KR20120122485A - Compisition and method for diagnosting sex of Pa-ralichthyidae - Google Patents

Abstract

PURPOSE: A marker composition for determining sex of Paralichthyidae containing Fig-alpha or Scp3 gene is provided to quickly and accurately determine sex of Paralichthyidae. CONSTITUTION: A marker composition for determining sex of Paralichthyidae contains Fig-alpha gene or Fig-alpha proteins encoded from the gene. The Fig-alpha contains a base of sequence number 1. The marker composition contains Scp3 gene or Scp3 protein encoded from the gene. The Scp3 gene has a base of sequence number 2. A composition for determining sex of Paralichthyidae contains a material which measures Fig-alpha gene or Fig-alpha protein level. The material includes a primer, probe, or antibody. A primer for amplifying Fig-alpha gene is a primer pair of sequence numbers 3 and 4. A composition for determining sex of Paralichthyidae contains a material which measures Scp3 gene or protein level. A method for determining sex of Paralichthyidae comprises a step of measuring Fig-alpha gene or protein expression level or Scp3 gene or protein expression level.

Description

Composition and method for determining sex of flounder sex {Compisition and method for diagnosting sex of Pa-ralichthyidae}

The present invention relates to the identification of novel genes specifically expressed in females and males of flounder (flounder) which is representative of Korean sashimi, and relates to a flounder sex discrimination marker composition, a flounder sex discrimination composition, and a flounder sex discrimination method based on the same. .

The ovaries and testes of vertebrates are reproductive organs that produce eggs and sperm, respectively, and begin to form in the sexually undifferentiated gonads at the beginning of development and the timing varies depending on the species. In general, sex is determined by sex chromosomes after fertilization of each spouse (XX or XY), but sometimes the sex of an individual is suppressed from male to female, as the activity of the SRY gene in the Y chromosome, which determines male according to external environmental factors, is suppressed. In some cases, These individuals, even if they have male XY sex chromosomes, have female characteristics in germline development and subsequent phenotypes. Recently, numerous studies have been conducted to reveal various mechanisms for sex determination and composition of vertebrates. However, in fish, the limitation of model experimental fish is limited to a few species such as songsari and tilapia. Tilapia, in particular, has a central role in the ovarian differentiation of a female hormone called estrogen. It is said to play an important role.

Sex discrimination according to fish composition is divided into three types: morphological method, histologic method, and genetic method. First, the morphological sex discrimination method is a technique for discriminating sex according to the shape and characteristics of the gonad through direct dissection of the fish in the gonad maturation. Second, the histological method is to target the fry fish grown to some extent after the composition period, and to observe the germline by the immunological staining of the fish's germline using an optical microscope. Finally, the genetic method molecularly analyzes the generation and action of genes that specifically express sex-determining genes or ovarian formation / spermogenesis in young fry and immature gonads before and after the componentization period. That's how.

In Korea, halibut, commonly called flatfish, is divided into male and female, and the period of incubation is about 50 to 60 days after hatching, and the size of the fry is about 5 to 6 cm long. The undifferentiated gonads at the time of componentization of the flounder are known to differentiate sex into male and female by the action of cyp19a1 (P450arom), which regulates the secretion of estrogens, but various controls that control the formation and maturation and maturation of the flounder The molecular nature of the identification of genes and the generation and function of these factors is not known. In addition, RT-PCR amplification analysis of the male-specific Y chromosome gene DMY of the killifish has been reported, but there is a problem in that only males can be determined.

Therefore, the present inventors aimed to identify a new genetic factor specifically expressing the female or male gonads in the fry and growth stages of the flounder before and after the componentization period of the flounder to propose a more accurate method of discriminating sex.

Therefore, it is an object of the present invention to provide a flounder discriminating marker composition comprising Figα or Scp3 gene specifically expressed in males of flounder.

It is also an object of the present invention to provide a composition for discriminating flounder, comprising a substance measuring the level of Figα gene or Scp3 gene.

Furthermore, it is an object of the present invention to provide a method for determining the possibility of male and female flounder through the step of measuring the expression amount of Figα gene or Scp3 gene.

In order to achieve the object of the present invention as described above, the present invention provides a flounder discrimination marker composition consisting of Fig α (Factor In the Germline alpha) gene or Fig α protein encoded from the gene.

In one embodiment of the present invention, the Figα gene may be one having a nucleotide sequence of SEQ ID NO: 1.

In another aspect, the present invention provides a halibut sex discrimination marker composition consisting of Scp3 (synaptonemal complex protein 3) gene or Scp3 protein encoded from the gene.

In one embodiment of the present invention, the Scp3 gene may be one having a nucleotide sequence of SEQ ID NO: 2.

In addition, the present invention provides a composition for discriminating flounder, comprising a substance measuring the level of Fig α gene or Fig α protein.

In one embodiment of the invention, the material for measuring the level of Figα gene or Figα protein is a primer or probe capable of amplifying the Figα gene; Or an antibody that specifically binds to Figα protein.

