KR20130091044A - COMPOSITION FOR PREVENTING OR TREATING IMMUNE DISEASE COMPRISING J u n B INHIBITOR - Google Patents

Abstract

PURPOSE: A composition for prevention and treatment of an immune disease including an expression or activity inhibitor of JunB is provided to be used in manufacture of a medicine for treating various immune diseases that are caused by an abnormal immune control when expression or activity of JunB is inhibited. CONSTITUTION: A composition for prevention and treatment of an immune disease comprises at least one selected from the group consisting of an antisense nucleotide complementarily binding to mRNA of gene JunB, a short interfering RNA, a short hairpin RNA, and an antibody with respect to JunB protein. The gene JunB is formed of polynucleotides of SEQ ID NO:1. The polynucleotides of the SEQ ID NO: 1 code a polypeptide of SEQ ID NO:2.

Description

Composition for Preventing or Treating Immune Disease Comprising Immune Disease Comprising

The present invention relates to a composition for preventing or treating immune diseases, including an inhibitor of JunB expression or activity.

Although diseases due to immune hypersensitivity reactions are increasing all over the world, the root cause for the occurrence of these diseases is insufficient. Currently, a method for treating a disease caused by an excessive immune response is to alleviate or reduce various symptoms caused by the disease by administering an immunosuppressant alone or in combination. Immunosuppressants refer to a variety of substances used to reduce or block the host's ability to produce antibodies (a humoral immune response) or a cellular immune response to the action of an antigen. Such immunosuppressive agents may be useful for autoimmune diseases such as lupus, rheumatoid arthritis, and skin hypersensitivity reactions such as atopy and allergy as well as organ transplant field. Good immunosuppressants should be able to control the imbalance of the immune response, ensure the safety of the human body, and reduce the incidence of disease recurrence during long-term treatment (Wollenberg 2008).

Currently used immunosuppressive agents include cyclosporin A and FK506, which are compounds derived from natural products with complex chemical structures, which are uneconomical due to high cost in terms of supply and demand of raw materials, and may cause various side effects due to long-term administration. Doing. Therefore, there is an urgent need for the development of new immunosuppressive agents capable of economical production with low toxicity and induction of immune tolerance.

Meanwhile, T cells are one of a group of cells that play a central role in the immune system as a biological defense system against various pathogens. T cells are produced in the thymus of the human body, and undergo a series of differentiation processes, resulting in differentiation into T cells with inherent characteristics. The differentiated T cells are largely classified into type 1 (Th1) Auxiliary cells (Th2). Among them, the main function of Th1 cells is involved in cell mediated immunity, Th2 cells are involved in humoral immunity, and in the immune system, these two cell populations are balanced with each other so that they are not activated with each other.

Therefore, most of the immune diseases can be attributed to the imbalance between these two immune cells, for example, abnormally increased activity of Th1 cells can cause autoimmune diseases, and abnormally increased activity of Th2 cells It is known that immune diseases occur due to hypersensitivity reactions.

Meanwhile, according to a recent study on the differentiation of Th1 cells, the existence of a new group of immunoregulatory T cells (Tregs), which can control Th1 cell activity, is known, and studies on the treatment of immune diseases using the same are emerging. In addition, since Treg cells inhibit the function of abnormally activated immune cells to control the inflammatory response, many experiments have been reported to treat immune diseases through the action of increasing the activity of Treg cells.

In addition to the Treg cells, another group made during the differentiation is Th17 cells, which are known to be formed through a process similar to the differentiation of Treg cells during the differentiation of undifferentiated T cells. That is, differentiation of Treg cells and Th17 cells is performed in the presence of TGF-β in common but does not require IL-6 in Treg cells, whereas IL-6 is present in combination with TGF-β in Th17 cells. Differentiate in situations In addition, differentiated Th17 cells are characterized by the secretion of IL-17.

Unlike Treg cells, Th17 cells have been found to be involved in the forefront of inflammatory reactions seen in immune diseases, maximizing the signal of inflammatory responses and accelerating disease progression. Therefore, in the case of autoimmune diseases which are not controlled by Treg cells among autoimmune diseases, development of therapeutic agents for autoimmune diseases that target the inhibition of Th17 cell activity has been highlighted.

In addition to the treatment of immune diseases by inhibiting the activation of T cells, a treatment for controlling the amount of cytokines secreted from immune cells and a therapeutic method using antibodies targeting cytokines secreted from immune cells have been developed. There is. However, this method has to take a long time to apply to the patients after the actual clinical trials, the method using the antibody has a problem that too much cost in the antibody manufacturing process.

Therefore, there is a need for the development of a new immune disease treatment agent and a new immune disease treatment method with no side effects and inexpensive and excellent therapeutic effect.

Accordingly, the present inventors completed the present invention by confirming that while researching a new method for treating immune diseases, it is possible to treat symptoms of immune diseases when the expression of JunB gene is suppressed.

Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating immune diseases, including an inhibitor of JunB gene expression or an inhibitor of JunB protein activity as an active ingredient.

In addition, another object of the present invention is to provide a method for preventing or treating an immune disease comprising administering a pharmaceutically effective amount of the composition according to the present invention to a mammal other than a human suffering from an immune disease.

In order to achieve the above object, the present invention is a group consisting of antisense nucleotides, small interfering RNA (short interfering RNA), short hairpin RNA (short hairpin RNA) and antibodies to the JunB protein complementary to the mRNA of the JunB gene It provides a pharmaceutical composition for the prevention or treatment of immune diseases, including any one selected from.

In one embodiment of the present invention, the JunB gene may be made of a polynucleotide of SEQ ID NO: 1.

In one embodiment of the present invention, the polynucleotide of SEQ ID NO: 1 may be to encode a polypeptide of SEQ ID NO: 2.

