KR20130011056A - Receptors targeting inflammation and drug carriers for treatment of inflammatory diseases - Google Patents

Abstract

PURPOSE: An inflammation-targeting receptor and a drug delivery system for treating inflammatory diseases are provided to ensure excellent inflammation-targeting effect and to deliver a drug into an inflammatory lesion. CONSTITUTION: An pharmaceutical composition for treating inflammatory diseases or immune-modulatory treatment contains a fusion protein as an active ingredient, which contains an inflammatory inhibitor or an immune booster which is linked to a fragment containing an extracellular region of IL21R(interlukin 21 receptor), VcamI(vascular cell adhesion molecule 1), IL2RB(interleukin-2 receptor subunit beta), IL3RA(interleukin 3 receptor, alpha), IL13RA1(interleukin 13 receptor, alpha 1), or CRLF1(cytokine receptor like factor 1). The fragment containing an extracellular region IL21R contains a polypeptide with an amino acid sequence of sequence number 4.

Description

 Receptors targeting inflammation and drug carriers for treatment of inflammatory diseases

The present invention relates to an inflammatory target receptor and a drug carrier for treating an inflammatory disease. Specifically, the present invention relates to a fragment comprising an extracellular region of IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB protein. It relates to a pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy comprising as an ingredient.

The immune system protects the body from harmful foreign antigens. These types of antigens include bacteria, viruses, toxins, cancer cells and blood and tissues from other people or animals. The immune system produces antibodies to destroy these harmful substances. However, when autoimmune disorders occur, the immune system cannot distinguish between organs of its healthy body and harmful antigens, destroying normal tissues, and this reaction is called autoimmune disease. These reactions are allergic to hypersensitivity reactions. Allergies respond to foreign substances that do not harm the body.However, when autoimmune disorders occur, the reaction occurs in normal tissues of the body. do.

Interleukin (IL) is a type of cytokine that acts as a chemical signal between red blood cells. When IL-2 was approved by the FDA for the treatment of late stage cancer in 1992, it was the first single immunotherapy to be used to treat cancer. Since then, IL-2 has also been used for metastatic melanoma. IL-2 alone has been used to treat cancer and has been treated with vaccines. IL-2 helps the immune system to grow and divide cells faster. However, treatment with IL-2 showed side effects such as colds, chills, fever, fatigue and confusion. IL-15 and IL-21, which belong to the IL-2 family, are also being studied as single agents or adjuvants as cancer therapeutics.

IL-21 is a type of cytokine with alpha-helix structure, which causes an inflammatory response through signaling through the receptor and gamma chain of IL-21. IL-21 has been reported to induce maturation of NK cell precursors from bone marrow (Parrish-Novak J., et al., Nature, 408: 57-63, 2000), in particular cytokine production and apoptosis of NK cells It has been reported to increase effector functions such as performance (Strengell M, et al., J Immunol., 170: 5464-5469, 2003; Brady J, et al., J Immunol., 172: 2048-). 2058, 2004), it has also been reported to promote the anticancer response of the intrinsic, adaptive immune system by increasing the effect function of CD8 + T cells (Takaki R., et al., J Immunol., 175: 2167-2173, 2005; Moroz A , et al., J Immunol, 173: 900-909, 2004). It also activates NK cells isolated from human peripheral blood (Parrish-Novak J., et al., Nature, 408: 57-63, 2000) and induces mature NK cells from hematopoietic stem cells isolated from umbilical cord blood. An important role has been reported (Sonia A. P, et al., Int. Immunol., 18: 49-58, 2006).

VcamI, also known as CD106, functions as a cell adhesion molecule (Cybulsky M., et al., Cytogenet. Cell Genet. 58: 1852, 1991). The structure consists of 6-7 immunoglobulin domains (immunoglobulin doamin) and has been reported to be expressed in large and small blood vessels of endothelial cells stimulated by several cytokines (Barreiro, et al., J. Cell Biol. (United States) 157 (7): 1233-45. 2002). In addition, lymphocytes, monocytes, eosinophilic leukocytes and basophils contribute to adhesion to vascular endothelial tissues, and signal transduction of leukocytes into endothelial cells has been reported, and in the development of atherosclerosis or rheumatoid arthritis. It has been reported to play an important role (Yonekawa K ,. et al ,. J. Leukoc. Biol. 77 (2): 129-40. 2005).

Interleukin-2 (Interleukin-2) is an interleukin, an immune system signaling molecule that binds to the IL-2 receptor expressed by lymphocytes, the cells that produce immune responses, mediates the immune response and reacts from pathogenic bacterial invasion. There are reports of normal production in the body during the study (Smith KA ,. Science. 240 (4856): 1169-76. 1988. Stern J ,. et al, Science 233 (4760): 203-6. 1986) . The secretion of IL-2 and the expression of the IL-2 receptor are achieved by stimulation of antigens that bind to T cells. And, the interaction of the two has been reported to stimulate the survival, differentiation and growth of antigen-selected cytotoxic T cells (Beadling C ,. et al, Proc. Nat. Acad. Sci. USA 90 (7): 2719-23. 1993. Beadling CB ,. et al, Med. Immunol. 1 (1): 2. 2002.), T cells in the thymus for maturation of regulatory gene T cells. (Sakaguchi S ,. et al ,. J. Immunol. 155 (3): 1151-64. 1995. Shevach EM ,. et al ,. J. Exp. Med. 188 (2)) : 287-96. 1998). IL-2 has been shown to have a function similar to IL-15 and has been reported to be a cytokine that induces differentiation and proliferation of natural killer cells and promotes the production of immunoglobulins produced by B cells (Waldmann TA, et al. Nature Rev. Immun. 6 (8): 595-601. 2006).

IL-10 (Interleukin-10) is an anti-inflammatory cytokine well known to inhibit cytokine synthesis in the human body and is encoded by the IL-10 gene (Eskdale J .. et al, Immunogenetics 46 (2): 120 -8. 1997). In addition, it has been shown to have a pleiotropic effect on immunomodulation and inflammatory responses, and down-regulates the expression of Th1 cytokines, MHC Class II antigens and macrophage stimulatory molecules, and improves B cell survival, differentiation and antibody production. Enhances and blocks NF-kB activity in the JAK-STAT signaling pathway. In addition, it has been reported to play an important role in neutralizing excessive immune responses in the human body (Braat H ,. et al, Clin. Gastroenterol. Hepatol. 4 (6): 754-9. 2006), IFN-γ, It has been reported to inhibit the synthesis of inflammatory cytokines such as IL-2, IL-3, TNF-alpha, GM-CSF (Grimbaldeston MA ,. et al, Nat. Immunol. 8 (10): 1095-104 2007).

It is well known that inflammation-related immune cells have the ability to recognize the site of inflammation and reach the site of inflammation. The ability of immune cells to target these inflammatory sites can be caused by receptors on the cell membranes of immune cells and by ligands of these receptors.

Accordingly, the present inventors focus on the ability of targeting the inflammatory sites of the receptors present in the cell membranes of these immune cells to express ligand binding sites of the receptors present in the major inflammation-related human cells as soluble receptors and label them with quantum dots. The present invention is completed by discovering a water-soluble receptor having the best inflammation targeting ability in an inflammation-induced mouse and combining the discovered water-soluble receptor with various drugs to use as a carrier for drug delivery to an inflammation site. It was.

The present inventors confirmed the effect of inflammatory site targeting on IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB, and identified the potential of IL21R as an existing anti-inflammatory drug carrier having the best inflammation targeting ability. In order to find out, IL21R-TNFR2-Fc fusion receptor and Humira-IL21R fusion antibody were prepared. Quantum-dot was labeled on the fusion receptor and the fusion antibody, and in vivo inflammation targeting ability was confirmed. As a result, IL21R was used for treating inflammatory diseases. The present invention has been completed by confirming that it can be used as a carrier for drugs.

An object of the present invention is a drug carrier for treating inflammatory target receptors and inflammatory diseases comprising IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB protein or a fragment comprising an extracellular region of the protein as an active ingredient. It is intended to provide such.

In order to achieve the above object, the present invention is an interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor, alpha (IL3RA), IL13RA1 (Interleukin 13 one or more selected from the group consisting of receptor, alpha 1), cytokine receptor like factor 1 (CRLF1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor (beta) It provides a pharmaceutical composition for treating inflammatory diseases or immunomodulatory therapy comprising a fusion protein in which an inflammatory disease inhibitor or an immune enhancer is linked to a fragment including an extracellular region of the protein as an active ingredient.

In addition, the present invention is an interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor (alpha), IL13RA1 (Interleukin 13 receptor, alpha 1), Extracellular regions of one or more proteins selected from the group consisting of Cytokine receptor like factor 1 (CRLF1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor (beta). Provided is a fragment comprising, and a fusion protein linked with an inflammatory disease inhibitor or an immune enhancer as an active ingredient, a method of enhancing an inflammatory disease or immunomodulatory therapeutic effect.

The fusion protein or the fusion antibody of the present invention has excellent inflammation targeting ability and has a significantly superior inflammation targeting effect compared to the representative anti-inflammatory receptor drug, TNFR2-Fc fusion protein (Enbrel), and thus delivers the drug to the site of inflammation ( It can be used as a carrier) and has the effect of enhancing the effect of treating an inflammatory disease or an immunomodulatory therapy of a fused inflammatory disease inhibitor or immune enhancer.

1 shows the structure of IL21R.
Figure 2 shows the structure of the expression vector (pYK602-His-Fc :: IL21R) cloned the extracellular IL21R domain.
FIG. 3 shows Western blot results (a) and QC test results (b) of IL21R expressed.
Figure 4 shows the structure of the expression vector (pYK602-His-Fc :: IL21R-D1) cloned IL21R extracellular domain I (IL21R-D1).
5 is a Western blot result (a) and a QC test result (b) of IL21R-D1.
Figure 6 shows the structure of the expression vector (pYK602-His-Fc :: IL21R-D2) cloned IL21R extracellular domain II (IL21R-D2).
FIG. 7 shows Western blot results (a) and QC test results (b) of IL21R-D2 expressed.
8 shows the structure of an expression vector (pYK602-His-Fc :: VcamI) cloned from the VcamI extracellular domain.
9 are Western blot results (a) and QC test results (b) of the expressed VcamI.
10 shows the structure of an expression vector (pYK602-His-Fc :: IL2RB) cloned from the IL2RB extracellular domain.
FIG. 11 shows Western blot results (a) and QC test results (b) of IL2RB expressed.
12 shows the structure of an expression vector (pYK602-His-Fc :: IL3RA) cloned from the IL3RA extracellular domain.
FIG. 13 shows Western blot results (a) and QC test results (b) of expressed IL3RA.
Fig. 14 shows the structure of the expression vector (pYK602-His-Fc :: IL13RA1) cloned from the IL13RA1 extracellular domain.
Figure 15 shows Western blot results (a) and QC test results (b) of IL13RA1 expressed.
Figure 16 shows the structure of the expression vector (pYK602-His-Fc :: CRLF1) cloned from the CRLF1 extracellular domain.
FIG. 17 shows Western blot results (a) and QC test results (b) of CRLF1 expressed.
Fig. 18 shows the structure of an expression vector (pYK602-His-Fc :: IL17RA) cloned from the IL17RA extracellular domain.
19 are Western blot results (a) and QC test results (b) of expressed IL17RA.
20 shows the structure of an expression vector (pYK602-His-Fc :: IL2RG) cloned from the IL2RG extracellular domain.
FIG. 21 shows Western blot results (a) and QC test results (b) of expressed IL2RG.
Fig. 22 shows the structure of an expression vector (pYK602-His-Fc :: IL10RB) cloned from the IL10RB extracellular domain.
Figure 23 shows Western blot results (a) and QC test results (b) of expressed IL10RB.
Figure 24 shows the structure of the expression vector (pNATABL) cloned in the light chain (light chain) of the Humira antibody.
Figure 25 shows the structure of the expression vector (pNATABH) cloned in the heavy chain (heavy chain) of the Humira antibody.
FIG. 26 shows Western blot results (a) and QC test results (b) of expressed Humira antibodies.
Fig. 27 shows the structure of an expression vector (pNATABH :: Humira HC / IL21R) cloned from Humira HC / IL21R.
28 are Western blot results (a) and QC test results (b) of Humira HC / IL21R expressed.
29 shows the structure of an expression vector (pNATABH :: IL21R / Humira HC) cloned from IL21R / Humira HC.
FIG. 30 shows Western blot results (a) and QC test results (b) of IL21R / Humira HC expressed.
31 is a fusion structure of IL21R and TNFR2 (IL21R / TNFR2).
FIG. 32 shows the structure of an expression vector (pYK602-His-Fc :: IL21R + TNFR2) cloned from the IL21R / TNFR2 fusion receptor.
FIG. 33 shows Western blot results (a) and QC test results (b) of expressed IL21R / TNFR2.
34 shows a nanocrystal structure of a quantum dot.
35 compares the relative sizes of nanocrystals of Quantum Dot.
36 is a schematic diagram showing the process of binding Qdot and biomolecule.
37 shows a process for creating a CIA animal model.
38 shows the results of in vivo imaging of Q-dot attached Enbrel and Fc control in a control experiment.
FIG. 39 is a graph showing the results of a diagnosis of a living body using a CIA animal model (A), a wavelength of the Q-DOT 800 used to confirm in vivo imaging (B), and 5 days after intravenous injection. QDs are released to the body (C).
FIG. 40 is a table showing the results of FIG. 39. The stronger the inflammation targeting, the more positive values were given.
Fig. 41 is a bioimaging result showing that Qdot-labeled IL21R, IL21R-DomainI and IL21R-DomainII are capable of targeting inflammation in vivo.
42 is a bioimaging result showing that Qdot labeled IL21R / TNFR2 has the ability to target inflammation in vivo.
43 is a bioimaging result showing that Qdot labeled Humira, Humira / IL21R and IL21R / Humira have the ability to target inflammation in vivo.

The present invention relates to Interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor, alpha (IL3RA), Interleukin 13 receptor, alpha 1 (IL13RA1), CRLF1 ( Comprising an extracellular region of at least one protein selected from the group consisting of cytokine receptor like factor 1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor (beta). It provides a pharmaceutical composition for treating inflammatory diseases or immunomodulatory therapy comprising a fusion protein linked to an inflammatory disease inhibitor or immune enhancer as an active ingredient.

In the present invention, the fragment comprising the extracellular region of IL21R (Interlukin 21 receptor) is SEQ ID NO: 4, the fragment comprising the extracellular region of Vascular cell adhesion molecule (VcamI) SEQ ID NO: 14, IL2RB (Interleukin- The fragment comprising the extracellular region of 2 receptor subunit beta is SEQ ID NO: 18, the fragment comprising the extracellular region of Interleukin 3 receptor (alpha) is SEQ ID NO: 22, cells of IL13RA1 (Interleukin 13 receptor, alpha 1) A fragment comprising an extraregion is SEQ ID NO: 26, a fragment comprising an extracellular region of Cytokine receptor like factor 1 (CRLF1) is SEQ ID NO: 30, a fragment comprising an extracellular region of Interleukin 17 receptor A (IL17RA) is SEQ ID NO: 34, The fragment comprising the extracellular region of Interleukin-2 receptor subunit gamma (IL2RG) is SEQ ID NO: 38, The fragment comprising the extracellular region of Interleukin 10 receptor, beta (IL10RB) is a polypeptide having the amino acid sequence of SEQ ID NO: 42 Pho It is characterized by including.

