KR20120122801A - Composition for promoting the production of epidermal growth factor - Google Patents

Abstract

PURPOSE: A composition for promoting epidermal growth factor generation is provided to improve anti-wrinkling effect, elasticity, anti-aging function, and moisturizing effect. CONSTITUTION: A composition for promoting epidermal growth factor generation contains a compound of chemical formula 1, a compound of chemical formula 2, a compound of chemical formula 3, or a mixture thereof as an active ingredient. The composition improves anti-wrinkling, elasticity, anti-aging, moisturizing, or skin regeneration effect. The composition is an external use composition. A cosmetic composition contains a compound of chemical formula 1, 2, or 3, or a mixture thereof as an active ingredient. The cosmetic composition is manufactured in the form of a lotion, essence, cream, pack, gel, ointment, patch, or spray.

Description

Composition for promoting the production of epidermal growth factor {Composition for promoting the production of epidermal growth factor}

The present invention relates to a composition for promoting epidermal growth factor production, and specifically, includes feminin, dihydromolugin, chrysophanol or a mixture thereof as an active ingredient, skin wrinkle improvement, elasticity improvement, moisturizing Or it relates to a composition having a skin regeneration effect.

Epidermal growth factor (hEGF) is composed of 53 amino acids, 6 cysteine (cysteine) is a protein that forms three disulfite bond (disulfite). Epithelial growth factor is caused by intracellular signaling by binding to the epidermal growth factor receptor present on the cell surface and activating tyrosine kinase present on the receptor. As a result, various biochemical changes in cells such as increased intracellular calcium concentration, increased glycolysis, protein synthesis, increased expression of genes to which epidermal growth factor receptors act, and ultimately DNA synthesis and cell growth This is going on.

Epidermal growth factor acts on several tissues, but in particular regulates cell proliferation, migration, binding, and inflammatory response of the skin (Pastore, S. et al., 2008, J. Invest . Dermatol . , 128: 1365-1374, Schneider MR et al., 2008, Cytokein Growth Factor Rev. , 19: 173-181), and in the wound healing process (Buckley, A. et al., 1985 Proc . Natl . Acad . Sci . USA. , 82: 7340-7344). Such epithelial growth factor decreases as expression progresses as aging progresses, thereby decreasing the proliferation and migration of skin cells, which may be a cause of skin aging, skin wrinkles, and decreased elasticity.

Currently, human epidermal growth factor itself is used as a pharmaceutical or functional cosmetic that promotes skin cell growth by using as a raw material for cosmetics or external skin preparations, but since human epidermal growth factor is not stable for a long time at room temperature, it has a lasting effect. It is not easy to expect, and the productivity is low, the disadvantage is expensive.

The present inventors studied to find a substance that can effectively promote the production of epidermal growth factor in the skin even without using the epidermal growth factor itself. Discovered to complete the present invention.

The present invention is to provide a compound for promoting epithelial growth factor production comprising a compound represented by the following formula (1), a compound represented by the following formula (2), a compound represented by the formula (3) or a mixture thereof as an active ingredient.

[Formula 1]

[Formula 2]

(3)

In addition, the present invention is to provide a cosmetic composition comprising a compound represented by Formula 1, a compound represented by Formula 2, a compound represented by Formula 3 or a mixture thereof as an active ingredient.

In one embodiment, the present invention provides a composition for promoting epithelial growth factor production comprising a compound represented by the following formula (1), a compound represented by the following formula (2), a compound represented by the formula (3) or a mixture thereof as an active ingredient to provide.

[Formula 1]

[Formula 2]

(3)

The composition is a compound represented by Formula 1, a compound represented by Formula 2, a compound represented by Formula 3, a compound represented by Formula 1 and a compound represented by Formula 2, represented by Formula 1 A mixture of a compound represented by Formula 3 and a compound represented by Formula 3, a compound represented by Formula 2 and a compound represented by Formula 3, or a compound represented by Formula 1, a compound represented by Formula 2, and the formula A mixture of compounds represented by 3 may be included as an active ingredient.

Compound represented by the formula (1) is Paeminine (Peiminine), Paeminin is Fritillaria verticillata Willd . there is . thunbergii Bak . It can be separated from natural sources such as, but not limited to, chemically synthesized by methods known in the art, or commercially available materials can be used.

The compound represented by Formula 2 is dihydromollugin, and the dihydromollugin is Rubia cordifolia L. ) may be separated from natural sources, such as, but not limited to, chemically synthesized by methods known in the art, or commercially available materials can be used.

