KR20130017818A - Method for screening enhancer of an antimicrobial agent using ndm-1 gene and x gene - Google Patents

Abstract

PURPOSE: A method for screening an antibacterial susceptibility enhancer using NDM-1 gene and X gene is provided to recover an antibacterial ability. CONSTITUTION: A method for screening an antibacterial susceptibility enhancer comprises: a step of contacting a sample with cells containing NDM-1 protein of sequence number 1 and X protein of sequence number 3; a step of measuring protein quantity or activation; and a step of determining whether the sample enhances an antibacterial activity or not.

Description

Method for screening enhancer of an antimicrobial agent using NDM-1 gene and X gene}

The present invention relates to a method for screening antimicrobial susceptibility enhancers using the NDM-1 gene and the X gene.

An increase in the number of patients with severe disease, such as cancer, increases the number of immune function negative electrons, resulting in 5-10% of hospitalized patients and about 4 million medical infections each year. It is growing rapidly (Datamonitor, 2007).

Up to the 1960s and early 1970s, significant progress was made in the development of antimicrobials, which treated many infections. However, more than 40 years later, infectious diseases are the second most common cause of death worldwide (WHO Report-2002) and the third cause of death in the United States (Pinner RW. JAMA. 1996: 275: 189-93). have. In addition, the recent emergence and increase of bacteria resistant to various antimicrobial agents has significantly reduced the choice of drugs. The emergence of resistant bacteria is facilitated by the use of antimicrobial agents, which once emerged spread to the use of antimicrobial agents or to an unsanitary environment. According to KONSAR data of Korea, Klebsiella , a major medical infection Ceftazidime resistance of pneumoniae was 25-35% and fluoroquiolone resistance was less than 10% in 2002 but increased to more than 30% in 2004. This is mainly due to the increase in the production of a broad spectrum of antimicrobial enzymes such as extended-spectrum beta-lactamase.

This increased antimicrobial resistance in Gram-negative bacteria has resulted in the emergence of pandrug-resistant gram-negative bacilli that are resistant to both antibiotics. Furthermore, they are more serious because they are increasing in both Enterobacteriaceae and glucose-nonfermenting bacilli.

In recent years, NDM-1, a New Delhi metallo-β-lactatmase enzyme, has emerged as a new cause of carvepenem resistance. The inventors have found that carbapenem-resistant Klebsiella pneumoniae and Escherichia Cloning the NDM-1 gene from coli , it was confirmed that the MIC values of imipenem and meropenem of the transformant having the NDM-1 gene were very high.

Accordingly, the present inventors have tried to find a candidate substance that revives the antimicrobial activity of an existing antimicrobial agent in order to ultimately solve the antimicrobial resistance bacteria problem. After confirming the existence of the present invention was completed.

It is an object of the present invention to provide a method for screening antimicrobial susceptibility enhancers using NDM-1 and X proteins.

In order to achieve the above object,

(a) contacting a sample to be analyzed with a cell comprising the NDM-1 protein represented by SEQ ID NO: 1 and the X protein represented by SEQ ID NO: 3;

(b) measuring the amount or activity of the protein; And

(c) providing an antimicrobial susceptibility enhancer screening method comprising determining that the sample is a substance that increases antimicrobial activity when the amount or activity of the protein is determined to be down regulated.

In another embodiment,

(a) contacting a sample to be analyzed with a cell comprising a gene encoding the NDM-1 protein represented by SEQ ID NO: 1 and a gene encoding the X protein represented by SEQ ID NO: 3;

(b) measuring the expression level of the gene; And

(c) providing a method for screening an antimicrobial susceptibility enhancer comprising determining that the sample is a substance that increases antimicrobial activity when the expression level of the gene is measured to be down regulated. The gene encoding one protein may be represented by SEQ ID NO: 2, and the gene encoding the X protein may be represented by SEQ ID NO: 4.

In another embodiment,

(a) contacting the sample to be analyzed with a cell comprising the X protein represented by SEQ ID NO: 3;

(b) measuring the amount or activity of the protein; And

(c) providing an antimicrobial susceptibility enhancer screening method comprising determining that the sample is a substance that increases antimicrobial activity when the amount or activity of the protein is determined to be down regulated.

In another embodiment,

(a) contacting a sample to be analyzed with a cell comprising a gene encoding the X protein represented by SEQ ID NO: 3;

(b) measuring the expression level of the gene; And

(c) providing an antimicrobial susceptibility enhancer screening method comprising determining that the sample is a substance that increases antimicrobial activity when the expression level of the gene is measured to be down regulated. The gene encoding the protein may be characterized by SEQ ID NO: 4.

In the present invention, the antimicrobial agent may be characterized in that the penicillin-based, cephalosporin-based or carbapenem-based antimicrobial agent, wherein the antimicrobial agent is empicillin, Sepharosin, ceftriaxone, Cytotaxin, ceftazidime, three It may be characterized in that it is selected from the group consisting of pepim, imipenem, meropenem and ertapenem.

In another embodiment, the present invention provides a transformation comprising an X protein represented by SEQ ID NO: 3, a nucleic acid encoding the protein, a recombinant vector comprising the nucleic acid, and a gene encoding the X protein represented by SEQ ID NO: 3. A transformant comprising a sieve, a gene encoding the NDM-1 protein represented by SEQ ID NO: 1, and a gene encoding the X protein represented by SEQ ID NO: 3 is provided.

In another embodiment, the present invention provides a primer set for PCR capable of hybridizing with the gene represented by SEQ ID NO: 4, wherein the primer set may be characterized by SEQ ID NO: 5 and SEQ ID NO: 6.