In addition, in the present invention, the inflammatory disease inhibitor is an extracellular region of Tumor necrosis factor receptor type 2 (TNFR2), an extracellular region of CTLA-4 (Orencia), an IL-1 antagonist, an Humira antibody, an anti-CXCL10 antibody, It may include but is not limited to anti IL6R antibody or anti IL6 antibody.

In addition, the fragment comprising the extracellular region of the protein in the present invention is characterized in that the fusion disease inhibitor or immune enhancer fusion in the C-term direction or N-term direction.

The invention also relates to Interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor (alpha), IL13RA1 (Interleukin 13 receptor, alpha 1), Extracellular regions of one or more proteins selected from the group consisting of Cytokine receptor like factor 1 (CRLF1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor (beta). Provided is a fragment comprising, and a fusion protein linked with an inflammatory disease inhibitor or an immune enhancer as an active ingredient, a method for enhancing an inflammatory disease or an immunomodulatory therapeutic effect.

In the present invention, the fragment comprising the extracellular region of the protein is as described above of SEQ ID NO: 4, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 26, SEQ ID NO: 30, SEQ ID NO: 34, SEQ ID NO: 38 or SEQ ID NO: 42 It is characterized by comprising a polypeptide having an amino acid sequence.

In addition, the inflammatory disease inhibitor in the present invention is as described above, the fragment comprising the extracellular region of the protein is characterized in that the fusion disease inhibitor or immune enhancer fusion in the C-term direction or N-term direction .

In a specific embodiment of the present invention, the inventors confirmed the effect of inflammation targeting on IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB. IL21R and other cytokines showed the degree of inflammation targeting the ability to target the inflammation site compared with Enbrel's inflammation targeting ability. As a result, IL21R, VcamI, IL21RB, IL2RG, and IL10RB showed excellent specific binding ability to the inflammation site. , IL13RA1, IL17RA was excellent, IL3RA, CRLF1 was confirmed to be normal. Therefore, we observed that all of the inflammation-related receptors we selected, IL21R, VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, and IL17RA, targeted inflammation sites. We have identified IL21R, VcamI, IL21RB, IL2RG, and IL10RB, which are inflammation-insoluble water-soluble receptors whose capacity is similar or very strong with Enbrel. In particular, in order to investigate the possibility of IL21R having the best inflammation targeting ability as a carrier of the existing anti-inflammatory drugs, IL21R-TNFR2-Fc was prepared by fusing with a representative anti-inflammatory receptor drug, TNFR2-Fc fusion protein (Enbrel). After labeling the quantum-dot on the fusion receptor and confirming its in vivo inflammation targeting ability, it was confirmed that the inflammation targeting ability of IL21R / TNFR2 fusion receptor was much stronger than that of Enbrel's inflammation targeting ability. The ability as a carrier for was also demonstrated in Humira, a neutralizing antibody of TNF-alpha. In other words, after labeling the quantum-dots on the fusion protein of the heavy chain N-terminus (IL21R-Humira) of the humira antibody and the C-terminus of the heavy chain (Humira-IL21R) of the humira antibody, the in-vivo inflammation targeting ability was confirmed. The present invention was completed by confirming that IL21R can be used as a carrier for inflammation site targeting of IL21R by confirming excellent inflammation targeting ability compared to humira.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

Example 1 Preparation of Water Soluble Receptors of Inflammatory Cytokines

In order to obtain inflammatory receptors VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA including IL21R as water-soluble receptors, the present inventors took and expressed only the extracellular domain of each cytokine as follows.

After designing the appropriate primers to secure the extracellular domain of the various genes above, cDNA Library mix (Kidney, placenta, pancrease, liver) as a template, polymerase chain reaction (PCR, polymerase) chain reaction) to give an amplified product.

PCR reaction conditions were 50 μl of the total reaction solution, the template was put to 100 ng, 2.5 units of pfu polymerase (Gennote, Korea), 10 pmole / 50 μl of the forward and reverse primer, respectively, and the remaining volume After filling with distilled water to form a total of 50 μl of the reaction solution, after 2 minutes at 94 ℃, amplify the gene by repeating 30 cycles at 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minutes, and then at 10 ℃ 72 The reaction was carried out for a minute to obtain a PCR product.

Next, cut with SfiI (# R033S, Enzynomics, Korea) restriction enzyme, loaded on agarose gel (# 9002-18-0, BIO BASIC INC, USA), and then gel purification kit (Gel Purification kit) (# 1014876, QIAGEN, USA) was used to secure the insert to be inserted into the vector.

Restriction enzyme cleavage reaction cuts 1 μg DNA. After mixing 1 μl of SfiI (10 unit) and 5 μl of 10x reaction buffer, add sterile distilled water to make 50 μl of total volume, After reacting for 6 hours, separation and purification were performed from an agarose gel.

Then, ligation was performed using a T4 DNA ligase (# M001S, Enzynomics, Korea) to insert the insert into the pYK602-Fc vector, a mammalian expression vector. The ligation reaction involves mixing 1 μl of ligase (10 units) and 1 μl of 10 × reaction buffer with a vector and insert ratio of 1 (50 ng): 3 (150 ng). After that, the expression vector into which the gene was inserted was obtained by ligation at 16 ° C. for at least 16 hours.

Hereinafter, restriction enzyme cleavage reactions and ligation reactions in the examples of the present invention were performed under the same conditions as described above.

The cloned genes (ligates) were transformed into E. coli cells, and the formed colonies were sequenced to obtain clones correctly inserted into the pYK602-Fc expression vector. . After performing the midi prep (# 740 410.100, MACHERY-NAGEL, Germany) with the obtained clones, transfecting 293E cells, which are animal cells, confirmed the expression rate of soluble receptors related to inflammation, The culture was performed to obtain the respective inflammation related water soluble receptor proteins.

In addition, fusion-soluble receptors such as IL21R / TNFR2 were fused by overlapping PCR, a molecular biological method, to obtain the fusion protein by performing the expression, culture, and identity in the same manner as above. Humira, the antibody and Humira / IL21R, IL21R / Humira, were obtained by synthesis through gene synthesis, and fusion antibody protein was also obtained using the same method as above.

Examples 2 to 14 are structures for IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL21R / TNFR2, IL2RG, IL10RB and Humira, Humira / IL21R, IL21R / Humira to be inserted into the vector. PCR amplification, purification, and QC procedures were shown. All procedures were performed under the same conditions.

Example  2. IL21R ( Interlukin  21 receptor A) water soluble receptor manufacturing

Interlukin 21 receptor (IL21R) consists of two domains, and the structure of IL21R is briefly shown in FIG.

As shown in FIG. 1, the extracellular domain of IL21R is a cytokine composed of domains I and II. The total length of the extracellular domain of IL21R is 636bp, which is composed of 212 amino acids, domain I is 300bp, 100 amino acids, and domain II is 411bp, which is 137 amino acids.

In the present invention, the extra-cellular domain full length of IL21R, extracellular domain I of IL21R and extracellular domain II of IL21R were cloned into pYK602-His Fc, respectively.

2-1. Preparation of IL21R-Fc (IL21R extra-cellular domain full length)

The structure of the expression vector obtained by cloning the extra-cellular domain full length of IL21R to pYK602-His-Fc is shown in FIG. 2, and specifically, FIG. 2 is an animal cell expression vector pYK602-His-Fc. IL21R is inserted into the vector and IL21R are cut with restriction enzyme SfiI, and the vector structure expected when IL21R is inserted is shown.

The forward primer (SEQ ID NO: 1) and reverse primer (SEQ ID NO: 2) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. The extracellular domain of IL21R is described by the DNA sequence of SEQ ID NO: 3 or the amino acid sequence of SEQ ID NO: 4.

IL21R-F (SfiI): aggg ggccgtgggggcc cccgacctcgtctgctacac

IL21R-R (SfiI): tagc ggccgacgcggcc aattcctttaactcctctgact

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 150 mm plate (# 430599 Corning USA) to occupy 70 to 80% of the area, and 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 0.6 liters of supernatant collected at two, five, seven, and nine days in 20 150 mm plates was purified. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL21R), collect 2-3 protein-expressing fractions, concentrate using amicon ultra (# UFC805024, Millipore, USA), and use PBS (# 70011, Gibco, USA) for about 10 times. The buffer was exchanged.

As a result, a total of 1.0 mg of IL21R was obtained from 600 ml of the culture supernatant.

After transfecting IL21R inserted into pYK602-His-Fc into 293E cells, which are animal cells, 2 days later and 5 days later, the test was carried out in a media obtained by Western culture and protein was confirmed. After purification using beads (protein bead), the protein purity and quantitation of IL21R obtained through the Agilent 230 kit assay was measured. The purity of IL21R was confirmed to be 98%, and Western blot results (a) and QC test results (b) of IL21R are shown in FIG. 3.

2-2. Preparation of IL21R-D1-Fc (IL21R extra-cellular domain I)

The structure of the expression vector which cloned the extra-cellular domain I (D1) of IL21R in pYK602-His-Fc is shown in FIG. Specifically, FIG. 4 is a diagram in which IL21R-D1 is inserted into pYK602-His-Fc, which is an animal cell expression vector, and after cutting the vector and IL21R-D1 with restriction enzyme SfiI, the vector structure is expected when IL21R-D1 is inserted.

The forward primer (SEQ ID NO: 1) and reverse primer (SEQ ID NO: 5) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. Extracellular domain I of IL21R is described by the DNA sequence of SEQ ID NO: 6 or the amino acid sequence of SEQ ID NO: 7.

IL21R-F (SfiI): aggg ggccgtgggggcc cccgacctcgtctgctacac

IL21R-D1-R (SfiI): tagc ggccgacgcggcc aacttgatgctctcagccagga

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 1.0 L of supernatant collected at 2, 5 and 7 days in 20 150 mm plates was purified. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL21R-D1), collect 2-3 protein-expressing fractions, concentrate using amicon ultra (# UFC805024, Millipore, USA), and then use PBS (# 70011, Gibco, USA). The buffer was changed about once.

As a result, a total of 1.6 mg of IL21R-D1 was obtained from 1.0 L of the culture supernatant.

IL21R-D1 inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in a medium obtained after 2, 5, and 7 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL21R-D1 obtained through Agilent 230 kit assay were measured. The purity of IL21R-D1 was confirmed to be 96%, and Western blot results (a) and QC test results (b) of IL21R-D1 are shown in FIG. 5.

2-3. Preparation of IL21R-D2-Fc (IL21R extra-cellular domain II)

The structure of the expression vector which cloned the extra-cellular domain II (D2) of IL21R in pYK602-His-Fc is shown in FIG. Specifically, FIG. 6 is a diagram in which IL21R-D2 is inserted into pYK602-His-Fc, an animal cell expression vector, and the vector and IL21R-D2 are cut with restriction enzyme SfiI, and the vector structure expected when IL21R-D2 is inserted.

The forward primer (SEQ ID NO: 8) and reverse primer (SEQ ID NO: 2) sequences including the SfiI restriction enzyme sequences used in the PCR reaction are as follows. Extracellular domain I of IL21R is described by the DNA sequence of SEQ ID NO: 9 or the amino acid sequence of SEQ ID NO: 10.

IL21R-D2-F (SfiI): aggg ggccgtgggggcc gtcaacatcacagaccagtct

IL21R-R (SfiI): tagc ggccgacgcggcc aattcctttaactcctctgact

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant taken at 2, 5 and 7 days were purified in 50 150 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL21R-D2), collect 2 to 3 fractions with protein expression, concentrate using amicon ultra (# UFC805024, Millipore, USA), and then concentrate with PBS (# 70011, Gibco, USA). The buffer was changed about once.

As a result, 2.0 mg of IL21R-D2 was obtained in 2.0 L of the culture supernatant as shown in FIG.

IL21R-D2 inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and tested western in a medium obtained after 2, 5, and 7 days to confirm protein expression. After purification using protein beads, protein purity and quantitation of IL21R-D2 obtained through Agilent 230 kit assay were measured. The purity of IL21R-D2 was found to be 92%, and Western blot results (a) and QC test results (b) of IL21R-D2 are shown in FIG. 7.

Example 3. Preparation of VcamI (Vascular cell adhesion molecule 1) -Fc

8 shows a structure of an expression vector obtained by cloning an extra-cellular domain of VcamI (Vascular cell adhesion molecule 1) to pYK602-His-Fc. Specifically, FIG. 8 is a diagram in which VcamI is inserted into pYK602-His-Fc, an animal cell expression vector, and the vector and VcamI are cut with restriction enzyme SfiI, and then the vector structure is expected when VcamI is inserted.

The forward primer (SEQ ID NO: 11) and reverse primer (SEQ ID NO: 12) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. Extracellular domain I of IL21R is described by the DNA sequence of SEQ ID NO: 13 or the amino acid sequence of SEQ ID NO: 14.

VcamI-F (SfiI): aggg ggccgtgggggcc ccagaatctagatatcttgct

VcamI-R (SfiI): tagc ggccgacgcggcc aatccttgaacatcaagtgttaa

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant taken at 2, 4, 6, and 8 days were purified in 50 150 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (VcamI), collect 2-3 protein-expressing fractions, concentrate using amicon ultra (# UFC805024, Millipore, USA), and use PBS (# 70011, Gibco, USA) for about 10 times. The buffer was exchanged.

As a result, as shown in FIG. 9, 2.0 mg of VcamI was obtained from 2.0 L of the culture supernatant.

VcamI inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and tested western in a medium obtained after 2, 4, 6, and 8 days to confirm protein expression. After purification using protein beads, protein purity and quantitation of VcamI obtained through Agilent 230 kit assay were measured. Purity of VcamI was confirmed to be 97.5%, and the results of Western blot (a) and QC test (b) of VcamI are shown in FIG. 9.

Example 4. Preparation of Interleukin-2 receptor subunit beta (IL2RB) -Fc

The structure of the expression vector which cloned the extra-cellular domain of IL2RB (Interleukin-2 receptor subunit beta) into pYK602-His-Fc is shown in FIG. Specifically, FIG. 10 is a diagram illustrating the insertion of IL2RB into pYK602-His-Fc, an animal cell expression vector, which is a vector structure expected after cutting the vector and IL2RB with restriction enzyme SfiI and inserting IL2RB1.

The forward primer (SEQ ID NO: 15) and reverse primer (SEQ ID NO: 16) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. The extracellular domain of IL2RB is described by the DNA sequence of SEQ ID NO: 17 or the amino acid sequence of SEQ ID NO: 18.

IL2RB-F (SfiI): aggg ggccgtgggggcc gcagcggtgaatggcacttcc

IL2RB-R (SfiI): tagc ggccgacgcggcc aacctgaaggccaggggctg

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant collected at 2, 4, 6 and 9 were purified in 50 150 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL2RB), collect 2-3 protein-expressing fractions, concentrate using amicon ultra (# UFC805024, Millipore, USA), and use PBS (# 70011, Gibco, USA) for about 10 times. The buffer was exchanged.

As a result, 1.6 mg of IL2RB was obtained from 2.0 L of the culture supernatant as shown in FIG.

IL2RB inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 4, 6, and 9 days to confirm protein expression. After purification using protein beads, protein purity and quantitation of IL2RB obtained through Agilent 230 kit assay were measured. The purity of IL2RB was found to be 98%, and Western blot results (a) and QC test results (b) of IL2RB are shown in FIG. 11.