In one embodiment of the invention, the short hairpin RNA that complementarily binds to the mRNA of the JunB gene may be composed of the polynucleotide sequence of SEQ ID NO: 9.

In one embodiment of the invention, the antibody to the antisense nucleotide, small interfering RNA (short interfering RNA), short hairpin RNA (JbinB) or JunB protein complementary to the mRNA of the JunB gene is a Inhibits Th17 cell differentiation through expression or inhibition of JunB protein, inhibits the production of inflammatory cytokine IL-17, inhibits inflammatory autoantibodies, and inhibits proliferation of immune cells by antigen. Can be.

In one embodiment of the invention, the immune disease is autoimmune disease; Inflammatory disease; And a transplant rejection disease of cells, tissues, or organs.

In one embodiment of the present invention, the autoimmune disease or inflammatory disease is autoimmune hepatitis, arthritis, insulin-dependent diabetes mellitus, ulcerative colitis, Crohn's disease, multiple sclerosis, autoimmune myocarditis, skin sclerosis, myasthenia gravis, multiple myositis / Dermal myositis, Hashimoto's disease, autoimmune cytopenia, Sjogren's syndrome, vasculitis syndrome and systemic lupus erythematosus.

The present invention also provides a method for preventing or treating an immune disease comprising administering a pharmaceutically effective amount of the composition according to the present invention to a mammal other than a human suffering from an immune disease.

The present invention comprises any one selected from the group consisting of antisense nucleotides complementary to the mRNA of the JunB gene, small interfering RNA (short interfering RNA), short hairpin RNA (RNA) and antibodies to the JunB protein The present invention relates to a pharmaceutical composition for preventing or treating an immune disease and a method for preventing or treating an immune disease using the same. According to the present invention, inhibition of the expression or activity of JunB inhibits the differentiation of Th17 cells causing immune diseases, inhibits the production of inflammatory cytokines, IL-17, inhibits inflammatory autoantibodies, and Excellent activity of inhibiting the proliferation of immune cells, it can be widely used in the manufacture of therapeutic agents for treating various immune diseases caused by immune regulation abnormalities.

FIG. 1 shows the results of measuring the amount of JunB mRNA expressed in cells and the degree of IL-17 cytokine production according to the increased expression of JunB in Th17 cells induced differentiation from CD4 + T cells.
2 shows confocal microscopy images of cells expressing JunB and IL-17 at the same time in spleen tissues of arthritis-derived mouse water.
Figure 3 shows the results of measuring the degree of inhibition of IL-17 cytokine production in T cells inhibited the expression of JunB.
Figure 4 shows the results of measuring the promoter activity of IL-17 according to whether JunB expression in T cells transfected with an expression vector capable of overexpressing JunB and a vector capable of inhibiting JunB expression.
Figure 5 shows the results obtained by injecting a vector capable of inhibiting the expression of JunB in arthritis-induced mouse animal model, comparing the control group injected with MOCK vector and the symptoms of arthritis.
Figure 6 shows the injection of a vector capable of inhibiting JunB expression in a mouse animal model induced arthritis, and the degree of destruction of joints and the inhibition of invasion of inflammatory cells in JunB-inhibited mice. The stained by the method of the method is shown by a microscope photograph.
Figure 7 shows the results of the serum isolated from arthritis induced mouse animal model and the expression level of CII specific inflammatory antibodies in the serum.
Figure 8 shows the results of measuring the proliferation of antigen-specific immune cells by FACs analysis compared to the group injected with a vector capable of inhibiting JunB expression in a mouse animal model induced arthritis and a control vector will be.
Figure 9 shows the results of measuring the production of IL-17 after injecting a vector and a control vector that can inhibit the expression of JunB in arthritis-induced mouse animal model.
Figure 10 shows the results confirming that when the expression of JunB in the mouse animal model of graft-versus-host disease was inhibited, the transplant rejection reaction is suppressed.

The present invention provides a therapeutic agent and a method for the treatment of immune diseases, and it is characterized in that inhibitors that inhibit the expression or activity of JunB can be used as a preventive or therapeutic agent for immune diseases.

In the present invention, JunB targeted as an immunological disease therapeutic agent belongs to Jun protein, and the common structure of Jun protein is its DNA binding region, and is composed of a leucine zipper adjacent to a region rich in basic amino acids. Jun proteins form dimers via leucine zippers and bind to specific DNA sequences (similar to TGACTCA) via the basic region. Jun bound to DNA activates transcription, but its intensity is known to be c-Jun> JunD> JunB. Jun also binds strongly to DNA by forming the most stable heterodimer with flexible Fos family protein, but its transcriptional regulation is determined by the Fos family member. In addition, the name jun is derived from 17 (junana), and the jun protein is thought to be promoted to regulate cell proliferation in that it has the ability to transform cells by overexpression or reorganization.

On the other hand, in the present invention, when inhibiting the expression of JunB in the Jun protein in immune cells, it was confirmed that the production of the inflammatory cytokine IL-17 is inhibited, which is the promoter activity of IL-17 in the cells lacking JunB It was confirmed that the mechanism of decreasing the inhibition of production (expression) of IL-17 (see Examples 3 and 4).

In addition, in one embodiment of the present invention, Th17 cells, unlike Treg cells, are involved in the forefront of the inflammatory response in immune diseases, thereby maximizing the signal of the inflammatory response, thereby accelerating disease progression. Analysis of the expression level revealed that JunB has the ability to promote the differentiation of CD4 + T cells into Th17 cells, suggesting that JunB and IL-17 cytokines are co-expressed in differentiated Th17 cells. (See Example 1 and Example 2).

Therefore, the present inventors focus on the fact that JunB has an effect of accelerating the symptoms of immune diseases, and when inhibiting the expression or activity of such JunB prevents or prevents immune diseases through inhibiting the immune response or inflammatory response. It can be seen that it can be treated.