As used to refer to the screening methods of the present invention, the term "sample" refers to an unknown candidate used in screening to test whether it affects the expression level of a gene or affects the amount or activity of a protein. . The sample includes, but is not limited to, chemicals, nucleotides, antisense-RNAs and natural extracts.

Measurement of the change in the expression level of the gene can be carried out through various methods known in the art. For example, RT-PCR (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Northern blotting (Peter B. Kaufma et al., Molecular and Cellular Methods in Biology and Medicine , 102-108, CRCpress), hybridization reactions using cDNA microarrays (Sambrook et al., Molecular Cloning.A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)) or in situ hybridization reactions (Sambrook et al., Molecular Cloning.A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)).

When performed according to the RT-PCR protocol, first, total RNA is isolated from cells treated with a sample, and then single-stranded cDNA is prepared using oligo dT primers and reverse transcriptase. Then, single-stranded cDNA is used as a template, and PCR reaction is performed using a gene-specific primer set. Gene-specific primer sets are listed in Table 2 below. Then, the PCR amplification product is electrophoresed, and the formed band is analyzed to measure the change in the expression level of the gene.

Changes in the amount of protein can be carried out through various immunoassay methods known in the art. Examples include, but are not limited to, radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hardwood assays, and sandwich assays. The immunoassay or method of immunostaining is described in Enzyme Immunoassay, ET Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, JM ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999. For example, when the method of the present invention is carried out in accordance with radioimmunoassay methods, protein-specific antibodies labeled with radioisotopes (eg, C ¹⁴ , I ¹²⁵ , P ³² and S ³⁵ ) can be used. When the method of the present invention is carried out by an ELISA method, a specific embodiment of the present invention comprises the steps of (i) coating the surface of a solid substrate with an extract from a sample-treated cell (ii) contacting the protein- (Iii) reacting the result of step (ii) with an enzyme-conjugated secondary antibody, and (iv) measuring the activity of the enzyme. Suitable as the solid substrate are hydrocarbon polymers (eg polystyrene and polypropylene), glass, metal or gel, most preferably microtiter plates. Enzymes bound to the secondary antibody include, but are not limited to, enzymes catalyzing color reaction, fluorescence, luminescence or infrared reaction, for example, alkaline phosphatase, β-galactosidase, hose Radish peroxidase, luciferase and cytochrome P450. When alkaline phosphatase is used as the enzyme binding to the secondary antibody, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-ASB1-phosphate (naphthol-AS-B1) as a substrate chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N) when colorimetric substrates such as -phosphate) and enhanced chemifluorescence (ECF) are used, and horse radish peroxidase is used. -Methylacridinium nitrate), resorupin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), TMB (3,3,5,5-tetramethylbenzidine), ABTS Substrates such as (2,2'-Azine-di [3-ethylbenzthiazoline sulfonate]) and o-phenylenediamine (OPD) can be used. Measurement of the final enzyme activity or signal in the ELISA method can be carried out according to various methods known in the art. If biotin is used as a label, it can be easily detected by streptavidin. When luciferase is used, luciferin can easily detect a signal.

The "antibacterial agent" of the present invention inhibits the propagation of bacteria and / or fungi, and includes an inorganic antibacterial agent, an organic natural product extraction antimicrobial agent, an organic aliphatic compound antimicrobial agent, and an organic aromatic compound antimicrobial agent. In addition, the inorganic antibacterial agent includes, but is not limited to, a chlorine compound represented by sodium hypochlorite, a peroxide represented by hydrogen peroxide, a borated compound represented by sodium borate, a copper compound represented by copper sulfate, and a zinc compound represented by zinc chloride. Calcium compounds represented by sulfur-based calcium oxide, thiosulphite silver complex salt, silver compounds represented by silver nitrate, sulfur compounds such as sulfur, polysulfuric acid lime, and hydrated sulfur, and oxo and sodium silicofluoride, Examples of the organic-based natural product extracting antibacterial agents include hinokithiol, bamboo shoots, creosote oil, and the like.

In the present invention, the antimicrobial agent may be penicillin-based (Penicillin), cephalosporin-based (cephalosporin), carbapenem-based (carbapenem) and the like.

Using a method for screening antimicrobial susceptibility enhancers using NDM-1 protein and X protein according to the present invention, it is possible to provide a material that can restore the antimicrobial activity of the existing antimicrobial agents.

1 The flanking region of bla _{NDM- 1} introduced into pK18 is shown (PAI: phosphoribosyl anthranilate isomerase, ldh: lactate dehydrogenase, D: nodal gene).
Figure 2 shows the structure of the vector using the PSFDuet-1 vector, bla _{NDM- 1} , X gene.
Figure 3 shows the imipenem hydrolysis curve.

Hereinafter, the present invention will be described in detail by the following examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Etest Bacterial strain and antimicrobial sensitivity test

We cloned the NDM-1 gene and adjacent DNa and expressed it in E. coli TOP10 cells, the strains for all cephalosporins except cefepime and aztreonam. Had resistance. The original vector plasmid pK18- bla _{NDM- 1} was extracted and transformed into other E. coli TOP10s to eliminate all obstacles of the host cell, such as production of additional AmpC-b-lactamase or modification of outer membrane proteins. Etest strips (AB bioMerieux, Solna, Sweden) were used to measure the antimicrobial sensitivity of the experimental strains.