The compound represented by Chemical Formula 3 is Chrysophanol, which is a form of anthraguinone, and the chrysophanol may be separated from natural sources such as Rheum Palmatum L., but is not limited thereto. Instead, chemically synthesized by methods known in the art, or commercially available materials may be used.

The compounds may also be in the form of solvates, pro-drugs or pharmaceutically acceptable salts thereof, solvates preferably include hydrates and ethanolates.

The "pharmaceutically acceptable salts thereof" are useful acid addition salts formed by pharmaceutically acceptable free acid. Acid addition salts are prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. The same molar amount of the compound and the acid or alcohol (e.g., glycol monomethyl ether) in water may be heated and then the mixture may be evaporated to dryness, or the precipitated salt may be subjected to suction filtration. At this time, an organic acid and an inorganic acid may be used as the free acid, and hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, and the like may be used as the inorganic acid, and methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, and maleic acid may be used as the organic acid. (maleic acid), succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid (gluconic acid), galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanic acid, hydroiodic acid, and the like can be used. It is not limited.

Bases can also be used to make pharmaceutically acceptable metal salts. Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and then evaporating and drying the filtrate. In this case, as the metal salt, it is particularly suitable to prepare sodium, potassium or calcium salt, but is not limited thereto. Corresponding silver salts can also be obtained by reacting an alkali or alkaline earth metal salt with a suitable silver salt (eg silver nitrate).

"Promoting epithelial growth factor production" of the present invention means to increase the production of protein by increasing the expression of epidermal growth factor genes in cells including skin cells. When the production of intracellular epithelial growth factors including skin cells is promoted, intracellular signal transduction occurs by binding epithelial growth factors to the epithelial growth factor receptor present on the cell surface, and as a result, various biochemical changes Epithelial cell growth factor receptor, and the like. Ultimately, DNA synthesis and cell growth progress.

The composition for promoting epidermal growth factor production of the present invention, in particular, promotes cell proliferation, migration, and binding of the skin, regulates inflammatory responses, and plays an important role in wound healing, improving skin wrinkles, improving elasticity, and preventing skin aging. It may have a moisturizing or skin regeneration effect. By using such an effect, the composition for promoting epidermal growth factor production of the present invention can be used as a component of the external preparation for skin. The composition for promoting epidermal growth factor production of the present invention can be used as a component of the skin external preparation for preventing skin aging through skin elasticity improvement, skin wrinkle improvement, moisturizing, etc., and used as a component of skin external preparation for scar improvement such as burns and acne. However, the present invention is not limited thereto, and may be used to ameliorate other diseases or symptoms requiring human epidermal growth factor.

In an embodiment of the present invention, the peminin, dihydromolugin or crispanol activate the promoter of human epidermal growth factor in the fibroblasts of the skin to promote the expression of human epidermal growth factor to increase the amount of protein produced It was confirmed that the, peminin, dihydromolugin or crispanol was prescribed after the effect of improving the skin wrinkles and elasticity was confirmed.

The composition of the present invention may include a pharmaceutically acceptable carrier, and the term "pharmaceutically acceptable carrier" in the present invention means a carrier that does not significantly stimulate the organism and does not inhibit the biological activity and properties of the administered compound or Refers to a diluent. The composition may be formulated with a carrier.

In the case of oral dosage forms, for example, they may be formulated as troches, lozenges, aqueous or oily suspensions, prepared powders or granules, emulsions, hard or soft capsules, syrups or elixirs. It is not limited to this. To prepare into formulations such as tablets and capsules, binders such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin and excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch and magnesium stearate Lubricants, such as calcium stearate, sodium stearyl fumarate or polyethylene glycol wax. In the case of capsule formulation, in addition to the above-mentioned substances, it may include a liquid carrier such as fatty oil.

In order to formulate into a dosage form for parenteral administration, it may be formulated into a transdermal dosage form, an injection form such as subcutaneous injection, intravenous injection or intramuscular injection.

