KR20130025770A - Variation enzyme of thermostable bacillus circulans xylanase and gene thereof - Google Patents

Variation enzyme of thermostable bacillus circulans xylanase and gene thereof Download PDF

Info

Publication number
KR20130025770A
KR20130025770A KR1020110089295A KR20110089295A KR20130025770A KR 20130025770 A KR20130025770 A KR 20130025770A KR 1020110089295 A KR1020110089295 A KR 1020110089295A KR 20110089295 A KR20110089295 A KR 20110089295A KR 20130025770 A KR20130025770 A KR 20130025770A
Authority
KR
South Korea
Prior art keywords
thr
gly
ser
asn
tyr
Prior art date
Application number
KR1020110089295A
Other languages
Korean (ko)
Other versions
KR101457957B1 (en
Inventor
유영제
김태호
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to KR1020110089295A priority Critical patent/KR101457957B1/en
Publication of KR20130025770A publication Critical patent/KR20130025770A/en
Application granted granted Critical
Publication of KR101457957B1 publication Critical patent/KR101457957B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2477—Hemicellulases not provided in a preceding group
    • C12N9/248—Xylanases
    • D—TEXTILES; PAPER
    • D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
    • D21C—PRODUCTION OF CELLULOSE BY REMOVING NON-CELLULOSE SUBSTANCES FROM CELLULOSE-CONTAINING MATERIALS; REGENERATION OF PULPING LIQUORS; APPARATUS THEREFOR
    • D21C9/00—After-treatment of cellulose pulp, e.g. of wood pulp, or cotton linters ; Treatment of dilute or dewatered pulp or process improvement taking place after obtaining the raw cellulosic material and not provided for elsewhere
    • D21C9/10—Bleaching ; Apparatus therefor
    • D21C9/1063—Bleaching ; Apparatus therefor with compounds not otherwise provided for, e.g. activated gases

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

PURPOSE: A Bacillus circulans xylanase and a gene thereof are provided to enhance heat stability and to be used in industrial fields. CONSTITUTION: A Bacillus circulans xylanase with enhanced heat stability contains an amino acid sequence among sequence numbers 1-7. A gene of the Bacillus circulans xylanase has a gene sequence among sequence numbers 8-16.

Description

열안정성이 증진된 바실러스 서큘런스 자일라네이즈의 변이 효소 및 그 유전자 {Variation Enzyme of Thermostable Bacillus circulans Xylanase and Gene thereof}Variation Enzyme of Thermostable Bacillus Circulans Xylanase and its Genes

본 발명은 열안정성이 증가된 돌연변이 Bacillus circulans xylanase 효소(이하 BCX) 효소 3종과 그의 조합 효소 및 그들의 유전자에 관한 것이다. 보다 상세하게, 본 발명은 Bacillus circulans 종의 xylanase 효소의 64번째 아미노산 글리신을 알라닌으로 치환한 변이 유전자와 효소, 156번째 아미노산 히스티딘을 발린으로 치환한 변이 유전자와 효소, 168번째 아미노산 발린을 이소류신으로 치환한 변이 유전자와 효소, 혹은 이들의 조합으로 이루어진 변이 효소 및 유전자에 관한 것이다. 열안정성이 증가한 변이 효소로써 산업적으로 유용한 반응에 이용할 수 있을 것으로 기대된다.The present invention relates to three mutant Bacillus circulans xylanase enzymes (hereinafter referred to as BCX) enzymes with increased thermostability, combination enzymes thereof and genes thereof. More specifically, the present invention is a variant gene and enzyme substituted with alanine for the 64th amino acid glycine of the xylanase enzyme of Bacillus circulans species, a variant gene and enzyme for replacing the 156th amino acid histidine with valine, and an isoleucine for 168 amino acid valine It relates to a variant enzyme and gene consisting of a variant gene and enzyme, or a combination thereof. As a variant enzyme with increased thermal stability, it is expected to be used for industrially useful reactions.