Structure of the vector

The ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to find the expected OFR. ORF containing NDM-1 was amplified by PCR using the primers shown in Table 1 below. First, the plasmid vector pK18 was used to locate the putative genes that increase the carbepenem MIC value of the transformants. Upon finding the putative ORF, the amplified structure was digested and then bound to the pRSFDuet-1 vector (Novagen Gibbstown, NJ, USA) with two sets of multiple cloning sites. The primers of Table 1 were used to confirm the DNA sequence of the construct and transformed into E. coli TOP10 to confirm the phenotypic characteristics of each plasmid vector.

primer target The sequence (5'-3 ') - 99, 5'putative efflux duet Nde1 5 'of the X gene GGAATTCCATATGATGCGGTGCCGGTATCCTTAC (SEQ ID NO: 5) Duet vector 100, 3'putative efflux duet Xho1 3 'of the X gene CCGCTCGAGTTATTTCCGATAATGATCGCC (SEQ ID NO: 6) Duet vector 101, 5 '96NDM DUET EcoR1 bla _{NDM -1} of 5 ' CCGGAATTCGGCCCCATATTTTTGCTACAGT Duet vector 102, 3 '96NDM DUET HindIII bla _{NDM -1} of 3 ' CGCAAGCTTTCAGCGCAGCTTGTCGGC Duet vector 110, 5 'Kpn1 NDM- LDH 20100217 bla _{NDM -1} of 5 ' GGGGTACCCGCCCCATATTTTTGCTACAGT Pk18 vector 109, 3 'NDM1 BamH1 20100217 bla _{NDM -1} of 3 ' CCGGGATCCTCAGCGCAGCTTGTCGGC Pk18 vector 111, 3 'Xba1 NDM- LDH 20100217 △ 3 'of ldh GCTCTAGATCAGGCGGGTAAGGATACCGG Pk18 vector 113, 3 'efflux Xba1 PAI- efflux 20100217 △ 5 'of Efflux pump GCTCTAGAAAATCGCCGACTTCACCCTGG Pk18 vector 112, 5 'PAI EcoR1 PAI- efflux 20100217 △ 5 'of PAI CCGGAATTCGATGCCCGCGAAAATCAAGATT Pk18 vector 18, Efflux (NDM) EcoR1 (end-start) △ 3 'of Efflux pump CCGGAATTCTTACCTCTGAAGGTGCAACTC Pk18 vector 19, Efflux (NDM) Xba1 (start-end) △ 5 'of Efflux pump GCTCTAGAGGAAATCGCCGACTTCACCCTGG Pk18 vector 16S rRNA F 16S rRNA gene AGCTAGAGTATGGGAGAGGATGG RT-qPCR Sense 16S rRNA R 16S rRNA gene TTCGTACCTCAGCGTCAGTATTAG RT-qPCR Antisense 16S rRNA 16S rRNA gene TGCCTTCGCCATCGGTATTCCTCCAGA RT-qPCR Probe NDM F bla _{NDM -1} of 5 ' TTGATCGTCAGGGATGGC RT-qPCR Sense NDM R bla _{NDM -1} of 3 ' AGGTTGATCTCCTGCTTGA RT-qPCR Antisense NDM bla _{NDM -One} TAC [+ C] GC [+ C] TG [+ G] AC [+ C] GAT RT-qPCR Probe

RT - qPCR  Test

Total RNA was obtained from the transformants using the RNeasy Protect Bacteri Mini Kint and RNase-free DNase set (Qiagen, Hildne, Germany) according to the manufacturer's instructions. RT-qPCR was performed with Omniscript RT kint (Qiagen) using random primers (Promega, Madison, WI, USA) and RNase inhibitors (GenDEPOT, Barker, TX). Primers and probes used in real-time PCR experiments using LightCycler (Roche Diagnositcs, Indianapolis, IN, USA) are shown in Table 1. The 5 'and 3' ends of all probes were labeled with 6-carboxyfluorescein (FAM) and fluorescence quencher dye (BHQ1), respectively. 4 μL of premix (LightCycler Taqman Master kit, Roche Diagnostics), 1 μL of primer (final concentration, 0.5 μmol / L), 0.1 μL of probe (final concentration, 0.1 μmol / L), 9.9 μL of water and 5 μL of 10-fold diluted cDNA Amplification was carried out in a total volume of 20 μL containing. The reaction took place for 10 minutes at 95 ° C., 40 times for 15 seconds at 95 ° C., and 60 seconds at 60 ° C. The expression level of NDM-1 gene was averaged over 16S rRNA, and expression of bla _{NDM- 1} gene at # 14 was used as basal level.

Hydrolysis

The experimental strain was sonicated and dissolved and centrifuged at 4 ° C. and 12000 rpm for 10 minutes to obtain a supernatant. The activity of imipenemase was measured using a UV-1601PC spectrophotometer (Shimadzu Corp., Tokyo, Japan) with 100 μM of imipenem.

Computer Analysis of the X Gene

Nucleotide and deduced amino acid sequences were compared with the sequences available on the internet ( http://www.ebi.ac.uk/fasta33/ ).

Discovery of the X Gene

pK18 vector with bla _{NDM- 1} gene has a high MIC value (12μg / ml) for imipenem and meropenem. We have found that overproduction of AmpC β-lactamase or loss of outer membrane proteins can increase MIC values, so that pK18 vectors with bla _{NDM- 1} gene at the new TOP10 are excluded in order to rule out cellular effects on these carbepenems MIC. Was transformed. However, the MIC value did not change to 12 μg / ml. This led to the conviction that any gene in the transgenic plasmid was responsible for the increase in carbepenem MIC values.