Therefore, the present inventors produced an animal model of arthritis mouse, which is an example of an immune disease, and then produced a vector capable of inhibiting its expression by targeting the mRNA of JunB to the mouse and injecting it into the arthritis mouse. As a result of analyzing the degree, the arthritis index was markedly decreased in the mice suppressed JunB expression compared to the control mice injected with the MOCK vector (control) (see FIG. 5).

In addition, in another embodiment, in order to examine the mechanism of the therapeutic effect of arthritis in detail, the degree of destruction of the joint and the invasion rate of inflammatory cells in the joint were analyzed in the mouse and the control mouse in which JunB expression was suppressed. In the mouse group that inhibited the expression of JunB, the degree of destruction of the joints and the infiltration of inflammatory cells were significantly reduced compared to the control group (see FIG. 6).

Furthermore, the present inventors prepared a mouse model of graft-versus-host disease, an autoimmune disease other than arthritis, and then injected a vector capable of inhibiting JunB expression and a vector capable of overexpressing JunB and observing the immune rejection reaction. As a result, the group overexpressing JunB was found to increase the graft immune rejection response, whereas the group inhibiting the expression of JunB was significantly reduced in the graft immune rejection response (see FIG. 10).

Therefore, through these experiments, the present inventors were able to cure immune diseases caused by immune response abnormalities including autoimmune diseases such as arthritis and graft-versus-host disease through ultimately inhibiting the expression of JunB.

Therefore, the present invention can provide a composition for the prevention or treatment of immune diseases comprising the expression or activity inhibitor of JunB as an active ingredient, more specifically, the present invention is antisense nucleotide, complementary to the mRNA of JunB gene, small It provides a pharmaceutical composition for the prevention or treatment of immune diseases, including any one selected from the group consisting of interfering RNA (short interfering RNA), short hairpin RNA (short hairpin RNA) and antibodies to the JunB protein.

In addition, the JunB gene in the present invention may be made of a polynucleotide of SEQ ID NO: 1, the polynucleotide of SEQ ID NO: 1 may be to encode a polypeptide of SEQ ID NO: 2.

The antisense oligonucleotides are used in the art to achieve gene-specific inhibition in vivo as well as in vitro, and short length DNA synthesis strands (or DNA) that are antisense (or complementary) to specific DNA or RNA targets. Analog). The antisense oligonucleotide can inhibit the expression of a protein encoded by a DNA or RNA target by binding to the target and stopping expression at the stage of transcription, translation or splicing. The antisense oligonucleotides have been successfully used in cell culture and animal models of disease (Hogrefe, 1999). Another modification of antisense oligonucleotides is known to those skilled in the art in order to ensure that the oligonucleotides are not degraded.

Thus, antisense oligonucleotides that may be used in the present invention may include oligonucleotides having double or single stranded DNA, double or single stranded RNA, DNA / RNA hybrids, DNA and RNA analogs and base, sugar or backbone modifications and In addition, the oligonucleotides may be modified by methods known in the art to increase stability and to increase resistance to nuclease degradation, these modifications are well known in the art and modification of the oligonucleotide backbone, sugar Including but not limited to modifications of the moiety or modification of the base.

In addition, the inhibitor for the JunB gene may be a siRNA (small interfering RNA) for the JunB gene, but may also be a short hairpin RNA that complementarily binds to the mRNA of the JunB gene, in one embodiment of the present invention. The expression of the JunB gene was suppressed using the polynucleotide of SEQ ID NO: 9 as a short hairpin RNA that complementarily binds to the mRNA of the JunB gene.

The siRNA may be obtained by purifying the siRNA already present by chemical synthesis, amplification of the required nucleotide sequence by polymerase chain reaction (PCR), or by recombinant synthesis. In addition, many companies offer siRNA synthesis commercially, in particular companies such as Eurogentec, Ambion, Dharmacon, or Qiagen.

The siRNA has been suggested as an alternative to antisense oligonucleotides, because even at relatively low concentrations, it is possible to obtain an effect equivalent to or higher than that obtained by antisense oligonucleotides (Thompson, 2002). It is widely used to inhibit gene expression. Delivery of such siRNAs and expression constructs / vectors including siRNAs are well known to those skilled in the art. For example, U.S. Patent Application Nos. 2004/106567 and 2004/0086884 disclose delivery mechanisms including viral vectors, non-viral vectors, liposome delivery vehicles, plasmid injection systems, artificial viral envelopes and polylysine conjugates, / Vector.

One skilled in the art can synthesize and modify the antisense oligonucleotides and siRNAs in any desired manner using methods known in the art (Andreas Henschel, Frank Buchholz 1 and Bianca Habermann (2004) DEQOR: a web-based tool for the design and quality control of siRNAs.Nucleic Acids Research 32 (Web Server Issue): W113-W120.) Those skilled in the art will also appreciate that regulatory sequences useful for expression constructs / vectors with antisense oligonucleotides or siRNAs (eg, constitutive promoters, inducibles). Promoter, tissue-specific promoter, or a combination thereof) can be readily selected and used.

In the present invention, the inhibitor of the JunB gene may be any substance that inhibits the expression of the gene in addition to the antisense oligonucleotide or siRNA. Therefore, compounds known in the art as inhibitors of these genes are also available.

In addition, as an active ingredient that may be included in the composition for preventing or treating immune diseases of the present invention, an inhibitor for JunB protein may be included. Such inhibitors may be, but are not limited to, nucleic acids, compounds, natural products or proteins. For example, the inhibitor for the protein may be an antibody against a protein expressed from the gene of the present invention. The monoclonal antibody to the protein may be prepared and used through a monoclonal antibody manufacturing method customary in the art, or may be used commercially. In addition, a polyclonal antibody that recognizes the protein may be used instead of the monoclonal antibody, which may be manufactured and used through an antiserum production method conventional in the art.

