KR20120131725A - A novel virus like particle of high pathogenic avian Influenza virus H5N1 and vaccine for high pathogenic avian Influenza comprising the same - Google Patents

Abstract

PURPOSE: A highly pathogenic avian influenza A/chicken/Korea/Es/03 (H5N1) virus-like particle antigen and an influenza virus immunogenic composition containing the same are provided to produce a vaccine with a strong defense ability against highly pathogenic avian influenza H5N1. CONSTITUTION: A virus-like particle of purified highly pathogenic avian influenza H5N1 virus contains hemagglutinin(HA) of the virus of sequence number 1, neuraminidase(NA) of sequence number 2, and matrix protein M1 protein of sequence number 3. An antigen formulation contains the virus-like particles and an adjuvant or an immune stimulator. A vaccine contains the virus-like particles and is used with oral, percutaneous, intranasal, intraperitoneal, intravenous, or intradermic administration. The vaccine is formulated with an adjuvant or an immune stimulator. [Reference numerals] (AA) Virus reisolation

Description

A novel virus like particle of high pathogenic avian Influenza virus H5N1 and vaccine for high pathogenic avian Influenza comprising the same}

The present invention relates to a high pathogenic avian influenza A / chicken / Korea / Es / 03 (H5N1) virus like particle antigen and an influenza virus immunogenic composition comprising the same as an active ingredient.

Influenza viruses are RNA viruses belonging to the family Orthomyxoviridae and consist of subtypes designated A, B and C. Influenza A is known to cause infections in humans, horses, pigs, other mammals, and various kinds of poultry and wild birds. H1 to H16 depend on the characteristics of hemagglutinin, a hemagglutinin present on the surface of the virus. 16 subtypes are divided into 9 subtypes from N1 to N9 according to the characteristics of the surface protein expressed by the enzyme neuraminidase. When the H type and the N type are combined, the A type influenza virus has theoretically totaled 144 types Subtypes will exist. Among the influenza type A, avian influenza H9N2 and H5N1 viruses, which infect birds, continue to infect poultry in Korea.

Highly Pathogenic Avian Influenza (HPAI) is classified as List A disease by the International Water Bureau (OIE) and is considered as the first type of livestock epidemic in Korea. It is also an important disease in the trade of livestock products between countries. Among the highly pathogenic influenza, the H5N1 subtype virus has been reported with frequent frequency of poultry infection since 2003 in Asia, Europe and Africa.

Recently, in Korea, high pathogenic avian influenza virus H5N1 was detected in feces and mortality of wild birds in the winter of 2010. Highly pathogenic avian influenza occurred in ducks and poultry farms. Poultry infection of highly pathogenic avian influenza occurred.

The highly pathogenic avian influenza has caused a lot of public health concerns in addition to the enormous economic loss caused by high mortality in poultry infection. The highly pathogenic avian influenza H5N1 has been reported to cause fatal consequences for human infections. Since the first human infection was reported in Hong Kong in 1997, there has been a sharp increase in human infection reports since 2003, when the incidence of poultry increased rapidly. Started.

Currently, reports of human infection of the highly pathogenic avian influenza H5N1 type have been confirmed in 553, with 323 deaths. Most of them are reported in Vietnam, Indonesia, where the HPAI H5N1 is located in poultry. There is a need for effective eradication.

The highly pathogenic avian influenza has been preferred to follow the prompt diagnosis when it occurs, and domestically has also coped with this method. However, the killing policy has environmental and ethical issues including enormous compensation, and the killing policy was unsuccessful in the highly pathogenic avian influenza type H5N1 such as China, Vietnam and Indonesia. Poultry infections of the highly pathogenic avian influenza of new clades have been reported in several regions, including In addition, the possibility of poultry generation through migratory birds of highly pathogenic avian influenza is increasing the need for the development of a vaccine that can be effectively used in this situation.

In fact, in China, Vietnam and Indonesia, one of the policies to control high-pathogenic avian influenza is the vaccine against poultry. In Korea, the high-pathogenic avian influenza vaccine is prohibited, but poultry infection and transmission of avian influenza In a situation that occurs repeatedly, the need for vaccine development in case of emergency is being raised.

