KR20130009478A - Nanocomposites comprising with calcium phosphate adsorbed modified carbon nanotubes and degradable polymer and method of preparing thereof - Google Patents

Abstract

PURPOSE: A nanocomposite is provided to increase the mechanical tensile strength and to improve the cell proliferation and the differentiation of osteoblast by using calcium phosphate nano particles adsorbed with modified carbon nanotubes and a biodegradable polymer. CONSTITUTION: A nanocomposite comprises calcium phosphate nano particles in which modified carbon nanotubes(CNT) are adsorbed, wherein CNT is represented by the formula 1: [CNT-((CH_2)_aO)_bH]^+[Y]^-, and a biodegradable polymer. In the formula 1, [Y]^- represents anion, a is integer of 2ΔaΔ6, and b is integer of 1ΔbΔ50. The carbon nanotubes are single-wall carbon nanotubes, double-wall carbon nanotubes or multi-wall carbon nanotubes. The calcium phosphate is any one selected from hydroxyapatite, oxy apatite, dicalcium phosphate, tricalcium phosphate, tetracalcium phosphate, calcium metaphosphate and their mixture.

Description

Nanocomposites comprising with calcium phosphate adsorbed modified carbon nanotubes and degradable polymer and method of preparing SUMMARY

The present invention is calcium phosphate nanoparticles adsorbed modified CNT; And it relates to a nanocomposite comprising a biodegradable polymer and a preparation method thereof.

The replacement and regeneration of human hard tissue with medical materials is a widely used therapeutic technique in ophthalmology and dentistry. Bone and tooth defects are often treated by treatment with bioceramic particulates or degradable polymers. In addition, when bone tissue is fractured or removed by injury or trauma, bone fixative fluid is used to restore physical and biological function. In most cases, the bone fixer consists of a titanium alloy and stainless steel. However, metals are inherently absorptive and therefore require secondary action if problems occur in the implant site.

Recently, biodegradable polymers such as PLA have been introduced as bone substitutes. PLA is an FDA-approved substance and is generally available for large tissue areas, including bone. And it can be easily produced as a composite-shaped implant through a thermally molded polymer manufacturing process. However, in terms of mechanical strength, the use of biodegradable polymers (PLA) is still a problem, and hydroxyapatite, tricalcium phosphate, calcium carbonate and life are needed to improve the properties of the polymer material. It has been proposed to combine bioactive ceramic materials such as glass granules. The addition of such bioactive ceramic materials can neutralize the reduced pH associated with polymeric acid products, reduce material degradation and enhance mechanical properties. In addition, the action of the complex in cells by in vitro experiments shows increased activity in cell proliferation and osteoblast differentiation.

There are tissue organs that function while absorbing mechanical shocks such as blood vessels and cartilage in vivo, and studies of synthetic polymers having elasticity and resilience as biomaterials to replace such tissue organs have begun. Highly elastic biodegradable polymers include poly (lactide-caprolactone) (PLCL), which is a block copolymer of PLA and poly (carprolactane) (PCL). When using such a biodegradable polymer as an implant can overcome the disadvantage that the deformation is impossible due to the very strong mechanical properties of the metal implant. However, there was a problem that the strength is weak. Therefore, the research on the development of a material having a high strength and easy deformation.

The present inventors, while studying to solve the problem of weak strength and biocompatibility when using the biodegradable polymer, when used together with carbon nanotubes and calcium phosphate, not only increases the tensile strength but also cells in cells The present invention was completed by confirming that activity is increased in proliferation and differentiation.

The present invention provides a carbon nanotube, calcium phosphate and a nanocomposite having increased mechanical tensile strength, increased cell proliferation and osteoblast differentiation using a biodegradable polymer.

In addition, the present invention is to provide a method for producing the nanocomposite.

In order to solve the above problems, the present invention is calcium phosphate nanoparticles adsorbed by the modified CNT represented by the formula (1); And it provides a nanocomposite comprising a biodegradable polymer.

[Formula 1]

[CNT-((CH ₂ ) _a O) _b H] ⁺ [Y] ^-

(In the formula 1, [Y] ^- represents an anion,

An integer of 2 ≦ a ≦ 6,

Is an integer of 1≤b≤50)

As used herein, the term “CNT” refers to carbon nanotubes, where one carbon atom forms sp ² bonds with three other carbon atoms, has a hexagonal honeycomb structure, and has a diameter of several nanometers to several tens of microns. Mean material that is meters. CNT was added to the biodegradable polymer to improve the tensile strength of the polymer by biodispersing using the excellent mechanical properties of the CNT. In addition, when CNT is used as it is, the aggregation phenomenon is large and the hydrophobicity of the surface is difficult to disperse uniformly in the polymer matrix, and the interfacial interaction between CNT and the polymer is weak so that the application of the polymer / CNT composite is limited. .