In one embodiment of the present invention, the primer is a halibut sex discrimination composition, characterized in that the primer pair of SEQ ID NO: 3 and SEQ ID NO: 4.

The present invention provides a composition for determining flounder sex comprising a substance for measuring the level of the Scp3 gene or Scp3 protein.

In one embodiment of the present invention, the material for measuring the level of the Scp3 gene or Scp3 protein is a primer or probe capable of amplifying the Scp3 gene; Or an antibody that specifically binds to Scp3 protein.

In one embodiment of the present invention, the primer may be a primer pair of SEQ ID NO: 5 and SEQ ID NO: 6.

In addition, the present invention provides a method for determining the sex of the flounder comprising the step of measuring the expression of Figα gene or Scp3 gene present in the biological sample.

In one embodiment of the present invention, the sex determination method may further comprise the step of determining that the female when the Figα gene is expressed, and the male when the Scp3 gene is expressed.

In one embodiment of the invention, the biological sample may be extracted from the gonad of the halibut.

In one embodiment of the present invention, the flounder may be 50 to 60 days of age or fry.

In one embodiment of the invention, the measurement is reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, ELISA (enzyme linked immunosorbent). assay, radioimmunoassay (RIA), radioimmunodiffusion, immunoprecipitation assay, and immunohistochemical analysis.

The composition and sex determination method for flounder sex determination according to the present invention, by identifying the sex of the flounder that has not been able to distinguish male and female by the external morphological method until now, by identifying a new genetic factor that specifically expresses in the gonads of the flounder, The detailed expression level test has the effect of allowing the male and female of the flounder to be distinguished quickly and accurately.

1 is a result of sex discrimination by real-time quantitative PCR amplification of Figα and Scp3 genes in the gonad of the flounder.
Figure 2 shows the results of sex judgment through the microscopic examination of the gonad cell tissue of the flounder by HE staining.
Figure 3 is a graph showing the expression level of Figα which is a female specific gene in red snapper, defensive hull, rockfish and flounder.
4 is a graph showing the expression level of Scp3, a male specific gene, in red snapper, yellowtail, rockfish and flounder.

The present invention has identified a new method for determining sex of flounder by identifying the presence of genes that are specifically expressed in each of the sexes of the flounder, and providing a composition for discriminating sex effectively and quickly. have.

Flounder ( Paralichthys olivaceus ) is a saltwater fish of the flounder family known for its sashimi, also called flatfish, which means that the eyes are asymmetrically on the left side of the head and flat fish. Although similar, it can be easily distinguished from the type of flounder whose eyes are concentrated to the right. It is found in many coasts of Korea and lives in the deep sea in winter. The componentization of the flounder occurs 50 to 60 days after hatching, but it is impossible to distinguish male and female by external morphological methods. Therefore, it is difficult to distinguish the male and female of flounder morphologically with the naked eye, and there is a difficulty in flatfish farming. In addition, since the external morphological sex determination method is impossible, genetic methods are required to determine the sex of the flounder, and even genetic methods of the flounder have not been specifically established due to the lack of genetic research on the flounder. Therefore, sex determination of flounder was virtually impossible.

Therefore, in the present invention, the sex discrimination analysis method of the flounder was developed by genetic techniques utilizing the characteristics of Figα gene specifically expressed in females and Scp3 gene specifically expressed in males.

According to an embodiment of the present invention, the present inventors have identified and identified Figα and Scp3 genes in the gonads of females and males of the flounder, and based on this, a primer capable of effectively detecting the Figα and Scp3 genes of the flounder. Through this, it was confirmed by real-time quantitative PCR that the two genes were specifically overexpressed in females and males of the flounder, respectively (see Example 1).

Therefore, the present inventors have found that the Fig α gene can be used as a sex discriminator marker for flounder and the Scp3 gene as a male discriminator marker for flounder.

Therefore, the present invention can provide a novel flounder sex discriminating marker composition comprising the Figα gene or the Figα protein encoded therefrom.

Preferably the Figα gene may have a nucleotide sequence represented by SEQ ID NO: 1.

In addition, the present invention can provide a novel flounder discriminating marker composition comprising the Scp3 gene or Scp3 protein encoded from the gene.

Preferably the Scp3 gene may have a nucleotide sequence represented by SEQ ID NO: 2.

In the present invention, the term sex determination means to determine whether an individual is a female or a male, and for purposes of the present invention, the sex determination confirms whether or not the expression of a gene serving as a sex discrimination marker depends on the result. It means to distinguish between the sexes of individuals.

In addition, the sex determination marker composition refers to a substance that allows discrimination between a female individual and a male individual. The female discrimination marker composition is a female individual compared to a male individual, and a male discrimination marker composition is a male individual compared to a female individual. Polypeptides or nucleic acids (eg, mRNA, etc.), lipids, glycolipids, glycoproteins, organic biomolecules such as sugars (monosaccharides, disaccharides, oligosaccharides, etc.), and the like, which show an increase or decrease in The halibut sex discrimination marker composition provided by the present invention is a female sex discriminator marker composition, which is specifically expressed in the female gonad of the halibut, or a protein thereof, or a male sex discriminator marker composition, which is particularly much in the male gonad of the halibut. It may be the Scp3 gene or protein thereof expressed.