Example 5 Preparation of Interleukin 3 Receptor (alpha) -Fc

12 shows the structure of an expression vector obtained by cloning an extra-cellular domain of IL3RA (Interleukin 3 receptor, alpha) to pYK602-His-Fc. Specifically, FIG. 12 is a diagram illustrating the insertion of IL3RA into pYK602-His-Fc, an animal cell expression vector. The vector and IL3RA are cut with restriction enzyme SfiI, and then the vector structure is expected when IL3RA is inserted.

The forward primer (SEQ ID NO: 19) and reverse primer (SEQ ID NO: 20) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. The extracellular domain of IL3RA is described by the DNA sequence of SEQ ID NO: 21 or the amino acid sequence of SEQ ID NO: 22.

IL3RA-F (SfiI): aggg ggccgtgggggcca aggaagatccaaacccacca

IL3RA-R (SfiI): tagc ggccgacgcggcc aagcgctggggggtgctccag

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant collected at 2, 5, 7 and 9 days were purified in 50 150 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL3RA), collect 2-3 protein-expressing fractions, concentrate using amicon ultra (# UFC805024, Millipore, USA), and use PBS (# 70011, Gibco, USA) for about 10 times. The buffer was exchanged.

As a result, 1.2 mg of IL3RA was obtained from 2.0 L of the culture supernatant as shown in FIG.

IL3RA inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then western-tested in media obtained after 2, 5, and 7 days to confirm protein expression. After purification using beads (protein bead), the protein purity and quantitation of IL3RA obtained through the Agilent 230 kit assay was measured. The purity of IL3RA was confirmed to be 95.3%, and Western blot results (a) and QC test results (b) of IL3RA are shown in FIG. 13.

Example 6. Preparation of IL13RA1 (Interleukin 13 receptor, alpha 1) -Fc

14 shows the structure of an expression vector obtained by cloning an extra-cellular domain of IL13RA1 (Interleukin 13 receptor, alpha 1) to pYK602-His-Fc. Specifically, FIG. 14 is a diagram showing the insertion of IL13RA1 into pYK602-His-Fc, an animal cell expression vector, which is a vector structure expected after cutting IL13RA1 into restriction enzyme SfiI and inserting IL13RA1.

The forward primer (SEQ ID NO: 23) and reverse primer (SEQ ID NO: 24) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. The extracellular domain of IL13RA1 is described by the DNA sequence of SEQ ID NO: 25 or the amino acid sequence of SEQ ID NO: 26.

IL13RA1-F (SfiI): aggg ggccgtgggggcc gacaccgagataaaagttaa

IL13RA1-R (SfiI): tagc ggccgacgcggcc aagcattgtttatcactccact

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant taken at 2, 4, 6, and 8 days were purified in 50 150 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL13RA1), collect 2-3 protein-expressing fractions, concentrate using amicon ultra (# UFC805024, Millipore, USA), and then use PBS (# 70011, Gibco, USA) for about 10 times. The buffer was exchanged.

As a result, 1.1 mg of IL13RA1 was obtained from 2.0 L of the culture supernatant as shown in FIG.

IL13RA1 inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 4, 6, and 8 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL13RA1 obtained through Agilent 230 kit assay were measured. The purity of IL13RA1 was found to be 95.4%, and Western blot results (a) and QC test results (b) of IL13RA1 are shown in FIG. 15.

Example 7 Preparation of Cytokine Receptor Like Factor 1 (CRLF1) -Fc

16 shows a structure of an expression vector obtained by cloning an extra-cellular domain of Cytokine receptor like factor 1 (CRLF1) to pYK602-His-Fc. Specifically, FIG. 16 is a diagram illustrating the insertion of CRLF1 into pYK602-His-Fc, an animal cell expression vector, which is a vector structure predicted when CRLF1 is inserted into the vector and CRLF1 by restriction enzyme SfiI.

The forward primer (SEQ ID NO: 27) and reverse primer (SEQ ID NO: 28) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. The extracellular domain of CRLF1 is described by the DNA sequence of SEQ ID NO: 29 or the amino acid sequence of SEQ ID NO: 30.

CRLF1-F (SfiI): aggg ggccgtgggggcc gcccacacagctgtgatcag

CRAF1-R (SfiI): tagc ggccgacgcggcc aaactgcggggagtggaggcg

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant taken at 2, 4, 6, and 8 days were purified in 50 150 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (CRLF1), collect 2 to 3 fractions with protein expression, concentrate using amicon ultra (# UFC805024, Millipore, USA), and use PBS (# 70011, Gibco, USA) for about 10 times. The buffer was exchanged.

As a result, 1.8 mg of CRLF1 was obtained from 2.0 L of the culture supernatant as shown in FIG.

CRLF1 inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 5, 7, 9 days to confirm protein expression. After purification using protein beads, protein purity and quantitation of CRLF1 obtained through Agilent 230 kit assay were measured. Purity of CRLF1 was confirmed to be 94.4%, and Western blot results (a) and QC test results (b) of CRLF12 are shown in FIG. 17.

Example 8. Preparation of Interleukin 17 receptor A (Fc-RA)

The structure of the expression vector which cloned the extra-cellular domain of IL17RA (Interleukin 17 receptor A) to pYK602-His-Fc is shown in FIG. Specifically, FIG. 18 is a diagram illustrating the insertion of IL17RA into pYK602-His-Fc, which is an animal cell expression vector. The vector and IL17RA are cut with restriction enzyme SfiI, and the vector structure is expected when IL17RA is inserted.

The forward primer (SEQ ID NO: 31) and reverse primer (SEQ ID NO: 32) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. The extracellular domain of IL17RA is described by the DNA sequence of SEQ ID NO: 33 or the amino acid sequence of SEQ ID NO: 34.

IL17RA-F (SfiI): aggg ggccgtgggggcc ctgcgactcctggaccaccg

IL17RA-R (SfiI): tagc ggccgacgcggcc aatggagtgtctggcatttctg

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant collected at 2, 5, 7 and 9 days were purified in 50 150 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL17RA), collect 2-3 protein-expressing fractions, concentrate using amicon ultra (# UFC805024, Millipore, USA), and use PBS (# 70011, Gibco, USA) for about 10 times. The buffer was exchanged.

As a result, 1.8 mg of IL17RA was obtained from 2.0 L of the culture supernatant as shown in FIG.

IL17RA inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 5, 7, 9 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL17RA obtained through Agilent 230 kit assay were measured. The purity of IL17RA was found to be 89.4%, and Western blot results (a) and QC test results (b) of IL17RA are shown in FIG. 19.

Example 9. Preparation of Interleukin-2 receptor subunit gamma (Fc) -Fc

20 illustrates the structure of an expression vector obtained by cloning an extra-cellular domain of IL2RG (Interleukin-2 receptor subunit gamma) into pYK602-His-Fc. Specifically, FIG. 20 is a diagram illustrating the insertion of IL2RG into pYK602-His-Fc, an animal cell expression vector. The vector and IL2RG are cut with restriction enzyme SfiI, and are expected when the IL2RG is inserted.

The forward primer (SEQ ID NO: 35) and reverse primer (SEQ ID NO: 36) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. The extracellular domain of IL2RG is described by the DNA sequence of SEQ ID NO: 37 or the amino acid sequence of SEQ ID NO: 38.

IL2RG-F (SfiI): aggg ggccgtgggggcc aacacgacaattctgacgcccaa

IL2RG-R (SfiI): tagc ggccgacgcggcc aaagtattgctcccccagtggatt

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 100 mm plate (# 430599 Corning USA) to cover 80 to 90% of the area, and 13 μg of DNA and 26 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 L of supernatant collected at 2, 4, 6, and 9 days were purified in 50 100 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL2RG), collect 2-3 protein-expressing fractions, concentrate using amicon ultra (# UFC805024, Millipore, USA), and use PBS (# 70011, Gibco, USA) for about 10 times. The buffer was exchanged.

As a result, 2.2 mg of IL2RG was obtained from 2.0 L of the culture supernatant as shown in FIG.

IL2RG inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and tested western in a medium obtained after 2, 4, 6, and 9 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL2RG obtained through Agilent 230 kit assay were measured. The purity of IL2RG was confirmed to be 93.6%, and Western blot results (a) and QC test results (b) of IL2RG are shown in FIG. 21.

Example 10. Preparation of Interleukin 10 receptor, beta) -Fc

The structure of the expression vector which cloned the extra-cellular domain of IL10RB (Interleukin 10 receptor, beta) into pYK602-His-Fc is shown in FIG. Specifically, FIG. 22 is a diagram illustrating the insertion of IL10RB into pYK602-His-Fc, an animal cell expression vector, which is a vector structure expected when the vector and IL10RB are cut with restriction enzyme SfiI, and then IL10RB is inserted.

The forward primer (SEQ ID NO: 39) and reverse primer (SEQ ID NO: 40) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. The extracellular domain of IL10RB is described by the DNA sequence of SEQ ID NO: 41 or the amino acid sequence of SEQ ID NO: 42.

IL10RB-F (SfiI): aggg ggccgtgggggcc catgggacagagctgcccag

IL10RB-R (SfiI): tagc ggccgacgcggcc aaatactgcctggtgagggagat

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

293E cells were plated in a 100 mm plate (# 430599 Corning USA) to cover 80 to 90% of the area, and 13 μg of DNA and 26 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 L of supernatant collected at 2, 4, 6, and 9 days were purified in 50 100 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL10RB), collect 2-3 protein-expressing fractions, concentrate using amicon ultra (# UFC805024, Millipore, USA), and then use PBS (# 70011, Gibco, USA) for about 10 times. The buffer was exchanged.

As a result, 1.5 mg of IL10RB was obtained from 2.0 L of the culture supernatant as shown in FIG.

IL10RB inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 4, 6, and 8 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL10RB obtained through Agilent 230 kit assay were measured. The purity of IL10RB was confirmed to be 95%, and Western blot results (a) and QC test results (b) of IL10RB are shown in FIG. 23.

Example 11 Preparation of Humira Antibodies

11-1.Humira light chain

The structure of the expression vector which cloned the light chain region of Humira antibody into pNATABL is shown in FIG. Specifically, FIG. 24 is a diagram in which a Humira light chain is inserted into an animal cell expression vector pNATABL, and the vector and Humira light chain are cut with restriction enzymes SfiI and BglII, and are expected when the Humira light chain is inserted.

Forward primer (SEQ ID NO: 43) containing the SfiI (# R033S, enzynomic, korea) restriction enzyme sequence used in the PCR reaction and reverse primer (SEQ ID NO: 44) containing the BglII (# R010s, enzynomics, Korea) restriction enzyme sequence The sequence is as follows. Humira antibody light chain regions are described by the DNA sequence of SEQ ID NO: 45 or the amino acid sequence of SEQ ID NO: 46.

NATVK1-1 (SfiI): ttggt ggccacagcggcc gatgtccactcggacatccagatgacccagtc

NATJK-R4 (BglⅡ): gaggag agatct tttgatttccaccttggt

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

11-2.Humira heavy chain

The structure of the expression vector which cloned the heavy chain region of Humira antibody into pNATABL is shown in FIG. Specifically, FIG. 25 is a diagram in which a Humira heavy chain is inserted into an animal cell expression vector pNATABL, and the vector and Humira heavy chain are cut with restriction enzymes SfiI and NheI, and then the vector structure is expected when the Humira heavy chain is inserted.

Forward primer (SEQ ID NO: 47) containing the SfiI (# R033S, enzynomic, korea) restriction enzyme sequence used in the PCR reaction and reverse primer (SEQ ID NO: 48) containing the NheI (# R016s, enzynomics, Korea) restriction enzyme sequence The sequence is as follows. Humira antibody heavy chain regions are described by the DNA sequence of SEQ ID NO: 49 or the amino acid sequence of SEQ ID NO: 50.

NATVH3-4 (SfiI): TTGGT GGCCACAGCGGCC GATGTCCACTCGGAGGTGCAGCTGGTGCAGTC

NATJH-all (NheI): GAGGAG GCTAGC TGAGGAGACGGTGA

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

After 293E cells were plated on a 100 mm plate with an area of 80-90%, 13 μg of DNA (heavy chain: light chain = 4: 6) and 40 μg of PEI (# 23966, Polysciences, USA) were 1: 2 ratio. After mixing for 20 minutes at room temperature, the cells were transfected by dropping. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant taken at 3, 5, 7 and 9 days were purified in 50 100 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, the protein (Humira antibody) was quantified, and 2 to 3 fractions containing the protein expression were collected and concentrated using amicon ultra (# UFC805024, Millipore, USA), followed by 10 times with PBS (# 70011, Gibco, USA). The degree buffer was exchanged.

As a result, 8.7 mg of Humira antibody was obtained from 2.0 L of the culture supernatant as shown in FIG.

The transgenic light and heavy chains of Humira inserted into the heavy and light chain expression vectors were transfected into 293E cells, which are animal cells, and then tested Western in a medium obtained after 3 or 5 days to confirm the protein expression rate. After purification using protein beads, protein purity and quantitation of Humira antibodies obtained through the Agilent 230 kit assay were measured. The purity of the Humira antibody was found to be 96.8%, and Western blot results (a) and QC test results (b) of the Humira antibody are shown in FIG. 26.

Example 12 Preparation of Humira / IL21R Fusion Antibody

A fusion antibody of Humira and IL21R was prepared by inserting IL21R in the C-term direction into pNATABL into which the heavy chain region of Humira antibody was inserted, and the structure of the cloned expression vector is shown in FIG. 27. Specifically, FIG. 27 is a diagram illustrating the insertion of the C-terminal fusion of Humira heavy chain and IL21R into the heavy chain expression vector pNATABH of an animal cell antibody. This is the expected vector structure when the C-terminal fusion of Humira heavy chain and IL21R is inserted.

The reverse primer (SEQ ID NO: 52) sequence including the IL21R forward primer (SEQ ID NO: 51) and the XhoI (# R007S, enzynomics, Korea) restriction enzyme sequence used in the PCR reaction is as follows. The extracellular domain of IL21R is described by the DNA sequence of SEQ ID NO: 3 or the amino acid sequence of SEQ ID NO: 4.

IL21R-F: tgccccgacctcgtctgctaca

IL21R-R (XhoI): ccag ctcgag cggccgtcgcactcattcctttaactcctct

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

After 293E cells were plated on a 100 mm plate with an area of 80-90%, 13 μg of DNA (heavy chain: light chain = 4: 6) and 40 μg of PEI (# 23966, Polysciences, USA) were 1: 2 ratio. After mixing for 20 minutes at room temperature, the cells were transfected by dropping. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant taken at 2, 4, 6 and 8 days were purified in 50 100 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, the protein (Humira / IL21R fusion antibody) was quantified, and 2-3 fractions containing the protein expression were collected and concentrated using amicon ultra (# UFC805024, Millipore, USA), followed by PBS (# 70011, Gibco, USA). The buffer was changed about 10 times.

As a result, 4.3 mg of Humira / IL21R fusion antibody was obtained from 2.0 L of the culture supernatant as shown in FIG.