Avian influenza vaccines developed to date include inactivated oil vaccine (Intervet Mexico) against H5N2 serotype in Mexico and H5 recombinant fowl pox- There is a vectored AI vaccine; Merial Select, and there is a Divaating Infected from Vaccinated Animals (DIVA).

In order to eradicate highly pathogenic avian influenza, it is necessary to confirm the presence of the virus through the monitoring after the vaccine.For the serotoxin vaccine using the same type, it is impossible to apply DIVA through serum and for the vaccine with different NA type It is possible to apply DIVA through serum, but it is pointed out that the fluorescent antibody method for discriminating NA type is not suitable for large scale antibody monitoring test.

Virus-like particles (VLPs) have received much attention recently as antigens for incorporation into immunogen compositions. VLPs appear to be sufficiently similar to the natural (native) form of the virus, because they contain one or more surface proteins that can cause an immune response. Also, unlike wild-type viruses, VLPs are safe because they lack genetic material and cannot infect the host. In addition, unlike the venomous vaccine, it does not express the NP protein of influenza. Therefore, if it is used, ELISA, which can be used for a large-scale test, can be clearly distinguished from vaccine and infected individuals.

The present invention solves the above problems and the object of the present invention is to provide a highly pathogenic avian influenza A / chicken / Korea / Es / 03 (H5N1) virus like particles.

Another object of the present invention is to provide a poultry vaccine using high pathogenic avian influenza A / chicken / Korea / Es / 03 (H5N1) virus analogous particles.

In order to achieve the above object, the present invention provides a tablet comprising hemagglutinin (HA), neuraminidase (NA), and matrix protein M1 protein of a highly pathogenic avian influenza H5N1 virus. Provides virus-like particles of highly pathogenic avian influenza H5N1 virus.

The present invention also provides an antigen formulation comprising the virus-like particles and adjuvant or immune stimulator of the high pathogenic avian influenza H5N1 virus of the present invention.

In one embodiment of the present invention, the antigen formulation is preferably administered to the animal orally, intradermal, intranasal, intramuscular, intraperitoneal, intravenous or subcutaneous, but is not limited thereto.

The present invention also provides a vaccine comprising virus-like particles of the highly pathogenic avian influenza H5N1 virus of the present invention.

In one embodiment of the invention, the vaccine is preferably administered orally, intradermal, intranasal, intramuscular, intraperitoneal, intravenous or subcutaneous to the animal, but is not limited thereto.

In one embodiment of the invention, the vaccine is preferably formulated with an adjuvant or immune stimulant, but is not limited thereto.

The present invention also provides a method of inducing prophylactic immunity against H5N1 type virus infection in a human or animal comprising administering the antigenic formulation of the invention to a human or animal.

The present invention also provides a method of inducing prophylactic immunity against H5N1 type virus infection in a human or animal comprising administering the vaccine of the invention to a human or animal.

In addition, the present invention synthesizes a cDNA by extracting the RNA of the highly pathogenic avian influenza H5N1 virus, primer pairs for the HA of SEQ ID NO: 7 and 8, primer pairs for the HA of SEQ ID NO: 9 and 10 and the cDNA as a template PCR amplification was carried out using primer pairs for M1 of SEQ ID NOs: 11 and 12 to obtain HA, NA and M1 genes of SEQ ID NOs: 4, 5, 6, respectively, and then inserted these genes into DNA of baculoviruses into recombinant baculoviruses. It provides a virus-like particle production method of the highly pathogenic avian influenza H5N1 virus of the present invention comprising the step of preparing a virus, and infecting the baculovirus with insect cells.

Hereinafter, the present invention will be described.

In the present invention, using a VLP antigen expressing the HA, NA, M1 protein of the highly pathogenic avian influenza H5N1 virus strain was prepared a vaccine showing a high protective ability against the highly pathogenic avian influenza H5N1.

