 0.4 to 0.5, followed by the addition of 1 mM isopropyl-D- Galactopyranoside (IPTG) was added and incubated for 6 hours. The expressed protein was purified using nickel-nitrilotriacetic acid (Ni-NTA, Invitrogen, Carlsbad, CA, USA) agarose according to the manufacturer's method. The final purified recombinant protein was identified by SDS-PAGE analysis.

Example  2. Rv2005c Cytotoxicity

To measure the cell viability of dendritic cells stimulated with Rv2005c, dendritic cells were treated with Rv2005c at a concentration of 5 μg / ml, 10 μg / ml or LPS (lipopolysaccharide) at a concentration of 50 ng / ml as a control for 24 hours. This was then double stained with propidium iodide (PI) and Annexin-V and analyzed via flow cytometry.

The results are shown in FIG. As shown in Fig. 1, not only Rv2005c at a concentration of 5 μg / ml but also Rv2005c at 10 μg / ml showed no toxicity in dendritic cells.

Example  3. Rv2005c Surface Factor Expression Analysis of Dendritic Cells by

The cells were maintained in OptiMEM medium containing GM-CSF and IL-4 to homogenize the maturation of all cells. Rib2005c and LPS (50 ng / ml) concentration of 5 ㎍ / ml and 10 ㎍ / Were treated for 24 hours each, and dendritic cells were recovered. To prevent nonspecific binding, Fcγ I / III (BD bioscience) at 1 ㎍ / ml was treated at 4 ° C for 20 minutes and stained with CD11c-FITC (BD bioscience) for 20 minutes at 4 ° C for dendritic cell analysis Respectively. After staining with cell surface factor antibodies such as anti-CD80-PE (BD bioscience), anti-CD86-PE (BD bioscience), anti-MHC I and II-PE (BD bioscience), flow cytometry FACs Canto (BD Biosciences).

The results are shown in Fig. As shown in FIG. 2, Rv2005c dose-dependently increased the expression of CD80, CD86, MHC class I, and MHC class II, which are protein surface proteins of dendritic cells. These results indicate that dysplasia cells were effectively maturated by Rv2005c.

Example 4 . Effects of Rv2005c on the secretion of cytokines from dendritic cells

The type of cytokine secreted depends on the maturation of dendritic cells. To confirm this, dendritic cells were treated with Rv2005c at a concentration of 5 μg / ml or 10 μg / ml or 50ng / ml of LPS as a control group and cultured for 24 hours. Supernatants were applied to ELISA kits for TNF-α, IL-6, IL-1β, IL-10 and IL-12 p70 to measure cytokine secretion.

IL-12 p70 and IL-10 are major cytokines secreted from dendritic cells, and play an important role in the differentiation of T cells into Th1 and Th2, respectively. IL-12 is a representative Th1 cytokine, and IL-10 is known to interfere with the activity of cytokines (including IL-12 p70) produced by activated monocytes, NK cells and Th1 cells. Based on these data, anti-IL-12 p70-APC (BD bioscience) and anti-IL-10-APC were stained to measure secretion of IL-12 p70 and IL-10 in the cells, and analyzed by flow cytometer FACScallibur , USA). The results are shown in FIG.

As shown in Fig. 3, IL-12 p70 was significantly increased in a dose-dependent manner by Rv2005c, and the proinflammatory cytokines TNF-a, IL-6 and IL-l [beta] were also markedly increased. Thus, it can be seen that Rv2005c causes dendritic cells to mature and changes the amount of cytokine. On the other hand, there was no significant increase in the secretion of IL-10, indicating that Rv2005c could deflect dendritic cells into Th1 cells.

Example  5. Rv2005c On by Dendritic  Antigen Capability Analysis

Immature dendritic cells are good for antigen acquisition, but mature dendritic cells are known to decrease antigen acquisition capacity. Therefore, an experiment was conducted to confirm the effect of Rv2005c protein on dendritic cell endocytic activity. Immature dendritic cells were treated with 5 and 10 μg / ml Rv2005c or 50 ng / ml LPS and cultured for 24 hours.

To the dendritic cells, fluorescein conjugated dextran (molecular weight: 40,000; Molecular Probes, Eugene, OR) was added at 1 / / ml for 1 hour. After incubation at 37 ° C. and 4 ° C. for 30 minutes, the reaction was stopped by the addition of cold staining buffer and the cells were washed. After staining with PE (Phycoerythrin) -binding CD11c (BD bioscience), the phagocytosis of dextran-FITC (Fluorescein isothiocyanate) was measured using flow cytometry FACs Canto (BD Biosciences).