(c 는 1≤c≤5의 정수)를 첨가하여 반응시켜서 다수의 -((CH₂)_aO)_bH)기가 CNT 몸체에 공유 결합 방식으로 결합되게 하고 그 후 CNT 몸체는 비편재화된 양전하로 하전되어 상대음이온[Y]^-과 이온 결합방식으로 결합되어 제조된다.
The term "modified CNT" used in the present invention is an anion bonded to the positively charged alkylated carbon nanotubes by alkylating pure CNTs. Specifically, the modified CNT of Chemical Formula 1 is pure CNT.

(c is an integer of 1 ≦ c ≦ 5) to react so that a large number of — ((CH ₂ ) _a O) _b H) groups are covalently bonded to the CNT body, and then the CNT body is delocalized positive charge. is charged to a counter anion [Y] ^- it is made in combination with the ionic bond method.

Carbon nanotubes that can be used in the present invention may be used single-walled carbon nanotubes, double-walled carbon nanotubes or multi-walled carbon nanotubes, preferably multi-walled carbon nanotubes.

Calcium phosphate used in the present invention refers to a compound composed of Ca, P, O and H as a non-metal inorganic material, and there are various calcium phosphate salts depending on the combination ratio of elements. Calcium phosphate is a biomaterial having excellent biocompatibility, in which some calcium phosphates bind directly to hard tissues without inflammatory reactions or fibrous tissues because the mineral components of hard tissues are chemically similar.

Calcium phosphate that can be used in the present invention may be any one selected from the group consisting of hydroxyapatite, oxy apatite, dicalcium phosphate, tricalcium phosphate, tetracalcium phosphate, calcium metaphosphate and mixtures thereof, but is not limited thereto. It doesn't work.

In the present invention, the biodegradable polymer is a generic term for a polymer that decomposes itself in vivo or in a natural environment, and particularly, refers to a biodegradable polymer that decomposes in vivo for medical purposes. Biodegradable polymers that can be used in the present invention include poly (glycolic acid), polylactic acid, poly (D, L-lactic acid-co-glycolic acid), poly (L-lactide-co-D, L-lactide), Any one selected from the group consisting of poly (hydroxybutyrate), poly (hydroxy valerate), poly (valerolactone), poly (caprolactone), polydioxanone, copolymers thereof and mixtures thereof It may be used, but is not limited thereto.

In the chemical 1 [Y] ^- it is to mean an anion. In one example _{^{N 3 -, Br -, Cl}} -, F -, I -, SbF 6 -, fullerene ^{_{anion, CHB 11 H 12 -, HS}} -, OCN -, SCN -, CN -, PF 6 -, NTf 2 - _{^{, OTf -, BF 4 -,}} CO 3 2 -, HCO 3 -, OH -, NO 3 -, NO 2 -, PO 4 3 -, HPO 4 2 -, H 2 PO 4 -, SO 4 2 -, HSO ^{4. R-COO -, R-SO} 4 - ( where, R is each independently a hydroxyl group or substituted with one or more functional groups comprising an amino group or unsubstituted represents an unsubstituted alkyl group or an aryl _{^{group), C 2 O 4 2 -}} , HC ₂ O ^{4 -} or anion derived from RNA, anion derived from DNA, anion derived from protein, and anion derived from cation exchange resin. Preferably, Cl ^- means ^- or SbF _6.

In the nanocomposite, the content of the modified CNT is preferably 0.01 wt% to 0.5 wt% with respect to the nanocomposite.

In addition, in the nanocomposite, the content of the modified CNT is preferably 0.10% to 1% by weight based on the calcium phosphate nanoparticles.

In addition, in the nanocomposite, the content of calcium phosphate is preferably 10% by weight to 50% by weight based on the biodegradable polymer. In particular, in order to increase the tensile strength, it is preferably 30% by weight.

The greater the content of CNT in the weight ratio may be better in terms of strength, but too much (more than 1%) may not be uniformly adsorbed on the calcium phosphate particles, so the strength may be lowered after the nanocomposite is formed in the future. In this case (less than 0.1%) the effect may be negligible. In addition, the content of calcium phosphate is higher than the polymer in terms of improving bioactivity, but too much (more than 50%) is not easy to disperse the calcium phosphate particles, the strength is lowered.

The nanocomposite according to the above has a form in which calcium phosphate nanoparticles on which modified carbon nanotubes are adsorbed are uniformly dispersed in a biodegradable polymer, and when only the existing biodegradable polymer is used, only calcium phosphate is used in the biodegradable polymer. Compared to the case of containing it, the tensile strength is improved and the activity in the cell proliferation and differentiation in the cell is increased. The shape of the composite is preferably selected from fibers, films, pellets and bulks having a three-dimensional shape.

In addition, the present invention comprises the steps of preparing a modified CNT solution by adding a solvent to the modified CNT of the formula (1) and then stirred or sonicated (step 1); Mixing the modified CNT solution with calcium phosphate nanoparticles to produce a modified CNT-adsorbed calcium phosphate nanoparticle solution (step 2); Mixing the modified CNT-adsorbed calcium phosphate nanoparticle solution with a biodegradable polymer (step 3); And it provides a method for producing a nanocomposite comprising the step (step 4) of removing the solvent from the mixture.