VLPs of the invention are used in the preparation of immunogens or pharmaceutical compositions. To do so, the VLP is adjusted to the appropriate concentration and formulated with any suitable adjuvant, diluent or carrier. Physiologically acceptable media can be used as carriers and / or diluents. These include, but are not limited to, suitable isotonic media, glycerol, ethanol and other common solvents, phosphate buffered saline and the like. Suitable adjuvants include synthetic lipid A analogues such as aluminum phosphate, aluminum hydroxide, MPLTM (3-O-deacylated monophosphoryl lipid A; RIBI ImmunoChem Research, Inc., Hamilton, MT, Corixa Current), 529 (Corixa). ), Synthetic polynucleotides such as Stimulon ™ QS-21 (Aquila Biopharmaceuticals, Framingham, Mass.), IL-12 (Genetics Institute, Cambridge, Mass.), Oligonucleotides containing CpG motifs (US Patent No. 6,207,646 (28)) , Heat-labile toxins of E. coli, and cholera toxin (in wild or mutant form, for example, when glutamic acid at amino acid position 29 is replaced by another amino acid, preferably histidine, published international patent application No. WO 00/18434 (29)).

In one aspect of the invention, a formulation comprising a VLP is for use as an immunogen composition. Viruses may be cryoprotectant additives or stabilizers such as proteins (eg albumin, gelatin), sugars (eg sucrose, lactose, sorbitol), amino acids (eg sodium glutamate), saline, or other protective agents. It can be mixed with. This mixture is kept in liquid state, or then dried or lyophilized for transport and storage and mixed with water immediately prior to administration.

As can be seen through the present invention, the present invention prepared a vaccine showing a high protective ability against high pathogenic avian influenza H5N1 using VLP antigens expressing HA, NA, M1 protein of the high pathogenic avian influenza H5N1 virus strain.

Figure 1 shows that the resulting VLP antigen was confirmed by Western blotting to express influenza HA, M1 protein.
2 is a table showing changes in H5 influenza specific antibody titers after VLP vaccination.
3 is a table re-isolating challenge virus in the vaccination group.

Hereinafter, the present invention will be described in more detail with reference to non-limiting examples. However, the following examples are illustrated to illustrate the present invention and the scope of the present invention is not to be construed as limited by the following examples.

Example 1: Construction of a VLP

Selected gene sequences encoding HA, NA, and M1 proteins of A / chicken / Korea / ES / 03 (H5N1) virus were prepared to produce virus-like particles (VLP) of the highly pathogenic avian influenza H5N1 type that occurred in 2003 in Korea. Amplified.

Specifically, virus RNA was synthesized into cDNA using a primer having agcgaaagcagg nucleotide sequence, and the synthesized cDNA was amplified by HA, NA and M1 genes using a primer set containing restriction enzyme recognition sites. Each primer sequence is as follows.

HA NA M1 Forward primer > BamHI-H5 F
TGGATCCATGGAGAAAATAGTGC (SEQ ID NO: 7) > EcoRI-N1 F
AGAATTCATG AATCCAAATC AGAAG (SEQ ID NO: 9)
> EcoRI-M (H5N1) F
AGAATTCATG AGTCTTCTAA CCGAGG (SEQ ID NO: 11)
Reverse primer > HindIII-Uni13 R
TAAGCTTAGTAGAAACAAGG
(SEQ ID NO: 8) > HindIII-Uni13 R
TAAGCTTAGTAGAAACAAGG
(SEQ ID NO: 10) > HindIIII-M1 (H5N1) R
TAAGCTTTCA CTTGAATCGC TGC (SEQ ID NO: 12)

Table 1 shows the primer sequences used for HA, NA, M1 gene amplification.

By inserting the amplified gene into the baculovirus DNA, a recombinant baculovirus capable of simultaneously expressing HA, NA, and M1 proteins of A / chicken / Korea / ES / 03 (H5N1) virus when infected by insect cells It was.

Specifically, the transfer vector was prepared by inserting the gene amplified by the method described above into the pFastbacT1 (invitrogen) vector to express the protein under the control of the polyhedron promoter upon infection with the insect cell. The produced vectors were called pHA, pNA, and pM1, respectively. The pM1 vector was treated with SnaBI and HpaI restriction enzymes, and then cloned into pNA vector treated with HpaI. The vector thus created is called pNAM1, which was cloned and inserted into the HA gene of pHA treated with SnaBI and HpaI by HpaI treatment. Thus, when the final transfer vector pNAM1HA was completed, the transformed bacterium was transformed into DH10Bac (invitrogen) competent cell to obtain recombinant bacmid. The bacmid thus obtained was transfected into 8 × 10 5 Sf9 cells in a 35 mm cell culture plate to obtain a recombinant baculovirus.