In addition, the present invention provides a composition for discriminating flounder sex comprising a substance for measuring the level of Fig α gene or the level of Fig α protein encoded from the gene.

In addition, the present invention provides a composition for determining flounder sex comprising a substance for measuring the level of the Scp 3 gene or the level of the Scp 3 protein encoded from the gene.

In the present invention, the level of the Fig α or Scp 3 gene, preferably means the mRNA level of each of the genes expressed, that is, the amount of mRNA, as a material that can measure the level of Fig α or Scp 3 Primers or probes specific for the gene may be included. In the present invention, the primer or probe specific to the Fig α or Scp 3 gene may be a primer or probe capable of specifically amplifying the entirety of the Fig α or Scp 3 gene or a specific region of the gene represented by SEQ ID NO: 1 or SEQ ID NO: 2 The primers or probes may be designed through methods known in the art.

The term primer in the present invention refers to a single-strand that can serve as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in suitable buffers. Oligonucleotides. Suitable lengths of primers can vary depending on various factors, such as temperature and the use of the primer. In addition, the sequence of the primer need not have a sequence that is completely complementary to some sequences of the template, it is sufficient to have sufficient complementarity within the range that can hybridize with the template to perform the primer-specific action.

Therefore, the primer in the present invention does not need to have a sequence that is perfectly complementary to the nucleotide sequence of the Fig α or Scp 3 gene, which is a template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing to the gene sequence and acting as a primer. Do. In addition, the primer according to the present invention is preferably used for the gene amplification reaction, but is not limited thereto, and most preferably in the case of Figα gene, may be a primer pair of SEQ ID NO: 3 and SEQ ID NO: 4, Scp 3 For genes, it may be a primer pair of SEQ ID NO: 5 and SEQ ID NO: 6.

The amplification reaction refers to an amplification reaction of a nucleic acid molecule, and the amplification reactions of such genes are well known in the art, for example, polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), and Liga. Aze chain reaction (LCR), electron mediated amplification (TMA), nucleic acid sequence substrate amplification (NASBA), and the like.

In the present invention, the term probra refers to a linear oligomer of natural or modified monomers or linkages, and includes deoxyribonucleotides and ribonucleotides and can specifically hybridize to a target nucleotide sequence, and is present naturally. Or artificially synthesized. The probe according to the invention may be single chain, preferably oligodioxyribonucleotides. Probes of the invention can include natural dNMPs (ie, dAMP, dGMP, dCMP and dTMP), nucleotide analogues or derivatives. In addition, the probe of the present invention may also include a ribonucleotide. For example, the probes of the present invention can be used in combination with a framework-modified nucleotide such as a peptide nucleic acid (PNA) (M. Egholm et al., Nature, 365: 566-568 (1993)), phosphorothioate DNA, phosphorodithioate DNA, phosphoamidate DNA, amide-linked DNA, MMI-linked DNA, 2'-O-methyl RNA, alpha-DNA and methylphosphonate DNA, sugar modified nucleotides such as 2'- 2'-O-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl DNA, hexose DNA, pyranosyl RNA, and anhydrohexy Tolyl DNA, and nucleotides with base modifications such as C-5 substituted pyrimidines wherein the substituents are fluoro, bromo, chloro, iodo-, methyl-, ethyl-, vinyl-, formyl-, 7-deazapurines having C-7 substituents (the substituents being fluoro, bromo, chloro, bromo, chloro, , Iodo-, me -, ethyl-, vinyl-, formyl-, alkynyl -, alkenyl-, quinolyl and quinoxalyl thiazol-, quinolyl and quinoxalyl imidazolidin -, pyridyl-), inosine, and may include a diamino purine.

In addition, in the present invention, a material capable of measuring the level of the Figα or Scp3 protein may include antibodies such as polyclonal antibodies, monoclonal antibodies, and recombinant antibodies that can specifically bind to Figα or Scp3 proteins. have.

In addition, in the present invention, Fig α or Scp3 protein has been identified as a marker composition that can determine the flounder sex as described above, the method for producing an antibody using the protein is known to those skilled in the art It can be manufactured easily using a technique. For example, polyclonal antibodies can be produced by methods well known in the art that inject the Figα or Scp3 antigen into an animal and draw a blood from the animal to obtain a serum comprising the antibody, such polyclonal antibodies are goats, rabbits. And sheep, monkeys, horses, pigs, cattle, dogs and the like. In the case of monoclonal antibodies, the hybridoma method (Kohler et al., European Jounral of Immunology , 6, 511-519, 1976) or phage antibody libraries (Clackson et al, Nature , 352, 624-628, 1991, Marks et al, J. Mol . Biol ., 222: 58 , 1-597, 1991). In addition, the antibodies according to the invention may comprise functional fragments of antibody molecules, as well as complete forms having two full length light chains and two full length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.