Meanwhile, in the present invention, the "immune disease" refers to a disease in which components of the mammalian immune system cause, mediate or otherwise contribute to the pathology of the mammal. In addition, the stimulation or discontinuation of the immune response may include all diseases that have a compensatory effect on the progress of the disease, and the present invention may include diseases caused by an irritable immune response. Examples of such immune disorders include, but are not limited to, autoimmune diseases; Inflammatory disease; And transplant rejection of cells, tissues, or organs.

In addition, one of the most important properties of all normal individuals is that they do not react negatively to the antigenic material that constitutes the self, while non-self antigens are recognized and reacted to remove I have the ability. Such a non-response of a living body to a self-antigen is called immunologic unresponsiveness or tolerance.

However, when there is a problem in inducing or maintaining such self-tolerance, an immune response occurs to autoantigens, and this causes an attack on one's own tissue. The disease caused by this process is called an "autoimmune disease" It is called.

In addition, "inflammatory disease" refers to tumor necrosis factor-α (TNF-α) and IL-1 (excessively stimulated by the immune system such as macrophages due to excessive stimulation of the human immune system due to harmful stimuli such as inflammation-induced factors or irradiation). interleukin-1), IL-6, prostaglandin (prostagladin), luecotriene or nitric oxide (nitric oxide, NO) refers to a disease caused by proinflammatory substances (inflammatory cytokines).

On the other hand, in order to successfully transplant the organ, the recipient's immune rejection response to the transplanted cells and organs must be overcome. The main mediator of transplantation immune rejection is T cell, which is expressed in the graft. Major histocompatibility complex (MHC) is recognized by T cell receptor (T cell receptor) A reaction occurs. Immunosuppressive agents have been used to reduce these transplant immune rejection responses. A common goal of these immunosuppressive agents is to inhibit T cell-mediated immune responses to grafts. Recently, regulatory T cells have been used to suppress immune responses, Methods to treat refractory diseases have been attempted.

In addition, the autoimmune disease or inflammatory disease in the present invention is autoimmune hepatitis, arthritis, insulin-dependent diabetes mellitus, ulcerative colitis, Crohn's disease, multiple sclerosis, autoimmune myocarditis, skin sclerosis, myasthenia gravis, multiple myositis / skin myositis, Hashimoto's disease, autoimmune cytopenia, Sjogren's syndrome, vasculitis syndrome and systemic lupus erythematosus.

As used herein, the term “treatment”, unless stated otherwise, reverses, alleviates, inhibits the progression of, or a disease or condition to which the term applies, or one or more symptoms of the disease or condition, Or to prevent, and the term "treatment" as used herein refers to the act of treating when "treating" is defined as above. Thus, in mammals, “treatment” or “therapy” of an immune disease may include one or more of the following:

(1) inhibiting the growth of the immune system, i.e., inhibiting its development,

(2) preventing the spread of immune diseases, i.e., preventing metastasis,

(3) alleviates immune diseases.

(4) preventing the recurrence of immune disorders, and

(5) palliating symptoms of immune disorders

A composition for preventing or treating an immune disease according to the present invention may include a pharmaceutically effective amount of an inhibitor of JunB gene expression or an inhibitor of JunB protein activity alone or include one or more pharmaceutically acceptable carriers, excipients or diluents. Can be. The pharmaceutically effective amount herein refers to an amount sufficient to prevent, ameliorate and treat the symptoms of an immune disease.

The pharmaceutically effective amount of the inhibitor of JunB gene expression or the inhibitor of JunB protein activity is 0.5-100 mg / day / kg body weight, preferably 0.5-5 mg / day / kg body weight. However, the pharmaceutically effective amount may be appropriately changed according to the degree of symptoms of immune disease, the age, weight, health condition, sex, route of administration and duration of treatment of the patient.

Also, the pharmaceutically acceptable hereinabove refers to a composition that is physiologically acceptable and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, or the like when administered to a human. Examples of the carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. Further, it may further include a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent.

In addition, the compositions of the present invention may be formulated using methods known in the art so as to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal. The formulations may be in the form of powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatine capsules, sterile injectable solutions, sterile powders.

In addition, the composition for preventing or treating immune diseases according to the present invention may be administered through various routes including oral, transdermal, subcutaneous, intravenous or intramuscular, and the dosage of the active ingredient is determined by the route of administration, age, sex, It may be appropriately selected according to various factors such as body weight and severity of the patient, and the composition for preventing or treating an immune disease according to the present invention may be a known compound having the effect of preventing, ameliorating or treating the symptoms of cancer or immune disease. It may be administered in parallel.

Therefore, the present invention may provide a method for preventing or treating an immune disease, comprising administering a composition for preventing or treating an immune disease to a mammal other than a human suffering from an immune disease.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited to these examples.

< Example  1>

Th17  In a cell JunB With the expression of IL Of the impact on the generation of -17

To determine whether JunB inhibition is effective in treating diseases caused by abnormal immune response, such as autoimmune diseases, IL-induced levels of JunB expression and increased JunB expression in Th17 cells associated with autoimmune diseases. The expression level of 17 was confirmed by the following method.

<1-1> PCR  By method JunB of Expression level  analysis

First, the spleen was separated from the mouse and ground to obtain cells. The cells were then reacted with anti-mouse CD4 microbeads at 4 ° C. for 15 minutes, washed, and the positive fractions were recovered by autoMACs. The separated CD4 + cell fraction was washed with PBS, inactivated fetal bovine serum at 5 ° C. for 30 minutes, and the cell culture solution containing penicillin (100 U / ml) and streptomycin (10 g / ml) (RPMI1640 medium). , Gibco BRL, USA). 1 x 10 ⁶ cells were cultured in 24-well plates for differentiation into Th17 cells, and anti-CD28 antibody (1ug / ml), anti-IFNg antibody (2ug / ml), anti-IL in 23-well plates coated with anti-CD3 Incubated for 3 days with -4 antibody (2ug / ml, anti-IL-2 antibody (2ug / ml), IL-6 (20ng / ml), TGF-beta1 (2ng / ml).