[Formula 1]

[CNT-((CH ₂ ) _a O) _b H] ⁺ [Y] ^-

(In the formula 1, [Y] ^- represents an anion,

An integer of 2 ≦ a ≦ 6,

Is an integer of 1≤b≤50)

The solvent used in step 1 is not limited as long as it is a solvent capable of dispersing CNT, preferably water, methanol, ethanol, trifluoroethanol, propanol, isopropanol, tetrahydrofuran, dichloromethane, chloroform, 1, Any one selected from the group consisting of 4-dioxane, acetone, ethyl acetate, methyl methacrylate, ethylene glycol, dimethylformamide, and mixtures thereof can be used. In particular, tetrahydrofuran is preferable. The solvent is used in 1 to 100 ml per 1 ml of modified CNT. If the content of the solvent is less than the above range, there is a problem that the dispersion is prevented by agglomeration between the modified CNTs during the dispersion process, on the contrary, if the content exceeds the above range, it takes a long time in the subsequent removal process, which is uneconomical.

In addition, the carbon nanotubes may use single-wall CNT, double-wall CNT or multi-wall CNT.

In step 2, the modified CNT solution and calcium phosphate nanoparticles are mixed to prepare a calcium phosphate nanoparticle solution to which the modified CNT is adsorbed. Calcium phosphate is added as shown in FIG. The modified CNTs are adsorbed in the shape of branches.

In step 3, the modified CNT-adsorbed calcium phosphate nanoparticle solution is mixed with a biodegradable polymer, and it is preferable to mix 10 mg to 500 mg of the biodegradable polymer with respect to 1 ml of the modified CNT solution.

Step 4, the drying conditions may vary depending on the solvent used, it is preferable to be carried out within a short time so that phase separation does not occur. In particular, the step of removing the solvent from the mixture is preferably carried out by drying for 10 minutes to 2 days at 25 ℃ to 50 ℃.

At this time, the drying method is not particularly limited and may be a drying method known in the art. Typically, room temperature atmospheric pressure drying, hot air drying, reduced pressure drying, freeze drying, spray drying, rotary evaporation drying is possible. Drying conditions may vary depending on the solvent used and are preferably carried out in a short time so that no phase separation occurs.

Calcium phosphate nanoparticles adsorbed with modified CNTs according to the present invention; And a nanocomposite comprising a biodegradable polymer, the mechanical tensile strength is increased compared to the case of using only the existing biodegradable polymer or a biodegradable polymer-calcium phosphate nanoparticle complex, the proliferation of cells and osteoblasts Since the degree of differentiation increases, it can be usefully used as a biomaterial.

Figure 1 schematically shows the step of preparing a nanocomposite of the present invention.
Figure 2 shows a high resolution SEM image of the nanocomposite according to an embodiment of the present invention.
Figure 3 shows a high resolution SEM image of PLA and PLA nanocomposites, where (a) shows PLA, (b) shows PLA-CP, (c) shows PLA-CPNT1, and (d) shows PLA-CPNT2. .
Figure 4 shows the chemical spectrum of the nanocomposite according to an embodiment of the present invention, (a) shows the FTIR, (b) shows the Raman spectrum.
Figure 5 shows the cell proliferation effect in the nanocomposite according to an embodiment of the present invention, (a) is a graph showing the degree of cell proliferation after 3 days, 7 days, 14 days, (b) is 7 It shows the growth pattern of osteoblasts after one day.
6 is a graph showing the degree of cell activity after 7 days and 14 days.
Figure 7 shows the gene expression profile of PLA and its nanoparticle complexes after 7 days as measured by qRT-PCR, for collagen type I (Col I), OPN, Bone sialoprotein (BSP), Osteocalcine (OCN) Target gene expression is shown.
Figure 8 shows Western blot analysis of bone-related protein expression, including collagen type I and ALP, GAPDH, where GAPDH was used as a control.

Hereinafter, preferred embodiments and experimental examples are provided to facilitate understanding of the present invention. However, the following Examples and Experimental Examples are provided only to more easily understand the present invention, and the contents of the present invention are not limited by the Examples and Experimental Examples.