자일라네이즈는 기존 산업 중 펄프 생산 공정에서 표백을 위한 공정에서 투입되었다. 전 공정의 온도가 높아, 자일라네이즈의 투입 공정은 열을 식히는 과정 후에 투입되어야 하는데 이것이 비용과 시간의 증가를 가져온다. 또한 최근 바이오에너지 및 바이오화학 산업에서 목질계 바이오매스의 전처리 이후 당화 과정을 위한 효소 처리 공정에도 자일라네이즈가 사용된다. 이 과정 역시 전처리 과정의 온도가 고온이므로 식히는 과정이 필요하며 이것이 비용과 시간의 증가를 가져온다. 따라서 식히는 과정을 줄일 수 있도록 높은 온도에서 반응하는 자일라네이즈의 개량은 산업적으로 필요하다.Xylanase is used in the process for bleaching in the pulp production process in the existing industry. Due to the high temperature of the entire process, the xylanide loading process must be added after the cooling process, which adds cost and time. Also, in the bioenergy and biochemical industries, xylanase is also used in the enzyme treatment process for the saccharification process after pretreatment of wood-based biomass. This process also requires a cooling process because of the high temperature of the pretreatment process, which leads to an increase in cost and time. Therefore, it is industrially necessary to improve the reaction of xylase at high temperatures to reduce the cooling process.

KR 874873 (경상대학교산학협력단) 2008.12.19.KR 874873 (Gyeongsang National University Industry-Academic Cooperation Foundation) 2008.12.19.

본 발명은 상기와 같은 문제점을 해결하기 위하여 안출된 것으로서, Bacillus circulans 종의 xylanase 효소의 64번째 아미노산 글리신을 알라닌으로, 156번째 아미노산 히스티딘을 발린으로, 168번째 아미노산 발린을 이소류신으로 치환하거나 이들을 조합한 변이효소를 제공하는 것을 그 목적으로 한다.The present invention has been made to solve the above problems, the 64th amino acid glycine of xylanase enzyme Bacillus circulans species with alanine, 156 amino acid histidine valine, 168 amino acid valine to isoleucine or combined The aim is to provide a variant enzyme.

본 발명은 또한, 상기 변이효소를 암호화하는 유전자를 제공하는 것을 또 다른 목적으로 한다.Another object of the present invention is to provide a gene encoding the above-mentioned mutaenzyme.

본 발명의 바실러스 서큘런스 자일라네이즈 변이효소는 상술한 바와 같은 목적을 달성하기 위하여, 서열목록 1 내지 7 중 어느 한 서열목록의 아미노산 서열을 포함하는 것을 특징으로 한다.Bacillus circulatory xylase mutase of the present invention is characterized in that it comprises the amino acid sequence of any one of SEQ ID NOS: 1 to 7 in order to achieve the object as described above.

또한, 본 발명의 바실러스 서큘런스 자일라네이즈 변이효소의 유전자는 서열목록 8 내지 16 중 어느 한 서열목록의 유전자 서열을 포함하는 것을 특징으로 한다.In addition, the gene of the Bacillus circular xylase mutase of the present invention is characterized in that it comprises the gene sequence of any one of SEQ ID NOS: 8-16.

본 발명은 Bacillus circulans 종의 xylanase 효소의 64번째 아미노산 글리신을 알라닌으로 치환한 변이 유전자와 효소, 156번째 아미노산 히스티딘을 발린으로 치환한 변이 유전자와 효소, 168번째 아미노산 발린을 이소류신으로 치환한 변이 유전자와 효소, 혹은 이들의 조합으로 이루어진 변이 효소 및 유전자에 관한 것으로, 야생형에 비해 열안정성이 최고 75 배 증가하여 산업적으로 대단히 유용하다.The present invention relates to a variant gene and an enzyme substituted with alanine for the 64th amino acid glycine of the xylanase enzyme of Bacillus circulans species, a variant gene and an enzyme substituted with valine for the 156 amino acid histidine, and a variant gene substituted for isoleucine for the 168th amino acid valine The present invention relates to a mutant enzyme and a gene consisting of an enzyme, or a combination thereof. The thermal stability is up to 75 times higher than that of a wild type, which is very useful industrially.

이하, 본 발명의 바람직한 실시예에 대하여 상세히 설명한다. 또한, 하기의 설명에서는 구체적인 구성요소 등과 같은 많은 특정사항들이 설명되어 있는데, 이는 본 발명의 보다 전반적인 이해를 돕기 위해서 제공된 것일 뿐 이러한 특정 사항들 없이도 본 발명이 실시될 수 있음은 이 기술분야에서 통상의 지식을 가진 자에게는 자명하다 할 것이다. 그리고, 본 발명을 설명함에 있어서, 관련된 공지 기능 혹은 구성에 대한 구체적인 설명이 본 발명의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.Hereinafter, preferred embodiments of the present invention will be described in detail. In the following description, numerous specific details, such as specific elements, are set forth in order to provide a thorough understanding of the present invention, and it is to be understood that the present invention may be practiced without these specific details, It will be obvious to those who have knowledge of. In the following description of the present invention, a detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear.