The results are shown in FIG. As shown in Fig. 4, the dendritic (antigen) predisposing ability of dendritic cells treated with Rv2005c at 37 DEG C was lower than that. These results indicate that Rv2005c matured dendritic cells in terms of function. In order to determine the nonspecific binding of dextran to dendritic cells, the result was also corrected by measuring at 4 ° C. Thus, it was confirmed that Rv2005c treatment increased the maturation of dendritic cells functionally.

Example  6. Rv2005c Dendritic cell maturation TLR Association analysis with

In order to examine the relationship between the maturation of dendritic cells and TLR by Rv2005c, dendritic cells were isolated from TLR4 - / - and WT mice in the same manner as in Example 1. For each dendritic cell isolated, the degree of TNF-α and IL-6 production was measured in the same manner as in Example 4.

The results are shown in Fig. When Rv2005c was treated, the secretion of TNF-α and IL-6 was increased in dendritic cells of WT, but the secretion of TNF-α and IL-6 was decreased in dendritic cells of TLR4 - / -. This confirms that Rv2005c passes through TLR4 as well as LPS. On the other hand, in the case of Pam3CSK4 (TLR1 / 2), Imiquimod (TLR7) and ODN (TLR9) which are different TLR antagonists in TLR4 - / - dendritic cells, Suggesting that the dendritic cells of TLR4 - / - specifically inhibit TLR4 and thus have no problem in function.

Example  7. Rv2005c Of T cell differentiation

The ability to promote allogeneic T cell proliferation is a property of dendritic cells in vitro. To determine whether Rv2005c has a detectable effect on allogeneic T cell stimulation, the present inventors compared the allostimulatory ability of dendritic cells before and after inducing dendritic cell maturation by treating Rv2005c or LPS. CD8 + T, CD4 + T cells were separated into OVA-specific OT-1 T cell receptor transgenic mice to determine whether mature dendritic cells affected the proliferation of CD8 + T, CD4 + T cells by Rv2005c. Also, the purified dendritic cells were cultured for 24 hours without treatment (negative control) with 5 μg / ml of Rv2005c, 10 μg / ml of Rv2005c and 50 ng / ml of LPS. To confirm the proliferation of OVA-specific CD8 + T cells, OVA323-339 peptide was stimulated for 1 hour with Rv2005c and LPS-treated dendritic cells to confirm the proliferation of OVA 257-264 peptide and CD4 + T cells Cells were isolated. OVA-specific T cells were stained with CFSE fluorescent dye and then co-cultured for 4 days.

T cells stimulated by dendritic cells form clusters with dendritic cells, and dendritic cell / T cell (DC / T cell) cluster size is further increased in response to Rv2005c compared to clusters formed by untreated cells . In addition, the effect on the differentiation of T cells was confirmed by the rate of growth of allogeneic CD8 + T cells and CD4 + T cells cultured with dendritic cells treated with Rv2005c faster than those cultured with untreated dendritic cells. These results support that maturation induced by Rv2005c treatment promotes differentiation of T cells and significantly increases the allostimulatory ability of untreated dendritic cells.

To investigate the characteristics of early T cell responses in dendritic cells matured in the presence of Rv2005c, the degree of IFN-γ production was measured by ELISA. As shown in Figure 6, dendritic cells matured by Rv2005c significantly increased IFN-y production compared to the other treatment groups.

Claims (8)

A composition for inducing maturation of dendritic cells comprising Rv2005c protein as an active ingredient.
The composition for inducing maturation of dendritic cells according to claim 1, wherein the Rv2005c protein is a protein derived from Mycobacterium tuberculosis .
The composition for inducing maturation of dendritic cells according to claim 1 or 2, wherein the Rv2005c protein is contained at a concentration of 1 / / ml to 20 / / ml.
A method of inducing maturation of immature dendritic cells, characterized in that immature dendritic cells are treated with Rv2005c to differentiate into mature dendritic cells.
5. The method for inducing maturation of immature dendritic cells according to claim 4, wherein the cells after the Rv2005c treatment are cultured for 12 hours to 36 hours or less.
The method of claim 4, wherein Rv2005c increases production of TNF-α, IL-12p70, IL-6, IL-1ß during the maturation process of immature dendritic cells.
5. The method according to claim 4, wherein the Rv2005c protein is treated at a concentration of 1 / / ml to 20 / / ml.
A composition for enhancing immunity comprising the composition of claim 1 or 2.

Images