Example  1 to 2: polymer CNT Preparation of Calcium Phosphate Nanocomposites

1-1. Reformed  Carbon nanotubes ( mCNT _S Synthesis of

The original multi-walled carbon nanotubes (pCNT _S ) (ILJIN Nanotech) synthesized by chemical vapor deposition were subjected to anion exchange for 3 hours and ionization reforming for 30 minutes. Accordingly, a positively charged carbon nanotube derivative [CNT] ⁺ [X] ^- [X = SbF ₆ or Cl] (here described as mCNT (X)) was prepared. In summary, dichloromethane was added from argon (Ar) gas, and a suspension of pCNT _S and [bmin] [Sb ₂ F ₁₁ ] (bmin = 1-butyl-3-methylimidazolium-based ionic liquids) were mixed. To the suspension, tetrahydrofuran (THF) was added and sonicated for 15 minutes. After quenching with aqueous solution, the CNT-SbF ₆ filtered through the Teflon membrane was produced and washed with acetone and dichloromethane. After drying in vacuo CNT-SbF ₆ and NaCl were added to the ethanol / water mixture. The mixture was sonicated at 25 ° C. for 3 hours to obtain Cl-exchanged CNT _S. The resulting particles were filtered through a Teflon membrane and washed with water, acetone, and dichloromethane. And dried in vacuo to obtain ionically modified CNTs. The product produced in this way is called "mCNT". The element of mCNT was analyzed by FLASH EA 1112 (Thermo Elemental) and found to have 90.8% carbon, 0.33% hydrogen, and 0.1% nitrogen. It is not modified when compared to the unmodified pCNT pCNT _{S S} is has been found that the nitrogen of 93.8% carbon, hydrogen of 0.14%, and 0.1%. Using the MALDI TOF MS (Matrix-assisted laser desorption / ionization time-of-flight mass spectroscop, Voyager-DE STR), the ratio m / e peaks of 34.97 (100%) and 36.97 (32%) isotopes were generated. It was found that Cl is present in mCNTs.

Tricalcium phosphate particles on a CP (Ca ₃ (PO ₄ ) ₂ , B-form) bioceramic phase were purchased from Merck and used after sintering at 900 ° C. for 1 hour. Poly (L-lactic acid) (PLLA, Resomer L206S) was purchased from Boehringer lngelheim. All other compounds including organic solvents were purchased commercially and used without purification.

1-2. mCNT - CP  Nanoparticles and PLA  Preparation of Nanoparticle Composite

A homogeneous multiwall CNT solution was prepared by dissolving mCNT (50 mg) in THF solvent (100 mL) under ultrasonic vibration for 3 minutes. 10 grams of CP particles were then slowly added to 20 and 50 ml of mCNT / THF solution. Meanwhile, CNT molecules were adsorbed onto CP nanoparticles and precipitated in the remaining clean THF solvent. This process was defined as mCNT-CP, a calcium phosphate nanoparticle adsorbed with homogeneous modified carbon nanotubes. The amount of mCNTs for CP was 0.1 and 0.25% by weight. 0.1 wt% and 0.25 wt% mCNT-CP nanoparticles are described herein as CPNT1 and CPNT2, respectively. mCNT-CP nanoparticles were separated from the solvent, washed several times with acetone and dried at ambient conditions.

10 g of PLA was also dissolved in 50 ml chloroform solvent. Thereafter, 10 g of CPNT1 and CPNT2 were mixed with the prepared PLA / chloroform solution with stirring at 50 ° C. After fast extraction of the solvent in ethanol, PLA-CP-mCNT tri-element nanoparticle complexes containing 0.05 and 0.125 wt% (relative to nanoparticle complex) mCNTs were obtained without agglomeration of the two phases. The final nanoparticle composites described here as PLA-CPNT1 and PLA-CPNT2 are disk type specimens (1 × 10 mm ^{2 for} thickness × hotplate and 3 × 5 mm ² It was prepared in a 180 ℃ hot plate to form. For comparison, the PLA-CP composite without mCNT _S was prepared by using CP nanoparticles instead of CP nanoparticles on which carbon nanotubes were adsorbed. Such complexes are described herein as PLA-CP. The amount of material used to produce the sample is listed in Table 1.

Of the material used for the preparation of the sample Sheep and  The name of the sample The name of the sample CP (+ mCNT ) / PLA ( wt Of wt ) mCNT / CNT ( wt Of wt ) PLA 0 0 PLA - CP One 0 PLA - CPNT1 One 0.0025 PLA - CPNT2 One 0.0010

Experimental Example  1: Measurement Method in Property Analysis

The shape of the sample was measured by scanning electron microscopy (SEM, Hitachi, Japan). High resolution SEM images were obtained using JEM2100F (JEOL, Tokyo, Japan). Raman spectra of the nanocomposite samples were obtained using Nd-YAG-laser (1064 nm stimulus wavelength). All samples were analyzed in the dry state. FT-IR was measured using a PerkinElmer Spectrum GX Spectrometer (MA). KBr, consisting of the sample and monomorphic, was stored in a dryer using a silica-gel desiccant. The FT-IR spectrometer was measured in transmission mode and in the spectrum (wavelength range 500-4000 cm ^-1 ). Pure monoform KBr discs were used as background samples and all data was obtained in the background spectral state. Thermogravimetric analyzer (TGA) was measured using a Seiko Exstar 6000 (TG / DTA6100; Seico, Japan) at 10 ° C./mim heating rate in the temperature range 20-800 ° C. in air. Heat-presses and molds (thickness × diameter = 3 × 5 mm ² and 1 × 10 mm ² ) equipped with two heat plates (Carver 3851-0) were prepared to prepare sample discs. The tensile strength properties of the samples were measured by indirect tensile strength (DTS) test using Instron 3344 at room temperature. Samples (size 3 × 5 mm ² ) were loaded at a speed of 5 mm / min and the DTS values were measured. All four samples were measured under each condition (n = 4).