단백질의 열안정성은 분자 내에서 3차원 공간적으로 군집해서 이루어져 있는 소수성 상호 작용에 가장 큰 영향을 받아 결정되는 것으로 알려져 있다. 본 연구에서는 소수성 상호 작용의 특성을 이해하기 위해 네트워크 분석법을 단백질 구조에 자일라네이즈의 열안정성에 영향을 끼치는 것으로 보이는 적합한 소수성 아미노산의 무리 형성 양상을 발견하였다. 이 군집의 양상을 대상 효소인 BCX에 도입하여 열안정성을 획득하였다.The thermal stability of proteins is known to be determined by the strongest influence of hydrophobic interactions, which consist of three-dimensional spatial clustering within a molecule. In order to understand the nature of hydrophobic interactions in this study, we used network analysis to find a suitable group of hydrophobic amino acids that seem to influence the thermal stability of xylanase on protein structure. This cluster was introduced into BCX, a target enzyme, to obtain thermal stability.

이하, 본 발명의 실시예에 대하여 설명한다.Hereinafter, embodiments of the present invention will be described.

실시예Example

MaterialsMaterials andand methodsmethods (재료와 방법)(Materials and methods)

ChemicalsChemicals andand enzymesenzymes (화학물질과 효소)(Chemicals and enzymes)

따로 명시되지 않은 대부분의 chemical(화학물질)은 Sigma(St.Louis, USA), Merck(Darmstadt, Germany), Invitrogen(Carlsbad, USA)에서 구입하였으며, 모두 analytical grade(분석용 품위)이다. 제한효소의 경우, NEB(Ipswich, USA)와 Bioneer(Daejeon, Korea)에서 구입하였다. Cell culture(세포 배양)를 위한 배지의 경우 BD(Sparks, USA), Merck, Invitrogen에서 구입하였다.Most of the chemicals not specified are purchased from Sigma (St. Louis, USA), Merck (Darmstadt, Germany) and Invitrogen (Carlsbad, USA), all of which are analytical grade. Restriction enzymes were purchased from NEB (Ipswich, USA) and Bioneer (Daejeon, Korea). Cell culture media were purchased from BD (Sparks, USA), Merck, and Invitrogen.

StrainsStrains andand plasmidsplasmids (품종과 플라스미드)(Breed and plasmid)

E.coli Top10은 Invitrogen(Carlsbad, USA)에서, E.coli BL21(DE3)는 Novagen(Madison, WI, USA)에서 구입하였다. 재조합에 쓰인 pET23b(+) 벡터는 Novagen(Madison, WI, USA)에서 구입하였다.E. coli Top 10 was purchased from Invitrogen (Carlsbad, USA) and E. coli BL21 (DE3) was purchased from Novagen (Madison, WI, USA). The pET23b (+) vector used for recombination was purchased from Novagen (Madison, WI, USA).

BCXBCX 유전자의 돌연변이 Gene mutation

Modify(변형)된 QuickChangeTM site-directed mutagenesis(QuickChangeTM 위치 지향적 돌연변이) 방법이 사용되었다(Nucleic Acids Research Vol. 32, No. 14, e115). 사용된 primer(프라이머)는 다음과 같다. A modified QuickChange ™ site-directed mutagenesis method was used (Nucleic Acids Research Vol. 32, No. 14, e115). The primers used are as follows.

Mutants (돌연변이)Mutants Template(주형)Template Primers(프라이머)Primers G64AG64A pET23bBCXpET23bBCX 5’GGTAACGCTTACCTGACACTGATGG3’
5’CAGGTAAGCGTTACCATTCGGGGC3’5'GGTAACGCTTACCTGACACTGATGG3 '
5'CAGGTAAGCGTTACCATTCGGGGC3 ' H156VH156V pET23bBCXpET23bBCX 5’GGAAATCCGTCGGTATGAACCTAGGTTCTAATTG3’
5’CATACCGACGGATTTCCATGCATTCACG3’5'GGAAATCCGTCGGTATGAACCTAGGTTCTAATTG3 '
5'CATACCGACGGATTTCCATGCATTCACG3 ' V168IV168I pET23bBCXpET23bBCX 5’CTTATCAAATAATGGCGACCGAAGGCTACCAG3’
5’GTCGCCATTATTTGATAAGCCCAATTAGAACC3’5'CTTATCAAATAATGGCGACCGAAGGCTACCAG3 '
5'GTCGCCATTATTTGATAAGCCCAATTAGAACC3 ' G64A/H156V/V168IG64A / H156V / V168I pET23bBCX
G64A/H156VpET23bBCX
G64A / H156V 5’CTTATCAAATAATGGCGACCGAAGGCTACCAG3’
5’GTCGCCATTATTTGATAAGCCCAATTAGAACC3’5'CTTATCAAATAATGGCGACCGAAGGCTACCAG3 '
5'GTCGCCATTATTTGATAAGCCCAATTAGAACC3 '

모든 primer(프라이머)는 Cosmogenteck(Daejeon, Korea)에서 합성되었고, 돌연변이 유전자의 확인 역시 같은 회사에서 sequencing(염기서열 결정법)을 통해 확인하였다. All primers were synthesized by Cosmogenteck (Daejeon, Korea), and mutant genes were also identified by sequencing (base sequence determination).