A medium obtained after 4 days of transfection of the Humira heavy chain, the C-terminal fusion of IL21R, and the Humira light chain inserted into the heavy chain expression vector and the light chain expression vector to 293E cells, which are animal cells (media) ) Was tested in western, purified using protein beads, and protein purity and quantitation of fusion antibodies of Humira and IL21R obtained through Agilent 230 kit assay were measured. The purity of the fusion antibody of Humira and IL21R was found to be 95.1%, and Western blot results (a) and QC test results (b) of the fusion antibody of Humira and IL21R are shown in FIG. 28. The supernatant samples of Humira / IL21R antibody were obtained on days 2, 4, 6, and 8, and the Western blot was only obtained from supernatant samples collected after 4 days.In the case of antibodies, when they are fused with other proteins, they are denaturated and precipitate. The supernatant was precipitated with and without to check for solubility.

Example 13. Preparation of IL21R / Humira Fusion Antibody

A fusion antibody of Humira and IL21R was prepared by inserting IL21R in the N-term direction to pNATABL into which the heavy chain region of Humira antibody was inserted, and the structure of the cloned expression vector is shown in FIG. 29. Specifically, FIG. 29 is a diagram in which the N-terminal fusion of Humira heavy chain and IL21R is inserted into the heavy chain expression vector pNATABH of an animal cell antibody. The N-terminal fusion of the vector and Humira heavy chain and IL21R is cut with restriction enzymes SfiI and NheI, The vector structure is expected when the N-terminal fusion of Humira heavy chain and IL21R is inserted.

IL21R forward primer (SEQ ID NO: 53) and reverse primer (SEQ ID NO: 54) sequences including the SfiI (# R033S, enzynomics, Korea) restriction enzyme sequence used in the PCR reaction are as follows. The extracellular domain of IL21R is described by the DNA sequence of SEQ ID NO: 3 or the amino acid sequence of SEQ ID NO: 4.

IL21R-F (SfiI): tggt ggccacagcggcc tgccccgacctcgtctgctac

IL21R-R: agctgcacctgcgagtggacatcttcctttaactcc

The PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.

After 293E cells were plated on a 100 mm plate with an area of 80-90%, 13 μg of DNA (heavy chain: light chain = 4: 6) and 40 μg of PEI (# 23966, Polysciences, USA) were 1: 2 ratio. After mixing for 20 minutes at room temperature, the cells were transfected by dropping. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 2.0 liters of supernatant taken at 2, 4, 6 and 8 days were purified in 50 100 mm plates. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, quantify the protein (IL21R / Humira fusion antibody), collect 2 to 3 fractions with protein expression, concentrate using amicon ultra (# UFC805024, Millipore, USA), and then concentrate PBS (# 70011, Gibco, USA). The buffer was changed about 10 times.

As a result, as shown in FIG. 30, 2.9 mg of IL21R / Humira fusion antibody was obtained in 2.0 L of the culture supernatant.

After 4 days to confirm the protein expression rate after transfection of the N-terminal fusion of Humira heavy chain, IL21R and Humira light chain inserted into the heavy chain expression vector and the light chain expression vector into 293E cells which are animal cells (media ) Was tested in western, purified using protein beads, and protein purity and quantitation of fusion antibodies of Humira and IL21R obtained through Agilent 230 kit assay were measured. The purity of the fusion antibody of Humira and IL21R was confirmed to be 97%, and Western blot results (a) and QC test results (b) of the fusion antibody of Humira and IL21R are shown in FIG. 30. The supernatant samples of IL21R / Humira antibodies were obtained on days 2, 4, 6, and 8, and the Western blot was only obtained from supernatant samples collected after 4 days.In the case of antibodies, they are denaturated and precipitated when fused with other proteins. The supernatant was precipitated with and without to check for solubility.

Example  14. IL21R Of TNFR2  Preparation of Fusion Receptors

The structure of the expression vector which cloned the extra-cellular domain II (D2) of IL21R in pYK602-His-Fc is shown in FIG. Specifically, FIG. 6 is a diagram in which IL21R-D2 is inserted into pYK602-His-Fc, an animal cell expression vector, and the vector and IL21R-D2 are cut with restriction enzyme SfiI, and the vector structure expected when IL21R-D2 is inserted.

By performing overlapping PCR, a DNA structure fused to IL21R and TNFR2 was prepared, and then inserted into pYK602-Fc to produce a fusion receptor.

Specifically, an overlapping PCR technique was performed to make a fusion protein of two cytokines of IL21R and TNFR2. The primer was overlapped by 30mer between the C-terminus of IL21R and the N-terminus of TNFR2. Design and amplify IL21R with IL21R-SfiI and overlap IL21R primers, amplify TNFR2 with overlap TNFR2 and TNFR2-SfiI primers, and then add the amplified IL21R and TNFR2 fragments to form a template. Two fragments were fused to primers to form an IL21R / TNFR2 fusion structure. The fusion structure of IL21R and TNFR2 is shown in FIG. 31.

In addition, IL21R / TNFR2 was inserted into pYK602-His-Fc, an animal cell expression vector. The vector and IL21R / TNFR2 were cut with restriction enzyme SfiI, and the vector structure expected when IL21R / TNFR2 was inserted is shown in FIG. 32. It was.

IL21R forward primer (SEQ ID NO: 55), reverse primer (SEQ ID NO: 56), TNFR2 forward primer (SEQ ID NO: 57) and reverse primer (SEQ ID NO: 55) containing the SfiI (# R033S, enzynomics, Korea) restriction enzyme sequence used in the PCR reaction No. 58) The sequence is as follows. IL21R / TNFR2 fusion receptors are described by the DNA sequence of SEQ ID NO: 59 or the amino acid sequence of SEQ ID NO: 60.

IL21R-F (SfiI): caggg ggccgtgggggcc cccgacctcgtctgctacac

IL21R-R: tagcggccgacgcggccaattcctttaactcctctgact

TNFR2-F: cagggggccgtgggggccttgcccgcccaggtggcatt

TNFR2-R (SfiI): tagc ggccgacgcggcc aacgtgcagactgcatccatgc

PCR reaction was carried out under the same conditions as in Example 1, but after 2 minutes of IL21R and TNFR2 at 94 ℃, respectively, amplified the gene by repeating 30 cycles at 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1 minute After the reaction was conducted at 72 ° C. for 10 minutes, a PCR product was obtained.

Then, the IL21R PCR product and the TNFR2 PCR product were purified by agarose gel under the same conditions, and then the template was mixed 1: 1. PCR was performed using IL21R-F (StifI) and TNFR2 (StifI) as primers.

 DNA obtained by PCR was transfected and purified in the following manner.

After 293E cells were plated to a 70-80% area on a 150 mm plate, 20 μg of DNA and 40 μg of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2 for 20 minutes at room temperature. The cells were then transfected by dropping into cells. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.

A total of 600 ml of the supernatant collected at two, five and seven days in 20 150 mm plates was purified. The whole supernatant was first filtered using a 0.22 μm top-filter (# PR02890 Millipore USA), followed by 500 μl of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C. overnight at 0.9 ml / min using a Peri-start pump, the column was washed with 100 ml or more of PBS (# 70011 Gibco USA), and 0.1 M glycine-hydrochloric acid (Glycine-HCl, Elution was carried out in 6 fractions using # G7126, Sigma, USA) and neutralized with 1M Tris (# T-1503-5KG, Sigma, USA) (pH 9.0). Next, the protein (IL21R / TNFR2-Fc) was quantified and two to three fractions with protein expression were collected and concentrated using amicon ultra (# UFC805024, Millipore, USA), followed by PBS (# 70011, Gibco, USA). The buffer was changed about 10 times.

As a result, 1.0 mg of IL21R / TNFR2-Fc fusion receptor was obtained from 600 ml of the culture supernatant as shown in FIG.

IL21R / TNFR2 inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 5, 7, 9 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL21R / TNFR2 obtained through Agilent 230 kit assay were measured. The purity of IL21R / TNFR2 was confirmed to be 97%, and Western blot results (a) and QC test results (b) of IL21R / TNFR2 are shown in FIG. 33.

Example 15 Quantum dot Labeling on IL21R and VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA Proteins

After transfecting transiently from 293E cells, which are mammalian cells, the quantum dots were selected by selecting only those with purity greater than 90%.

QD nanoparticles (Quantum dot nanocrystals) (see FIGS. 34 and 35) were labeled to IL-21R receptor conjugates that bind to the receptor of IL-21 overexpressed in autoimmune arthritis tissue. The labeling method is Qdot 800 ITK carbosylquantum dots (Invitrogen, # MOP-Q21371MP) and 16 proteins (IL21R, IL21R-DomainI (D1), IL21R-DomainII (D2), VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, 11 inflammatory receptors related to inflammation, including CRLF1 and IL17RA; IL21R / TNFR2 fused with IL21R and TNFR2 (Enbrel), an inflammatory drug; Enbrel, an inflammatory drug; Humira; inflammatory antibody Humira; fused with IL21R and Humira For IL21R / Humira and Humira / IL21R), it is activated and mixed using 10 mM borate buffer (pH7.4), and a linker for linking QDs to the respective water-soluble receptors, fusion receptors, and fusion antibodies. After addition of EDC (N-ehyl-N-dimethylaminopropyl-carbodiimide, Sigma, # 424331), the mixture was quenched at room temperature for 2 hours to synthesize QDs-labeled receptors, fusion receptors, and fusion antibodies.

EDC of each of the reactants, the water-soluble receptor, the fusion receptor, and the fusion antibody, was reacted at a molar ratio of 1: 40: 1500. Next, the unlabeled protein was purified by washing several times with 50 mM borate buffer (pH 8.3) using an ultrafiltration membrane (Urafiltration filter 100kDa, Millipore, # UFC910024).

Example 16 Establishment of Collagen Induced Arthritis (CIA) Animal Model

To create a CIA animal model, a 7-week-old male DBA / 1J was purchased and adapted for 3-4 days in the animal kennel.

Collagen primary injection connects a 3-way stopcock with 2 mg / ml Type II collagen (Chondrex, # 20022, USA) and 2 mg / ml CFA (Chondrex, # 7009, USA) at a ratio of 1: 1. Put the mixture into a glass syringe (Hamilton, # 1010, USA) while maintaining a temperature of 4 ℃ to prepare a mixed solution, then pre-cooled 1 ml glass syringe (Hamilton, # 1001, USA) for 7 weeks, male, DBA / 1J NCrljOri 100 μl per mouse was injected subcutaneously into the mixed solution prepared on the tail of the mouse (Oriental Bio).

The second injection of collagen was performed 18 days after the first injection of collagen, and a collagen mixture was prepared in the same manner as in the first injection, and booster injection was performed at the upper tail region rather than the first immunization position. From day 18 after the initial immunization, the progression of arthritis was assessed by the standard arthritis index (criteria arthritic index) from 0 to 3 (see Table 1). In addition, when the inflammation level reached a peak, inflammation targeting in-vivo experiments were performed on various inflammation-related receptor drugs including IL21R, and the results are shown in FIG. 37.

In FIG. 37, A shows that inflammation occurs at 18 days after the first and second injections of collagen, and the inflammation level reaches its peak at 28 days, and B is 0 to 3 in the degree of inflammation when the inflammation occurs. The scores are given to the point, and the higher the score, the more severe the inflammation.

[Table 1]

Example  17. Qutum dot this Labeled Enbrel and Fc For CIA  Inflammation targeting ability observed in animal models (comparative experiment)

The present inventors have identified Qdot-labeled IL21R, IL21R-Domain I, IL21R-Domain II receptor, inflammation-related receptors (VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA), and IL21R / TNFR2 (Enbrel). ) In vivo imaging system was performed to observe inflammatory targeting ability of the fusion receptor, Humira, and the fusion IL21R / Humira and Humira / IL21R. Imaging equipment was used Maestro 2 In-vivo imaging system (Korea Basic Research Institute).

 First, as a control experiment to check whether inflammation targeting using an in vivo imaging system by Qdot conjugation is performed, an experiment was performed using Enbrel, which is currently sold as a therapeutic agent for rheumatoid arthritis. In this case, Enbrel was used as a positive control and only Fc was used as a negative control.

When Qdot was labeled in the same manner as in Example 15 on Enbrel and Fc only, and the inflammatory response reached the highest point (arthritis score = 15) in the CIA animal model made in Example 16, 100 was applied to the tail vein of the animal. Μg was injected. Inflammation targeting ability was observed 30 minutes after the injection with maestro in vivo imaging equipment, and the results are shown in FIG. 38.

In the results shown in Figure 38, it can be seen that in the case of Enbrel precisely inflamed 30 minutes after injection. Inflammation targeting signal (signal) appears strong in the site of inflammation, such as knee, ankle, toes. On the other hand, Fc only control is not found in the inflammatory site but only in the liver, indicating that it does not target the inflammatory site at all. Both Enbrel and Fc only are commonly found in the liver, which is thought to be a common process of detoxification and metabolism in the liver due to the toxicity of Qdot.

Example 18 Biological Imaging Using a CIA Animal Model

We intravenously injected 60 nmol of Qdot conjugated IL21R receptors and inflammation-related receptors (VcamI, IL21RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA) when they reached arthritis score = 15. After 30 minutes, inflammation targeting ability was diagnosed in vivo using MAESTRO (Korea Institute of Basic Support Science), a fluorescence imaging system. As a result, it was confirmed that all targeting the inflammation site, the results are shown in Figure 39 and 40.

39A and 40, IL21R, VACM1, IL21RB, IL2RG, and IL10RB labeled QDs had the most excellent inflammation targeting ability, IL13RA1 and IL17RA were excellent, and IL3RA and CRLF1 were normal. It was. The present inventors have shown the wavelength of the Q-DOT 800 used to confirm in vivo imaging as a red graph in B of FIG. 39, and also after 5 days of intravenous injection in C of FIG. 39. It was confirmed that it was discharged in vitro.

Example 19. Biological Image Diagnosis Using CIA Animal Models for IL21R, IL21R-DomainI, IL21R-DomainII

The inventors of the present invention have shown that IL21R has superior inflammation targeting ability than that of Enbrel, a therapeutic agent for arthritis, and therefore, when two domains of IL21R are separated, IL21R and IL21R-Domain I, IL21R- The aim of this study was to determine the degree of inflammation targeting ability against Domain II. 30 minutes after intravenous injection of IL21R, IL21R-Domain I and IL21R-Domain II receptors with 60 nmol Qdot conjugated to arthritis index (arthritis score = 15), MAESTRO (fluorescence imaging system) Inflammation targeting ability was diagnosed in vivo.

The results are shown in FIG. 41, and it was confirmed that both IL21R domain I and IL21R domain II target the inflammatory site exactly as IL21R. In particular, IL21R-Domain I was found to have the stronger ability to target inflammation sites than IL21R and IL21R-Domain II. From the above results, since administration of the IL21R protein to the human body can minimize side effects, it can be seen that it has a more effective advantage when used as a small molecule drug (small molecule drug).

Example 20. Bioimaging Diagnosis Using a CIA Animal Model of a Fusion Protein of IL21R with an Arthritis Therapeutic Drug

In order to find out the possibility of IL21R having the best inflammation targeting ability as a carrier of existing anti-inflammatory drugs, the present inventors first fused ILN-R2-Tc fusion protein (Enbrel), a representative anti-inflammatory receptor drug, to prepare IL21R-TNFR2-Fc. After 30 minutes of intravenous injection of IL21R / TNFR2 (Enbrel) fusion receptor with 60 nmol Qdot conjugation in articulated animals in CIA when the arthritis index reached grade 3 (arthritis score = 15), MAESTRO (fluorescence imaging system) Inflammation targeting ability was diagnosed in vivo using the Korea Research Institute of Basic Support Science) and the results are shown in FIG. 42.