In addition, the present invention can provide a kit for determining the flounder sex composition comprising a composition for determining the flounder to measure the expression level of Figα or Scp3 protein or gene encoding the same.

The composition for determining the flounder included in the kit for determining the flounder of the present invention may include a primer, a probe or an antibody capable of measuring the expression level of Figα or Scp3 protein or a gene encoding the same, the definition of which As described.

If the kit for discriminating the flounder of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally contain reagents necessary for PCR amplification, such as buffers, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus). (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or thermally stable DNA polymerase obtained from Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs, wherein the kit for determining the flounder of the present invention When applied to assays, the kits of the invention may optionally comprise a substrate of a secondary antibody and a label. Furthermore, the kits according to the invention can be produced in a number of separate packaging or compartments comprising the reagent components described above.

In addition, the present invention provides a microarray for determining the flounder sex composition comprising a composition for determining the flounder can measure the expression level of Fig α or Scp3 protein or gene encoding the same.

In the microarray of the present invention, primers, probes or antibodies capable of measuring the expression level of Figα or Scp3 proteins or genes encoding them are used as hybridizable array elements and immobilized on substrates. do. Preferred substrates may include suitable rigid or semi-rigid supports, such as membranes, filters, chips, slides, wafers, fibers, magnetic beads or nonmagnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. have. The hybridization array element is arranged and immobilized on the substrate, and such immobilization can be performed by a chemical bonding method or a covalent binding method such as UV. For example, the hybridization array element can be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bonded by UV at the polylysine coating surface. In addition, the hybridization array element can be coupled to the substrate via a linker (eg, ethylene glycol oligomer and diamine).

On the other hand, when the sample to be applied to the microarray of the present invention is a nucleic acid can be labeled (labeled), it can be hybridized with the array element on the microarray. Hybridization conditions may vary, and detection and analysis of the degree of hybridization may vary depending on the labeling substance.

In addition, the present invention can provide a method for determining the sex of the flounder by measuring the expression level of Figα or Scp3 gene, or Figα or Scp3 protein level, the method of Figα or Scp3 gene present in a biological sample It may include measuring the degree of expression or the amount of protein coated by the gene.

At this time, the control result, that is, a male flounder as a control when measuring the level of Figα gene or protein as a control, and a female flounder as a control when measuring the level of the Scp3 gene or protein as a control, and the control group of each control group It may comprise the step of comparing the gene expression level or the amount of protein. The method for measuring the expression level or Figα or Scp3 protein level of Fig α or Scp3 gene in the above may be carried out including a known process for separating mRNA or protein from biological samples using known techniques.

In addition, the method of determining the flounder according to the present invention, when a biological sample analysis of the flounder population of the experimental group as described above, Figα gene or protein is expressed, the flounder may be determined to be female, when the Scp3 gene or protein is expressed The method may further include determining to be a male. Figα is excessively expressed in females and Scp3 is expressed in males, and there is no or very little expression of the gene (or protein) in each control group.

In the present invention, the "biological sample" refers to a sample collected from the flounder population, but is not limited thereto, and may include, for example, tissue, cells, blood, serum, plasma, saliva and urine. Most preferably, it may be a biological sample extracted from the gonads of the flounder.

The expression level of the Figα or Scp3 gene is preferably to measure the level of mRNA, the method of measuring the level of mRNA reverse transcription polymerase chain reaction (RT-PCR), real-time reverse transcription polymerase chain reaction, RNase protection Assays, northern blots and DNA chips, and the like.

In addition, in the method for detecting the flounder sex according to the present invention, the biological sample to be used may preferably be a fry after 50-60 days of age after hatching in which the flounder has been incubated or extracted from the adult fish.

The measurement of the Figα or Scp3 protein level can be performed using an antibody, in which case the Figα or Scp3 marker protein in the biological sample and the antibody specific to it form a binding, ie an antigen-antibody complex, Formation can be measured quantitatively through the magnitude of the signal of the detection label. Such a detection label may be selected from the group consisting of enzymes, fluorescent materials, ligands, luminescent materials, microparticles, redox molecules and radioisotopes, but is not limited thereto. Analytical methods for measuring protein levels include, but are not limited to, Western blot, ELISA, radioimmunoassay, radioimmunoassay, oukteroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, Complement fixation assays, FACS, protein chips, and the like.

Therefore, the flounder sex discrimination marker composition, the flounder sex discrimination composition, and the flounder sex discrimination method according to the present invention provide a genetic method for discriminating the specificity of “flounder”, among other fish. It works.

According to an embodiment of the present invention, Fig. And Scp3 genes, which are identified by the inventors of the flounder sex discriminator marker gene, have been proved to have a sex discrimination effect. First, the actual Figα and Scp3 genes of the flounder identified by the present inventors do not have a high degree of genetic homology, compared with other fish species, so that the specificity of the base and amino acid sequence of the flounder is relatively recognized. See Table 3).