자일라네이즈의Xylanize 발현과 획득 Expression and Acquisition

pET23b(+)-BCX 야생형과 돌연변이들의 재조합 벡터는 E.coli BL21(DE3) 품종에 electroporation(전기충격) 방법(Bio-Rad Micropulser)을 통해 transformation(형질전환)되었다. 이후 앰피실린 50μg/ml함유 LB 배지에서 selection하였다. Recombinant vectors of the pET23b (+)-BCX wild type and mutants were transformed into E. coli BL21 (DE3) varieties via electroporation (Bio-Rad Micropulser). Then, it was selected in ampicillin 50μg / ml containing LB medium.

pET23b(+)-BCX 야생형과 돌연변이들의 재조합 DNA가 형질전환된 BL21 세포를 LB 배지 3ml에 접종하였다. Overnight(하룻밤) 후 50ml LB 배지로 2차 접종하여 OD600이 0.4~0.6 수준으로 키운 후 IPTG(isopropyl-ß-D-thiogalactopyranoside(이소프로필 1-티오-ß-D-갈락토시드))의 농도를 최종 1mM이 되도록 처리하여 induction(유도)을 시작하였다. 모든 과정은 37°C에서 진행하였다. 24시간 후 세포를 수확하여 centrifugation(원심분리)을 통하여 cell pellet(세포 집괴)을 얻었다. BL21 cells transformed with recombinant DNA of pET23b (+)-BCX wild type and mutants were seeded in 3 ml of LB medium. Overnight (overnight) was inoculated in 50ml LB medium to raise the OD600 to 0.4 ~ 0.6 level and then the concentration of isopropyl-ß-D-thiogalactopyranoside (isopropyl 1-thio-ß-D-galactoside) was measured. Induction was started by treating the final 1 mM. All procedures were carried out at 37 ° C. After 24 hours, the cells were harvested to obtain cell pellets by centrifugation.

15ml lysis buffer(세포 용혈 완충 용액)(50mM NaH2PO4, 300mM NaCl, 10mM imidazole(이미다졸), pH 8.0)를 처리하여 resuspension(재부유)시킨 후 sonication(음파처리)을 통하여 cell disruption(세포파열)하였다. cell lysate(세포 용해물)를 Ni2+-NTA column(칼럼)(Qiagen, Hilden, Germany)에 loading(로딩)하였다. 500μl Ni-NTA agarose resin(아가로오스 수지)이 사용되었고, cell lysate(세포 용해물)와 함께 4°C에서 1시간 동안 처리되었다. Washing buffer(세척 완충 용액)(50mM NaH2PO4, 300mM NaCl, 20mM imidazole(이미다졸), pH 8.0) 15ml을 흘려주고, 최종적으로 elution buffer(용출 완충 용액)(50mM NaH2PO4, 300mM NaCl, 250mM imidazole(이미다졸), pH 8.0) 500μl을 2번 흘려서 재조합 단백질을 얻었다.15 ml lysis buffer (cell hemolysis buffer solution) (50mM NaH2PO4, 300mM NaCl, 10mM imidazole, pH 8.0) was treated to resuspension (resuspension), followed by cell disruption through sonication. . The cell lysate (cell lysate) was loaded (loaded) on a Ni2 + -NTA column (column) (Qiagen, Hilden, Germany). 500 μl Ni-NTA agarose resin was used and treated with cell lysate at 4 ° C. for 1 hour. 15 ml of Washing buffer (50mM NaH2PO4, 300mM NaCl, 20mM imidazole, pH 8.0) is poured and finally elution buffer (50mM NaH2PO4, 300mM NaCl, 250mM imidazole) ), pH 8.0) 500 μl was flowed twice to obtain a recombinant protein.