After infecting the recombinant virus with Sf9 cells, which are insect cells, H5N1 VLPs were collected from the culture supernatant, and low-centrifugation (500g, 10 min) was used to collect only the culture supernatant and treated with formalin to fluorinate the baculovirus. .

After concentrating the culture supernatant containing the VLP antigen, the presence of the antigen was confirmed by hemagglutination, western blotting. Western blotting confirmed the presence of the VLP antigen containing influenza HA, M1 protein (FIG. 1), and was found to have a hemagglutination ability of 2 ^ 10 HAU.

Example  2: VLP  Production of vaccine and SPF Chickens  Immunogenicity and Defense  exam

To determine immunogenicity and defense ability of antigens in SPF chickens, the VLP antigens prepared by concentration (2 ^ 8, 2 ^ 9, 2 ^ 10 HAU) and poultry-specific adjuvant ISA70 (SEPPIC, France) and weight ratio 30 Vaccines with different VLP antigen concentrations were prepared by mixing at: 70.

The prepared VLP vaccine was administered to the five-week-old SPF chickens per group via the intramuscular route, and the control medium used for cultivation of insect cells instead of the culture supernatant containing VLP was ISA70 (SEPPIC, France) and weight ratio. 30:70 was mixed and administered in the same manner as the experimental group.

After 2 and 3 weeks of vaccine, blood collection was performed to determine whether H5 influenza-specific antibodies were produced. After 3 weeks of vaccine, 10/6 EID50 / ml of A / chicken / Korea / ES / 03 ( H5N1) virus was challenged in the nasal route by 0.1 ml per dose. On 2, 3, 5, 7 days after challenge, oropharynx and cloaca swab after inoculation were observed for re-separation of challenge virus (Fig. 3).

The change in the H5 influenza specific antibody titer of FIG. 2 shows that the antibody titer is formed at a high level in the chickens to which the VLP vaccine is administered, indicating that the VLP vaccine has high immunogenicity in the chicken, which is produced as a poultry vaccine. It can be expected to show high efficacy.

In addition, when the results of the resegregation are summarized from the table for re-separation of FIG. 3, it can be seen that the virus is re-separated in some individuals in the inoculation 1d and 2d, but not in most individuals. This not only prevents the infection of the virus in the vaccine-administered population, but also reduces the frequency of virus release into the environment even if infected, which can be expected to significantly reduce the possibility of disease transmission. In addition, 100% of chickens died in the control group that did not receive the vaccine, and all the individuals survived in the vaccine group.