To find out which genes affect carvepenem MIC values, PCR amplified ORFs of gene fragments inserted into pK18 were used. The list of gene fragments is as follows: bla _{NDM -1} alone / bla _{NDM -1} plus ΔPAI , Δ bla _{DHA -1} , △ ldh / bla _{NDM -1} plus ΔPAI , Δ bla _DHA-1 , △ ldh , gene X plus △ Efflux pump / △ PAI, △ ldh , gene X plus △ Efflux pump / △ Efflux pump. Vectors of various structures were transformed into E. coli TOP10 competent cells, and the MIC values of imipenem and meropenem were measured (FIG. 1, Table 2).

The imipenem and meropenem MIC values of E. coli TOP10 (pK18- bla _{NDM- 1} ) were 31.6 and 65.2 times higher than those of E. coli TOP10 (pK18), respectively, and E. coli TOP10 (pk18- bla _{NDM- 1} , ΔPAI). , Δ bla _{DHA -1} , △ ldh ) also increased by 31.6 and 87 fold, similar to E. coli TOP10 (pK18- bla _{NDM -1} ). In addition, MIC values of E. coli TOP10 (pk18- bla _{NDM- 1} , ΔPAI, Δ bla _{DHA- 1} , Δ ldh , gene X, ΔEfflux pump) increased significantly to 168.4 and 1391.3 times, respectively. However, the MIC values of E. coli TOP10 (pK18-DPAI, Δ bla _{DHA- 1} , Δ ldh , gene X, ΔEfflux pump) and E. coli TOP10 (pK18-ΔEfflux pump) were again low. From this, △ ldh Specific genes located downstream were found to increase the MIC values of imipenem and meropenem in collaboration with the bla _{NDM- 1} gene.

In addition, the inhibition of the antimicrobial susceptibility was measured by the disk diffusion method. As a result, the inhibitory band was reduced only in the beta-lactam series except for aztreonam (monobactam), and minocycline, aminoglycoside (amikacin, Tobramycin (gentamicin), fluoroquinoneron (levofloxacin), trimethoprim-sulfamethoxazole (trimethoprim-sulfamethoxazole) was confirmed to have no effect (Table 3).

Competent Cells (Vector-Derived Genes) MIC (mg / ml) Fold increase ^a Imipenem Meropenem Imipenem Meropenem E. coli TOP10 0.094 0.023 0.5 0.1 E. coli TOP10 (pk18) 0.19 0.023 1.0 1.0 E. coli TOP10 (pk18- bla _{NDM -1} ) 6 1.5 31.6 65.2 E. coli TOP10 (pk18- bla _{NDM -1} , DPAI, D bla _DHA-1 , D ldh ) 6 2 31.6 87.0 E. coli TOP10 (pk18- bla _{NDM -1} , DPAI, D bla _DHA-1 , D ldh , gene X, DEfflux pump) 32 32 168.4 1391.3 E. coli TOP10 (pk18- DPAI, D bla _DHA-1 , D ldh , gene X, DEfflux pump) 0.125 0.016 0.7 0.7 E. coli TOP10 (pk18-DEfflux pump) 0.19 0.023 1.0 1.0

Antimicrobial agent
Inhibitor band diameter in disk diffusion test, mm E. coli TOP10 E. coli TOP10 (pk18) E. coli TOP10 (pk18- bla _{NDM -1} ) E. coli TOP10 (pk18- △ PAI, △ b la _{D HA-1} , △ ldh , gene X, △ Efflux pump) Ampicillin 23 24 6 6 Cephalothin 23 24 6 6 Ampicillin-sulbactam 23 24 6 6 Imipenem 35 34 23 11 Piperacillin 35 35 16 9 Meropenem 38 38 21 11 Cefepime 39 40 20 10 Cefotaxime 43 37 9 6 Ceftazidime 37 36 6 6 Aztreonam 39 41 37 39 Cefoxitin 28 27 6 6 Minocycline 21 28 25 28 Gentamicin 30 29 32 30 Amikacin 31 26 26 26 Piperacillin-tazobactam 33 36 16 10 Levofloxacin 41 36 45 46 Trimethoprim-sulfamethoxazole 35 36 35 35 Tobramycin 33 29 31 30 Amoxicillin-clavulanate 29 26 6 6

X gene Kabepenem MIC  Identify the effect on value

The ORF of the estimated X gene of nucleotide 585 size was found downstream of Δ ldh using the ORF finder (http://www.ncbi.nlm.nih.gov/gorf/). To identify the role of the X gene on carbepenem MIC values, pRSFDuet-1 vector and E. coli TOP10 cells with two multicloning sites were used (FIG. 2).

As a result, MIC values of transformants transformed with the PSFDuet-1 vector containing only X gene were ampicillin 3 mg / ml, cephalothin 4 mg / ml, ceftriaxone 2 mg / ml, cefotaxime 0.047 mg / ml, ceftazidime 0.25 mg / ml, aztreonam 0.047 mg / ml, cefepime 0.032 mg / ml, oploxacin ( ofloxacin) was found to be 0.094 mg / ml. However, transformants transformed with PSFDuet-1 vector with blaNDM-1 gene significantly increased the following MIC values:> 256 mg / ml (ampicillin),> 256 mg / ml (cepharosine), > 256 mg / ml (ceftriaxone), 12 mg / ml (cephataxime),> 256 mg / ml (ceptazidime). On the other hand, the values of Aztreonam (0.023 mg / ml), Levofloxacin (0.032 mg / ml), Ofloxacin (0.125 mg / ml) did not change significantly, Cefepime (0.38 mg / ml), Imipenem (0.25 mg / ml), meropenem (0.064 mg / ml) and ertafenem (0.064 mg / ml) slightly increased. In addition, transformants transformed with PSFDuet-1 vector with X gene and blaNDM-1 gene increased MIC values even more: 64 mg / ml (Cetaxim), 2 mg / ml (sefepime), 0.75 mg / ml (imipenem), 0.38 mg / ml (meropenem), and 0.5 mg / ml (ertafenem) (Table 4).