ActivityActivity assayassay (활성 분석) (Activity analysis)

E.coli에서 발현한 BCX는 modified DNS method를 사용하여 활성을 분석하였다. 기질로는 beechwood xylan을 사용하였고, pH 5.5의 50mM sodium acetate buffer 상에서 진행하였다. 40μL 효소 용액(2μg/mL xylanase solution with 10% glycerol)과 360μL 기질 용액(1%(w/v) xylan)을 섞어 반응을 진행하였다. 반응은 50°C에서 5분 동안 진행되다가 600μL의 DNS reagent를 넣어 반응을 종결하였다. 용액을 5분 동안 100°C에서 끓이고 2분 동안 얼음에서 식힌 후, 분광광도계 Varian, CA, USA)를 이용하여 540nm에서 흡광도를 측정하였다.BCX expressed in E. coli was assayed using the modified DNS method. Beechwood xylan was used as a substrate and was run on 50 mM sodium acetate buffer at pH 5.5. The reaction was carried out by mixing 40 μL enzyme solution (2 μg / mL xylanase solution with 10% glycerol) and 360 μL substrate solution (1% (w / v) xylan). The reaction proceeded at 50 ° C. for 5 minutes and then terminated by adding 600 μL of DNS reagent. The solution was boiled at 100 ° C. for 5 minutes and cooled on ice for 2 minutes, then the absorbance was measured at 540 nm using a spectrophotometer Varian, CA, USA).

열안정성Thermal stability 측정 Measure

효소의 열에 의한 비활성 정도를 반감기로 측정하였다. 기질이 첨가되지 않은 효소 용액을 50°C와 55°C에서 거치하며 시간에 따른 잔여 활성을 측정하였다. 반감기는 t1/2=ln2/k(k는 비활성 상수) 식을 이용하여 계산하였다. The degree of heat inactivation of the enzyme was measured by half life. The enzyme solution without the substrate was added at 50 ° C and 55 ° C, and residual activity was measured over time. Half-life was calculated using the formula t1 / 2 = ln2 / k (k is an inert constant).

ResultsResults (결과)(result)

G64A, H156V, V168I는 증진된 열안정성을 보였다. 각각 반감기가 2배, 1.4배, 10배 증가하였다. G64A, H156V, and V168I showed enhanced thermal stability. The half-lives increased by 2, 1.4, and 10 times, respectively.

효소enzyme Vmax (μM/분)V max (μM / min) Km (mM-1)K m (mM -1 ) 촉매효율 (mM/분)Catalytic Efficiency (mM / min) t1 /2 (분)t 1/2 (min) 야생형 BCXWild type BCX 2.9282.928 29.4129.41 10.5610.56 6969 G64A (Fingers)G64A (Fingers) 3.3203.320 30.0730.07 11.06 (105 %)11.06 (105%) 139139 H156V (Helix)H156V (Helix) 3.4853.485 19.1019.10 17.98 (170 %)17.98 (170%) 9999 V168I (Palm)V168I (Palm) 2.4142.414 35.6735.67 7.18 (68 %)7.18 (68%) 693693

열안정성을 더욱 높이기 위한 조합으로 G64A/H156V/V168I triple mutant를 제작하였다. Triple mutant는 야생형의 75배에 해당하는 반감기를 나타내었다.G64A / H156V / V168I triple mutant was fabricated as a combination to further improve thermal stability. Triple mutants had a half-life of 75 times that of wild type.

효소enzyme Vmax (μM/분)V max (μM / min) Km (mM-1)K m (mM -1 ) 촉매효율 (mM/분)Catalytic Efficiency (mM / min) t1 /2 (분)t 1/2 (min) 야생형 BCXWild type BCX 2.9282.928 29.4129.41 10.5610.56 ~4~ 4 G64A/H156V/V168IG64A / H156V / V168I 1.9981.998 33.8233.82 6.02 (57 %)6.02 (57%) 300 (> ×75)300 (> × 75)

이상에서는 본 발명의 바람직한 실시예에 대해서 설명하였으나, 본 발명은 상술한 특정의 실시예에 한정되지 아니하며, 당해 기술분야에서 통상의 지식을 가진 자라면 본원 발명의 요지를 벗어남이 없이 다양한 변형 실시가 가능함은 물론이다. 따라서, 본 발명의 범위는 위의 실시예에 국한해서 해석되어서는 안되며, 후술하는 특허청구범위 뿐만 아니라 이 특허청구범위와 균등한 것들에 의해 정해져야 할 것이다.
While the present invention has been described in connection with what is presently considered to be practical exemplary embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, Of course it is possible. Accordingly, the scope of the present invention should not be construed as being limited to the above-described embodiments, but should be determined by equivalents to the appended claims, as well as the following claims.