<110> Konkuk University Industrial Cooperation Corp. <120> A novel virus like particle of high pathogenic avian Influenza          virus H5N1 and vaccine for high pathogenic avian Influenza          comprising the same <160> 12 <170> Kopatentin 1.71 <210> 1 <211> 567 <212> PRT <213> H5N1 <400> 1 Met Glu Lys Ile Val Leu Leu Leu Ala Ile Val Ser Leu Val Lys Ser   1 5 10 15 Asp Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val              20 25 30 Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile          35 40 45 Leu Glu Arg Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys      50 55 60 Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn  65 70 75 80 Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val                  85 90 95 Glu Lys Ala Asn Pro Pro Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn             100 105 110 Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu         115 120 125 Lys Ile Gln Ile Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser     130 135 140 Ser Gly Val Ser Ser Ala Cys Pro Tyr Gln Gly Arg Ser Ser Phe Phe 145 150 155 160 Arg Asn Val Val Trp Leu Ile Lys Lys Asn Ser Ala Tyr Pro Thr Ile                 165 170 175 Lys Arg Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp             180 185 190 Gly Ile His His Pro Asn Asp Ala Ala Glu Gln Thr Arg Leu Tyr Gln         195 200 205 Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg     210 215 220 Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly 225 230 235 240 Arg Met Glu Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Ser                 245 250 255 Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Tyr Ala Tyr Lys Ile             260 265 270 Val Lys Lys Gly Asp Ser Ala Ile Met Lys Ser Glu Leu Glu Tyr Gly         275 280 285 Asn Cys Asn Thr Lys Cys Gln Thr Pro Met Gly Ala Ile Asn Ser Ser     290 295 300 Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys 305 310 315 320 Tyr Val Lys Ser Ser Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser                 325 330 335 Pro Gln Arg Glu Lys Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile Ala             340 345 350 Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr Gly         355 360 365 Tyr His His Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys Glu     370 375 380 Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser Ile 385 390 395 400 Ile Asp Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe Asn                 405 410 415 Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp Gly             420 425 430 Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu         435 440 445 Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr     450 455 460 Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly Asn 465 470 475 480 Gly Cys Phe Glu Phe Tyr His Arg Cys Asp Asn Glu Cys Ile Glu Ser                 485 490 495 Val Gly Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala Arg             500 505 510 Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly Thr         515 520 525 Tyr Gln Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala Leu     530 535 540 Ala Ile Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser 545 550 555 560 Leu Gln Cys Arg Ile Cys Ile                 565 <210> 2 <211> 449 <212> PRT <213> H5N1 <400> 2 Met Asn Pro Asn Gln Lys Ile Ile Thr Ile Gly Ser Ile Cys Met Val   1 5 10 15 Ile Gly Ile Val Ser Leu Met Leu Gln Val Gly Asn Met Ile Ser Ile              20 25 30 Trp Val Ser His Ser Ile Gln Thr Gly Asn Gln Arg Lys Ala Glu Pro          35 40 45 Ile Ser Asn Thr Lys Phe Leu Thr Glu Lys Ala Val Thr Ser Val Thr      50 55 60 Leu Ala Gly Asn Ser Ser Leu Cys Pro Ile Ser Gly Trp Ala Val His  65 70 75 80 Ser Lys Asp Asn Ser Ile Arg Ile Gly Ser Lys Gly Asp Val Phe Val                  85 90 95 Ile Arg Glu Pro Phe Ile Ser Cys Ser His Leu Glu Cys Arg Thr Phe             100 105 110 Phe Leu Thr Gln Gly Ala Leu Leu Asn Asp Lys His Ser Asn Gly Thr         115 120 125 Val Lys Asp Arg Ser Pro His Arg Thr Leu Met Ser Cys Pro Val Gly     130 