In particular, the scp3 gene is known as a gene involved in meiosis, and it is known that the pod is also expressed in females. However, through the above studies, the inventors confirmed for the first time that the fig α gene in the halibut is expressed in female ovary, and the scp3 gene has species specificity in male testis-specific expression.

Furthermore, the inventors analyzed the degree of Figα and Scp3 gene expression only in the flounder compared to other fish species. As a result, the Figα gene was only strongly expressed in the females of the flounder and the Scp3 gene was only strongly expressed in the males of the flounder. I could confirm that. For reference, the other groups included fish species such as red snapper, yellowtail, and zodiac rockfish (Urug), which are the representative sashimi fish in Korea along with the flounder, which are being actively farmed along with the flounder. Fish species (see Example 2).

The specific primer used in the gene expression analysis, that is, the PCR experiment was a primer specially prepared by the present inventors, in the present invention includes an intron region during primer production to increase the sex discrimination effect by measuring the more accurate expression of the gene. It was made to. The reason for this is that genomic DNA is frequently introduced when RNA is extracted from biological tissue, and it can be amplified together in real-time quantitative gene lamella reaction to greatly affect final expression results and accuracy. Therefore, in order to prevent errors due to contamination of genomic DNA, each intron region and position of the mRNA gene (exon only) of the scp3 and fig α genes are identified, and at least one of the forward and reverse primers is identified. By making one or more regions necessarily include the intron region, it was realized that the primer did not detect genomic DNA, but accurately selected only mRNA, resulting in amplification, and as a result, the flounder gender discrimination effect was as shown in one embodiment of the present invention. The road was maximized.

Therefore, the flounder sex discrimination marker composition, sex discrimination composition and sex discrimination method based on the Figα or Scp3 gene of the flounder according to the present invention effectively detect the degree of gene expression or the amount of the expressed protein, This makes it possible to accurately verify the sex discrimination of flounder which cannot be discriminated from sex.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited to these examples.

< Example  1>

Flounder Fig alpha and Scp3  Analyzing the Sex of Genes

<1-1> Female and male of flounder In the freshness  Specifically expressing Fig α and Scp3  Gene isolation

CDNA was synthesized using PrimeScript ^TM RT reagent Kit (Takara, Japan) with 0.5 ㎍ of total RNA extracted from the halibut's gonads as a template. Oligo dT Primer 0.5 μl, Rnadom 6mers 0.5 μl, PrimeScript ^TM 0.5 μl RT Enzyme mix and 5 × PrimeScript ^TM After adding 2 μl of buffer to adjust the total volume of 10 μl into sterile distilled water, reverse transcription was performed at 37 ° C. for 15 minutes and the reaction was stopped at 85 ° C. for 5 seconds. Each synthesized cDNA was used by diluting the final volume to 50 μl by adding 40 μl of sterile distilled water to prevent over-amplification by real-time quantitative PCR.

In order to identify Figα nucleotide sequence, which is a female-specific expression gene of halibut among the cDNA prepared above, the nucleotide sequences of the accession number (AF128805) and the pufferfish (accession number, EU723769) listed in the NCBI (International Biotechnology Information Center) The primer was designed and fabricated based on the Scp3 base sequence, a male-specific expression gene of the flounder, based on the base sequence information of the trout (accession number, AB162905) and trout (accession number, DQ683743). See Table 1).

Primer set for figα and Scp3 gene sequencing primer Sequence (5'-3 ') SEQ ID NO: Figα-cF CAGVGGMRGAATTAATGAGC 3 Figα-cR ACYAGYCTGSTCATATCTCC 4 Scp3-cF CASAAACTGGAGCAGCTGTG 5 Scp3-cR GACWGTGGCCATCTCYTGYT 6

The primer sets and PCR amplified gene products of the genes prepared as described above were purified, subcloned into pGEM-T easy vector (Promega, USA), and partial sequencing was confirmed through mass replication. As a result, Fig. Nucleotide sequence of the flounder was found to be 166 amino acids encoded in 500 bp nucleic acid, and Scp3 sequence of the flounder was confirmed that 123 amino acids were encoded in 369 bp nucleic acid. The base sequence of the Figα gene isolated and identified in the present invention is described in SEQ ID NO: 1, the base sequence of the Scp3 gene is described in SEQ ID NO: 2.

<1-2> Fig α and Scp3  Gene primer  Production and real time quantification PCR  analysis

Primer sets were prepared for real-time quantitative gene amplification in the partial nucleotide sequence of Figα and Scp3 genes in the flounder. The primers are designed to have amplification sequences of about 80 to 150 bp in each gene, and at least one of the forward and reverse primers contains genomic DNA introns to prevent expression of contaminated genomic DNA introduced into the sample tissue. Primers were designed (see Table 2).

