KR20130083311A - Method of transgenic bovine cloned embryos using piggybac transposition - Google Patents

Abstract

PURPOSE: A method for preparing a transformed bovine embryo using piggybac transposition is provided to uniformly express target genes in all embryos and to stably prepare transformed bovine embryos, thereby studying various embryo-related fields. CONSTITUTION: A transformed bovine embryo is prepared using piggybac transposition. The piggybac transposition is formed using vectors. The piggybac transposition is formed using a primer of sequence number 1 or 2. An embryo is prepared through somatic cell nuclear transfer (SCNT) using fibroblasts as a donor cell. The expression of a foreign target gene is regulated by antibiotics or uniform expression of the foreign target genes.

Description

Method of manufacturing bovine transgenic embryos using piggyback translocation {Method of transgenic bovine cloned embryos using Piggybac transposition}

The present invention relates to a method for producing a bovine transformed embryo using piggyback translocation.

Since the birth of the first cloned cows, many cloned animals have been produced in many countries and the importance of the development of the transgenic cows has been encouraged. In particular, a method of micro-injecting DNA into pronuclear stage oocytes was used to prepare a transgenic cow, and after performing somatic cell nuclear transfer (SCNT), the donor cell containing the target remnants. Reprogramming into oocytes without nuclei was used. Reporter genes, such as green (GFP) or red fluorescent protein (RFP), have been used to study the tracking and expression of cells in studies of transgenic animals using SCNT. To date, transgenic studies of bovine embryos have been developed using viral or plasmid DNA delivery systems.

Research on in vitro produced bovine embryos, including SCNT embryos, can provide basic information in numerous embryo-related fields, such as in vitro fertilized embryos, in vitro embryo development, embryonic gene expression, and embryonic stem cells. Bovine transgenic embryos are also used to breed elite cattle, produce disease resistant cattle or for gene expression in a mammalian gland bioreactor. However, when producing a transgenic embryo using the virus or the plasmid as described above, there was a problem that side effects such as chromosomal abnormalities appear.

Therefore, the present inventors have continued the research to solve the above problems, and as a result, by producing a small transgenic embryo capable of ubiqutious the gene of interest using the piggyback transposition or gene expression by antibiotic control The invention has been completed.

It is an object of the present invention to provide a method for producing bovine transformed embryos using a novel gene delivery system.

In order to solve the above problems, the present invention provides a method for producing a bovine transformed embryo using piggyback translocation.

In the production of bovine transgenic embryos using piggyback translocation, a novel gene delivery system of the present invention, gene expression of target genes can be efficiently ubiqutious or controlled by antibiotics, and the target genes are inserted into introns rather than exons. As a result, it is possible to prepare bovine transgenic embryos with increased safety, which may be useful in studies of various embryo-related fields.

1 is a GFP expression vector map.
2 is an induced RFP expression vector map.
Figure 3 shows the expression of GFP in bovine donor fibroblasts (c-c ') and bovine replication preimplantation embryos (d-d') (cd is the observation under visible light, c'-d 'is fluorescent) Observations under).
4 is a result of observing the expression of RFP in cells treated with 2 μg / mL of doxycycline and 800 μg / mL of neomycin (a-a ') and after 8 days after removing doxycycline, RFP expression disappeared. (b-b ').
5 is a result of reprogramming the transformed cells and developing into blastocysts without doxycycline, incubating with doxycycline for more than 2 days on the 7th day and observing the expression of RFP. The blastocysts from the transformed cells expressed RFP (right cell) and the control blastocysts did not express RFP (left cell).
Figure 6 shows the results of confirming the expression of RFP in transgenic blastocysts cultured on feeder cells depending on whether or not doxycycline treatment.
Fig. 7 shows the results of GFP or RFP identification through RT-PCR and genomic PCR from piggyback transgenic blastocysts and SCNT blastocysts from untransformed cells (A: PCR results based on genomic DNA, B : PCR using cDNA as a template, C: GAPDH mRNA expression through RT-PCR, M: molecular marker).

In one aspect, the present invention provides a method for producing bovine transformed embryos using piggybac transposition.