Antimicrobial agent MIC (mg / ml) Fold increase E. coli TOP10 E. coli TOP10
(PSFDuet-1) # 10 E. coli TOP10 (PSFDuet-1-gene X) # 14 E. coli TOP10 (PSFDuet-1- bla _{NDM -1} ) # 10-8 E. coli TOP10 (PSFDuet-1- bla _NDM-1, gene X) # 10 E. coli TOP10 (PSFDuet-1-gene X) # 14 E. coli TOP10 (PSFDuet-1- bla _{NDM -1} ) # 10-8 E. coli TOP10 (PSFDuet-1- bla _NDM-1, gene X) AMP 3 3 3 > 256 > 256 1.0 > 85.3 > 85.3 KEP 4 4 4 > 256 > 256 1.0 > 64.0 > 64.0 CRO 0.094 0.023 0.023 > 125 > 256 1.0 > 5,434.8 > 11,130.4 CTX 0.047 0.047 0.047 12 64 1.0 255.3 1,361.7 CAZ 0.38 0.25 0.25 > 256 > 256 1.0 > 1024.0 > 1024.0 AZT 0.094 0.047 0.047 0.023 0.064 1.0 0.5 1.4 FEP 0.032 0.032 0.032 0.38 2 1.0 11.9 62.5 IPM 0.019 0.019 0.125 0.25 0.75 1.0 2.0 6.0 MEM 0.012 0.012 0.012 0.064 0.38 1.0 5.3 31.7 ERT 0.006 0.012 0.012 0.064 0.5 1.0 5.3 41.7 LEV 0.003 0.006 0.032 0.032 0.006 1.0 1.0 0.2 OFX 0.012 0.016 0.094 0.125 0.023 1.0 1.3 0.2

X gene and blaNDM -1 gene expression

RT-qPCR and carbapenem hydrolysis tests were performed to confirm whether the X gene increases the expression level of the bla _{NDM- 1} gene or the product of the X gene functions with the NDMA-1 enzyme (FIG. 3). ). bla _{NDM -1} and bla _NDM in the transformant was transformed with PSFDuet-1 vector with the X _{gene-expression} level of _1, it was confirmed that it has increased by about 300 times than the transformant having only the bla gene _{NDM -1} ( Table 5).

Strain Expression level of bla _{NDM- 1} gene using RT-qPCR Imiphenem hydrolytic activity
-Imiphenem self-decomposition
Yes / No (mU / mg protein) Fold SD # 10 E. coli TOP10 (PSFDuet-1-gene X) Not observed Not observed 40.9 / 0 # 14 E. coli TOP10 (PSFDuet-1- bla _{NDM -1} ) One 0.222 306.6 / 265.7 # 10-8 E. coli TOP10 (PSFDuet-1- bla _{NDM -1,} gene X) 308.2 0.726 2055.7 / 2014.8

Imipenemase activity showed a 306.6 mU / mg protein that was 7.5-fold increased in the PSFDuet-1- bla _{NDM- 1} transformant than E. coli TOP10 (PSFDuet-1-gene X). In addition, bla _{NDM- 1,} and The transformant carrying the X gene showed 2055.7 mU / mg protein, which was about 6.7 times higher than E. coli TOP10 (PSFDuet-1- bla _{NDM- 1} ) (Table 5).