As shown in FIG. 42, it was confirmed that the inflammation targeting ability of the IL21R / TNFR2 fusion receptor was much stronger than the inflammation targeting ability of Enbrel, and it could be used as a carrier of the inflammation site targeting of IL21R. This is believed to show stronger inflammation targeting ability as the inflammation targeting ability of TNFR2 is added to the inflammation targeting ability of IL21R itself.

The ability of IL21R as a carrier for targeting inflammation sites has also been demonstrated in Humira, a neutralizing antibody of TNF-alpha. As shown in FIG. 43, Quantum-dot was labeled on the fusion protein of the N-terminus (IL21R / Humira) of the Humira antibody heavy chain and the C-terminus (Humira / IL21R) of the Humira antibody heavy chain, and then the in-vivo inflammation targeting ability was measured. As a result, it was confirmed that Humira / IL21R had better inflammation targeting ability than Humira, and IL21R / Humira was similar to Humira. When fusion of IL21R to Humira antibody, it is found that fusion to C-terminus of heavy chain is more effective for inflammation targeting than fusion to N-terminus of Humira heavy chain, which indicates that Humira has the inflammatory targeting ability of IL21R itself. As the inflammation targeting ability is added, it is judged to show stronger inflammation targeting ability.

The description of the present invention described above is for illustrative purposes, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. . It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> A & R therapeutics co., Ltd. <120> Receptors targeting inflammation and drug carriers for treatment          of inflammatory diseases <130> PB11-09289 <160> 60 <170> Kopatentin 2.0 <210> 1 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-F (SfiI) <400> 1 agggggccgt gggggccccc gacctcgtct gctacac 37 <210> 2 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-R (SfiI) <400> 2 tagcggccga cgcggccaat tcctttaact cctctgact 39 <210> 3 <211> 636 <212> DNA <213> Artificial Sequence <220> <223> Interlukin 21 receptor DNA sequence <400> 3 cccgacctcg tctgctacac cgattacctc cagacggtca tctgcatcct ggaaatgtgg 60 aacctccacc ccagcacgct cacccttacc tggcaagacc agtatgaaga gctgaaggac 120 gaggccacct cctgcagcct ccacaggtcg gcccacaatg ccacgcatgc cacctacacc 180 tgccacatgg atgtattcca cttcatggcc gacgacattt tcagtgtcaa catcacagac 240 cagtctggca actactccca ggagtgtggc agctttctcc tggctgagag catcaagccg 300 gctccccctt tcaacgtgac tgtgaccttc tcaggacagt ataatatctc ctggcgctca 360 gattacgaag accctgcctt ctacatgctg aagggcaagc ttcagtatga gctgcagtac 420 aggaaccggg gagacccctg ggctgtgagt ccgaggagaa agctgatctc agtggactca 480 agaagtgtct ccctcctccc cctggagttc cgcaaagact cgagctatga gctgcaggtg 540 cgggcagggc ccatgcctgg ctcctcctac caggggacct ggagtgaatg gagtgacccg 600 gtcatctttc agacccagtc agaggagtta aaggaa 636 <210> 4 <211> 212 <212> PRT <213> Artificial Sequence <220> <223> Interlukin 21 receptor protein sequence <400> 4 Pro Asp Leu Val Cys Tyr Thr Asp Tyr Leu Gln Thr Val Ile Cys Ile   1 5 10 15 Leu Glu Met Trp Asn Leu His Pro Ser Thr Leu Thr Leu Thr Trp Gln              20 25 30 Asp Gln Tyr Glu Glu Leu Lys Asp Glu Ala Thr Ser Cys Ser Leu His          35 40 45 Arg Ser Ala His Asn Ala Thr His Ala Thr Tyr Thr Cys His Met Asp      50 55 60 Val Phe His Phe Met Ala Asp Asp Ile Phe Ser Val Asn Ile Thr Asp  65 70 75 80 Gln Ser Gly Asn Tyr Ser Gln Glu Cys Gly Ser Phe Leu Leu Ala Glu                  85 90 95 Ser Ile Lys Pro Ala Pro Pro Phe Asn Val Thr Val Thr Phe Ser Gly             100 105 110 Gln Tyr Asn Ile Ser Trp Arg Ser Asp Tyr Glu Asp Pro Ala Phe Tyr         115 120 125 Met Leu Lys Gly Lys Leu Gln Tyr Glu Leu Gln Tyr Arg Asn Arg Gly     130 135 140 Asp Pro Trp Ala Val Ser Pro Arg Arg Lys Leu Ile Ser Val Asp Ser 145 150 155 160 Arg Ser Val Ser Leu Leu Pro Leu Glu Phe Arg Lys Asp Ser Ser Tyr                 165 170 175 Glu Leu Gln Val Arg Ala Gly Pro Met Pro Gly Ser Ser Tyr Gln Gly             180 185 190 Thr Trp Ser Glu Trp Ser Asp Pro Val Ile Phe Gln Thr Gln Ser Glu         195 200 205 Glu Leu Lys Glu     210 <210> 5 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-D1R (SfiI) <400> 5 tagcggccga cgcggccaac ttgatgctct cagccagga 39 <210> 6 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> Interlukin 21 receptor domain I DNA sequence <400> 6 tgccccgacc tcgtctgcta caccgattac ctccagacgg tcatctgcat cctggaaatg 60 tggaacctcc accccagcac gctcaccctt acctggcaag accagtatga agagctgaag 120 gacgaggcca cctcctgcag cctccacagg tcggcccaca atgccacgca tgccacctac 180 acctgccaca tggatgtatt ccacttcatg gccgacgaca ttttcagtgt caacatcaca 240 gaccagtctg gcaactactc ccaggagtgt ggcagctttc tcctggctga gagcatcaag 300                                                                          300 <210> 7 <211> 100 <212> PRT <213> Artificial Sequence <220> <223> Interlukin 21 receptor domain I protein sequence <400> 7 Cys Pro Asp Leu Val Cys Tyr Thr Asp Tyr Leu Gln Thr Val Ile Cys   1 5 10 15 Ile Leu Glu Met Trp Asn Leu His Pro Ser Thr Leu Thr Leu Thr Trp              20 25 30 Gln Asp Gln Tyr Glu Glu Leu Lys Asp Glu Ala Thr Ser Cys Ser Leu          35 40 45 His Arg Ser Ala His Asn Ala Thr His Ala Thr Tyr Thr Cys His Met      50 55 60 Asp Val Phe His Phe Met Ala Asp Asp Ile Phe Ser Val Asn Ile Thr  65 70 75 80 Asp Gln Ser Gly Asn Tyr Ser Gln Glu Cys Gly Ser Phe Leu Leu Ala                  85 90 95 Glu Ser Ile Lys             100 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-D2F (SfiI) <400> 8 agggggccgt gggggccgtc aacatcacag accagtct 38 <210> 9 <211> 411 <212> DNA <213> Artificial Sequence <220> <223> Interlukin 21 receptor domain II DNA sequence <400> 9 gtcaacatca cagaccagtc tggcaactac tcccaggagt gtggcagctt tctcctggct 60 gagagcatca agccggctcc ccctttcaac gtgactgtga ccttctcagg acagtataat 120 atctcctggc gctcagatta cgaagaccct gccttctaca tgctgaaggg caagcttcag 180 tatgagctgc agtacaggaa ccggggagac ccctgggctg tgagtccgag gagaaagctg 240 atctcagtgg actcaagaag tgtctccctc ctccccctgg agttccgcaa agactcgagc 300 tatgagctgc aggtgcgggc agggcccatg cctggctcct cctaccaggg gacctggagt 360 gaatggagtg acccggtcat ctttcagacc cagtcagagg agttaaagga a 411 <210> 10 <211> 137 <212> PRT <213> Artificial Sequence <220> <223> Interlukin 21 receptor domain II protein sequence <400> 10 Val Asn Ile Thr Asp Gln Ser Gly Asn Tyr Ser Gln Glu Cys Gly Ser   1 5 10 15 Phe Leu Leu Ala Glu Ser Ile Lys Pro Ala Pro Pro Phe Asn Val Thr              20 25 30 Val Thr Phe Ser Gly Gln Tyr Asn Ile Ser Trp Arg Ser Asp Tyr Glu          35 40 45 Asp Pro Ala Phe Tyr Met Leu Lys Gly Lys Leu Gln Tyr Glu Leu Gln      50 55 60 Tyr Arg Asn Arg Gly Asp Pro Trp Ala Val Ser Pro Arg Arg Lys Leu  65 70 75 80 Ile Ser Val Asp Ser Arg Ser Val Ser Leu Leu Pro Leu Glu Phe Arg                  85 90 95 Lys Asp Ser Ser Tyr Glu Leu Gln Val Arg Ala Gly Pro Met Pro Gly             100 105 110 Ser Ser Tyr Gln Gly Thr Trp Ser Glu Trp Ser Asp Pro Val Ile Phe         115 120 125 Gln Thr Gln Ser Glu Glu Leu Lys Glu     130 135 <210> 11 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer of VcamI-F (SfiI) <400> 11 agggggccgt gggggcccca gaatctagat atcttgct 38 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer of VcamI-R (SfiI) <400> 12 tagcggccga cgcggccaat ccttgaacat caagtgttaa 40 <210> 13 <211> 1971 <212> DNA <213> Artificial Sequence <220> <223> Vascular cell adhesion molecule 1 DNA sequence <400> 13 ccagaatcta gatatcttgc tcagattggt gactccgtct cattgacttg cagcaccaca 60 ggctgtgagt ccccattttt ctcttggaga acccagatag atagtccact gaatgggaag 120 gtgacgaatg aggggaccac atctacgctg acaatgaatc ctgttagttt tgggaacgaa 180 cactcttacc tgtgcacagc aacttgtgaa tctaggaaat tggaaaaagg aatccaggtg 240 gagatctact cttttcctaa ggatccagag attcatttga gtggccctct ggaggctggg 300 aagccgatca cagtcaagtg ttcagttgct gatgtatacc catttgacag gctggagata 360 gacttactga aaggagatca tctcatgaag agtcaggaat ttctggagga tgcagacagg 420 aagtccctgg aaaccaagag tttggaagta acctttactc ctgtcattga ggatattgga 480 aaagttcttg tttgccgagc taaattacac attgatgaaa tggattctgt gcccacagta 540 aggcaggctg taaaagaatt gcaagtctac atatcaccca agaatacagt tatttctgtg 600 aatccatcca caaagctgca agaaggtggc tctgtgacca tgacctgttc cagcgagggt 660 ctaccagctc cagagatttt ctggagtaag aaattagata atgggaatct acagcacctt 720 tctggaaatg caactctcac cttaattgct atgaggatgg aagattctgg aatttatgtg 780 tgtgaaggag ttaatttgat tgggaaaaac agaaaagagg tggaattaat tgttcaagag 840 aaaccattta ctgttgagat ctcccctgga ccccggattg ctgctcagat tggagactca 900 gtcatgttga catgtagtgt catgggctgt gaatccccat ctttctcctg gagaacccag 960 atagacagcc ctctgagcgg gaaggtgagg agtgagggga ccaattccac gctgaccctg 1020 agccctgtga gttttgagaa cgaacactct tatctgtgca cagtgacttg tggacataag 1080 aaactggaaa agggaatcca ggtggagctc tactcattcc ctagagatcc agaaatcgag 1140 atgagtggtg gcctcgtgaa tgggagctct gtcactgtaa gctgcaaggt tcctagcgtg 1200 tacccccttg accggctgga gattgaatta cttaaggggg agactattct ggagaatata 1260 gagtttttgg aggatacgga tatgaaatct ctagagaaca aaagtttgga aatgaccttc 1320 atccctacca ttgaagatac tggaaaagct cttgtttgtc aggctaagtt acatattgat 1380 gacatggaat tcgaacccaa acaaaggcag agtacgcaaa cactttatgt caatgttgcc 1440 cccagagata caaccgtctt ggtcagccct tcctccatcc tggaggaagg cagttctgtg 1500 aatatgacat gcttgagcca gggctttcct gctccgaaaa tcctgtggag caggcagctc 1560 cctaacgggg agctacagcc tctttctgag aatgcaactc tcaccttaat ttctacaaaa 1620 atggaagatt ctggggttta tttatgtgaa ggaattaacc aggctggaag aagcagaaag 1680 gaagtggaat taattatcca agttactcca aaagacataa aacttacagc ttttccttct 1740 gagagtgtca aagaaggaga cactgtcatc atctcttgta catgtggaaa tgttccagaa 1800 acatggataa tcctgaagaa aaaagcggag acaggagaca cagtactaaa atctatagat 1860 ggcgcctata ccatccgaaa ggcccagttg aaggatgcgg gagtatatga atgtgaatct 1920 aaaaacaaag ttggctcaca attaagaagt ttaacacttg atgttcaagg a 1971 <210> 14 <211> 657 <212> PRT <213> Artificial Sequence <220> <223> Vascular cell adhesion molecule 1 protein sequence <400> 14 Pro Glu Ser Arg Tyr Leu Ala Gln Ile Gly Asp Ser Val Ser Leu Thr   1 5 10 15 Cys Ser Thr Thr Gly Cys Glu Ser Pro Phe Phe Ser Trp Arg Thr Gln              20 25 30 Ile Asp Ser Pro Leu Asn Gly Lys Val Thr Asn Glu Gly Thr Thr Ser          35 40 45 Thr Leu Thr Met Asn Pro Val Ser Phe Gly Asn Glu His Ser Tyr Leu      50 55 60 Cys Thr Ala Thr Cys Glu Ser Arg Lys Leu Glu Lys Gly Ile Gln Val  65 70 75 80 Glu Ile Tyr Ser Phe Pro Lys Asp Pro Glu Ile His Leu Ser Gly Pro                  85 90 95 Leu Glu Ala Gly Lys Pro Ile Thr Val Lys Cys Ser Val Ala Asp Val             100 105 110 Tyr Pro Phe Asp Arg Leu Glu Ile Asp Leu Leu Lys Gly Asp His Leu         115 120 125 Met Lys Ser Gln Glu Phe Leu Glu Asp Ala Asp Arg Lys Ser Leu Glu     130 135 140 Thr Lys Ser Leu Glu Val Thr Phe Thr Pro Val Ile Glu Asp Ile Gly 145 150 155 160 Lys Val Leu Val Cys Arg Ala Lys Leu His Ile Asp Glu Met Asp Ser                 165 170 175 Val Pro Thr Val Arg Gln Ala Val Lys Glu Leu Gln Val Tyr Ile Ser             180 185 190 Pro Lys Asn Thr Val Ile Ser Val Asn Pro Ser Thr Lys Leu Gln Glu         195 200 205 Gly Gly Ser Val Thr Met Thr Cys Ser Ser Glu Gly Leu Pro Ala Pro     210 215 220 Glu Ile Phe Trp Ser Lys Lys Leu Asp Asn Gly Asn Leu Gln His Leu 225 230 235 240 Ser Gly Asn Ala Thr Leu Thr Leu Ile Ala Met Arg Met Glu Asp Ser                 245 250 255 Gly Ile Tyr Val Cys Glu Gly Val Asn Leu Ile Gly Lys Asn Arg Lys             260 265 270 Glu Val Glu Leu Ile Val Gln Glu Lys Pro Phe Thr Val Glu Ile Ser         275 280 285 Pro Gly Pro Arg Ile Ala Ala Gln Ile Gly Asp Ser Val Met Leu Thr     290 295 300 Cys Ser Val Met Gly Cys Glu Ser Pro Ser Phe Ser Trp Arg Thr Gln 305 310 315 320 Ile Asp Ser Pro Leu Ser Gly Lys Val Arg Ser Glu Gly Thr Asn Ser                 325 330 335 Thr Leu Thr Leu Ser Pro Val Ser Phe Glu Asn Glu His Ser Tyr Leu             340 345 350 Cys Thr Val Thr Cys Gly His Lys Lys Leu Glu Lys Gly Ile Gln Val         355 360 365 Glu Leu Tyr Ser Phe Pro Arg Asp Pro Glu Ile Glu Met Ser Gly Gly     370 375 380 Leu Val Asn Gly Ser Ser Val Thr Val Ser Cys Lys Val Pro Ser Val 385 390 395 400 Tyr Pro Leu Asp Arg Leu Glu Ile Glu Leu Leu Lys Gly Glu Thr Ile                 405 410 415 Leu Glu Asn Ile Glu Phe Leu Glu Asp Thr Asp Met Lys Ser Leu Glu             420 425 430 Asn Lys Ser Leu Glu Met Thr Phe Ile Pro Thr Ile Glu Asp Thr Gly         435 440 445 Lys Ala Leu Val Cys Gln Ala Lys Leu His Ile Asp Asp Met Glu Phe     450 455 460 Glu Pro Lys Gln Arg Gln Ser Thr Gln Thr Leu Tyr Val Asn Val Ala 465 470 475 480 Pro Arg Asp Thr Thr Val Leu Val Ser Pro Ser Ser Ile Leu Glu Glu                 485 490 495 Gly Ser Ser Val Asn Met Thr Cys Leu Ser Gln Gly Phe Pro Ala Pro             500 505 510 Lys Ile Leu Trp Ser Arg Gln Leu Pro Asn Gly Glu Leu Gln Pro Leu         515 520 525 Ser Glu Asn Ala Thr Leu Thr Leu Ile Ser Thr Lys Met Glu Asp Ser     530 535 540 Gly Val Tyr Leu Cys Glu Gly Ile Asn Gln Ala Gly Arg Ser Arg Lys 545 550 555 560 Glu Val Glu Leu Ile Ile Gln Val Thr Pro Lys Asp Ile Lys Leu Thr                 565 570 575 Ala Phe Pro Ser Glu Ser Val Lys Glu Gly Asp Thr Val Ile Ile Ser             580 585 590 Cys Thr Cys Gly Asn Val Pro Glu Thr Trp Ile Ile Leu Lys Lys Lys         595 600 605 Ala Glu Thr Gly Asp Thr Val Leu Lys Ser Ile Asp Gly Ala Tyr Thr     610 615 620 Ile Arg Lys Ala Gln Leu Lys Asp Ala Gly Val Tyr Glu Cys Glu Ser 625 630 635 640 Lys Asn Lys Val Gly Ser Gln Leu Arg Ser Leu Thr Leu Asp Val Gln                 645 650 655 Gly     <210> 15 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer of IL2RB-F (SfiI) <400> 15 agggggccgt gggggccgca gcggtgaatg gcacttcc 38 <210> 16 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer of IL2RB-R (SfiI) <400> 16 tagcggccga cgcggccaac ctgaaggcca ggggctg 37 <210> 17 <211> 615 <212> DNA <213> Artificial Sequence <220> <223> Interleukin-2 receptor subunit beta DNA sequence <400> 17 gcagcggtga atggcacttc ccagttcaca tgcttctaca actcgagagc caacatctcc 60 tgtgtctgga gccaagatgg ggctctgcag gacacttcct gccaagtcca tgcctggccg 120 gacagacggc ggtggaacca aacctgtgag ctgctccccg tgagtcaagc atcctgggcc 180 tgcaacctga tcctcggagc cccagattct cagaaactga ccacagttga catcgtcacc 240 ctgagggtgc tgtgccgtga gggggtgcga tggagggtga tggccatcca ggacttcaag 300 ccctttgaga accttcgcct gatggccccc atctccctcc aagttgtcca cgtggagacc 360 cacagatgca acataagctg ggaaatctcc caagcctccc actactttga aagacacctg 420 gagttcgagg cccggacgct gtccccaggc cacacctggg aggaggcccc cctgctgact 480 ctcaagcaga agcaggaatg gatctgcctg gagacgctca ccccagacac ccagtatgag 540 tttcaggtgc gggtcaagcc tctgcaaggc gagttcacga cctggagccc ctggagccag 600 cccctggcct tcagg 615 <210> 18 <211> 205 <212> PRT <213> Artificial Sequence <220> <223> Interleukin-2 receptor subunit beta protein sequence <400> 18 Ala Ala Val Asn Gly Thr Ser Gln Phe Thr Cys Phe Tyr Asn Ser Arg   1 5 10 15 Ala Asn Ile Ser Cys Val Trp Ser Gln Asp Gly Ala Leu Gln Asp Thr              20 25 30 Ser Cys Gln Val His Ala Trp Pro Asp Arg Arg Arg Trp Asn Gln Thr          35 40 45 Cys Glu Leu Leu Pro Val Ser Gln Ala Ser Trp Ala Cys Asn Leu Ile      50 55 60 Leu Gly Ala Pro Asp Ser Gln Lys Leu Thr Thr Val Asp Ile Val Thr  65 70 75 80 Leu Arg Val Leu Cys Arg Glu Gly Val Arg Trp Arg Val Met Ala Ile                  85 90 95 Gln Asp Phe Lys Pro Phe Glu Asn Leu Arg Leu Met Ala Pro Ile Ser             100 105 110 Leu Gln Val Val His Val Glu Thr His Arg Cys Asn Ile Ser Trp Glu         115 120 125 Ile Ser Gln Ala Ser His Tyr Phe Glu Arg His Leu Glu Phe Glu Ala     130 135 140 Arg Thr Leu Ser Pro Gly His Thr Trp Glu Glu Ala Pro Leu Leu Thr 145 150 155 160 Leu Lys Gln Lys Gln Glu Trp Ile Cys Leu Glu Thr Leu Thr Pro Asp                 165 170 175 Thr Gln Tyr Glu Phe Gln Val Arg Val Lys Pro Leu Gln Gly Glu Phe             180 185 190 Thr Thr Trp Ser Pro Trp Ser Gln Pro Leu Ala Phe Arg         195 200 205 <210> 19 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer of IL3RA-F (SfiI) <400> 19 agggggccgt gggggccaag gaagatccaa acccacca 38 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer of IL3RA-R (SfiI) <400> 20 tagcggccga cgcggccaag cgctgggggg tgctccag 38 <210> 21 <211> 813 <212> DNA <213> Artificial Sequence <220> <223> Interleukin 3 receptor alpha DNA sequence <400> 21 aaggaagatc caaacccacc aatcacgaac ctaaggatga aagcaaaggc tcagcagttg 60 acctgggacc ttaacagaaa tgtgaccgat atcgagtgtg ttaaagacgc cgactattct 120 atgccggcag tgaacaatag ctattgccag tttggagcaa tttccttatg tgaagtgacc 180 aactacaccg tccgagtggc caacccacca ttctccacgt ggatcctctt ccctgagaac 240 agtgggaagc cttgggcagg tgcggagaat ctgacctgct ggattcatga cgtggatttc 300 ttgagctgca gctgggcggt aggcccgggg gcccccgcgg acgtccagta cgacctgtac 360 ttgaacgttg ccaacaggcg tcaacagtac gagtgtcttc actacaaaac ggatgctcag 420 ggaacacgta tcgggtgtcg tttcgatgac atctctcgac tctccagcgg ttctcaaagt 480 tcccacatcc tggtgcgggg caggagcgca gccttcggta tcccctgcac agataagttt 540 gtcgtctttt cacagattga gatattaact ccacccaaca tgactgcaaa gtgtaataag 600 acacattcct ttatgcactg gaaaatgaga agtcatttca atcgcaaatt tcgctatgag 660 cttcagatac aaaagagaat gcagcctgta atcacagaac aggtcagaga cagaacctcc 720 ttccagctac tcaatcctgg aacgtacaca gtacaaataa gagcccggga aagagtgtat 780 gaattcttga gcgcctggag caccccccag cgc 813 <210> 22 <211> 271 <212> PRT <213> Artificial Sequence <220> <223> Interleukin 3 receptor alpha protein sequence <400> 22 Lys Glu Asp Pro Asn Pro Pro Ile Thr Asn Leu Arg Met Lys Ala Lys   1 5 10 15 Ala Gln Gln Leu Thr Trp Asp Leu Asn Arg Asn Val Thr Asp Ile Glu              20 25 30 Cys Val Lys Asp Ala Asp Tyr Ser Met Pro Ala Val Asn Asn Ser Tyr          35 40 45 Cys Gln Phe Gly Ala Ile Ser Leu Cys Glu Val Thr Asn Tyr Thr Val      50 55 60 Arg Val Ala Asn Pro Pro Phe Ser Thr Trp Ile Leu Phe Pro Glu Asn  65 70 75 80 Ser Gly Lys Pro Trp Ala Gly Ala Glu Asn Leu Thr Cys Trp Ile His                  85 90 95 Asp Val Asp Phe Leu Ser Cys Ser Trp Ala Val Gly Pro Gly Ala Pro             100 105 110 Ala Asp Val Gln Tyr Asp Leu Tyr Leu Asn Val Ala Asn Arg Arg Gln         115 120 125 Gln Tyr Glu Cys Leu His Tyr Lys Thr Asp Ala Gln Gly Thr Arg Ile     130 135 140 Gly Cys Arg Phe Asp Asp Ile Ser Arg Leu Ser Ser Gly Ser Gln Ser 145 150 155 160 Ser His Ile Leu Val Arg Gly Arg Ser Ala Ala Phe Gly Ile Pro Cys                 165 170 175 Thr Asp Lys Phe Val Val Phe Ser Gln Ile Glu Ile Leu Thr Pro Pro             180 185 190 Asn Met Thr Ala Lys Cys Asn Lys Thr His Ser Phe Met His Trp Lys         195 200 205 Met Arg Ser His Phe Asn Arg Lys Phe Arg Tyr Glu Leu Gln Ile Gln     210 215 220 Lys Arg Met Gln Pro Val Ile Thr Glu Gln Val Arg Asp Arg Thr Ser 225 230 235 240 Phe Gln Leu Leu Asn Pro Gly Thr Tyr Thr Val Gln Ile Arg Ala Arg                 245 250 255 Glu Arg Val Tyr Glu Phe Leu Ser Ala Trp Ser Thr Pro Gln Arg             260 265 270 <210> 23 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer of IL13RA1-F (SfiI) <400> 23 agggggccgt gggggccgac accgagataa aagttaa 37 <210> 24 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer of IL13RA1-R (SfiI) <400> 24 tagcggccga cgcggccaag cattgtttat cactccact 39 <210> 25 <211> 912 <212> DNA <213> Artificial Sequence <220> <223> Interleukin 13 receptor alpha 1 DNA sequence <400> 25 gacaccgaga taaaagttaa ccctcctcag gattttgaga tagtggatcc cggatactta 60 ggttatctct atttgcaatg gcaaccccca ctgtctctgg atcattttaa ggaatgcaca 120 gtggaatatg aactaaaata ccgaaacatt ggtagtgaaa catggaagac catcattact 180 aagaatctac attacaaaga tgggtttgat cttaacaagg gcattgaagc gaagatacac 240 acgcttttac catggcaatg cacaaatgga tcagaagttc aaagttcctg ggcagaaact 300 acttattgga tatcaccaca aggaattcca gaaactaaag ttcaggatat ggattgcgta 360 tattacaatt ggcaatattt actctgttct tggaaacctg gcataggtgt acttcttgat 420 accaattaca acttgtttta ctggtatgag ggcttggatc atgcattaca gtgtgttgat 480 tacatcaagg ctgatggaca aaatatagga tgcagatttc cctatttgga ggcatcagac 540 tataaagatt tctatatttg tgttaatgga tcatcagaga acaagcctat cagatccagt 600 tatttcactt ttcagcttca aaatatagtt aaacctttgc cgccagtcta tcttactttt 660 actcgggaga gttcatgtga aattaagctg aaatggagca tacctttggg acctattcca 720 gcaaggtgtt ttgattatga aattgagatc agagaagatg atactacctt ggtgactgct 780 acagttgaaa atgaaacata caccttgaaa acaacaaatg aaacccgaca attatgcttt 840 gtagtaagaa gcaaagtgaa tatttattgc tcagatgacg gaatttggag tgagtggagt 900 gataaacaat gc 912 <210> 26 <211> 304 <212> PRT <213> Artificial Sequence <220> <223> Interleukin 13 receptor alpha 1 protein sequence <400> 26 Asp Thr Glu Ile Lys Val Asn Pro Pro Gln Asp Phe Glu Ile Val Asp   1 5 10 15 Pro Gly Tyr Leu Gly Tyr Leu Tyr Leu Gln Trp Gln Pro Pro Leu Ser              20 25 30 Leu Asp His Phe Lys Glu Cys Thr Val Glu Tyr Glu Leu Lys Tyr Arg          35 40 45 Asn Ile Gly Ser Glu Thr Trp Lys Thr Ile Ile Thr Lys Asn Leu His      50 55 60 Tyr Lys Asp Gly Phe Asp Leu Asn Lys Gly Ile Glu Ala Lys Ile His  65 70 75 80 Thr Leu Leu Pro Trp Gln Cys Thr Asn Gly Ser Glu Val Gln Ser Ser                  85 90 95 Trp Ala Glu Thr Thr Tyr Trp Ile Ser Pro Gln Gly Ile Pro Glu Thr             100 105 110 Lys Val Gln Asp Met Asp Cys Val Tyr Tyr Asn Trp Gln Tyr Leu Leu         115 120 125 Cys Ser Trp Lys Pro Gly Ile Gly Val Leu Leu Asp Thr Asn Tyr Asn     130 135 140 Leu Phe Tyr Trp Tyr Glu Gly Leu Asp His Ala Leu Gln Cys Val Asp 145 150 155 160 Tyr Ile Lys Ala Asp Gly Gln Asn Ile Gly Cys Arg Phe Pro Tyr Leu                 165 170 175 Glu Ala Ser Asp Tyr Lys Asp Phe Tyr Ile Cys Val Asn Gly Ser Ser             180 185 190 Glu Asn Lys Pro Ile Arg Ser Ser Tyr Phe Thr Phe Gln Leu Gln Asn         195 200 205 Ile Val Lys Pro Leu Pro Pro Val Tyr Leu Thr Phe Thr Arg Glu Ser     210 215 220 Ser Cys Glu Ile Lys Leu Lys Trp Ser Ile Pro Leu Gly Pro Ile Pro 225 230 235 240 Ala Arg Cys Phe Asp Tyr Glu Ile Glu Ile Arg Glu Asp Asp Thr Thr                 245 250 255 Leu Val Thr Ala Thr Val Glu Asn Glu Thr Tyr Thr Leu Lys Thr Thr             260 265 270 Asn Glu Thr Arg Gln Leu Cys Phe Val Val Arg Ser Lys Val Asn Ile         275 280 285 Tyr Cys Ser Asp Asp Gly Ile Trp Ser Glu Trp Ser Asp Lys Gln Cys     290 295 300 <210> 27 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer of CRLF1-F (SfiI) <400> 27 agggggccgt gggggccgcc cacacagctg tgatcag 37 <210> 28 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer of CRLF1-R (SfiI) <400> 28 tagcggccga cgcggccaaa ctgcggggag tggaggcg 38 <210> 29 <211> 912 <212> DNA <213> Artificial Sequence <220> <223> Cytokine receptor like factor 1 DNA sequence <400> 29 gcccacacag ctgtgatcag tccccaggat cccacgcttc tcatcggctc ctccctgctg 60 gccacctgct cagtgcacgg agacccacca ggagccaccg ccgagggcct ctactggacc 120 ctcaacgggc gccgcctgcc ccctgagctc tcccgtgtac tcaacgcctc caccttggct 180 ctggccctgg ccaacctcaa tgggtccagg cagcggtcgg gggacaacct cgtgtgccac 240 gcccgtgacg gcagcatcct ggctggctcc tgcctctatg ttggcctgcc cccagagaaa 300 cccgtcaaca tcagctgctg gtccaagaac atgaaggact tgacctgccg ctggacgcca 360 ggggcccacg gggagacctt cctccacacc aactactccc tcaagtacaa gcttaggtgg 420 tatggccagg acaacacatg tgaggagtac cacacagtgg ggccccactc ctgccacatc 480 cccaaggacc tggctctctt tacgccctat gagatctggg tggaggccac caaccgcctg 540 ggctctgccc gctccgatgt actcacgctg gatatcctgg atgtggtgac cacggacccc 600 ccgcccgacg tgcacgtgag ccgcgtcggg ggcctggagg accagctgag cgtgcgctgg 660 gtgtcgccac ccgccctcaa ggatttcctc tttcaagcca aataccagat ccgctaccga 720 gtggaggaca gtgtggactg gaaggtggtg gacgatgtga gcaaccagac ctcctgccgc 780 ctggccggcc tgaaacccgg caccgtgtac ttcgtgcaag tgcgctgcaa cccctttggc 840 atctatggct ccaagaaagc cgggatctgg agtgagtgga gccaccccac agccgcctcc 900 actccccgca gt 912 <210> 30 <211> 304 <212> PRT <213> Artificial Sequence <220> <223> Cytokine receptor like factor 1 protein sequence <400> 30 Ala His Thr Ala Val Ile Ser Pro Gln Asp Pro Thr Leu Leu Ile Gly   1 5 10 15 Ser Ser Leu Leu Ala Thr Cys Ser Val His Gly Asp Pro Pro Gly Ala              20 25 30 Thr Ala Glu Gly Leu Tyr Trp Thr Leu Asn Gly Arg Arg Leu Pro Pro          35 40 45 Glu Leu Ser Arg Val Leu Asn Ala Ser Thr Leu Ala Leu Ala Leu Ala      50 55 60 Asn Leu Asn Gly Ser Arg Gln Arg Ser Gly Asp Asn Leu Val Cys His  65 70 75 80 Ala Arg Asp Gly Ser Ile Leu Ala Gly Ser Cys Leu Tyr Val Gly Leu                  85 90 95 Pro Pro Glu Lys Pro Val Asn Ile Ser Cys Trp Ser Lys Asn Met Lys             100 105 110 Asp Leu Thr Cys Arg Trp Thr Pro Gly Ala His Gly Glu Thr Phe Leu         115 120 125 His Thr Asn Tyr Ser Leu Lys Tyr Lys Leu Arg Trp Tyr Gly Gln Asp     130 135 140 Asn Thr Cys Glu Glu Tyr His Thr Val Gly Pro His Ser Cys His Ile 145 150 155 160 Pro Lys Asp Leu Ala Leu Phe Thr Pro Tyr Glu Ile Trp Val Glu Ala                 165 170 175 Thr Asn Arg Leu Gly Ser Ala Arg Ser Asp Val Leu Thr Leu Asp Ile             180 185 190 Leu Asp Val Val Thr Thr Asp Pro Pro Pro Asp Val His Val Ser Arg         195 200 205 Val Gly Gly Leu Glu Asp Gln Leu Ser Val Arg Trp Val Ser Pro Pro     210 215 220 Ala Leu Lys Asp Phe Leu Phe Gln Ala Lys Tyr Gln Ile Arg Tyr Arg 225 230 235 240 Val Glu Asp Ser Val Asp Trp Lys Val Val Asp Asp Val Ser Asn Gln                 245 250 255 Thr Ser Cys Arg Leu Ala Gly Leu Lys Pro Gly Thr Val Tyr Phe Val             260 265 270 Gln Val Arg Cys Asn Pro Phe Gly Ile Tyr Gly Ser Lys Lys Ala Gly         275 280 285 Ile Trp Ser Glu Trp Ser His Pro Thr Ala Ala Ser Thr Pro Arg Ser     290 295 300 <210> 31 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer of IL17RA-F (SfiI) <400> 31 agggggccgt gggggccctg cgactcctgg accaccg 37 <210> 32 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer of IL17RA-R (SfiI) <400> 32 tagcggccga cgcggccaat ggagtgtctg gcatttctg 39 <210> 33 <211> 834 <212> DNA <213> Artificial Sequence <220> <223> Interleukin 17 receptor A DNA Sequence <400> 33 ctgcgactcc tggaccaccg ggcgctggtc tgctcccagc cggggctaaa ctgcacggtc 60 aagaatagta cctgcctgga tgacagctgg attcaccctc gaaacctgac cccctcctcc 120 ccaaaggacc tgcagatcca gctgcacttt gcccacaccc aacaaggaga cctgttcccc 180 gtggctcaca tcgaatggac actgcagaca gacgccagca tcctgtacct cgagggtgca 240 gagttatctg tcctgcagct gaacaccaat gaacgtttgt gcgtcaggtt tgagtttctg 300 tccaaactga ggcatcacca caggcggtgg cgttttacct tcagccactt tgtggttgac 360 cctgaccagg aatatgaggt gaccgttcac cacctgccca agcccatccc tgatggggac 420 ccaaaccacc agtccaagaa tttccttgtg cctgactgtg agcacgccag gatgaaggta 480 accacgccat gcatgagctc aggcagcctg tgggacccca acatcaccgt ggagaccctg 540 gaggcccacc agctgcgtgt gagcttcacc ctgtggaacg aatctaccca ttaccagatc 600 ctgctgacca gttttccgca catggagaac cacagttgct ttgagcacat gcaccacata 660 cctgcgccca gaccagaaga gttccaccag cgatccaacg tcacactcac tctacgcaac 720 cttaaagggt gctgtcgcca ccaagtgcag atccagccct tcttcagcag ctgcctcaat 780 gactgcctca gacactccgc gactgtttcc tgcccagaaa tgccagacac tcca 834 <210> 34 <211> 278 <212> PRT <213> Artificial Sequence <220> <223> Interleukin 17 receptor A protein sequence <400> 34 Leu Arg Leu Leu Asp His Arg Ala Leu Val Cys Ser Gln Pro Gly Leu   1 5 10 15 Asn Cys Thr Val Lys Asn Ser Thr Cys Leu Asp Asp Ser Trp Ile His              20 25 30 Pro Arg Asn Leu Thr Pro Ser Ser Pro Lys Asp Leu Gln Ile Gln Leu          35 40 45 His Phe Ala His Thr Gln Gln Gly Asp Leu Phe Pro Val Ala His Ile      50 55 60 Glu Trp Thr Leu Gln Thr Asp Ala Ser Ile Leu Tyr Leu Glu Gly Ala  65 70 75 80 Glu Leu Ser Val Leu Gln Leu Asn Thr Asn Glu Arg Leu Cys Val Arg                  85 90 95 Phe Glu Phe Leu Ser Lys Leu Arg His His His Arg Arg Trp Arg Phe             100 105 110 Thr Phe Ser His