Primer set for real-time quantitative gene amplification of Scp3 genes primer Sequence (5'-3 ') SEQ ID NO: Figα-rtF GCTGAGAATCCGGAACTTGA 7 Figα-rtR AGCTTTGAGCGTGTCCACTT 8 Scp3-rtF TGGAGAAGAGCCATGACAGC 9 Scp3-rtR TGTTGTTGTGTGTCCATGAGG 10 18s rRNA-rtF AAACGGCTACCACATCCAAG 11 18s rRNA-rtR GGCCTCGAAAGAGTCCTGTA 12

The composition of the reaction solution for real-time quantitative PCR using the primers was added 4 μl of cDNA (40 ng) extracted from each gonad tissue of the flounder, 10 μl of 2 × SYBR Premix Ex Taq, The final volume of 20 μl was made by mixing 0.8 μl of primer sets (10 pM / μl) of Figα and Scp3 genes and sterile distilled water. PCR reaction conditions for gene amplification were amplified in real time by repeating a total of 40 times, 5 seconds at 95 ° C, 30 seconds at 60 ° C and the expression amount of each sample was investigated. For the quantitative analysis, the expression levels of Figα and Scp3 genes according to the present invention were compared and quantified based on the expression level of 18s rRNA, a kind of housekeeping gene of flounder as a control gene. The PCR was performed using SYBR Premix Ex Taq II kit (Takara) and CFX96 ^™ Real-Time System (BIO-RAD, USA).

As shown in FIG. 1, a result of analysis of relative expression of 18α rRNA expression level, which is a housekeeping gene and Figα and Scp3 expression by real-time quantitative gene amplification reaction, was performed on gonads extracted from a total of 14 flounder. Strongly expressed in SEQ ID NOs: 2, 3, 5, 6, 7, 9, 10, 11, 12, 14, and the Scp3 gene showed strong expression in other IDs 1, 4, 8, 13. Therefore, according to the present invention, 2, 3, 5, 6, 7, 9, 10, 11, 12, 14 individuals with strong expression of Figα gene are female flounder, and 1, 4, 8, 13 with strong expression of Scp3 gene. Burn's individual was found to be male flounder.

<1-3> Reconfirmation of sex determination results through histologic analysis

In order to confirm whether the sex discrimination result of the subjects identified in the above example is certain, the gonad tissues of the olive flounder are actually collected, and the histological analysis confirms the presence of oocytes produced in the ovary or sperm cells produced in the testis. It was. In the above embodiment, if the individual determined as a female is really female, oocytes should be present, and if the individual determined to be a male is really male, hair cells should be present.

To this end, the present inventors first extracted the gonad tissue from the flounder to prepare a slice of 1 ~ 2 mm thickness and fixed in a bouin's solution for 24 hours. The fixed tissue sections were washed and dehydrated and embedded in paraffin, and the embedded tissues were prepared by paraffin sectioning, and then sections were attached to the slide glass. Hematoxylin and 0.5% eosin were used for comparative staining of the nucleus and cytoplasm and observed by light microscopy.

As shown in FIG. 2, the results of reconfirmation of the sex-female discrimination by microscopic examination of the presence of oocytes or spermatocytes in the gonad using a histological method for 14 identical individuals were performed. The presence of oocytes was observed in 5, 6, 7, 9, 10, 11, 12, and 14, and in the other individuals 1, 4, 8, and 13, the hair cells were observed.

Therefore, based on the above results, it was found that 10 out of 14 flounders of the present experimental population were females and 4 were males. Furthermore, Figα gene is a gene specifically expressed in the germline of females with oocytes. , Scp3 gene was found to be a gene that is specifically expressed in the gonads of males with hair cells.

< Example  2>

Sex discrimination of flounder As a marker Fig alpha and Scp3  Genetic Flounder Specificity Verification

<2-1> with other fish Fig alpha and Scp3  Gene Homology  comparison analysis

Through the above examples, the inventors first isolated the Figα and Scp3 genes in the flounder and revealed their nucleotide sequences. If the sex discrimination genes Figα and Scp3 genes according to the present invention have a high degree of homology in other fish species and on the flounder, this is a gene specifically expressed only in the flounder and a primer for detecting the expression level thereof. It was judged that there is a high possibility that the specificity of a composition such as a probe cannot be recognized. Therefore, the present inventors analyzed the degree of homology through the actual sequencing of the Figα and Scp3 genes, which are known in the flounder and the Figα and Scp3 genes known in other fish species, in particular amino acid sequence analysis. .

As a result, it was confirmed that the Figα gene of the flounder identified in the present invention is composed of 166 amino acids represented by SEQ ID NO: 13, the Scp3 gene of the flounder identified in the present invention is 123 amino acids represented by SEQ ID NO: 14 It could be confirmed that the configuration.

As a result of confirming the amino acid sequence of the flounder figα and scp3 genes with the previously known fish by NCBI Blast search, as shown in Table 3 below, the flounder figα amino acid sequence is red snapper, mollusk, larva, It shows a somewhat low homology of about 81 ~ 91% with figαα amino acid sequence of other fish such as apron. It was very low at 69 ~ 78%. Therefore, the figα and scp3 genes of the flounder identified in the present invention are considered to have high species specificity, and NCBI will be registered later.