Then, in order to confirm the increase of JunB expression in the differentiation-induced Th17 cells in CD4 + T cells, RNA is extracted from the differentiation-induced Th17 cells, and then the primers described in the following table that can amplify mouse JunB and the control β-actin The polymerase chain reaction was carried out using the polymerase chain reaction, and the reaction solution for real-time polymerase reaction was 25 μl in total. The composition of the solution was 2.5 μl of 10 × reaction buffer, 0.5 mM dNTP, and each primer pair. Amplification was repeated 40 times with 10 minutes of reaction at 94 ° C, 15 seconds at 94 ° C, and 45 seconds at 60 ° C using ABI StepOnePlus instrument.

Primer sequence primer Primer sequence SEQ ID NO: junB sense  5'- ATGTGCACGAAAATGGAACA -3 ' 3 junB antisense  5'- CCTGACCCGAAAAGTAGCTG -3 ' 4 β-actin sense  5'- GAAATCGTGCGTGACATCAAAG -3 ' 5 β-actin antisense  5'- TGTAGTTTCATGGATGCCACAG -3 ' 6

As a result, as shown in FIG. 1, the expression of JunB was increased in the cells differentiated with Th17.

<1-2> JunB  Overexpression Th  17 Impact Analysis on Differentiation

Through the results of Example <1-1>, it was shown that the expression of JunB was increased in the differentiated Th17 cells. Therefore, the inventors of the present invention have as follows the relationship between the expression of JunB and IL-17. The same experiment was performed. First, recombinant genes were synthesized by JunB sequencing, which was well expressed in mammalian cells by codon optimization (Genscript, USA). After sequencing analysis to confirm that the JunB gene is correct, using the restriction enzymes of Hindlll and Xhol, the JunB gene region was cut and inserted into the pcDNA3.1 + vector to produce a JunB overexpression recombinant vector, E. coli as a recombinant vector The plasmid was isolated from the transformed Escherichia coli. After analyzing the nucleotide sequence of the recombinant gene, the recombinant plasmid with the correct nucleotide sequence of the JunB gene was selected, and then transduced into NIH 3T3 mouse fibroblasts to overexpress JunB in the fibroblasts, and then expressed the most JunB. A highly efficient pcDNA3.1 + HA-mJunB recombinant vector was selected. And it was cultured to obtain a large amount of plasmid vector DNA. Then, recombinant vectors capable of overexpressing JunB in cells were transfected into LBRM (mouse T lymphoma cell line), and then differentiated under differentiation conditions to Th17 cells one day later, and then cultured for 3 days. The cells were recovered to extract RNA, and the expression of IL-17 was confirmed by real time polymerase reaction using the primers described in Table 2 below.

Primer sequence primer Primer sequence SEQ ID NO: IL-17 sense  5'- CCTCAAAGCTCAGCGTGTCC -3 ' 7 IL-17 antisense  5'- GAGCTCACTTTTGCGCCAAG -3 ' 8

As a result, as shown in FIG. 1, overexpression of the JunB gene significantly increased the expression of IL-17, an inflammatory cytokine that is a differentiation marker of Th17 cells in cells.

Therefore, through the above results, the present inventors found that, in the case of Th17 differentiation-induced cells, the JunB gene is overexpressed in the cells and the expression of the inflammatory cytokine IL-17 is also increased, thereby promoting JunB differentiation into Th17. It was expected to have the ability to do so. In addition, the present inventors anticipate that the regulation of JunB may improve, prevent or treat the symptoms of inflammation or autoimmune disease caused by abnormal immune function.

&Lt; Example 2 >

Identification of cells expressing JunB and IL-17 simultaneously in Th17 cells

The present inventors confirmed the presence of cells expressing JunB and IL-17 together using the spleen tissue of the arthritis mouse induced model induced by type ll collagen to confirm the increase of immune response by JunB. To this end, spleen tissue of arthritis-induced mice was embedded with a frozen tissue embedding agent (OCT compound), and then rapidly cooled with liquid nitrogen, cut into 7 μm thickness using a frozen slicer, and then attached to slides. The sections were then fixed with acetone and then blocked for 30 minutes nonspecific reaction with 10% normal goat serum. The first antibody was then FITC-labeled anti-JunB Ab, PE-labeled anti-IL-17 Ab, PerCP-labeled anti-CD4 Ab (BD Biosciences, San Jose, Calif.) At 1: 100 in PBS pH 7.5. After dilution, the reaction was carried out at room temperature for 1 hour. After washing with PBS, the secondary antibody was reacted at room temperature for 2 hours, washed once with PBS, and then sealed with DAPI. Stained tissue was analyzed by confocal microscopy.

As a result, as shown in Fig. 2, it was found that cells expressing IL-17 and JunB coexist in the spleen of arthritis-induced mice.

Therefore, it was found that the expression of JunB may have an effect on causing immune diseases, and in particular, JunB may be related to the production of IL-17.

<Example 3>

Inhibition of IL-17 Production by JunB Inhibition

Based on the results of the previous examples, JunB inhibits JunB based on the fact that JunB has increased expression in Th17 cells and can increase the expression of IL-17. With this in mind, we analyzed the degree of inhibition of IL-17 production that appeared when we inhibited JunB.

For this analysis, shRNA lenti viral particles (santa cruz) and polybrene (5ug / ml) that inhibited JunB were added to CD4 + T cells to make JunB inhibited, and then Th17 cell differentiation conditions were made and cultured for 3 days. The expression level of IL-17 was examined.