Experimental Example  2: in cell growth in vitro  Measurement method in analysis

Murine-derived pre-osteoblast cell line (MC3T3-E1) is used to measure cellular responses to nanoparticle complexes, PLA-CP, PLA-CPNT1, and PLA-CPNT2 It was. Sample discs were placed in the wells of each 24-well plate. Then sterilized with 70% ethanol. The cells were then seeded at 4 × 10 ⁴ cell density per sample. Α-minimal essential medium (α-MEM) supplemented with 10% fetal vovin serum (FBS) and 1% penicillin / streptomycin at standard cell assay conditions (37 ° C. temperature, 5% CO ₂ and 95% humidity in air) Cultured up to 14 days in standard cell conditions. The cell monomorphic form of the sample was treated with gold coating and hexamethyldisilazan after attaching the cells, dehydrated by sequential order of ethanol treatment, and images were measured by SEM. Cell viability was measured by measuring viable cells of mitochondrial activity using the MTS method. CellTiter 96 Aqueous One solution (Promega) was added for cell culture. It was then measured by color quantitative analysis at an absorbance of 490 nm. Three replicated samples were measured at each condition (n = 3).

Experimental Example  3: Research Method for Bone Cell Differentiation

Alkaline phosphatase (ALP) activity was measured to assess cell differentiation into osteoblasts in response to nanocomposites. In particular, osteogenic elements comprising 10 mM ß-glycerol phosphate and 50 μg / ml ascorbic acid were supplemented with standard culture environment (10% FBS and 1% penicillin / streptomycin) to induce cell differentiation into osteoblasts. α-MEM). Cells cultured in the sample for 7 to 14 days were used for ALP determination. At least three samples were collected to ensure sufficient protein amount for analysis. Cell pellets were collected, treated with 0.1% Triton X-100 and split by continuous cooling and thawing. The total protein content was then analyzed using a commercial DC protein analysis kit (BioRad). For the enzymatic reaction, according to the manufacturer's instructions (Sigma), each sample was added to an ALP reaction environment containing p-nitrophenyl phosphate as substrate. The level of enzyme product, p-nitrophenol, was determined based on the change in 405 nm absorbance. ALP activity levels were excluded from protein standard curves. This was obtained using bovine serum albumin (Sigma). Three replicate samples were measured at each condition (n = 3).

Cell gene expression profiles in the growth of nanocomposites were measured by polymerase chain reaction (qRT-PCR) quantitative real time. Seven days after cell seeding, total RNA was extracted from each sample using the Qiagen RNeasy Mini kit (Qiagen, South Korea). Next, 2 μg of total RNA was used to perform the reverse transcription enzyme reaction. The obtained DNA was used as a template for PCR. It was measured by osteoblast differentiation markers including osteopontin (OPN), bone cyaroprotein (BSP), collagen type I (Col I), and osteocalcin (OCN). Array and inverted primers were designed to use cDNA arrays available from GeneBank. And ß-actin was used as a housekeeping gene to normalize RNA expression. Real-time PCR was measured using a SYBR Green PCR kit (Quantace, GCbiotech, Netherlands) in a spectrofluorometric thermal cycler (Rotor-Gene 3000, Corbett Research, Korea). After real-time PCR, Ct values were used to measure the effects of various genes associated with GAPDH. This was used as internal regulator (ΔCt = Ct gene-Ct ß-actin). MRNA in each sample was calculated by ΔΔCt (ΔCt gene-ΔCt control) measurements compared to the other. Each measurement was performed three times (n = 3). Primer sequences of the genes are shown in Table 2.

Actual time PCR for someone primer sequence template Inverse Col  I 5'- tgttcgtggttctcagggtag -3 ' 5'- ttgtcgtagcagggttctttc -3 ' BSP 5'- ataggcaacgagtacaacac -3 ' 5'- gtatccagatgcaaagacag -3 ' OCN 5'- tgaggaccctctctctgctc -3 ' 5'- gggctccaagtccattgtt -3 ' OPN 5'- atctgatgagtccttcactg -3 ' 5'- gggatactgttcatcagaaa -3 ' ß- actin 5'- gctacgagctgcctgacgg -3 ' 5'- gaggccaggatggagcc -3 '

Bone ALP in the expression of collagen type 1 and cells cultured for 21 days in one of PLA, PLA-CP, PLA-CPNT1 was measured protein levels by Western blot analysis. Briefly, extraction of cultured cells was prepared with cell lysis RIPA buffer. Protein samples were digested in 10% sodium dodecyl sulfate-poly-acrylamide gel. Transblotting was performed on nitrocellulose membranes limited to 2.5% bovine serum albumin in Tris-buffered saline containing 0.1% Tween-20. The membrane was placed in a plastic bag for blotting with the primary antigen (anti-mouse collagen antigen; 1: 100, anti-mouse bone ALP antigen; 1: 100). All antigens were purchased from Lowa University's Development studies Hybridoma Bank. Blots were measured using horseradish peroxidase-conjugated secondary immunoglobulin G and chemiluminescent ECL sensitizers (Pierce, Rockford) incubated with enhanced immune response bands.