As another aspect, the present invention provides a composition for promoting epidermal growth factor production comprising a compound represented by the following formula (1), a compound represented by the following formula (2), a compound represented by the formula (3) or a mixture thereof as an active ingredient It provides a method for improving skin wrinkles, improving elasticity, preventing skin aging, moisturizing or regenerating skin. The composition is a compound represented by Formula 1, a compound represented by Formula 2, a compound represented by Formula 3, a compound represented by Formula 1 and a compound represented by Formula 2, represented by Formula 1 A mixture of a compound represented by Formula 3 and a compound represented by Formula 3, a compound represented by Formula 2 and a compound represented by Formula 3, or a compound represented by Formula 1, a compound represented by Formula 2, and the formula A mixture of compounds represented by 3 may be included as an active ingredient. As used herein, the term "administration" means introducing a composition of the present invention to a patient in any suitable manner, and the route of administration of the composition of the present invention may be administered via any general route as long as it can reach the desired tissue. have. Preferably, transdermal administration can be carried out, and local application is most preferable. The number of times application of the composition of the present invention can be determined depending on the prescription, necessity or desire. The composition of the present invention may be prescribed in parallel with a surgical method such as a laser. It can also be incorporated into casts, bandages, dressings, gauze pads, and similar items.

As another aspect, the present invention provides a cosmetic composition comprising a compound represented by the formula (1), a compound represented by the formula (2), a compound represented by the formula (3) or a mixture thereof as an active ingredient. The composition is a compound represented by Formula 1, a compound represented by Formula 2, a compound represented by Formula 3, a compound represented by Formula 1 and a compound represented by Formula 2, represented by Formula 1 A mixture of a compound represented by Formula 3 and a compound represented by Formula 3, a compound represented by Formula 2 and a compound represented by Formula 3, or a compound represented by Formula 1, a compound represented by Formula 2, and the formula A mixture of compounds represented by 3 may be included as an active ingredient. The cosmetic composition of the present invention can be used in functional cosmetics for improving skin wrinkles, improving elasticity, preventing skin aging, moisturizing or regenerating skin.

The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used as a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, flexible lotion, astringent lotion, nutrition lotion, nutrition cream, massage cream, lotion, gel, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, ointment, stick, patch, spray or powder It may be prepared in a dosage form.

When the formulation of the present invention is a paste, cream or gel, an animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier component . When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as the carrier component. When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters. In the case where the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used. When the formulation of the present invention is a surfactant-containing cleansing, the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid amide ether. Sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.

The compositions of the present invention include acute or chronic moisturizers (including, for example, wetting agents, sealants, and agents that affect the natural moisturizing mechanism of the skin), antioxidants, sunscreens with UVA and / or UVB protection, pH adjusters, emollients And other beneficial agents and compounds, such as anti-irritants, vitamins, trace metals, antibacterial agents, vegetable extracts, perfumes, and / or dyes and color components.

In addition, the composition of the present invention may include a surfactant. The surfactant can be an anionic surfactant, cationic surfactant, nonionic surfactant or compatible mixture of surfactants. The surfactant may also be an ampholytic or amphoteric surfactant having the properties of anions or cations depending on the pH of the composition.

The composition of the present invention may also comprise hydrotrope. Hydrotropes are compounds that have the ability to enhance the water solubility of other compounds. Specific examples of hydrotropes include, but are not limited to, sodium cumene sulfonate, ammonium cumene sulfonate, ammonium xylene sulfonate, potassium toluene sulfonate, sodium toluene sulfonate, sodium xylene sulfonate, toluene sulfonic acid, and xylene sulfonic acid. Other useful hydrotropes include sodium polynaphthalene sulfonate, sodium polystyrene sulfonate, sodium methyl naphthalene sulfonate, sodium camphor sulfonate, and disodium succinate.

Compositions of the present invention may also include thickening or gelling agents. Thickeners or gelling agents are, for example, polymers or copolymers unsaturated carboxylic acids or unsaturated esters, polysaccharide derivatives, gums, colloidal silicates, polyethylene glycols (PEG) and derivatives thereof, polyvinylpyrrolidone and derivatives thereof, polyacrylamides And derivatives thereof, polyacrylonitrile, hydrophilic silica gel or mixtures thereof.

The composition of the present invention may also include a sunscreen. Organic sunscreens may include, for example, 4-tert-butyl-4'-methoxy dibenzoylmethane or 2-ethylhexyl methoxycinnamate, and inorganic sunscreens, for example, titanium dioxide, zinc oxide Or silica.

In the composition of the present invention, the amount of the compounds as the active ingredient is preferably 0.00005 to 10% by weight based on the total composition. When the amount is less than 0.00005% by weight, the effect is too weak, and when it exceeds 10% by weight, there is a problem that the increase in effect due to the increase of the content is insufficient and the stability of the formulation is not secured.

The composition of the present invention can promote the production of human epidermal growth factor by activating a promoter of the human epidermal growth factor gene present in human cells, and as a result, improve skin wrinkles, improve elasticity, prevent skin aging, It may have a moisturizing improvement or skin regeneration effect.