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Method for screening enhancers of an antimicrobial agent using          NDM-1 gene and X gene <130> IPDB44397 <160> 6 <170> Kopatentin 1.71 <210> 1 <211> 270 <212> PRT <213> Klebsiella pneumoniae <400> 1 Met Glu Leu Pro Asn Ile Met His Pro Val Ala Lys Leu Ser Thr Ala   1 5 10 15 Leu Ala Ala Ala Leu Met Leu Ser Gly Cys Met Pro Gly Glu Ile Arg              20 25 30 Pro Thr Ile Gly Gln Gln Met Glu Thr Gly Asp Gln Arg Phe Gly Asp          35 40 45 Leu Val Phe Arg Gln Leu Ala Pro Asn Val Trp Gln His Thr Ser Tyr      50 55 60 Leu Asp Met Pro Gly Phe Gly Ala Val Ala Ser Asn Gly Leu Ile Val  65 70 75 80 Arg Asp Gly Gly Arg Val Leu Val Val Asp Thr Ala Trp Thr Asp Asp                  85 90 95 Gln Thr Ala Gln Ile Leu Asn Trp Ile Lys Gln Glu Ile Asn Leu Pro             100 105 110 Val Ala Leu Ala Val Val Thr His Ala His Gln Asp Lys Met Gly Gly         115 120 125 Met Asp Ala Leu His Ala Ala Gly Ile Ala Thr Tyr Ala Asn Ala Leu     130 135 140 Ser Asn Gln Leu Ala Pro Gln Glu Gly Met Val Ala Ala Gln His Ser 145 150 155 160 Leu Thr Phe Ala Ala Asn Gly Trp Val Glu Pro Ala Thr Ala Pro Asn                 165 170 175 Phe Gly Pro Leu Lys Val Phe Tyr Pro Gly Pro Gly His Thr Ser Asp             180 185 190 Asn Ile Thr Val Gly Ile Asp Gly Thr Asp Ile Ala Phe Gly Gly Cys         195 200 205 Leu Ile Lys Asp Ser Lys Ala Lys Ser Leu Gly Asn Leu Gly Asp Ala     210 215 220 Asp Thr Glu His Tyr Ala Ala Ser Ala Arg Ala Phe Gly Ala Ala Phe 225 230 235 240 Pro Lys Ala Ser Met Ile Val Met Ser His Ser Ala Pro Asp Ser Arg                 245 250 255 Ala Ala Ile Thr His Thr Ala Arg Met Ala Asp Lys Leu Arg             260 265 270 <210> 2 <211> 4318 <212> DNA <213> Klebsiella pneumoniae <400> 2 gaaaatcgcc gacttcaccc tggtgggcag cggcgggcag cgggttccct tgtcacagat 60 tggcgacgtg tcgatcagga tggaggaccc gctgcttcgc cgtcgcgacc gcacgccgac 120 catcaccgtc cgcggagatg ttgcggagaa cctgcagccg ccggatgtct ccaccgcgct 180 gatgaagccg ctgcagccca ttatcgactc gctgccgcct ggctatcgca tcgagacggc 240 ggggtcgatt gaggaatccg gcaaggccac ccgggcgatg gtgccgttat ttccgataat 300 gatcgccctc acgctgctga tcattatcct gcaggtgcgt tcgctgtcgg cgatggtcat 360 ggttttcctg accgcgccgc tggggctgat tggcgtggtc ccgacgctgc tgctgttcaa 420 tcagccgttt ggcatcaatg ccctggtggg cctgatcgcc ctgtcgggga tcctgatgcg 480 caatacgctg atcctgattg gccaaatcca tcataaccaa caggcggggc tcgatccgtt 540 ccacgcggtg gtggaggcga cggtgcagcg cgcccgcccg gttctgctga ccgcgctggc 600 ggcgatcctg gcgttcattc cgctcactca ttcggtcttc tggggaacgc tcgcctatac 660 gctgattggc gggacgctgg ggggaaccat catgaccctt atcttcctgc cggccatgta 720 cgcgatctgg ttccgcatcc gtccggagaa cacggtacaa cagacagagt tgcaccttca 780 gaggtaattc cactttgccg gacctgggcg aggcacatgg ccaggccagg tcccgggcag 840 cgtcaggcgg gtaaggatac cggcaccgca tgaatgcggt gttgatcctg ttcgaggcga 900 tcaaggcaat cgaggctgat ggccgatggc gaggtcgcgc cggtgagggt catggtaacc 960 ttcatatcct cggcaaataa gcgcagcaga tgcgccacgc ccgcttcgcc cgccgcggcc 1020 agggcataaa tataggcccg accgagcagc acgcctttcg cgccgagggc cagcagacgt 1080 ataacgtcca cgccggagcg caccccggaa tcggcaagca ctgtcagatc gtcgccgacc 1140 gcatccacca ccctgggcag cgcccgggcg gtggggatgg cgccatcgag ctgtctgccg 1200 ccatgatttg acaccacaat accatcggcg ccaagccgca cggcattgcg cgcatcgtcg 1260 gcatcgagga tcctggcacc gctggggtta tctcacacct ttattactgt gccggaaagt 1320 gcgcaaagcc agtatgcgta cggttataaa aacaaaaaac cggtccgcgt gtcgccggga 1380 cagcttgatg cggaatctta cggcgtgaaa tccgcctcaa aagatatgct gcgctgggcg 1440 gaaatgaata tggagccgtc acgggccggt aatgcgggcg cgctttcgac gccgctggag 1500 gtatcgacca gcggcgctcc ggtgcgcgca atcgcctcgg caacattcgt cggatttagc 1560 ccgcctgcca gcccccacgg caaggcaccg cgatatccgg ccagcagcga ccagtcgaac 1620 gccaacccca tgccgccggg cagcgcgcct ttgggggtct tggcgtcgaa caagatcaag 1680 tccgccgccc cggcataggc tgcggcgcgt gcgacatcgc tggcgctggc gacgggcagc 1740 gccttccaca ccggcttgcc aaaccgcgcg cgcaactggg ccacgcgttc gggcgattcc 1800 gaaccgtgca gctgcagcgc gttcagcttg gctgccacca gtgcgtcggc gatgacagca 1860 tcatccgcat cgacgaacaa accgaccatg gcgatctggc cagctgcgcg cgatgtcaaa 1920 gcgcccgcga cattcgacgt aaccgcacgg ggcgacgctg gatagaacac caacccggca 1980 tagtccgccc gcgccgcgat ggtcgcatcg agcgcctcgg gtgtgctgat cccgcaaatc 2040 ttgattttcg cgggcatgcg gtcagtcggg gttctggatc agccgcacca gcgtgcagtc 2100 gggatcgatc aggtagccga tcctcaggcc gctcgcctcc agttgcggag ctttgaagcg 2160 cggccagccg gtgctttttt cctcggctcc cgccgcgttc accaatgcca ccatggcatc 2220 gagatcatcc aaccgcaggc aacagccgaa cgagctcgta gctgggtcga ggtcaggata 2280 