The piggyback potential may be made using the vector of FIG. 1 or FIG. 2.

The piggyback translocation may be performed using the primers of SEQ ID NOs: 1 to 2.

The transgenic embryo may be prepared through SCNT (somatic cell nuclear transfer), and can use fibroblasts as donor cells.

PB according to the present invention functions to be cut from one genomic site and integrated into another by a cut-and-paste mechanism with a transposon. Piggyback is a 2472-bp transposon with 13-bp inverted terminal repeats (ITRs) and 594-amino acid transposase (Cary et al, 1989, Virology 172: 156-169; Fraser et al, 1995, Virology 211: 397-407; Fraser et al, 1996, Insect Molecular Biology 5: 141-151). In the present invention, primers of SEQ ID NOS: 1 to 2 are preferably used for piggyback translocation.

The recombinant vector for piggyback translocation of the present invention may preferably be FIG. 1 or 2, but is not limited thereto.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been re-introduced into the cell by an artificial means as modified.

The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ". The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. The expression vector may preferably comprise one or more selectable markers and promoters. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.

In the production of bovine transformed embryos by piggyback translocation according to the present invention, efficient gene delivery (gene expression in all embryonic cells) is possible compared to the conventional method, and on / off regulation of the target gene by antibiotics This possible bovine transgenic embryo can be prepared. In particular, since the system in which the expression of the target gene is turned on / off by antibiotic control minimizes the side effects that can occur when the existing target gene is always expressed, the target gene protein production system through the antibiotic control gene expression system is Subsequent adverse effects in the animal can be minimized in the production of transgenic cattle.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example  1. Preparation of donor cells

Fibroblasts were isolated from fetuses at day 45 of gestation. Fetal tissue was chopped with a surgical knife and then separated for 1 hour at 37 ° C. in DMEM (Dulbecco's modified Eagle's medium) supplemented with 0.25% (w / v) trypsin and 1 mM EDTA. The treated cells were centrifuged at 1500 rpm for 2 minutes, washed once with DPBS without Ca2 + and Mg2 +, and then inoculated in a 100 mm culture dish. Inoculated cells were cultured in 39 ° C, 5% CO2 incubator for 6-8 days in DMEM medium containing 10% (v / v) FBS, 1 mM glutamine, 25 mM NaHCO3, 1% (v / v) MEM. It was. After removing the unattached cells and the clumps, the cells were treated with 0.1% trypsin and 0.02% EDTA for 5 minutes and subcultured at intervals of 4 to 6 days. The cells were stored by freezing in liquid nitrogen at 196 ° C. Before SCNT, after thawing cells, the cells were incubated for 3 to 4 days, and then cells were recovered from the monolayer using trypsin, which was used as donor cells in the following experiment.

Example  2. Gene building and Transfection  ( Transfection )

GFP and RFP were amplified by PCR. Gateway PCR system (invitrogen) was used, Gateway PCR Primer for this is as follows (Table 1).

GFP-Forward ggggacaagtttgtacaaaaaagcaggcttcACCATGGCCAGCAAAGGAGAAGAACTT GFP-Reverse ggggaccactttgtacaagaaagctgggtcTTATTTGTAGAGCTCATCCATGCC RFP-Forward ggggacaagtttgtacaaaaaagcaggcttcACCATGGATAGCACTGAGAACGTCAT RFP-Reverse ggggaccactttgtacaagaaagctgggtcCTACTGGAACAGGTGGTGGC

GFP- or RFP-PCR fragments were recombined using BP and LP clonase (Invitrogen). PDonor (Invitrogen) was used as the entry vector, and the final expression vector was prepared using PB-CA with the p-CCAGG promoter and PB-TET vector with the tetracycline induced promoter. Piggyback (Piggybac, PB) sequence used in this Example is as follows (Table 2).