Comparison of Homology Between Figα and Scp3 Genes in Flounder and Other Fishes Homology with homology figα (%) Homology with flounder scp3 (%) Red snapper figα 91 Killer scp3 78 Dragonfly figα 88 Rainbow trout scp3 75 Killifish figα 84 Zebrafish scp3 69 Self-defense figα 81

<2-2> other In fish Fig alpha and Scp3  Comparison of gene expression levels and according to the present invention Primer  Flounder specificity analysis

In the above example, the Figα and Scp3 genes identified in the present invention were found to have low homology with other fish species, and the present inventors specifically examined the expression levels of Figα and Scp3 genes in other fish. In the case of other fish, as in the case of the present invention, as in the case of females, the gene of Figα is expressed a lot, and in the case of males, the expression of the Scp3 gene is a lot. Because.

Therefore, the present inventors prepared primers of Figα and Scp3 genes according to the present invention prepared in the above examples, that is, primers of a pair of Figα genes of SEQ ID NOS: 3 and 4 and primers of a pair of Scp3 genes of SEQ ID NOs: 5 and 6 The expression levels of Figα and Scp3 genes were detected in flounder, red snapper, defense, and rockfish.

As a result, as shown in Figure 3, when comparing the expression of Figα mRNA, a female-specific gene of the flounder with red snapper, defense, and zodiac rock (Urug), strong expression of the Figα gene was observed only in females of the flounder, but in other fish species. It was not expressed. In addition, as shown in Figure 4, when comparing the expression of Scp3 mRNA, a male specific gene of the flounder with red sea bream, defense, and zodiac rock (Urug), strong expression was found only in males of flounder, and the expression was very low or not in other fish species. Did.

Therefore, the above results showed that Figα and Scp3 genes were specifically overexpressed in females and males of the flounder, and the specificity and accuracy of the flounder discrimination of the primers of the genes prepared in the present invention were also confirmed. . In addition, the analysis of the expression level of Figα and Scp3 genes according to the present invention showed that it is impossible to determine the sex of other fish species.

So far I looked at the center of the preferred embodiment for the present invention. Those skilled in the art will appreciate that the present invention can be implemented in a modified form without departing from the essential features of the present invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope will be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Jeju National University <120> Compisition and method for diagnosting sex of Pa-ralichthyidae <160> 14 <170> Kopatentin 1.71 <210> 1 <211> 500 <212> DNA <213> Artificial Sequence <220> <223> Fig alpha cDNA sequence <400> 1 ggggcggaat taatgagcga catattgaag cgtctgacgg gcgagtccgc gctgcctgtg 60 tacagcaaca tagagaagtt cagacgagct aaagacggcc tgtacttcgt cgctgaggac 120 ttcaacgaaa cggtgaaaaa gagggagctg gtcaacgcca aggagcggct gagaatccgg 180 aacttgaaca ctatgttctc ccgcttgaag cgtatggtgc cactaatgcg accagaccgg 240 aaacccagta aagtggacac gctcaaagct gcaactgaat acattcgatt gcttgttgga 300 gttttgcaag acactgacag tcatgatggc agtggcactg atttcctaaa gaatgcaatc 360 acttatggtc agactgaagg tttgagcaat gacctatgga gaatggatga tcttttgaac 420 atgtcagatg agtgcatgga agatggattc actctgcctc cagaaccagt aacagaggac 480 ggagatatga ccagactagt 500 <210> 2 <211> 369 <212> DNA <213> Artificial Sequence <220> Scp3 cDNA sequence <400> 2 cacaaactgg agcagctgtg gagcaactat cacggccaga ggcagaagat gagccagcag 60 tactctctgc aggtgtccac agcgctgcag cagtgggaga ctgaagccca gagagctgag 120 gagcaggagg agaagctcaa caatctgttc agacagcagc agaagatcct gcagcaggcc 180 agagtcgtgc agaaccagaa gctgaagacg gtcagagagc tgtacgagct gtttgtgaag 240 aacatggagg atatggagaa gagccatgac agcttcctgc agggagcgca acaagagctg 300 aggaaggaga tggccaccct gcagaagaag atcctcatgg acacacaaca acaagagatg 360 gccacagtc 369 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fig a-cF primer <400> 3 cagvggmrga attaatgagc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> Fig a-cR primer <400> 4 acyagyctgs tcatatctcc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Scp3-cF primer <400> 5 casaaactgg agcagctgtg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Scp3-cR primer <400> 6 gacwgtggcc atctcytgyt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> Fig a-rtF primer <400> 7 gctgagaatc cggaacttga 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fig a-rtR primer <400> 8 agctttgagc gtgtccactt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Scp3-rtF primer <400> 9 tggagaagag ccatgacagc 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Scp3-rtR primer <400> 10 tgttgttgtg tgtccatgag g 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s rRNA-rtF primer <400> 11 aaacggctac cacatccaag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s rRNA-rtR primer <400> 12 ggcctcgaaa gagtcctgta 20 <210> 13 <211> 166 <212> PRT <213> Artificial Sequence <220> <223> Fig alpha peptide sequence <400> 13 Gly Ala Glu Leu Met Ser Asp Ile Leu Lys Arg Leu Thr Gly Glu Ser   1 5 10 15 Ala Leu Pro Val Tyr Ser Asn Ile Glu Lys Phe Arg Arg Ala Lys Asp              20 25 30 Gly Leu Tyr Phe Val Ala Glu Asp Phe Asn Glu Thr Val Lys Lys Arg          35 40 45 Glu Leu Val Asn Ala Lys Glu Arg Leu Arg Ile Arg Asn Leu Asn Thr      50 55 60 Met Phe Ser Arg Leu Lys Arg Met Val Pro Leu Met Arg Pro Asp Arg  65 70 75 80 Lys Pro Ser Lys Val Asp Thr Leu Lys Ala Ala Thr Glu Tyr Ile Arg                  85 90 95 Leu Leu Val Gly Val Leu Gln Asp Thr Asp Ser His Asp Gly Ser Gly             100 105 110 Thr Asp Phe Leu Lys Asn Ala Ile Thr Tyr Gly Gln Thr Glu Gly Leu         115 120 125 Ser Asn Asp Leu Trp Arg Met Asp Asp Leu Leu Asn Met Ser Asp Glu     130 135 140 Cys Met Glu Asp Gly Phe Thr Leu Pro Pro Glu Pro Val Thr Glu Asp 145 150 155 160 Gly Asp Met Thr Arg Leu                 165 <210> 14 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Scp3 peptide sequence <400> 14 His Lys Leu Glu Gln Leu Trp Ser Asn Tyr His Gly Gln Arg Gln Lys   1 5 10 15 Met Ser Gln Gln Tyr Ser Leu Gln Val Ser Thr Ala Leu Gln Gln Trp              20 25 30 Glu Thr Glu Ala Gln Arg Ala Glu Glu Gln Glu Glu Lys Leu Asn Asn          35 40 45 Leu Phe Arg Gln Gln Gln Lys Ile Leu Gln Gln Ala Arg Val Val Gln      50 55 60 Asn Gln Lys Leu Lys Thr Val Arg Glu Leu Tyr Glu Leu Phe Val Lys  65 70 75 80 Asn Met Glu Asp Met Glu Lys Ser His Asp Ser Phe Leu Gln Gly Ala                  85 90 95 Gln Gln Glu Leu Arg Lys Glu Met Ala Thr Leu Gln Lys Lys Ile Leu             100 105 110 Met Asp Thr Gln Gln Gln Glu Met Ala Thr Val         115 120