135 140 Glu Ala Pro Ser Pro Tyr Asn Ser Arg Phe Glu Ser Val Ala Trp Ser 145 150 155 160 Ala Ser Ala Cys His Asp Gly Thr Ser Trp Leu Thr Ile Gly Ile Ser                 165 170 175 Gly Pro Asp Asn Gly Ala Val Ala Val Leu Lys Tyr Asn Gly Ile Ile             180 185 190 Thr Asp Thr Ile Lys Ser Trp Arg Asn Asn Ile Leu Arg Thr Gln Glu         195 200 205 Ser Glu Cys Ala Cys Val Asn Gly Ser Cys Phe Thr Val Met Thr Asp     210 215 220 Gly Pro Ser Asn Gly Gln Ala Ser Tyr Lys Ile Phe Lys Met Glu Lys 225 230 235 240 Gly Lys Val Val Lys Ser Val Glu Leu Asp Ala Pro Asn Tyr His Tyr                 245 250 255 Glu Glu Cys Ser Cys Tyr Pro Asp Ala Gly Glu Ile Thr Cys Val Cys             260 265 270 Arg Asp Asn Trp His Gly Ser Asn Arg Pro Trp Val Ser Phe Asn Gln         275 280 285 Asn Leu Glu Tyr Gln Ile Gly Tyr Ile Cys Ser Gly Val Phe Gly Asp     290 295 300 Asn Pro Arg Pro Asn Asp Gly Thr Gly Ser Cys Gly Pro Val Ser Pro 305 310 315 320 Asn Gly Ala Tyr Gly Val Lys Gly Phe Ser Phe Lys Tyr Gly Asn Gly                 325 330 335 Val Trp Ile Gly Arg Thr Lys Ser Thr Asn Ser Arg Ser Gly Phe Glu             340 345 350 Met Ile Trp Asp Pro Asn Gly Trp Thr Glu Thr Asp Ser Ser Phe Ser         355 360 365 Val Lys Gln Asp Ile Val Ala Ile Thr Asp Trp Ser Gly Tyr Ser Gly     370 375 380 Ser Phe Val Gln His Pro Glu Leu Thr Gly Leu Asp Cys Ile Arg Pro 385 390 395 400 Cys Phe Trp Val Glu Leu Ile Arg Gly Arg Pro Lys Glu Ser Thr Ile                 405 410 415 Trp Thr Ser Gly Ser Ser Ile Ser Phe Cys Gly Val Asn Ser Asp Thr             420 425 430 Val Gly Trp Ser Trp Pro Asp Gly Ala Glu Leu Pro Phe Thr Ile Asp         435 440 445 Lys     <210> 3 <211> 252 <212> PRT <213> H5N1 <400> 3 Met Ser Leu Leu Thr Glu Val Glu Thr Tyr Val Leu Ser Ile Ile Pro   1 5 10 15 Ser Gly Pro Leu Lys Ala Glu Ile Ala Gln Lys Leu Glu Asp Val Phe              20 25 30 Ala Gly Lys Asn Thr Asp Leu Glu Ala Leu Met Glu Trp Leu Lys Thr          35 40 45 Arg Pro Ile Leu Ser Pro Leu Thr Lys Gly Ile Leu Gly Phe Val Phe      50 55 60 Thr Leu Thr Val Ser Glu Arg Gly Leu Gln Arg Arg Arg Phe Val  65 70 75 80 Gln Asn Ala Leu Asn Gly Asn Gly Asp Pro Asn Asn Met Asp Arg Ala                  85 90 95 Val Lys Leu Tyr Lys Lys Leu Lys Arg Glu Ile Thr Phe His Gly Ala             100 105 110 Lys Glu Val Ala Leu Ser Tyr Ser Thr Gly Ala Leu Ala Ser Cys Met         115 120 125 Gly Leu Ile Tyr Asn Arg Met Gly Thr Val Thr Thr Glu Val Ala Phe     130 135 140 Gly Leu Val Cys Ala Thr Cys Glu Gln Ile Ala Asp Ser Gln His Arg 145 150 155 160 Ser His Arg Gln Met Ala Thr Ile Thr Asn Pro Leu Ile Arg His Glu                 165 170 175 Asn Arg Met Val Leu Ala Ser Thr Thr Ala Lys Ala Met Glu Gln Met             180 185 190 Ala Gly Ser Ser Glu Gln Ala Ala Glu Ala Met Glu Val Ala Asn Gln         195 200 205 Ala Arg Gln Met Val Gln Ala Met Arg Thr Ile Gly Thr His Pro Asn     210 215 220 Ser Ser Ala Gly Leu Arg Asp Asn Leu Leu Glu Asn Leu Gln Ala Tyr 225 230 235 240 Gln Lys Arg Met Gly Val Gln Met Gln Arg Phe Lys                 245 250 <210> 4 <211> 1701 <212> DNA <213> H5N1 <400> 4 atggagaaaa tagtgcttct tcttgcaata gtcagtcttg ttaaaagtga tcagatttgc 60 attggttacc atgcaaacaa ctcgacagag caggttgaca caataatgga aaagaacgtc 120 actgttacac atgcccaaga catactggaa aggacacaca acgggaagct ctgcgatcta 180 gatggagtga agcctctaat tttaagagat tgtagtgtag ctggatggct cctcgggaac 240 ccaatgtgtg acgaattcat caatgtgccg gaatggtctt acatagtgga gaaggccaat 300 ccacccaatg acctctgtta cccagggaat ttcaacgact atgaagaact gaaacaccta 360 ttgagcagaa taaaccattt tgaaaaaatt cagatcatcc ccaaaagttc ttggtccgat 420 catgaagcct catcaggggt gagctcagca tgtccatacc agggaaggtc ctccttcttc 480 agaaatgtgg tatggcttat caaaaagaac agtgcatacc caacaataaa gagaagctac 540 aataatacca accaagaaga tcttttggta ctgtggggga ttcaccatcc aaatgatgcg 600 gcagagcaga caagactcta tcaaaaccca accacctata tttccgttgg gacatcaaca 660 ctaaaccaga gattggtacc aaaaatagct actagatcca aagtaaacgg gcaaagtgga 720 aggatggagt tcttctggac aattttaaaa ccgaatgatg caatcagctt tgagagtaat 780 ggaaatttca ttgctccaga atatgcatac aaaatcgtca agaaagggga ctcagcaatt 840 atgaaaagtg aattggaata