<110> SNU R&DB FOUNDATION <120> Variation Enzyme of Thermostable Bacillus circulans Xylanase and Gene thereof <130> M11-8370-FD <160> 14 <170> KopatentIn 2.0 <210> 1 <211> 185 <212> PRT <213> Bacillus circulans <400> 1 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val 1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn 20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe 35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Ala 50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr 65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly 85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg 100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr 115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile 130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser His Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Val Met Ala Thr Glu Gly Tyr Gln Ser 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp 180 185 <210> 2 <211> 185 <212> PRT <213> Bacillus circulans <400> 2 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val 1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn 20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe 35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Gly 50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr 65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly 85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg 100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr 115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile 130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser Val Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Val Met Ala Thr Glu Gly Tyr Gln Ser 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp 180 185 <210> 3 <211> 185 <212> PRT <213> Bacillus circulans <400> 3 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val 1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn 20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe 35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Gly 50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr 65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly 85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg 100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr 115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile 130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser His Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Ile Met Ala Thr Glu Gly Tyr Gln Ser 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp 180 185 <210> 4 <211> 185 <212> PRT <213> Bacillus circulans <400> 4 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val 1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn 20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe 35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Ala 50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr 65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly 85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg 100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr 115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile 130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser Val Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Val Met Ala Thr Glu Gly Tyr Gln Ser 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp 180 185 <210> 5 <211> 185 <212> PRT <213> Bacillus circulans <400> 5 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val 1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn 20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe 35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Ala 50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr 65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly 85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg 100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr 115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile 130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser His Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Ile Met Ala Thr Glu Gly Tyr Gln Ser 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp 180 185 <210> 6 <211> 185 <212> PRT <213> Bacillus circulans <400> 6 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val 1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn 20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe 35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Gly 50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr 65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly 85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg 100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr 115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile 130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser Val Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Ile Met Ala Thr Glu Gly Tyr Gln Ser 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp 180 185 <210> 7 <211> 185 <212> PRT <213> Bacillus circulans <400> 7 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val 1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn 20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe 35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Ala 50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr 65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly 85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg 100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr 115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile 130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser Val Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Ile Met Ala Thr Glu Gly Tyr Gln Ser 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp 180 185 <210> 8 <211> 555 <212> DNA <213> Bacillus circulans <400> 8 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg cttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatcccacgg tatgaaccta 480 ggttctaatt gggcttatca agtaatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 9 <211> 555 <212> DNA <213> Bacillus circulans <400> 9 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg gttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatccgtcgg tatgaaccta 480 ggttctaatt gggcttatca agtaatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 10 <211> 555 <212> DNA <213> Bacillus circulans <400> 10 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg gttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatcccacgg tatgaaccta 480 ggttctaatt gggcttatca aataatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 11 <211> 555 <212> DNA <213> Bacillus circulans <400> 11 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg cttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatccgtcgg tatgaaccta 480 ggttctaatt gggcttatca agtaatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 12 <211> 555 <212> DNA <213> Bacillus circulans <400> 12 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg cttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatcccacgg tatgaaccta 480 ggttctaatt gggcttatca aataatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 13 <211> 555 <212> DNA <213> Bacillus circulans <400> 13 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg gttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatccgtcgg tatgaaccta 480 ggttctaatt gggcttatca aataatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 14 <211> 555 <212> DNA <213> Bacillus circulans <400> 14 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg cttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatccgtcgg tatgaaccta 480 ggttctaatt gggcttatca aataatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <110> SNU R & DB FOUNDATION <120> Variation Enzyme of Thermostable Bacillus circulans Xylanase and          Gene <130> M11-8370-FD <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 185 <212> PRT <213> Bacillus circulans <400> 1 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val   1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn              20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe          35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Ala      50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr  65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly                  85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg             100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr         115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile     130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser His Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Val Met Ala Thr Glu Gly Tyr Gln Ser                 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp             180 185 <210> 2 <211> 185 <212> PRT <213> Bacillus circulans <400> 2 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val   1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn              20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe          35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Gly      50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr  65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly                  85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg             100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr         115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile     130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser Val Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Val Met Ala Thr Glu Gly Tyr Gln Ser                 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp             180 185 <210> 3 <211> 185 <212> PRT <213> Bacillus circulans <400> 3 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val   1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn              20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe          35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Gly      50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr  65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly                  85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg             100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr         115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile     130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser His Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Ile Met Ala Thr Glu Gly Tyr Gln Ser                 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp             180 185 <210> 4 <211> 185 <212> PRT <213> Bacillus circulans <400> 4 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val   1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn              20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe          35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Ala      50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr  65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly                  85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg             100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr         115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile     130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser Val Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Val Met Ala Thr Glu Gly Tyr Gln Ser                 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp             180 185 <210> 5 <211> 185 <212> PRT <213> Bacillus circulans <400> 5 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val   1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn              20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe          35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Ala      50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr  65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly                  85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg             100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr         115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile     130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser His Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Ile Met Ala Thr Glu Gly Tyr Gln Ser                 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp             180 185 <210> 6 <211> 185 <212> PRT <213> Bacillus circulans <400> 6 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val   1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn              20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe          35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Gly      50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr  65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly                  85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg             100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr         115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile     130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser Val Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Ile Met Ala Thr Glu Gly Tyr Gln Ser                 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp             180 185 <210> 7 <211> 185 <212> PRT <213> Bacillus circulans <400> 7 Ala Ser Thr Asp Tyr Trp Gln Asn Trp Thr Asp Gly Gly Gly Ile Val   1 5 10 15 Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr Ser Val Asn Trp Ser Asn              20 25 30 Thr Gly Asn Phe Val Val Gly Lys Gly Trp Thr Thr Gly Ser Pro Phe          35 40 45 Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp Ala Pro Asn Gly Asn Ala      50 55 60 Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ser Pro Leu Ile Glu Tyr Tyr  65 70 75 80 Val Val Asp Ser Trp Gly Thr Tyr Arg Pro Thr Gly Thr Tyr Lys Gly                  85 90 95 Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp Ile Tyr Thr Thr Thr Arg             100 105 110 Tyr Asn Ala Pro Ser Ile Asp Gly Asp Arg Thr Thr Phe Thr Gln Tyr         115 120 125 Trp Ser Val Arg Gln Ser Lys Arg Pro Thr Gly Ser Asn Ala Thr Ile     130 135 140 Thr Phe Thr Asn His Val Asn Ala Trp Lys Ser Val Gly Met Asn Leu 145 150 155 160 Gly Ser Asn Trp Ala Tyr Gln Ile Met Ala Thr Glu Gly Tyr Gln Ser                 165 170 175 Ser Gly Ser Ser Asn Val Thr Val Trp             180 185 <210> 8 <211> 555 <212> DNA <213> Bacillus circulans <400> 8 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg cttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatcccacgg tatgaaccta 480 ggttctaatt gggcttatca agtaatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 9 <211> 555 <212> DNA <213> Bacillus circulans <400> 9 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg gttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatccgtcgg tatgaaccta 480 ggttctaatt gggcttatca agtaatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 10 <211> 555 <212> DNA <213> Bacillus circulans <400> 10 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg gttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatcccacgg tatgaaccta 480 ggttctaatt gggcttatca aataatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 11 <211> 555 <212> DNA <213> Bacillus circulans <400> 11 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg cttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatccgtcgg tatgaaccta 480 ggttctaatt gggcttatca agtaatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 12 <211> 555 <212> DNA <213> Bacillus circulans <400> 12 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg cttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatcccacgg tatgaaccta 480 ggttctaatt gggcttatca aataatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 13 <211> 555 <212> DNA <213> Bacillus circulans <400> 13 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg gttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatccgtcgg tatgaaccta 480 ggttctaatt gggcttatca aataatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555 <210> 14 <211> 555 <212> DNA <213> Bacillus circulans <400> 14 gctagcacag attactggca aaactggaca gacggtggcg gtatcgttaa tgccgtgaac 60 ggctccggag gcaactacag cgtgaattgg tctaatactg ggaacttcgt agtcggaaaa 120 ggttggacga caggatcccc gttccgtacg atcaactaca acgctggcgt ttgggccccg 180 aatggtaacg cttacctgac actgtatggc tggacgcgtt cgccactgat tgaatattac 240 gttgtcgact cttggggaac gtaccgtccg actggaacct acaaaggcac agtcaaaagc 300 gatggtggta cctatgacat ctacaccacc acaagataca acgcaccttc catcgatggc 360 gatcggacca cctttactca gtattggagt gttagacaat ctaagcggcc gactggttcg 420 aacgccacca ttacgttcac caatcacgtg aatgcatgga aatccgtcgg tatgaaccta 480 ggttctaatt gggcttatca aataatggcg accgaaggct accagagctc tggttcttcc 540 aacgttacag tgtgg 555