Claims (15)

Flounder sex discriminating marker composition consisting of Figα gene or Figα protein encoded from the gene. The method of claim 1,
The figα gene has a halibut sex discrimination marker composition, characterized in that it has a nucleotide sequence of SEQ ID NO: 1. Olive flounder discriminating marker composition comprising the Scp3 gene or Scp3 protein encoded from the gene. The method of claim 3,
The Scp3 gene has a halibut sex discrimination marker composition, characterized in that it has a nucleotide sequence of SEQ ID NO: 2. Composition for discriminating flounder comprising a substance measuring the level of Figα gene or Figα protein. The method of claim 5,
The substance measuring the level of the Figα gene or Figα protein may include a primer or a probe capable of amplifying the Figα gene; Or composition for discriminating halibut, characterized in that the antibody specifically binding to Fig α protein. The method according to claim 6,
The primer is a halibut sex discrimination composition, characterized in that the primer pair of SEQ ID NO: 3 and 4. Composition for discriminating flounder comprising a substance for measuring the level of the Scp3 gene or Scp3 protein. 9. The method of claim 8,
The substance for measuring the level of the Scp3 gene or Scp3 protein may include a primer or probe capable of amplifying the Scp3 gene; Or flounder sex composition, characterized in that the antibody specifically binding to Scp3 protein. 10. The method of claim 9,
The primer is a halibut sex discrimination composition, characterized in that the primer pair of SEQ ID NO: 5 and 6. The method of determining sex of the flounder, comprising measuring the expression of the Figα gene or protein present in the biological sample, or the expression level of the Scp3 gene or protein. The method of claim 11,
Determining that the Figα gene or protein is expressed as a female, and if the Scp3 gene or protein is expressed further comprises the step of determining the sex of the flounder. The method of claim 11,
The biological sample is a sex determination method of the flounder, characterized in that extracted from the gonads of the flounder. The method of claim 13,
The flounder is a flounder sex discrimination method, characterized in that 50-60 days of age or fry. The method of claim 11,
The measurement is reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA). : Sex discrimination method of flounder characterized in that it is selected from the group consisting of radioimmunoassay, radioimmunodiffusion, immunoprecipitation assay and immunohistochemical analysis.

Images