Experimental Example  4: statistical analysis

Data obtained through mechanical and cellular tests are represented by mean and standard deviation. Statistical analysis of the data was performed by the method of one-way analysis of variance (ANOVA). Bonferroni correction and major levels are p <0.05 or p <0.01.

Results and review

One. hybrid  Nano powder and PLA  Nanocomposite

Multi-walled carbon nanotubes (MWNT _S ) are very hydrophobic at initial conditions. Therefore, it is difficult to disperse in most experimental solvents. As a result, the use of CNT _S containing polymer compositions has been limited. In order to overcome this drawback, a new type of CNT _S was synthesized by chemical modification by the method described in the Examples. 1 shows a manufacturing process for producing mCNT _S- CP adsorbed particles. And furthermore, the manufacturing process of PLA nanocomposite is shown. Initial CNT _S (pCNT _S ) is converted to modified CNT _S (mCNT (X)). X is an anion which shows SbF ₆ or Cl here. CNT _S Side To maintain a positive charge To modify, initially activated THF Lewis-acidic ionization solution [bmin] [Sb ₂ F ₁₁ ] ([bmim] = 1-butyl-3-methylimidazolium), which is a highly charged substance To form a thermodynamically stable THF solvent ring. Next, CNT _S in activated THF was alkylated to provide a positively charged surface in cooperation in the presence of SbF ₆ center-anions. It can be exchanged for other ions for specific use. Solubility can be adjusted according to the range of a solvent.

Due to the surface ionization modification, the new m-CNT _S simply dissolves in chloroform, dichloromethane, and THF organic solvents. This is a common organic solvent used for the dissolution of biopolymers such as PLA. Therefore, it promotes the fibrosis of the biopolymer-CNT _S nanocomposite. In this study, a very homogeneous Cl-exchange CNT _S (mCNT [Cl]) was used in THF to prepare nanoparticles complexed with CP. CNT _S dissolved in THF was stable without the coagulation action of CNT _S. The sediment settled down and this stabilization was observed for several months. CP-CNT _S composite nanoparticles were prepared simply by stirring the CP nanoparticles in a uniform mCNT / THF solution. During this process, well dispersed ultrafine carbon nanotube molecules induced adsorption on the surface of the CP nanoparticles. The resulting composite nanoparticles containing two different concentrations of mCNTs 0.1 and 0.25% by weight, nanoparticles clearly distinguishable from pure CP particles based on their color, are here defined as CPNT1 and CPNT2, respectively. Thus, the production of PLA nanocomposite containing CPNT _S was carried out in order to facilitate the introduction of _S nanoparticles CPNT PLA- in chloroform solution. After extracting the solvent from ethanol, the solidified nanoparticles were cast onto discs.

Although CPNT change in the color of the composite nanoparticles are representative of the existence of _S mCNT However, mCNT _S is difficult to notice quickly because the concentration of mCNT extremely low (0.1 and 0.25% by weight). The high resolution of the SEM image makes it easier to see its presence and the degree of complication of mCNT _S is shown in FIG. 2 (mCNT _S is indicated by the arrow). mCNT molecules were well mixed with CP nanoparticles (hundreds of nanometers).

The composite CPNT nanoparticles were mixed with PLA polymer to prepare nanocomposites. The micro-nano-structure of the nanocomposite of the specimen to reveal the internal morphology is shown in FIG. 3. Although microscopic particle steps were observed in PLA-CP, the SEM cross-sectioned form of the CP-added complex [PLA-CP Figure 3 (b)] was quite similar to pure PLA [Figure 3 (a)]. However, the form of the CPNT-added complex [PLA-CPNT1 and PLA-CPNT2, FIG. 3 (c, d)] differs significantly from the complex mentioned above. This shows the nanostructure of the fiber and contributes to the presence of CNTs. Based on the image of FIG. 3, no clumps of CPNT nanoparticles are seen and the nanoparticles appear to be uniformly dispersed on the PLA.

2. Preparation of Nanoparticles

The structural properties of the resulting nanoparticles are measured by FT-IR and Raman spectra. The FT-IR spectrum of the PLA-CPNT2 nanocomposite is shown as a representative example in Figure 4 (a). The 1750-1735 range and the 1300-1100 cm ⁻¹ strong C═O and CO stretching bands were observed to react with the ester group of PLA, respectively. In addition, P = O and PO is a group of phosphate 1300-1240 cm ^- have a few of the band within the range of 1088-725 cm ^-1 has a very strong band at ^1. Raman spectroscopy was also introduced and shown in FIG. 4 (b). ca. The nature of the peaks of 1290 (D band) and 1600 (G band) clearly demonstrates the presence of mCNT _S in PLA-CPNT2 nanocomposites.