As a result, when compared with the infection with sh lenti viral particles used as a control group, when the expression of Jun Jun with sh JunB, IL-17 expression was significantly reduced (Fig. 3a).

In addition, these results were confirmed through the following experiment, that is, designed a JunB short hairpin RNA oligo for inhibiting the expression of JunB. Designed using the program of Genelink, the sequence is as described below.

JunB sh RNA sequence (SEQ ID NO: 9); 5'-GAAATGGAACAGCCTTTCTATCACGACGACTCAAGAGGTCGTCGTGATAGAAAGGCTGTTCCATTTTTTTTT-3 '

The JunB sh RNA sequence was transferred to lenti virus vector (pLK0.1) using Age1 and EcoRl restriction enzymes, and the JunB shRNA vector thus produced was transduced into LBRM T cell line to make JunB-suppressed cells. After making the differentiation conditions into Th17 cells and incubated for 3 days, the production of IL-17 was confirmed by real time PCR.

As a result, as in the previous experiments, the production of IL-17 was also significantly reduced when JunB was inhibited due to the treatment of sh JunB (see FIG. 3B).

Therefore, through these results, the present inventors found that JunB has a function of promoting differentiation into Th17 cells in the cell, and ultimately, when inhibiting the expression of JunB, it can suppress the differentiation of Th17 cells, which are inflammatory cells. And it was found.

< Example 4 >

Analysis of the Effect of JunB on IL-17 Expression by Luciferase Assay

Through the above examples, it was confirmed that JunB affects the expression of IL-17. In order to confirm whether the action is caused by a direct or indirect action, luciferase assay was used to determine the activity of the IL-17 promoter. Measured. First, to determine the role of JunB in IL-17 production, pGL4 mIL-17 2kb promoter + CNS-5 vector (Addgene plasmid # 20128) and control group were expressed in LBRM (Tcell lymphoma) cells overexpressing the JunB overexpression vector and sh JunB vector, respectively. After transfection of Renilla vector with 4 hours of stimulation with PMA (25ng / ml) and Ionomycin (250nd / ml), we analyzed the activity of IL-17 promoter by dual luciferase analysis with protein lysate.

As a result, the IL-17 promoter activity was increased in the cells overexpressing JunB compared to the control vector, whereas the IL-17 promoter activity was decreased in the cells knocked down. The inventors thus found that JunB directly acts on the promoter of IL-17 to reduce the activity of the IL-17 promoter (see FIG. 4).

&Lt; Example 5 >

Analyzing the Treatment Effect of Arthritis through Inhibition of JunB

In order to confirm whether JunB suppression is effective in inhibiting or treating arthritis, arthritis symptom improvement according to the inhibition of JunB expression was investigated in the arthritis biomodel. Arthritis was induced by intradermal injection of collagen type 2 into DBA1 / J mice, and then inhibited expression of JunB prepared in Example 3 using a hydrodynamic injection technique on day 8 after arthritis induction. 100 μg intravenously injected JunB shRNA vector. At this time, the MOCK vector was injected as a control. On the 14th and 18th day after the induction of arthritis, 100 μg of the vector was injected into the leg joint muscles by electroporation. After that, the arthritis index was evaluated, and the evaluation was performed after arthritis induction, and the index was graphed by evaluating 1 to 4 points.

As a result of evaluating the arthritis index of each group, as shown in Figure 5, when JunB expression was suppressed (mouse group injected with JunB expression suppression vector), arthritis index was significantly reduced compared to the control group injected with MOCK vector. Appeared.

< Example  6>

Inhibition of Arthritis Destruction and Inflammation Inhibition in Arthritis Biomodels

In Example 5, it was confirmed that the inhibition of JunB expression plays an important role in the suppression of arthritis. Furthermore, to determine whether the inhibition is due to the destruction of joints and inflammatory cell suppression mechanisms in the joint tissues, Mouse joints were harvested and fixed in 10% neutral buffered formalin and bone demineralized with EDTA. After embedding in paraffin, the joint tissue was made into 7 μm thick sections and attached to the slides. Xylene was used to pass the deparaffinization process before basic dyeing, and then ethanol was hydrated from high to low concentrations. Hematoxylin and eosin staining were performed, and Safranin O and Toluidine blue methods were used to detect protoglycans in cartilage.

As a result of evaluating the joint tissues of each group, as shown in Fig. 6, as shown in the arthritis index, the degree of joint destruction was significantly suppressed in the mouse group in which JunB expression was suppressed. Infiltration was shown to be inhibited.

Therefore, the present inventors have found that not only the inhibition of JunB according to the present invention can suppress the occurrence of arthritis, but also inhibit the destruction of the joint and the infiltration of inflammatory cells in the joint.

< Example  7>

Inhibition analysis of inflammatory autoantibody production

In order to determine whether inflammatory autoantibodies are inhibited by serum JunB inhibition in the arthritis biomodel, after 3 weeks of arthritis induction in the mice of arthritis of <Example 5>, each mouse group Serum was isolated from the blood by centrifugal separation, coated with typell collagen on 96well plate, and the expression of Cll specific inflammatory antibody (IgG2a) in serum isolated using mouse IgG2a ELISA kit provided by Bethyl. The amount was measured.

As a result, as shown in FIG. 7, the expression of Cll-IgG2a in serum was significantly suppressed in the JunB-inhibited mouse group. As a result, the inhibition of JunB according to the present invention is in vivo in the animal model of arthritis. It was found that inflammatory autoantibodies specific for the antigen can be selectively inhibited.