tggtaactgc aacaccaagt gtcaaactcc aatgggggcg 900 ataaactcta gtatgccatt ccacaacata caccctctca ccatcgggga atgccccaaa 960 tatgtgaaat caagtagatt agtccttgcg actgggctca gaaatagccc tcaaagagag 1020 aaaagaaaaa agagaggact atttggagct atagcaggtt ttatagaggg aggatggcag 1080 ggaatggtag atggttggta tgggtaccac catagcaatg agcaggggag tgggtacgct 1140 gcagacaaag aatccactca aaaggcaata gatggagtca ccaataaggt caactcgatc 1200 attgacaaaa tgaacactca gtttgaggcc gttggaaggg aatttaataa cttagaaagg 1260 agaatagaaa atttaaacaa gaagatggaa gacggattcc tagatgtctg gacttataat 1320 gctgaacttc tggttctcat ggaaaatgag agaactctag actttcatga ctcaaatgtc 1380 aagaaccttt acgacaaggt ccgactacag cttagggata atgcaaagga gctgggtaac 1440 ggttgtttcg agttctatca cagatgtgat aatgaatgta tagaaagtgt aggaaacgga 1500 acgtatgact acccgcagta ttcagaagaa gcaagattaa aaagagagga aataagtgga 1560 gtaaaattgg aatcaatagg aacttaccaa atactgtcaa tttattcaac agtggcaagt 1620 tccctagcac tggcaatcat ggtggctggt ctatctttat ggatgtgctc caatggatcg 1680 ttacaatgca gaatttgcat t 1701 <210> 5 <211> 1347 <212> DNA <213> H5N1 <400> 5 atgaatccaa atcagaagat aataaccatc ggatcaatct gtatggtaat tggaatagtt 60 agcttaatgt tacaagttgg gaacatgatc tcaatatggg tcagtcattc aattcagaca 120 gggaatcaac gcaaagctga accaatcagc aatactaaat ttcttactga gaaagctgtg 180 acttcagtaa cattagcggg caattcatct ctttgcccta ttagcggatg ggctgtacac 240 agtaaggaca acagtataag gatcggttcc aagggggatg tgtttgttat aagagagccg 300 ttcatctcat gctcccactt ggaatgcaga actttctttt tgactcaggg agccttgctg 360 aacgacaagc actccaatgg gactgtcaaa gacagaagcc ctcacagaac attaatgagt 420 tgtcctgtgg gtgaggctcc ctccccatat aactcaaggt ttgagtctgt tgcttggtca 480 gcaagtgctt gccatgatgg caccagttgg ttgacaattg gaatttctgg cccagacaat 540 ggggctgtgg ctgtattgaa atacaatggc ataataacag acactatcaa gagttggagg 600 aacaacatac tgagaactca agagtctgaa tgtgcatgcg taaatggctc ttgctttact 660 gtaatgactg atggaccaag taatgggcag gcatcatata agatcttcaa aatggaaaaa 720 ggaaaagtgg ttaaatcagt cgaattggat gctcctaatt atcactatga ggaatgctcc 780 tgttatcctg atgccggcga aatcacatgt gtgtgcaggg ataattggca tggctcaaat 840 aggccatggg tatctttcaa tcaaaatttg gagtatcaaa taggatatat atgcagtggg 900 gttttcggag acaatccacg ccccaatgat ggaacaggta gttgtggtcc ggtgtcccct 960 aacggggcat atggggtaaa agggttttca tttaaatacg gcaatggtgt ttggatcggg 1020 agaaccaaaa gcactaattc caggagcggc tttgaaatga tttgggatcc aaatgggtgg 1080 actgaaacgg acagtagctt ttcggtgaag caagatatcg tagcaataac tgattggtca 1140 ggatatagcg ggagttttgt ccagcatcca gaactgacag gattagattg cataagacct 1200 tgtttctggg ttgagttaat cagagggcgg cccaaggaga gcacaatttg gactagtggg 1260 agcagcatat ccttttgtgg tgtaaatagt gacactgtgg gttggtcttg gccagacggt 1320 gctgagttgc cattcaccat tgacaag 1347 <210> 6 <211> 756 <212> DNA <213> H5N1 <400> 6 atgagtcttc taaccgaggt cgaaacgtac gttctctcta tcatcccgtc aggccccctc 60 aaagccgaga ttgcacagaa acttgaagat gtcttcgcag gaaagaacac cgatctcgag 120 gctctcatgg agtggttaaa gacaagacca atcctgtcac ctctgactaa agggattttg 180 ggatttgtat tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240 cagaatgccc taaatggaaa tggagatcca aataatatgg atagggcagt taagctatat 300 aagaagctga aaagagaaat aacattccat ggggctaagg aggtcgcact cagctactca 360 accggtgcac ttgccagttg catgggtctc atatacaaca ggatgggaac ggtgactacg 420 gaagtggctt ttggcttagt gtgtgccact tgtgagcaga ttgcagattc acagcatcgg 480 tctcacagac agatggcaac tatcaccaac ccactaatca ggcatgagaa cagaatggtg 540 ctggccagca ctacagctaa ggctatggag cagatggcgg gatcaagtga gcaggcagcg 600 gaagccatgg aggtcgctaa tcaggctagg cagatggtgc aggcaatgag aacaattggg 660 actcatccta actctagtgc tggtctgaga gataatcttc ttgaaaattt gcaggcctac 720 cagaaacgaa tgggagtgca gatgcagcga ttcaag 756 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 tggatccatg gagaaaatag tgc 23 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 taagcttagt agaaacaagg 20 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 agaattcatg aatccaaatc agaag 25 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 taagcttagt agaaacaagg 20 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 agaattcatg agtcttctaa ccgagg 26 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 taagctttca cttgaatcgc tgc 23