As summarized in Table 3 as a rigid cell implant material, mechanical properties are one of the most important properties in determining the suitability of newly discovered PLA-CPNT nanocomposites. Thus, the DTS of the material was measured at room temperature and summarized in Table 3. In terms of pure PLA, the addition of CP (10, 20, 30, 40 and 50% by weight) significantly increased the tensile strength. When CPNT composite nanoparticles were added PLA instead of CP (10, 30, 50% by weight), the strength increased even more. Strength was maintained or improved. In particular, in the case of CPNT2, the tensile strength increased continuously due to the increase in the amount of nanoparticles added. And the highest tensile strength value was obtained at 50% of CPNT2.

PLA  Tensile Strength of and its Nanocomposites mCNT  content( CP %) CP  content ( PLA %) The tensile strength , Average( std ), MPa  % Increase (w.r.t. PLA ) PLA 0 0 6.0 (0.9) - PLA - CP



0 10 11.9 (2.5) * 198 0 20 12.5 (2.4) * 208 0 30 9.5 (0.5) * 158 0 40 11.3 (2.4) * 188 0 50 10.3 (3.0) ** 172 PLA -CPNT1 ( low mCNT )

0.0010 10 10.9 (2.2) * 182 0.0010 30 14.0 (0.4) ** ++ 233 0.0010 50 11.7 (0.7) ** 195 0.0025 10 10.4 (0.4) * 173 0.0025 30 14.3 (1.1) ** ++ 238 0.0025 50 15.9 (0.9) ** + 265 ANOVA Statistical analysis by * p <0.05 and ** p <0. From 01 PLA For and at + p, 0.05 and ++ p <0.01 PLA - CP Showed significant differences in nanocomposites for.

As a result, nanoparticles adsorbing modified CNTs containing CP increased by 50% were effectively dispersed in PLA matrix to increase the strength of PLA polymer. In addition, CNT adsorbed CP nanoparticles did not reduce the reinforcement effect. On the other hand, the addition of CNT molecules to CP nanoparticles enhanced the strength of the nanocomposites and this effect is believed to be promoted by well-equalized CNT _S through the initial CP nanoparticles. And these are more dispersed in the PLA matrix.

3. In vitro  Cell growth and osteoblast differentiation

In vitro biological phenomena of the nanocomposites of the present invention are determined through cell proliferation and osteoblast differentiation. MC3T3-E1 cells are cultured in PLA and CP or CPNT _S nanocomposites and cell growth levels are measured by MTS method. This is shown in Fig. 5 (a). Initial cell proliferation occurred within three days and was significantly higher than PLA for nanocomposites. In particular, the growth of PLA-CPNT1 was significantly higher than that of PLA-CP. Cell growth in PLA-CPNT1 was still high when compared to the other groups by incubation for 7-14 days. On day 7, there was a slight decrease for PLA-CPNT2. As illustrated in FIG. 5 (b), the sample on day 7 grew in cell morphology. And most of them completely covered the underlying material and showed excellent cell viability. Based on these results, the addition of CP-based nanoparticles to PLA is believed to have a positive effect on cell viability. And the presence of CNT in the nanocomposite showed no cytotoxic effect. However, CNT _S (0.05%) stimulated cell regeneration ability instead of low concentration.

Osteoblast differentiation of cells in nanocomposites was measured based on ALP activity during incubation up to 14 days (FIG. 6). ALP steps were measured by averaging the total protein amount. The results showed a time-dependent ALP improvement. In addition, ALP activity was significantly increased at both incubation times due to the addition of CP or CPNT nanoparticles to PLA. The increase in ALP was highest when CPNT1 was added.

Gene expressions associated with bone cells comprising collagen type I (Col I) were amplified as shown in FIG. 7 using qRT-PCR, OPN, BSP, and OCN. Col I and OPN are not much stimulated for most nanocomposites. BSP and OCN were rated significantly higher for the nanocomposites. Especially in terms of PCL-CPNT1. BSP and OCN are specific genes that include the final stages of bone cell differentiation and mineralization. Their significant up-regulation of the PLA-CPNT1 nanocomposites provides a potential substrate for inducing cells undergoing osteoblast development. Protein expression of collagen was determined as shown in Figure 8 by Western blot analysis of type I and ALP. Cells were incubated for 21 days with either PLA or PLA-CP or PLA-CPNT1. The cellular structure was similarly observed for collagen type I based on the sample group.

Protein changes and gene expression levels demonstrate the positive role of CP-CNTS mixed nanoparticles as inclusion agents in biopolymer PLA. Use of CNT-added nanocomposites in solid cell implant devices, in bone fixation. Only small concentrations of CNTS (0.05%) greatly enhance the expansion and differentiation of osteoblasts. CNT _S added to PLA should change the nanostructure on the substrate. As revealed by high resolution electron microscopy, CNT molecules associated with the PLA matrix are initially cell attached and possibly grown and differentiated. Although the molecular mechanisms are not fully understood, the role of nanostructured materials has been described in recent papers, particularly in improving the growth and adsorption capacity of osteoblasts, associated with CNT _S. The electrical conductivity of the substrate for CNT _S is another parameter that can alter another possible cellular function. The membrane potential and protein adsorption capacity of the cells are very high. Although accurate mechanisms for these behaviors are needed for better investigation. Ongoing research involves in vivo cellular responses in promoting the application of these new types of nanocomposites.