1 shows a recombinant vector by cloning a human epidermal growth factor (hEGF) promoter region into a pGL3 vector.
FIG. 2 is a graph measuring the activation of the human epidermal growth factor promoter after transforming the vector of FIG. 1 into human-derived fibroblasts and treating peminin, chrysopanol or dihydromolugin, respectively. FIG.
3 is treated with peminin, chrysopanol or dihydromolugin in human-derived fibroblasts, respectively, and expression of human epidermal growth factor protein using an enzyme-linked immunosorbent assay (ELISA). It is a graph measured.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

In the following Experimental Examples and Examples of the present invention, Sample 1 refers to Peminine, Sample 2 refers to Chrysophanol, and Sample 3 refers to Dihydromollugin, respectively. It was purchased from Co., Ltd. (陝西 사용 康 生物 有限公司).

Experimental Example 1 Evaluation of Promoter Activity of Human Epidermal Growth Factor in Human Fibroblasts

A reporter vector was prepared to determine the promoter activity of human epidermal growth factor. To this end, the promoter region (-890 ~ +80) of human epidermal growth factor was first amplified from human genomic DNA by PCR. The primers used at this time are shown in Table 1.

order Forward CGGGGTACCCCCATCGTGCATCAAATCTGCTAT (SEQ ID NO: 1) Reverse ATCCAAGGGTTGTAGCTGGAACTCCATGGCATG (SEQ ID NO: 2)

The amplified DNA was cut using KpnI and NcoI restriction enzymes and cloned into pGL3 vector expressing luciferase (FIG. 1). After culturing human fibroblasts in DMEM medium containing 10% fetal bovin serum for 18 hours, the vector combining the promoter and luciferase of human epidermal growth factor was cultured into lipofectamine. ) Were injected into cells via transfection.

After incubation for 5 hours, the cells were washed twice with DMEM medium containing no bovine serum, and replaced with a culture solution added to the concentration of 5 ppm and 20 ppm of each sample in DMEM medium containing no bovine serum and treated for 18 hours. After 18 hours, the cells were collected, washed with cooled phosphate buffer (PBS), lysed using a cell lysis buffer, and then extracted with supernatant using a centrifuge, followed by luciferase assay, followed by PerkinElmer Victor 3 Fluorescence (luminescence) was measured and analyzed by (Perkin Elmer Victor 3). The analysis results are shown collectively in Figure 2 and Table 2.

Name of sample Control group Sample 1
5 ppm Sample 1
20 ppm Sample 2
5 ppm Sample 2
20 ppm Sample 3
5 ppm Sample 3
20 ppm Increase 100% 112% 139% 120% 156% 122% 157%

As shown in Table 2, payminin, chrysopanol or dihydromolugin according to the present invention was able to activate the promoter of human epidermal growth factor in a concentration-dependent manner.

Experimental Example 2 Evaluation of Increase of Human Epidermal Growth Factor Production Using Enzyme-linked Immunosorbent Assay (ELISA)

Human fibroblasts were incubated for 18 hours in DMEM medium containing 10% fetal bovin serum, washed twice with DMEM medium containing no bovine serum, and washed in DMEM medium containing no bovine serum. Each sample was replaced with a culture solution added so that the concentration of 5 ppm and 20 ppm was treated for 18 hours. After 18 hours, only the culture medium was separated, and the amount of human epidermal growth factor protein present in the culture medium was analyzed by enzyme-linked immunosorbent assay (ELISA) and then measured by UV absorbance. The analysis results are shown in FIG. 3 and Table 3.

Name of sample Control group Sample 1
5 ppm Sample 1
20 ppm Sample 2
5 ppm Sample 2
20 ppm Sample 3
5 ppm Sample 3
20 ppm Increase 100% 117% 152% 160% 202% 136% 181%

As shown in Table 3, payminin, chrysopanol or dihydromolugin according to the present invention increased the production of human epidermal growth factor at higher concentrations.

In the following, it was added to the skin essence by adding peminin, chrysopanol or dihydromolugin to the skin essence, and to examine the skin wrinkle improvement effect and elasticity improvement effect by prescribing them to the test subjects.

<Production Example 1-1, 1-2, 1-3 and Comparative Example>

Payminin, chrysopanol or dihydromolugin were added as active ingredients, respectively, and an essence was prepared according to the ingredients and contents shown in Table 4 below. Comparative Example prepared an essence with the ingredients and contents shown in Table 4 without adding a sample.