5 'PB TTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTTACGTGATAACTTATTATATATATATTTTCTTGTTATAGATATC (SEQ ID NO: 1) 3 'PB TTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTTAATAAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTATTAGTATGTAAGTGTAAATATAATAAAACTTAATATCTATTCAAATTAATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTGATCGATAGGTATTGTCTTTAACTCGTATT

Transposase expression vector (pCy43, Sanger Institute, Hinxton, UK) was used for the transpose of PB-CA-GFP or PB-TET-RFP.

Donor fibroblasts were dispensed into 6 well plates about 18-24 hours prior to transfection using Fugene HD (Roche). When the cells had about 50-60% confluency, transfection was performed according to the known manufacturer's method. PB-CA-GFP and pCy43 vectors were used to express GFP, and PB-TET-RFP and PB-rtTA and pCy43 vectors were used to express RFP (FIGS. 1 and 2).

Example  3. SCNT  And in vitro  Cell culture

The nucleus of the transformed donor fibroblast prepared in Example 2 was transferred to an enucleated oocyte. The reconstructed embryos were electrically fused, then activated with ionomycin for 4 minutes and then incubated for 4 hours at 6-DMAP. Duplicate embryos were incubated in a 39 ° C., 5% CO 2 incubator for 7-8 days in 25 μL microdrops of chemically defined medium applied with mineral oil. The chemically defined medium was prepared according to conventionally known methods. Cleved embryos were observed 24 hours and 8 days after incubation, and for further incubation, SCNT blastocysts were transferred onto trophoblast cells consisting of CF1 fibroblasts mitotically inactivated with mitomycin C. 2 μg / ml doxycycline was added to the culture medium for inducible RFP expression.

Example  4. In bovine transgenic embryos GFP  or RFP Confirmation of expression of

PCR and RT-PCR were performed to confirm the expression of GFP and RFP in bovine transgenic embryos prepared in Example 3 (FIG. 7). PCR primers are as follows (Table 3).

GFP-Forward CACATGAAGCAGCACGACTT GFP-Reverse AGTTCACCTTGATGCCGTTC RFP-Forward CCCCGTAATGCAGAAGAAGA RFP-Reverse GGTGATGTCCAGCTTGGAGT GAPDH-F GGCGTGAACCACGAGAAGTA GAPDH-R CCCTCCACGATGCCAAAGT

As a result of the experiment, it was confirmed that the GFP and RFP genes are expressed in embryonic fetal fibroblasts as well as in embryos before transgenic replication without any chromosomal aberration by piggyback translocation (FIG. 3).

In addition, doxycycline induced the RFP gene in the same bovine fibroblasts (FIG. 4). The development of 2-cell and blastocysts of transgenic embryos induced with GFP (n = 70) or RFP (n = 255) expression was 57 (81.4%) and 27 (38.6%) in GFP and 193 respectively in RFP. (75.5%) and 68 (26.7%). In addition, RFP was not detected in preimplantation embryos when 1-cell cloned embryos were cultured and developed in blastocysts without doxycycline. To reactivate RFP expression, preimplantation embryos were incubated with or without doxycycline for several days on mouse embryonic fibroblasts treated with mitomycin C. As a result, when treated with doxycycline, it was confirmed that RFP expression gradually increased with the treatment time (FIGS. 5 to 6).

Through the above example, it is possible to prepare bovine transgenic embryos through piggyback translocation, which is a novel gene delivery system, and confirmed that GFP and RFP are uniformly expressed in all embryonic cells in transgenic embryos. In particular, the RFP gene was confirmed to be induced by doxycycline in the embryonic stage as well as donor fibroblasts.

Claims (6)

Method for producing bovine transgenic embryos using piggybac transposition.
The method of claim 1, wherein the piggyback translocation is performed using the vector of FIG. 1 or 2.
The method of claim 1, wherein the piggyback translocation is performed using the primers of SEQ ID NOs: 1 to 2. 3.
The method of claim 1, wherein the embryo is produced by SCNT (somatic cell nuclear transfer).
The method of claim 4, wherein the SCNT is a method for producing a bovine transformed embryo, characterized in that using the fibroblasts as donor cells.
The method of claim 1, wherein the manufacturing method is capable of regulating the expression of an external target gene by uniform expression of an external target gene or an antibiotic.

Images