Claims (14)

Calcium phosphate nanoparticles having a modified CNT adsorbed by Formula 1; And
Nanocomposites containing biodegradable polymers:
[Formula 1]
[CNT-((CH ₂ ) _a O) _b H] ⁺ [Y] ^-
(In the formula 1, [Y] ^- represents an anion,
An integer of 2 ≦ a ≦ 6,
Is an integer of 1≤b≤50)
The nanocomposite of claim 1, wherein the CNTs are single-walled CNTs, double-walled CNTs, or multi-walled CNTs.
According to claim 1, wherein the calcium phosphate is any one selected from the group consisting of hydroxyapatite, oxy apatite, dicalcium phosphate, tricalcium phosphate, tetracalcium phosphate, calcium meta phosphate and mixtures thereof Complex.
2. The method of claim 1, wherein [Y] ^- is ^{_{N 3 -, Br -, Cl}} -, F -, I -, SbF 6 -, fullerene ^{_{anion, CHB 11 H 12 -, HS}} -, OCN -, SCN -, ^{_{CN -, PF 6 -, NTf}} 2 -, OTf -, BF 4 -, CO 3 2 -, HCO 3 -, OH -, NO 3 -, NO 2 -, PO 4 3 -, HPO 4 2 -, H 2 ^{_{PO 4 -, SO 4 2 -}} , HSO 4-. ^{R-COO -, R-SO} 4 - ( where, R is each independently a hydroxyl group or substituted with one or more functional groups comprising an amino group or unsubstituted represents an unsubstituted alkyl group or an aryl ^{_{group), C 2 O 4 2 -}} , HC ₂ O ^{4 -,} or an anion derived from an RNA, a DNA derived from the anion, the anion and the nanocomposite, wherein the selected one from the group consisting of an anion derived from the cation exchange resin derived from the protein.
The nanocomposite of claim 1, wherein the content of the modified CNT is 0.05 wt% to 0.125 wt% with respect to the nanocomposite.
The nanocomposite of claim 1, wherein the modified CNT is present in an amount of 0.10 wt% to 0.25 wt% based on the calcium phosphate nanoparticles.
The composite according to claim 1, wherein the calcium phosphate content is 10 wt% to 50 wt% with respect to the biodegradable polymer.
The method of claim 1, wherein the biodegradable polymer is poly (glycolic acid), poly (L-lactic acid), poly (D, L-lactic acid-co-glycolic acid), poly (L-lactide-co-D, L -Lactide), poly (hydroxybutyrate), poly (hydroxy valerate), poly (valerolactone), poly (caprolactone), polydioxanone, copolymers thereof and mixtures thereof Nanocomposite, characterized in that any one selected.
Preparing a modified CNT solution by adding a solvent to the modified CNT of Formula 1, followed by stirring or sonication;
Mixing the modified CNT solution with calcium phosphate nanoparticles to produce a modified CNT-adsorbed calcium phosphate nanoparticle solution;
Mixing the modified CNT-adsorbed calcium phosphate nanoparticle solution with a biodegradable polymer; And
Removing solvent from the mixture
Method for producing a nanocomposite comprising:
[Formula 1]
[CNT-((CH ₂ ) _a O) _b H] ⁺ [Y] ^-
(In the formula 1, [Y] ^- represents an anion,
An integer of 2 ≦ a ≦ 6,
Is an integer of 1≤b≤50)
The method of claim 9, wherein the CNT is a single wall CNT, a double wall CNT, or a multi wall CNT.
The method of claim 9, wherein the biodegradable polymer is poly (glycolic acid), poly (L-lactic acid), poly (D, L-lactic acid-co-glycolic acid), poly (L-lactide-co-D, L -Lactide), poly (hydroxybutyrate), poly (hydroxy valerate), poly (valerolactone), poly (caprolactone), polydioxanone, copolymers thereof and mixtures thereof Production method characterized in that the selected one.
The method of claim 9, wherein the solvent is water, methanol, ethanol, trifluoroethanol, propanol, isopropanol, tetrahydrofuran, dichloromethane, chloroform, 1,4-dioxane, acetone, ethyl acetate, methyl methacrylate, ethylene Method for producing any one selected from the group consisting of glycol, dimethylformamide, and mixtures thereof.
10. The method according to claim 9, wherein 10 to 500 mg of the biodegradable polymer is mixed with 1 ml of the modified CNT solution.
The method of claim 9, wherein the removing of the solvent is performed by drying at 25 ° C. to 50 ° C. for 10 minutes to 2 days.

Images