ggggaagaat tcgagctgca aaccgcgatc cttccaactc gtcgcaaagc ccagcttcgc 2340 ataaaacgcc tctgtcacat cgaaatcgcg cgatggcaga ttgggggtga cgtggtcagc 2400 catggctcag cgcagcttgt cggccatgcg ggccgtatga gtgattgcgg cgcggctatc 2460 gggggcggaa tggctcatca cgatcatgct ggccttgggg aacgccgcac caaacgcgcg 2520 cgctgacgcg gcgtagtgct cagtgtcggc atcaccgaga ttgccgagcg acttggcctt 2580 gctgtccttg atcaggcagc caccaaaagc gatgtcggtg ccgtcgatcc caacggtgat 2640 attgtcactg gtgtggccgg ggccggggta aaataccttg agcgggccaa agttgggcgc 2700 ggttgctggt tcgacccagc cattggcggc gaaagtcagg ctgtgttgcg ccgcaaccat 2760 cccctcttgc ggggcaagct ggttcgacaa cgcattggca taagtcgcaa tccccgccgc 2820 atgcagcgcg tccataccgc ccatcttgtc ctgatgcgcg tgagtcacca ccgccagcgc 2880 gaccggcagg ttgatctcct gcttgatcca gttgaggatc tgggcggtct ggtcatcggt 2940 ccaggcggta tcgaccacca gcacgcggcc gccatccctg acgatcaaac cgttggaagc 3000 gactgccccg aaacccggca tgtcgagata ggaagtgtgc tgccagacat tcggtgcgag 3060 ctggcggaaa accagatcgc caaaccgttg gtcgccagtt tccatttgct ggccaatcgt 3120 cgggcggatt tcaccgggca tgcacccgct cagcatcaat gcagcggcta atgcggtgct 3180 cagcttcgcg accgggtgca taatattggg caattccatc aagttttcct tttattcagc 3240 attaaaaacc ccgcaaatgc gaggcctagt aaatagatga tcttaatttg gttcactgta 3300 gcaaaaatat ggggcgaatt caaacatgag gtgcgacagt ttcaaaagcc atatgataat 3360 caacaagctg agcaaatttc tctaatggtg taagccaatc taacgccttt ctaggacgag 3420 tattcagtga catggcaact tgatttaaat aatgctgatc tgcctgattt aaatggcact 3480 gttgcaaata gtcggtggtg ataaacttat catccccttt tgctgatgga gctgcacatg 3540 aacccattca aaggccggca ttttcagcgt gacatcattc tgtgggccgt acgctggtac 3600 tgcaaatacg gcatcagtta ccgtgagctg caggagatgc tggctgaacg cggagtgaat 3660 gtcgatcact ccacgattta ccgctgggtt cagcgttatg cgcctgaaat ggaaaaacgg 3720 ctgtgctggt actggcgtaa cccttcacat tgaccgagct ggccttgcag accgacaaag 3780 gcatcgtgct ggcgagcgca cttgtcgaga atctgcggcg gcagagcatt atcctgcccg 3840 ccatgaatgc catcgagcgc gcaagcgccg aggccatcac ccgtgccaac cgacgcattt 3900 acgcggcgct gaccgattct ttgttatcac cccaccgtca gcgcctggac gaacttctca 3960 agcgcaagga cggcagtaaa gtgacgtggc tggcatggct gcgccagtcg cctgccaaac 4020 cgaactctcg ccacatgctc gaacatattg agcgcctgaa atcctggcaa gcacttgatc 4080 tgcccgcagg catcgagcgg caggttcacc agaaccgcct gctcaaaatc gctcgtgaag 4140 gtggccagat gacgcctgct gatctggcaa agttcgaggt gcaacgacgc tatgccacgc 4200 tggtagcgct ggccatcgaa ggcatggcca ccgtcaccga tgaaatcatc gaccttcacg 4260 atcgcatcat cgacaagctg ttcaacgcgg ccaagaacaa gcatcagcag cagtccag 4318 <210> 3 <211> 194 <212> PRT <213> Klebsiella pneumoniae <400> 3 Met Arg Cys Arg Tyr Pro Tyr Pro Pro Asp Ala Ala Arg Asp Leu Ala   1 5 10 15 Trp Pro Cys Ala Ser Pro Arg Ser Gly Lys Val Glu Leu Pro Leu Lys              20 25 30 Val Gln Leu Cys Leu Leu Tyr Arg Val Leu Arg Thr Asp Ala Glu Pro          35 40 45 Asp Arg Val His Gly Arg Gln Glu Asp Lys Gly His Asp Gly Ser Pro      50 55 60 Gln Arg Pro Ala Asn Gln Arg Ile Gly Glu Arg Ser Pro Glu Asp Arg  65 70 75 80 Met Ser Glu Arg Asn Glu Arg Gln Asp Arg Arg Gln Arg Gly Gln Gln                  85 90 95 Asn Arg Ala Gly Ala Leu His Arg Arg Leu His His Arg Val Glu Arg             100 105 110 Ile Glu Pro Arg Leu Leu Val Met Met Asp Leu Ala Asn Gln Asp Gln         115 120 125 Arg Ile Ala His Gln Asp Pro Arg Gln Gly Asp Gln Ala His Gln Gly     130 135 140 Ile Asp Ala Lys Arg Leu Ile Glu Gln Gln Gln Arg Arg Asp His Ala 145 150 155 160 Asn Gln Pro Gln Arg Arg Gly Gln Glu Asn His Asp His Arg Arg Gln                 165 170 175 Arg Thr His Leu Gln Asp Asn Asp Gln Gln Arg Glu Gly Asp His Tyr             180 185 190 Arg lys         <210> 4 <211> 585 <212> DNA <213> Klebsiella pneumoniae <400> 4 atgcggtgcc ggtatcctta cccgcctgac gctgcccggg acctggcctg gccatgtgcc 60 tcgcccaggt ccggcaaagt ggaattacct ctgaaggtgc aactctgtct gttgtaccgt 120 gttctccgga cggatgcgga accagatcgc gtacatggcc ggcaggaaga taagggtcat 180 gatggttccc cccagcgtcc cgccaatcag cgtataggcg agcgttcccc agaagaccga 240 atgagtgagc ggaatgaacg ccaggatcgc cgccagcgcg gtcagcagaa ccgggcgggc 300 gcgctgcacc gtcgcctcca ccaccgcgtg gaacggatcg agccccgcct gttggttatg 360 atggatttgg ccaatcagga tcagcgtatt gcgcatcagg atccccgaca gggcgatcag 420 gcccaccagg gcattgatgc caaacggctg attgaacagc agcagcgtcg ggaccacgcc 480 aatcagcccc agcggcgcgg tcaggaaaac catgaccatc gccgacagcg aacgcacctg 540 caggataatg atcagcagcg tgagggcgat cattatcgga aataa 585 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggaattccat atgatgcggt gccggtatcc ttac 34 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ccgctcgagt tatttccgat aatgatcgcc 30