Phe Val Val Asp Pro Asp Gln Glu Tyr Glu Val Thr         115 120 125 Val His His Leu Pro Lys Pro Ile Pro Asp Gly Asp Pro Asn His Gln     130 135 140 Ser Lys Asn Phe Leu Val Pro Asp Cys Glu His Ala Arg Met Lys Val 145 150 155 160 Thr Thr Pro Cys Met Ser Ser Gly Ser Leu Trp Asp Pro Asn Ile Thr                 165 170 175 Val Glu Thr Leu Glu Ala His Gln Leu Arg Val Ser Phe Thr Leu Trp             180 185 190 Asn Glu Ser Thr His Tyr Gln Ile Leu Leu Thr Ser Phe Pro His Met         195 200 205 Glu Asn His Ser Cys Phe Glu His Met His His Ile Pro Ala Pro Arg     210 215 220 Pro Glu Glu Phe His Gln Arg Ser Asn Val Thr Leu Thr Leu Arg Asn 225 230 235 240 Leu Lys Gly Cys Cys Arg His Gln Val Gln Ile Gln Pro Phe Phe Ser                 245 250 255 Ser Cys Leu Asn Asp Cys Leu Arg His Ser Ala Thr Val Ser Cys Pro             260 265 270 Glu Met Pro Asp Thr Pro         275 <210> 35 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer of IL2RG-F (SfiI) <400> 35 agggggccgt gggggccaac acgacaattc tgacgcccaa 40 <210> 36 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer of IL2RG-R (SfiI) <400> 36 tagcggccga cgcggccaaa gtattgctcc cccagtggat t 41 <210> 37 <211> 681 <212> DNA <213> Artificial Sequence <220> <223> Interleukin-2 receptor subunit gamma DNA sequence <400> 37 aacacgacaa ttctgacgcc caatgggaat gaagacacca cagctgattt cttcctgacc 60 actatgccca ctgactccct cagtgtttcc actctgcccc tcccagaggt tcagtgtttt 120 gtgttcaatg tcgagtacat gaattgcact tggaacagca gctctgagcc ccagcctacc 180 aacctcactc tgcattattg gtacaagaac tcggataatg ataaagtcca gaagtgcagc 240 cactatctat tctctgaaga aatcacttct ggctgtcagt tgcaaaaaaa ggagatccac 300 ctctaccaaa catttgttgt tcagctccag gacccacggg aacccaggag acaggccaca 360 cagatgctaa aactgcagaa tctggtgatc ccctgggctc cagagaacct aacacttcac 420 aaactgagtg aatcccagct agaactgaac tggaacaaca gattcttgaa ccactgtttg 480 gagcacttgg tgcagtaccg gactgactgg gaccacagct ggactgaaca atcagtggat 540 tatagacata agttctcctt gcctagtgtg gatgggcaga aacgctacac gtttcgtgtt 600 cggagccgct ttaacccact ctgtggaagt gctcagcatt ggagtgaatg gagccaccca 660 atccactggg ggagcaatac t 681 <210> 38 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> Interleukin-2 receptor subunit gamma protein sequence <400> 38 Asn Thr Thr Ile Leu Thr Pro Asn Gly Asn Glu Asp Thr Thr Ala Asp   1 5 10 15 Phe Phe Leu Thr Thr Met Pro Thr Asp Ser Leu Ser Val Ser Thr Leu              20 25 30 Pro Leu Pro Glu Val Gln Cys Phe Val Phe Asn Val Glu Tyr Met Asn          35 40 45 Cys Thr Trp Asn Ser Ser Ser Glu Pro Gln Pro Thr Asn Leu Thr Leu      50 55 60 His Tyr Trp Tyr Lys Asn Ser Asp Asn Asp Lys Val Gln Lys Cys Ser  65 70 75 80 His Tyr Leu Phe Ser Glu Glu Ile Thr Ser Gly Cys Gln Leu Gln Lys                  85 90 95 Lys Glu Ile His Leu Tyr Gln Thr Phe Val Val Gln Leu Gln Asp Pro             100 105 110 Arg Glu Pro Arg Arg Gln Ala Thr Gln Met Leu Lys Leu Gln Asn Leu         115 120 125 Val Ile Pro Trp Ala Pro Glu Asn Leu Thr Leu His Lys Leu Ser Glu     130 135 140 Ser Gln Leu Glu Leu Asn Trp Asn Asn Arg Phe Leu Asn His Cys Leu 145 150 155 160 Glu His Leu Val Gln Tyr Arg Thr Asp Trp Asp His Ser Trp Thr Glu                 165 170 175 Gln Ser Val Asp Tyr Arg His Lys Phe Ser Leu Pro Ser Val Asp Gly             180 185 190 Gln Lys Arg Tyr Thr Phe Arg Val Arg Ser Arg Phe Asn Pro Leu Cys         195 200 205 Gly Ser Ala Gln His Trp Ser Glu Trp Ser His Pro Ile His Trp Gly     210 215 220 Ser Asn Thr 225 <210> 39 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer of IL10RB-F (SfiI) <400> 39 agggggccgt gggggcccat gggacagagc tgcccag 37 <210> 40 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer of IL10RB-R (SfiI) <400> 40 tagcggccga cgcggccaaa tactgcctgg tgagggagat 40 <210> 41 <211> 627 <212> DNA <213> Artificial Sequence <220> <223> Interleukin 10 receptor beta DNA sequence <400> 41 catgggacag agctgcccag ccctccgtct gtgtggtttg aagcagaatt tttccaccac 60 atcctccact ggacacccat cccaaatcag tctgaaagta cctgctatga agtggcgctc 120 ctgaggtatg gaatagagtc ctggaactcc atctccaact gtagccagac cctgtcctat 180 gaccttaccg cagtgacctt ggacctgtac cacagcaatg gctaccgggc cagagtgcgg 240 gctgtggacg gcagccggca ctccaactgg accgtcacca acacccgctt ctctgtggat 300 gaagtgactc tgacagttgg cagtgtgaac ctagagatcc acaatggctt catcctcggg 360 aagattcagc tacccaggcc caagatggcc cccgcaaatg acacatatga aagcatcttc 420 agtcacttcc gagagtatga gattgccatt cgcaaggtgc cgggaaactt cacgttcaca 480 cacaagaaag taaaacatga aaacttcagc ctcctaacct ctggagaagt gggagagttc 540 tgtgtccagg tgaaaccatc tgtcgcttcc cgaagtaaca aggggatgtg gtctaaagag 600 gagtgcatct ccctcaccag gcagtat 627 <210> 42 <211> 209 <212> PRT <213> Artificial Sequence <220> <223> Interleukin 10 receptor beta DNA sequence <400> 42 His Gly Thr Glu Leu Pro Ser Pro Pro Ser Val Trp Phe Glu Ala Glu   1 5 10 15 Phe Phe His His Ile Leu His Trp Thr Pro Ile Pro Asn Gln Ser Glu              20 25 30 Ser Thr Cys Tyr Glu Val Ala Leu Leu Arg Tyr Gly Ile Glu Ser Trp          35 40 45 Asn Ser Ile Ser Asn Cys Ser Gln Thr Leu Ser Tyr Asp Leu Thr Ala      50 55 60 Val Thr Leu Asp Leu Tyr His Ser Asn Gly Tyr Arg Ala Arg Val Arg  65 70 75 80 Ala Val Asp Gly Ser Arg His Ser Asn Trp Thr Val Thr Asn Thr Arg                  85 90 95 Phe Ser Val Asp Glu Val Thr Leu Thr Val Gly Ser Val Asn Leu Glu             100 105 110 Ile His Asn Gly Phe Ile Leu Gly Lys Ile Gln Leu Pro Arg Pro Lys         115 120 125 Met Ala Pro Ala Asn Asp Thr Tyr Glu Ser Ile Phe Ser His Phe Arg     130 135 140 Glu Tyr Glu Ile Ala Ile Arg Lys Val Pro Gly Asn Phe Thr Phe Thr 145 150 155 160 His Lys Lys Val Lys His Glu Asn Phe Ser Leu Leu Thr Ser Gly Glu                 165 170 175 Val Gly Glu Phe Cys Val Gln Val Lys Pro Ser Val Ala Ser Arg Ser             180 185 190 Asn Lys Gly Met Trp Ser Lys Glu Glu Cys Ile Ser Leu Thr Arg Gln         195 200 205 Tyr     <210> 43 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> primer of NATVK1-1 (SfiI) <400> 43 ttggtggcca cagcggccga tgtccactcg gacatccaga tgacccagtc 50 <210> 44 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer of NATJK-R4 (BglII) <400> 44 gaggagagat cttttgattt ccaccttggt 30 <210> 45 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Humira light chain DNA sequence <400> 45 gatgtccact cggacatcca gatgacccag agccccagca gcctgagcgc cagcgtgggc 60 gaccgggtga ccatcacctg ccgggccagc cagggcatcc ggaactacct ggcctggtac 120 cagcagaagc ccggcaaggc ccccaagctg ctgatctacg ccgccagcac cctgcagagc 180 ggcgtgccca gccggttcag cggcagcggc agcggcaccg acttcaccct gaccatcagc 240 agcctgcagc ccgaggacgt ggccacctac tactgccagc ggtacaaccg ggccccctac 300 accttcggcc agggcaccaa ggtggagatc aaa 333 <210> 46 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Humira light chain protein sequence <400> 46 Asp Val His Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser   1 5 10 15 Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly              20 25 30 Ile Arg Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro          35 40 45 Lys Leu Leu Ile Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser      50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser  65 70 75 80 Ser Leu Gln Pro Glu Asp Val Ala Thr Tyr Tyr Cys Gln Arg Tyr Asn                  85 90 95 Arg Ala Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys             100 105 110 <210> 47 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> primer of NATVH3-4 (SfiI) <400> 47 ttggtggcca cagcggccga tgtccactcg gaggtgcagc tggtgcagtc 50 <210> 48 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer of NATJH-all (NheI) <400> 48 gaggaggcta gctgaggaga cggtga 26 <210> 49 <211> 394 <212> DNA <213> Artificial Sequence <220> <223> Humira Heavy chain DNA sequence <400> 49 ggccacagcg gccgatgtcc actcgcaggt gcagctggtg gagagcggcg gcggcctggt 60 gcagcccggc cggagcctgc ggctgagctg cgccgccagc ggcttcacct tcgacgacta 120 cgccatgcac tgggtgcggc aggcccccgg caagggcctg gagtgggtga gcgccatcac 180 ctggaacagc ggccacatcg actacgccga cagcgtggag ggccggttca ccatcagccg 240 ggacaacgcc aagaacagcc tgtacctgca gatgaacagc ctgcgggccg aggacaccgc 300 cgtgtactac tgcgccaagg tgagctacct gagcaccgcc agcagcctgg actactgggg 360 ccagggcacc ctggtcaccg tctctgcagc tagc 394 <210> 50 <211> 130 <212> PRT <213> Artificial Sequence <220> <223> Humira Heavy chain protein sequence <400> 50 Gly His Ser Gly Arg Cys Pro Leu Ala Gly Ala Ala Gly Gly Glu Arg   1 5 10 15 Arg Arg Pro Gly Ala Ala Arg Pro Glu Pro Ala Ala Glu Leu Arg Arg              20 25 30 Gln Arg Leu His Leu Arg Arg Leu Arg His Ala Leu Gly Ala Ala Gly          35 40 45 Pro Arg Gln Gly Pro Gly Val Gly Glu Arg His His Leu Glu Gln Arg      50 55 60 Pro His Arg Leu Arg Arg Gln Arg Gly Gly Pro Val His His Gln Pro  65 70 75 80 Gly Gln Arg Gln Glu Gln Pro Val Pro Ala Asp Glu Gln Pro Ala Gly                  85 90 95 Arg Gly His Arg Arg Val Leu Leu Arg Gln Gly Glu Leu Pro Glu His             100 105 110 Arg Gln Gln Pro Gly Leu Leu Gly Pro Gly His Pro Gly His Arg Leu         115 120 125 Cys ser     130 <210> 51 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-F <400> 51 tgccccgacc tcgtctgcta ca 22 <210> 52 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-R (XhoI) <400> 52 ccagctcgag cggccgtcgc actcattcct ttaactcctc t 41 <210> 53 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-F (SfiI) <400> 53 tggtggccac agcggcctgc cccgacctcg tctgctac 38 <210> 54 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-R <400> 54 agctgcacct gcgagtggac atcttccttt aactcc 36 <210> 55 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-F (SfiI) <400> 55 cagggggccg tgggggcccc cgacctcgtc tgctacac 38 <210> 56 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer of IL21R-R <400> 56 tagcggccga cgcggccaat tcctttaact cctctgact 39 <210> 57 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer of TNFR2-F <400> 57 cagggggccg tgggggcctt gcccgcccag gtggcatt 38 <210> 58 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer of TNFR2-R (SfiI) <400> 58 tagcggccga cgcggccaac gtgcagactg catccatgc 39 <210> 59 <211> 1173 <212> DNA <213> Artificial Sequence <220> <223> IL21R / TNFR2 Fusion DNA sequence <400> 59 cccgacctcg tctgctacac cgattacctc cagacggtca tctgcatcct ggaaatgtgg 60 aacctccacc ccagcacgct cacccttacc tggcaagacc agtatgaaga gctgaaggac 120 gaggccacct cctgcagcct ccacaggtcg gcccacaatg ccacgcatgc cacctacacc 180 tgccacatgg atgtattcca cttcatggcc gacgacattt tcagtgtcaa catcacagac 240 cagtctggca actactccca ggagtgtggc agctttctcc tggctgagag catcaagccg 300 gctccccctt tcaacgtgac tgtgaccttc tcaggacagt ataatatctc ctggcgctca 360 gattacgaag accctgcctt ctacatgctg aagggcaagc ttcagtatga gctgcagtac 420 aggaaccggg gagacccctg ggctgtgagt ccgaggagaa agctgatctc agtggactca 480 agaagtgtct ccctcctccc cctggagttc cgcaaagact cgagctatga gctgcaggtg 540 cgggcagggc ccatgcctgg ctcctcctac caggggacct ggagtgaatg gagtgacccg 600 gtcatctttc agacccagtc agaggagtta aaggaattgc ccgcccaggt ggcatttaca 660 ccctacgccc cggagcccgg gagcacatgc cggctcagag aatactatga ccagacagct 720 cagatgtgct gcagcaagtg ctcgccgggc caacatgcaa aagtcttctg taccaagacc 780 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 840 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 900 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 960 caggaggggt gccggctgtg cgcgccgctg cgcaagtgcc gcccgggctt cggcgtggcc 1020 agaccaggaa ctgaaacatc agacgtggtg tgcaagccct gtgccccggg gacgttctcc 1080 aacacgactt catccacgga tatttgcagg ccccaccaga tctgtaacgt ggtggccatc 1140 cctgggaatg caagcatgga tgcagtctgc acg 1173 <210> 60 <211> 391 <212> PRT <213> Artificial Sequence <220> <223> IL21R / TNFR2 Fusion protein sequence <400> 60 Pro Asp Leu Val Cys Tyr Thr Asp Tyr Leu Gln Thr Val Ile Cys Ile   1 5 10 15 Leu Glu Met Trp Asn Leu His Pro Ser Thr Leu Thr Leu Thr Trp Gln              20 25 30 Asp Gln Tyr Glu Glu Leu Lys Asp Glu Ala Thr Ser Cys Ser Leu His          35 40 45 Arg Ser Ala His Asn Ala Thr His Ala Thr Tyr Thr Cys His Met Asp      50 55 60 Val Phe His Phe Met Ala Asp Asp Ile Phe Ser Val Asn Ile Thr Asp  65 70 75 80 Gln Ser Gly Asn Tyr Ser Gln Glu Cys Gly Ser Phe Leu Leu Ala Glu                  85 90 95 Ser Ile Lys Pro Ala Pro Pro Phe Asn Val Thr Val Thr Phe Ser Gly             100 105 110 Gln Tyr Asn Ile Ser Trp Arg Ser Asp Tyr Glu Asp Pro Ala Phe Tyr         115 120 125 Met Leu Lys Gly Lys Leu Gln Tyr Glu Leu Gln Tyr Arg Asn Arg Gly     130 135 140 Asp Pro Trp Ala Val Ser Pro Arg Arg Lys Leu Ile Ser Val Asp Ser 145 150 155 160 Arg Ser Val Ser Leu Leu Pro Leu Glu Phe Arg Lys Asp Ser Ser Tyr                 165 170 175 Glu Leu Gln Val Arg Ala Gly Pro Met Pro Gly Ser Ser Tyr Gln Gly             180 185 190 Thr Trp Ser Glu Trp Ser Asp Pro Val Ile Phe Gln Thr Gln Ser Glu         195 200 205 Glu Leu Lys Glu Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr Ala Pro     210 215 220 Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln Thr Ala 225 230 235 240 Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys Val Phe                 245 250 255 Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp Ser Thr             260 265 270 Tyr Thr Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys Gly Ser         275 280 285 Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg Glu Gln     290 295 300 Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu Ser Lys 305 310 315 320 Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg Pro Gly                 325 330 335 Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val Cys Lys             340 345 350 Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr Asp Ile         355 360 365 Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly Asn Ala     370 375 380 Ser Met Asp Ala Val Cys Thr 385 390