< Example  8>

Inhibition of Proliferation of Antigen-Specific Immune Cells

In order to determine whether the proliferation of antigen-specific immune cells by JunB inhibition is inhibited in the arthritis mouse model, the cells obtained from splenocytes of the arthritis-induced mouse in <Example 5> are stimulated with antigen (heterologous collagen). Increasing cells were confirmed by CFSE staining followed by FACs analysis. The cells of each group were placed in 1 ml of 0.1% BSA / PBS per 2 × 10 6 and added to the concentration of 5 μM CFSE. The cells were then reacted at 37 ° C. for 15 minutes, washed with cold 1% FBS / RPMI after the reaction, and then the cells of each group stained with CFSE were plated in 48well as 5 × 10 5 cells. Each cell was incubated for 3 days with anti-CD3 and 50ug / ml of type II collagen. After incubation, the cells were analyzed in the FL1-FITC channel using FACs caliber, and the cells proliferated and moved to the left were analyzed.

As a result, as shown in Figure 8, compared with the mouse injected with the control vector, the mice injected with JunB expression suppression vector was found to reduce the proliferation of immune cells. Therefore, the inhibition of JunB also inhibits the proliferation of immune cells by antigen, which can be expected to play a very important role in the treatment of autoimmune diseases.

< Example  9>

Arthritis in Animal Models JunB  Through inhibition IL - 17 expressions  control

In order to confirm the reduction of IL-17 expression due to JunB inhibition in vivo, the expression level of IL-17 in the spleen tissue of JunB-suppressive arthritis-induced mouse of <Example 5> was confirmed by confocal microscopy. In other words, the mouse spleen was used to embed the Optimal Cutting Temperature compound (OCT compound), and then the tissue was rapidly cooled in liquefied nitrogen and attached to the slide with a thickness of 7 μm using the frozen slicer. Sections were then fixed with acetone and 10% normal goat serum was applied to block nonspecific reactions for 30 minutes. Reaction with FiTC-labeled anti-CD4 antibody and PE-labeled anti-IL-17 at 4 ° C. overnight, washed with PBS solution the next day, and stained tissues were analyzed by confocal microscopy.

As a result, IL-17 expressing cells were found to be significantly reduced in the spleen of JunB inhibited mice than in the spleen of the control group. Therefore, these results indicate that JunB regulates inflammation by regulating the expression of IL-17 in the spleen of arthritic mice in vivo (see FIG. 9).

< Example  10>

In transplant rejection JunB Check the features of

To confirm JunB's function in transplant rejection, we constructed a mouse model for rejection. BalB / C mice were irradiated at 70 cGy / mic per minute with total body irraditation (TBI) 800 Rad for suppression of immune cells. Bone marrow and splenocytes were isolated from C57BL / 6 mice, and CD90.2 negative cells (without T cells) were isolated from bone marrow cells for use in the negative control group (TCD-BM). Bone marrow cells and splenocytes were irradiated with TBI-injected bone marrow cells without T cells in TCD-BM (negative control). The next day, the JunB overexpression vector and JunB inhibition vector were injected intravenously, and the immunorejection response scores were measured. Indices were evaluated after induction of transplant rejection, and the indices were evaluated from 1 to 10 points.

As a result, as shown in Figure 10, it was shown that the graft immune rejection reaction was well induced in the mice that induced graft immunorejection reactions, especially in JunB overexpressing mice, the graft immunorejection reaction was the most severe, In contrast, JunB-inhibited mice showed a significant decrease in immune rejection. Therefore, it was found that the inhibition of JunB has an excellent effect on suppression of rejection in transplant rejection.

Through the above results, the present inventors found that if the expression of JunB can be suppressed, the etiology can be controlled in an autoimmune disease such as arthritis or an immune rejection reaction.