(Unit: wt%) Preparation Example 1-1 Preparation Example 1-2 Preparation Example 1-3 Comparative example Sample 1 5 - - - Sample 2 - 5 - - Sample 3 - - 5 - Propylene glycol 10.0 10.0 10.0 10.0 glycerin 10.0 10.0 10.0 10.0 Sodium hyaluronate aqueous solution (1%) 5.0 5.0 5.0 5.0 ethanol 5.0 5.0 5.0 5.0 Polyoxyethylene Cured Castor Oil 1.0 1.0 1.0 1.0 Methyl paraoxybenzoate 0.1 0.1 0.1 0.1 incense Suitable amount Suitable amount Suitable amount Suitable amount Purified water To 100 To 100 To 100 To 100

In order to verify the skin wrinkle improvement effect by the skin essence prepared as described above, the skin wrinkle improvement effect was compared to 45 subjects with facial wrinkles aged 35 to 45 years with respect to the essence of the composition (Table 4). Evaluated.

In each of 15 subjects, the left side of each of the facial subjects used Preparation Example 1-1, 1-2, and 1-3 essences, and in the right side, the comparative example essences were used twice a day for three months after washing in the morning and evening. Compared with the comparative example, the degree of wrinkle improvement of the preparation examples was visually determined, and the preparation examples compared the comparative example with the "clear effect", "wrinkle improvement effect", "not sure", "nothing" The evaluation was carried out in four steps, and the results are shown in Table 5.

Experimental material Has pronounced effect (persons) Wrinkle improvement effect (persons) I don't know (person) None (persons) Production Example 1-1 3 9 2 One Preparation Example 1-2 4 8 3 0 Preparation Example 1-3 4 7 2 2

As shown in Table 5, the cosmetics containing the peminin, chrysopanol or dihydromolugin prepared according to Preparation Examples 1-1, 1-2, 1-3 as an active ingredient, respectively, At least 11 of them showed improvement in wrinkles and no adverse effects in the skin.

In addition, in order to verify the skin elasticity enhancement effect, the essences of the manufacture examples 1-1, 1-2, 1-3 and comparative example was applied to the neck of 45 healthy adults for 4 weeks in a constant temperature and humidity room of 22 ℃ and 50% relative humidity. After comparing the elasticity improvement effect by measuring the elasticity before and after the chart.

For each of 15 subjects, Preparation Example 1-1, 1-2, or 1-3 essences were used on the left side of the neck, and Comparative Example essences were used on the right side, twice a day for 4 weeks after washing the face. Then, the degree of improvement of elasticity at each site was measured by using a skin elasticity measuring instrument (Cutometer, C + K, Germany). The degree of improvement used Ur / Uf as a parameter.

Elasticity improvement (%, n = 15) Production Example 1-1 24.8 Preparation Example 1-2 32.5 Preparation Example 1-3 41.9 Comparative example 3.5

As can be seen in Table 6, it was found that the composition containing peminin, chrysopanol or dihydromolugin is superior to the skin elasticity improving effect than the comparative example.

<110> LG HOUSEHOLD & HEALTH CARE LTD. <120> Composition for promoting the production of epidermal growth          factor <130> PA110139 / KR <160> 2 <170> Kopatentin 1.71 <210> 1 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cggggtaccc ccatcgtgca tcaaatctgc tat 33 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 atccaagggt tgtagctgga actccatggc atg 33

Claims (8)

A compound for promoting epithelial growth factor production, comprising a compound represented by Formula 1, a compound represented by Formula 2, a compound represented by Formula 3, or a mixture thereof as an active ingredient.
[Formula 1]

(2)

(3)

The composition for promoting epidermal growth factor production according to claim 1, wherein the composition is an external preparation composition for skin.
According to claim 1, wherein the composition is to improve the skin wrinkles, improve skin elasticity, prevent skin aging, improve moisturizing or promote skin regeneration, the composition for promoting epidermal growth factor production.
The composition for promoting epithelial growth factor production according to claim 1, wherein the composition improves burn scars or acne scars.
A cosmetic composition comprising a compound represented by Formula 1, a compound represented by Formula 2, a compound represented by Formula 3, or a mixture thereof as an active ingredient.
[Formula 1]

(2)

(3)

The cosmetic composition of claim 5, wherein the composition improves skin wrinkles, improves skin elasticity, prevents skin aging, improves moisturizing, or promotes skin regeneration.
The cosmetic composition of claim 5, wherein the compound comprises 0.00005 to 10% by weight based on the total composition.
The cosmetic composition of claim 5, wherein the composition has a formulation of a lotion, essence, lotion, cream, pack, gel, ointment, patch or spray.

Images