Claims (25)

(a) contacting a sample to be analyzed with a cell comprising the NDM-1 protein represented by SEQ ID NO: 1 and the X protein represented by SEQ ID NO: 3;
(b) measuring the amount or activity of the protein; And
(c) determining that the sample is a substance that increases antimicrobial activity when the amount or activity of the protein is determined to be down regulated.
The method of claim 1,
The antimicrobial agent is a penicillin-based, cephalosporin-based or carbapenem-based antimicrobial agent, characterized in that the antimicrobial susceptibility screening method.
The method of claim 1,
The antimicrobial agent is an antimicrobial susceptibility enhancer screening method, characterized in that the carbenpenem-based antimicrobial agent.
The method of claim 1,
Said antimicrobial agent is selected from the group consisting of empicillin, cepharosine, ceftriaxone, cytotaxime, ceftazidime, cefepime, imipenem, meropenem and ertapenem.
(a) contacting a sample to be analyzed with a cell comprising a gene encoding the NDM-1 protein represented by SEQ ID NO: 1 and a gene encoding the X protein represented by SEQ ID NO: 3;
(b) measuring the expression level of the gene; And
(c) when the amount of expression of the gene is determined to be down regulated, the method for screening an antimicrobial susceptor enhancer comprising determining that the sample is a substance that increases antimicrobial activity.
6. The method of claim 5,
The gene encoding the NDM-1 protein is represented by SEQ ID NO: 2, and the gene encoding the X protein is represented by SEQ ID NO: 4 antimicrobial sensitivity screening enhancer screening method.
6. The method of claim 5,
The antimicrobial agent is a penicillin-based, cephalosporin-based or carbapenem-based antimicrobial agent, characterized in that the antimicrobial susceptibility screening method.
6. The method of claim 5,
The antimicrobial agent is an antimicrobial susceptibility enhancer screening method, characterized in that the carbenpenem-based antimicrobial agent.
6. The method of claim 5,
Said antimicrobial agent is selected from the group consisting of empicillin, cepharosine, ceftriaxone, cytotaxime, ceftazidime, cefepime, imipenem, meropenem and ertapenem.
(a) contacting the sample to be analyzed with a cell comprising the X protein represented by SEQ ID NO: 3;
(b) measuring the amount or activity of the protein; And
(c) determining that the sample is a substance that increases antimicrobial activity when the amount or activity of the protein is determined to be down regulated.
The method of claim 10,
The antimicrobial agent is a penicillin-based, cephalosporin-based or carbapenem-based antimicrobial agent, characterized in that the antimicrobial susceptibility screening method.
The method of claim 10,
The antimicrobial agent is an antimicrobial susceptibility enhancer screening method, characterized in that the carbenpenem-based antimicrobial agent.
The method of claim 10,
Said antimicrobial agent is selected from the group consisting of empicillin, cepharosine, ceftriaxone, cytotaxime, ceftazidime, cefepime, imipenem, meropenem and ertapenem.
(a) contacting a sample to be analyzed with a cell comprising a gene encoding the X protein represented by SEQ ID NO: 3;
(b) measuring the expression level of the gene; And
(c) when the amount of expression of the gene is determined to be down regulated, the method for screening an antimicrobial susceptor enhancer comprising determining that the sample is a substance that increases antimicrobial activity.
The method of claim 14,
The gene encoding the X protein is an antimicrobial susceptibility enhancer screening method, characterized in that shown in SEQ ID NO: 4.
The method of claim 14,
The antimicrobial agent is a penicillin-based, cephalosporin-based or carbapenem-based antimicrobial agent, characterized in that the antimicrobial susceptibility screening method.
The method of claim 14,
The antimicrobial agent is an antimicrobial susceptibility enhancer screening method, characterized in that the carbenpenem-based antimicrobial agent.
The method of claim 14,
Said antimicrobial agent is selected from the group consisting of empicillin, cepharosine, ceftriaxone, cytotaxime, ceftazidime, cefepime, imipenem, meropenem and ertapenem.
X protein represented by SEQ ID NO: 3.
A nucleic acid encoding the protein of claim 19.
A recombinant vector comprising the nucleic acid of claim 20.
Transformant comprising a gene encoding the X protein represented by SEQ ID NO: 3.
A transformant comprising a gene encoding the NDM-1 protein represented by SEQ ID NO: 1 and a gene encoding the X protein represented by SEQ ID NO: 3.
A primer set for PCR capable of hybridizing with the gene represented by SEQ ID NO: 4.
25. The method of claim 24,
Primer set for PCR, characterized in that the primer set is represented by SEQ ID NO: 5 and SEQ ID NO: 6.

Images