Claims (24)

Interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor, alpha (IL3RA), Interleukin 13 receptor, alpha 1 (IL13RA1), Cytokine receptor like inflammation of fragments comprising extracellular regions of at least one protein selected from the group consisting of factor 1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor (beta). A pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy comprising a fusion protein linked to a disease inhibitor or immune enhancer. The method of claim 1,
A fragment comprising an extracellular region of IL21R (Interlukin 21 receptor) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 4, pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 1,
A fragment comprising an extracellular region of VcamI (Vascular cell adhesion molecule 1) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 14, pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 1,
A fragment comprising the extracellular region of IL2RB (Interleukin-2 receptor subunit beta) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 18, a pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 1,
A fragment comprising the extracellular region of IL3RA (Interleukin 3 receptor, alpha) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 22, pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 1,
A fragment comprising the extracellular region of IL13RA1 (Interleukin 13 receptor, alpha 1) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 26, a pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 1,
A fragment comprising an extracellular region of Cytokine receptor like factor 1 (CRLF1) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 30, pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 1,
A fragment comprising the extracellular region of IL17RA (Interleukin 17 receptor A) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 34, pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 1,
A fragment comprising an extracellular region of IL2RG (Interleukin-2 receptor subunit gamma) comprises a polypeptide having an amino acid sequence of SEQ ID NO: 38, a pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 1,
A fragment comprising the extracellular region of IL10RB (Interleukin 10 receptor, beta) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 42, pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 1,
The inflammatory disease inhibitors include an extracellular region of Tumor necrosis factor receptor type 2 (TNFR2), an extracellular region of CTLA-4 (Orencia), an IL-1 antagonist, a Humira antibody, an anti CXCL10 antibody, an anti IL6R antibody, and At least one selected from the group consisting of anti-IL6 antibody, pharmaceutical composition for the treatment of inflammatory diseases or immunomodulation therapy. The method of claim 1,
The fusion protein is IL21R (Interlukin 21 receptor), VcamI (Vascular cell adhesion molecule 1), IL2RB (Interleukin-2 receptor subunit beta), IL3RA (Interleukin 3 receptor, alpha), IL13RA1 (Interleukin 13 receptor, alpha 1), CRLF1 (Cytokine receptor like factor 1), IL17RA (Interleukin 17 receptor A), IL2RG (Interleukin-2 receptor subunit gamma), and IL10RB (Interleukin 10 receptor, beta) Fragment is fused in the C-term direction or N-term direction of the inflammatory disease inhibitor or immune enhancer, Inflammatory disease treatment or immunomodulation therapy pharmaceutical composition. Interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor, alpha (IL3RA), Interleukin 13 receptor, alpha 1 (IL13RA1), Cytokine receptor like a fragment comprising an extracellular region of at least one protein selected from the group consisting of factor 1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor, beta (IL10RB), and A method for enhancing an inflammatory disease or an immunomodulatory therapeutic effect comprising a fusion protein linked to an inflammatory disease inhibitor or an immune enhancer as an active ingredient. The method of claim 13,
A fragment comprising an extracellular region of an Interlukin 21 receptor (IL21R) comprises a polypeptide having an amino acid sequence of SEQ ID NO: 4, wherein the effect of treating an inflammatory disease or immunomodulatory treatment. The method of claim 13,
A fragment comprising an extracellular region of Vascular Cell Adhesion Molecule 1 (VcamI) comprises a polypeptide having an amino acid sequence of SEQ ID NO: 14, wherein the effect of inflammatory disease or immunomodulatory treatment is enhanced. The method of claim 13,
A fragment comprising an extracellular region of Interleukin-2 receptor subunit beta (IL2RB) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 18, wherein the effect of treating an inflammatory disease or immunomodulatory treatment. The method of claim 13,
A fragment comprising an extracellular region of IL3RA (Interleukin 3 receptor, alpha) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 22, a method for enhancing an inflammatory disease or immunomodulatory therapeutic effect. The method of claim 13,
A fragment comprising an extracellular region of IL13RA1 (Interleukin 13 receptor, alpha 1) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 26. A method for enhancing an inflammatory disease or immunomodulatory therapeutic effect. The method of claim 13,
A fragment comprising an extracellular region of Cytokine receptor like factor 1 (CRLF1) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 30. A method for enhancing an inflammatory disease or immunomodulatory therapeutic effect. The method of claim 13,
A fragment comprising the extracellular region of IL17RA (Interleukin 17 receptor A) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 34, pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy. The method of claim 13,
A fragment comprising an extracellular region of interleukin-2 receptor subunit gamma (IL2RG) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 38. A method for enhancing an inflammatory disease or immunomodulatory therapeutic effect. The method of claim 13,
A fragment comprising the extracellular region of IL10RB (Interleukin 10 receptor, beta) comprises a polypeptide having the amino acid sequence of SEQ ID NO: 42, wherein the effect of inflammatory disease or immunomodulatory treatment. The method of claim 13,
The inflammatory disease inhibitors include an extracellular region of Tumor necrosis factor receptor type 2 (TNFR2), an extracellular region of CTLA-4 (Orencia), an IL-1 antagonist, a Humira antibody, an anti CXCL10 antibody, an anti IL6R antibody, and At least one selected from the group consisting of anti-IL6 antibodies. The method of claim 13,
The fusion protein is IL21R (Interlukin 21 receptor), VcamI (Vascular cell adhesion molecule 1), IL2RB (Interleukin-2 receptor subunit beta), IL3RA (Interleukin 3 receptor, alpha), IL13RA1 (Interleukin 13 receptor, alpha 1), CRLF1 (Cytokine receptor like factor 1), IL17RA (Interleukin 17 receptor A), IL2RG (Interleukin-2 receptor subunit gamma), and IL10RB (Interleukin 10 receptor, beta) Fusing the fragments in the C-term direction or N-term direction of an inflammatory disease inhibitor or an immune enhancer, a method for enhancing the inflammatory disease or immunomodulatory therapeutic effect.

Images