So far I looked at the center of the preferred embodiment for the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of catholic University <120> Composition for Preventing or Treating Immune Disease Comprising          JunB inhibitor <130> np12-1036 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 1035 <212> DNA <213> JunB DNA sequence <400> 1 atgtgcacga aaatggaaca gcctttctat cacgacgact cttacgcagc ggcgggatac 60 ggtcggagcc ctggcagcct gtctctacac gactacaaac tcctgaaacc caccttggcg 120 ctcaacctgg cggatcccta tcggggtctc aagggtcctg gggcgcgggg tccaggcccg 180 gagggcagtg gggcaggcag ctacttttcg ggtcagggat cagacacagg cgcatctctg 240 aagctagcct ccacggaact ggagcgcttg atcgtcccca acagcaacgg cgtgatcacg 300 acgacgccca cgcctccggg acagtacttt tacccccgtg ggggtggcag cggtggaggt 360 acagggggcg gcgtcaccga ggagcaggag ggctttgcgg acggttttgt caaagccctg 420 gacgacctgc acaagatgaa ccacgtgacg ccccccaacg tgtccctggg cgccagcggg 480 ggtccccagg ccggcccagg gggcgtctat gctggtccgg agccgcctcc cgtctacacc 540 aacctcagca gttactcccc agcctctgca ccctctggag gctccgggac cgccgtcggg 600 actgggagct catacccgac ggccaccatc agctacctcc cacatgcacc accctttgcg 660 ggcggccacc cggcacagct gggcttgagt cgcggcgctt ccgcctttaa agaggaaccg 720 cagaccgtac cggaggcacg cagccgcgac gccacgccgc ctgtgtcccc catcaacatg 780 gaagaccagg agcgcatcaa agtggagcga aagcggctgc ggaacaggct ggcggccacc 840 aagtgccgga agcggaagct ggagcgcatc gcgcgcctgg aggacaaggt gaagacactc 900 aaggctgaga acgcggggct gtcgagtgct gccggtctcc tacgggagca agtggcgcag 960 ctcaagcaga aggtcatgac ccatgtcagc aacggctgcc agttgctgct aggggtcaag 1020 ggacacgcct tctga 1035 <210> 2 <211> 344 <212> PRT <213> JunB peptide sequence <400> 2 Met Cys Thr Lys Met Glu Gln Pro Phe Tyr His Asp Asp Ser Tyr Ala   1 5 10 15 Ala Ala Gly Tyr Gly Arg Ser Pro Gly Ser Leu Ser Leu His Asp Tyr              20 25 30 Lys Leu Leu Lys Pro Thr Leu Ala Leu Asn Leu Ala Asp Pro Tyr Arg          35 40 45 Gly Leu Lys Gly Pro Gly Ala Arg Gly Pro Gly Pro Glu Gly Ser Gly      50 55 60 Ala Gly Ser Tyr Phe Ser Gly Gln Gly Ser Asp Thr Gly Ala Ser Leu  65 70 75 80 Lys Leu Ala Ser Thr Glu Leu Glu Arg Leu Ile Val Pro Asn Ser Asn                  85 90 95 Gly Val Ile Thr Thr Thr Pro Pro Pro Pro Gly Gln Tyr Phe Tyr Pro             100 105 110 Arg Gly Gly Gly Ser Gly Gly Gly Thr Gly Gly Gly Val Thr Glu Glu         115 120 125 Gln Glu Gly Phe Ala Asp Gly Phe Val Lys Ala Leu Asp Asp Leu His     130 135 140 Lys Met Asn His Val Thr Pro Pro Asn Val Ser Leu Gly Ala Ser Gly 145 150 155 160 Gly Pro Gln Ala Gly Pro Gly Gly Val Tyr Ala Gly Pro Glu Pro Pro                 165 170 175 Pro Val Tyr Thr Asn Leu Ser Ser Tyr Ser Pro Ala Ser Ala Pro Ser             180 185 190 Gly Gly Ser Gly Thr Ala Val Gly Thr Gly Ser Ser Tyr Pro Thr Ala         195 200 205 Thr Ile Ser Tyr Leu Pro His Ala Pro Pro Phe Ala Gly Gly His Pro     210 215 220 Ala Gln Leu Gly Leu Ser Arg Gly Ala Ser Ala Phe Lys Glu Glu Pro 225 230 235 240 Gln Thr Val Pro Glu Ala Arg Ser Arg Asp Ala Thr Pro Pro Val Ser                 245 250 255 Pro Ile Asn Met Glu Asp Gln Glu Arg Ile Lys Val Glu Arg Lys Arg             260 265 270 Leu Arg Asn Arg Leu Ala Ala Thr Lys Cys Arg Lys Arg Lys Leu Glu         275 280 285 Arg Ile Ala Arg Leu Glu Asp Lys Val Lys Thr Leu Lys Ala Glu Asn     290 295 300 Ala Gly Leu Ser Ser Ala Ala Gly Leu Leu Arg Glu Gln Val Ala Gln 305 310 315 320 Leu Lys Gln Lys Val Met Thr His Val Ser Asn Gly Cys Gln Leu Leu                 325 330 335 Leu Gly Val Lys Gly His Ala Phe             340 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JunB F primer <400> 3 atgtgcacga aaatggaaca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JunB R primer <400> 4 cctgacccga aaagtagctg 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Beta actin F primer <400> 5 gaaatcgtgc gtgacatcaa ag 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Beta actin R primer <400> 6 tgtagtttca tggatgccac ag 22 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> IL-17 F primer <400> 7 cctcaaagct cagcgtgtcc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> IL-17 R primer <400> 8 gagctcactt ttgcgccaag 20 <210> 9 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> JunB sh RNA sequence <400> 9 gaaatggaac agcctttcta tcacgacgac tcaagaggtc gtcgtgatag aaaggctgtt 60 ccattttttt tt 72

Claims (8)

Of an immunological disease comprising any one selected from the group consisting of antisense nucleotides complementary to the mRNA of the JunB gene, small interfering RNA, short hairpin RNA, and antibodies to the JunB protein. Prophylactic or therapeutic pharmaceutical compositions. The method of claim 1,
The JunB gene is a pharmaceutical composition for the prevention or treatment of immune diseases, characterized in that consisting of the polynucleotide of SEQ ID NO: 1. The method of claim 2,
The polynucleotide of SEQ ID NO: 1 is a pharmaceutical composition for the prevention or treatment of immune diseases, characterized in that for encoding the polypeptide of SEQ ID NO: 2. The method of claim 1,
Short hairpin RNA that complementarily binds to the mRNA of the JunB gene is a pharmaceutical composition for the prevention or treatment of immune diseases, characterized in that consisting of the polynucleotide sequence of SEQ ID NO: 9. The method of claim 1,
Antisense nucleotides, small interfering RNAs, short hairpin RNAs, or antibodies to JunB proteins that complementarily bind to the mRNA of the JunB gene may be expressed through the expression of the JunB gene or inhibition of the JunB protein activity. Prevent or treat immune diseases, characterized by inhibiting Th17 cell differentiation, inhibiting the production of inflammatory cytokine IL-17, inhibiting inflammatory autoantibodies, and inhibiting proliferation of immune cells by antigen Pharmaceutical composition for. The method of claim 1,
The immune disease is an autoimmune disease; Inflammatory diseases; And a transplant rejection disease of cells, tissues, or organs, the pharmaceutical composition for preventing or treating immune diseases. The method of claim 7, wherein
The autoimmune diseases or inflammatory diseases include autoimmune hepatitis, arthritis, insulin dependent diabetes mellitus, ulcerative colitis, Crohn's disease, multiple sclerosis, autoimmune myocarditis, scleroderma, myasthenia gravis, multiple myositis / skin myositis, Hashimoto's disease, autoimmunity Pharmaceutical composition for the prevention or treatment of immune diseases, characterized in that selected from thrombocytopenia, Sjogren's syndrome, vasculitis syndrome and systemic lupus erythematosus. A method of preventing or treating an immune disease comprising administering a pharmaceutically effective amount of the composition of claim 1 to a mammal, except for a human suffering from an immune disease.

Images