Claims (2)

서열목록 1 내지 7 중 어느 한 서열목록의 아미노산 서열을 포함하는 바실러스 서큘런스 자일라네이즈 변이효소.A Bacillus circular xylanase mutase comprising the amino acid sequence of any of SEQ ID NOS: 1-7. 서열목록 8 내지 16 중 어느 한 서열목록의 유전자 서열을 포함하는 바실러스 서큘런스 자일라네이즈 변이효소의 유전자.
A gene of Bacillus circular xylase mutase comprising the gene sequence of any one of SEQ ID NOs: 8-16.
KR1020110089295A 2011-09-02 2011-09-02 Variation Enzyme of Thermostable Bacillus circulans Xylanase and Gene thereof KR101457957B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110089295A KR101457957B1 (en) 2011-09-02 2011-09-02 Variation Enzyme of Thermostable Bacillus circulans Xylanase and Gene thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110089295A KR101457957B1 (en) 2011-09-02 2011-09-02 Variation Enzyme of Thermostable Bacillus circulans Xylanase and Gene thereof

Publications (2)

Publication Number Publication Date
KR20130025770A true KR20130025770A (en) 2013-03-12
KR101457957B1 KR101457957B1 (en) 2014-11-05

Family

ID=48177335

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110089295A KR101457957B1 (en) 2011-09-02 2011-09-02 Variation Enzyme of Thermostable Bacillus circulans Xylanase and Gene thereof

Country Status (1)

Country Link
KR (1) KR101457957B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022131798A1 (en) * 2020-12-15 2022-06-23 씨제이제일제당 (주) Variant polypeptide with xylanase activity
WO2022131799A1 (en) * 2020-12-15 2022-06-23 씨제이제일제당 (주) Variant polypeptide having xylanase activity

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6682923B1 (en) 1999-05-12 2004-01-27 Xencor Thermostable alkaliphilic xylanase

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022131798A1 (en) * 2020-12-15 2022-06-23 씨제이제일제당 (주) Variant polypeptide with xylanase activity
WO2022131799A1 (en) * 2020-12-15 2022-06-23 씨제이제일제당 (주) Variant polypeptide having xylanase activity

Also Published As

Publication number Publication date
KR101457957B1 (en) 2014-11-05

Similar Documents

Publication Publication Date Title
Chohan et al. TK1656, a thermostable L-asparaginase from Thermococcus kodakaraensis, exhibiting highest ever reported enzyme activity
CN108588052B (en) Mutant of PET degrading enzyme and application thereof
CN110499303A (en) Polypeptide, its polynucleotides of separation, and the additive comprising polypeptide, its purposes and method
US10655118B2 (en) Heat-resistant agarase and monosaccharide production method using same
EP3613851A1 (en) Recombinant dna polymerase
Liu et al. Improvement in thermostability of an alkaline lipase I from Penicillium cyclopium by directed evolution
Feng et al. Enhancing the thermostability of β-glucuronidase by rationally redesigning the catalytic domain based on sequence alignment strategy
JP6691558B2 (en) Novel P450-BM3 variants with improved activity
CN113462678B (en) Glutamic acid decarboxylase mutant
CN114450403A (en) Biosynthesis of enzymes for use in the treatment of Maple Syrup Urine Disease (MSUD)
KR101457957B1 (en) Variation Enzyme of Thermostable Bacillus circulans Xylanase and Gene thereof
Park et al. Cloning and protein expression of the sn-1 (3) regioselective lipase from Cordyceps militaris
Moore et al. Expression and purification of aspartate β-semialdehyde dehydrogenase from infectious microorganisms
CN111057686B (en) Alcohol dehydrogenase mutant and application thereof
KR20140047326A (en) Recombinant microorganisms, recombinant formate dehydrogenase expressed by the same, and formate synthesis using the same
KR101708974B1 (en) Novel sucrose isomerase and process for preparing the same
CN108277212B (en) Lipase mutant Gly183Cys/Gly212Cys and gene and application thereof
US9334544B2 (en) Cellulase compositions having improved thermostability and synergy
KR102254411B1 (en) Variant of D-allulose 3-epimerase, manufacturing method thereof and manufacturing method of D-alluose using the same
KR20190095429A (en) Glutathione reductase
KR101740099B1 (en) Biofuel cell comprising laccase
US20140308713A1 (en) Endoglucanase having enhanced thermostability and activity
CN107151660B (en) lipase variant Ala36Ser/Asp49His/Ala52Val/Asn55Asp
KR101430967B1 (en) Active Cellulolytic Enzyme and Gene thereof
CN109182299B (en) Hydrogen peroxide-tolerant bacillus subtilis lipase mutant and preparation method thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
FPAY Annual fee payment

Payment date: 20170925

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20181002

Year of fee payment: 5