Claims (9)

Hemagglutinin (HA) of the highly pathogenic avian influenza H5N1 virus of SEQ ID NO: 1, Nueraminidase (NA) of SEQ ID NO: 2, and Matrix protein M1 protein of SEQ ID NO: 3 Virus-like particles of the purified highly pathogenic avian influenza H5N1 type virus. An antigen formulation comprising the virus-like particles of the highly pathogenic avian influenza H5N1 virus of claim 1 and an adjuvant or immune stimulator. The antigenic formulation of claim 2, wherein the antigenic formulation is administered to the animal orally, intradermal, intranasal, intramuscular, intraperitoneal, intravenous or subcutaneous.  A vaccine comprising virus like particles of the highly pathogenic avian influenza H5N1 virus of claim 1. The vaccine of claim 4, wherein the vaccine comprises virus like particles of the highly pathogenic avian influenza H5N1 virus, which are administered to the animal orally, intradermal, intranasal, intramuscular, intraperitoneal, intravenous or subcutaneous. The vaccine of claim 4, wherein the vaccine comprises virus like particles of a highly pathogenic avian influenza H5N1 virus, which are formulated with an adjuvant or immune stimulant. A method of inducing prophylactic immunity against H5N1 type virus infection in a human or animal comprising administering the antigen formulation of claim 2 to a human or animal. A method of inducing prophylactic immunity against H5N1 type virus infection in a human or animal comprising administering the human or animal vaccine of claim 4. RNA was extracted from a highly pathogenic avian influenza H5N1 virus, and cDNA was synthesized, using the cDNA as a template, a primer pair for HA of SEQ ID NOs: 7 and 8, a primer pair for HA of SEQ ID NOs: 9 and 10, and SEQ ID NO: 11 and PCR amplification was carried out using primer pairs for M1 of 12 to obtain HA, NA and M1 genes of SEQ ID NOs: 4, 5, and 6, respectively, and then inserted these genes into DNA of baculoviruses to obtain recombinant baculoviruses. A method for producing a virus-like particle of the highly pathogenic avian influenza H5N1 virus of claim 1, comprising the step of preparing and infecting the baculovirus with insect cells.

Images