KR20120119211A - Gene implicated in drought stress tolerance and transformed plants with the same - Google Patents

Gene implicated in drought stress tolerance and transformed plants with the same Download PDF

Info

Publication number
KR20120119211A
KR20120119211A KR1020120113637A KR20120113637A KR20120119211A KR 20120119211 A KR20120119211 A KR 20120119211A KR 1020120113637 A KR1020120113637 A KR 1020120113637A KR 20120113637 A KR20120113637 A KR 20120113637A KR 20120119211 A KR20120119211 A KR 20120119211A
Authority
KR
South Korea
Prior art keywords
atairp1
gene
plant
dna
sequence
Prior art date
Application number
KR1020120113637A
Other languages
Korean (ko)
Other versions
KR101720289B1 (en
Inventor
김우택
조석근
유문영
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Priority to KR1020120113637A priority Critical patent/KR101720289B1/en
Publication of KR20120119211A publication Critical patent/KR20120119211A/en
Application granted granted Critical
Publication of KR101720289B1 publication Critical patent/KR101720289B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance

Abstract

PURPOSE: A drought stress tolerance related gene and a composition containing the same for enhancing the drought stress tolerance of a plant are provided to obtain a novel functional plant with drought tolerance. CONSTITUTION: A composition for promoting plant germination contains a nucleic acid molecule which suppresses a nucleotide sequence encoding an amino acid of sequence number 2. The nucleotide sequence contains a nucleotide sequence of sequence number 1. The nucleic acid molecule includes T-DNA, siRNA, shRNA, miRNA, ribozyme, or antisense oligonucleotide. A composition for enhancing drought stress tolerance of a plant contains the nucleic acid molecules.

Description

건조 스트레스 저항성 관련 유전자 및 형질전환 식물체{Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same}Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same}

본 발명은 건조 스트레스 저항성 관련 유전자 및 상기 유전자로 형질전환된 식물체에 관한 것이다.
The present invention relates to a dry stress resistance-related gene and a plant transformed with the gene.

유비퀴틴은 모든 진핵생물에서 발현되는 76개의 아미노산으로 구성된 단백질로써, E1-E2-E3(유비퀴틴 활성화, 유비퀴틴 결합, 유비퀴틴 연결효소) 연쇄 효소반응에 의해서 다양한 기질 단백질에 공유결합이 되는 특성을 가진다. 유비퀴틴이 붙게 되는 기질 단백질은 매우 다양하여 세포 내의 거의 모든 생리활동에 영향을 주며, 많은 질병이 이러한 기작과 연결되어져 있다는 연구결과들이 잘 밝혀져 있다. 유비퀴틴의 처음 알려진 기능은 다른 단백질에 결합함으로써 단백질의 분해를 촉진하는 것이었으나 최근 들어 유비퀴틴의 다른 기능들이 속속 밝혀지고 있다.Ubiquitin is a protein composed of 76 amino acids expressed in all eukaryotes, and has the property of being covalently bonded to various substrate proteins through an E1-E2-E3 (ubiquitin activation, ubiquitin binding, ubiquitin linking enzyme) chain enzyme reaction. The matrix protein to which ubiquitin is attached is so diverse that it affects almost all physiological activities in cells, and studies have shown that many diseases are linked to this mechanism. The first known function of ubiquitin was to promote the breakdown of proteins by binding to other proteins, but other functions of ubiquitin have been discovered one after another.

유비퀴틴은 세 종류의 단백질, 즉 E1, E2 및 E3의 순차적인 작용에 의해 기질에 결합하게 된다. 유비퀴틴의 C쪽 말단 도메인에 있는 글리신이 기질 단백질의 라이신의 R기에 있는 NH3에 결합함으로써 기질과 공유 결합을 형성하게 된다. 일반적으로 유비퀴틴이 붙은 단백질은 프로테아좀에 의해 분해가 된다. 이 때, 프로테아좀에 의해 분해가 되기 위해서는 유비퀴틴이 여러 개가 붙은 폴리유비퀴틴이 기질에 붙어야 한다. 현재까지는 적어도 4개의 유비퀴틴이 결합한 폴리유비퀴틴이 기질에 붙을때만 기질의 프로테아좀 의존적인 분해가 일어난다고 알려져 있으나 이것은 in vitro 실험결과이기 때문에 논란의 여지는 있다. 프로테아좀 의존적인 분해를 일으키는 폴리유비퀴틴결합은, 유비퀴틴의 48번째 라이신에 다른 유비퀴틴이 결합하는 형태이다.Ubiquitin binds to the substrate by the sequential action of three kinds of proteins, E1, E2 and E3. Glycine in the C-terminal domain of ubiquitin binds to NH 3 in the R group of lysine of the substrate protein, thereby forming a covalent bond with the substrate. In general, the protein to which ubiquitin is attached is degraded by the proteasome. At this time, in order to be decomposed by the proteasome, polyubiquitin with several ubiquitin attached to it must be attached to the substrate. Until now at least 4, but of a poly-ubiquitin ubiquitin it is only stick to the substrate a proteasome-dependent degradation of the substrate takes place is known and this is bonded in The results of in vitro experiments are controversial. Polyubiquitin binding, which causes proteasome-dependent degradation, is a form in which another ubiquitin binds to the 48th lysine of ubiquitin.

E1 효소는 개체 내에 한 종류만이 존재하고, 개수가 가장 많다. E2는 여러 종류가 존재하고, 일반적으로 유비퀴틴을 E1에서 E3 또는 기질로 전달해주는 역할을 한다. E3는 E3 리가아제(ligase) 효소라고도 하며, 유비퀴틴을 기질에 붙게 하는 마지막 단계의 효소이다. E3가 유비퀴티네이션이 될 기질의 특이성을 결정하게 된다. 즉, 주어진 E3 효소와 상호작용할 수 있는 기질은 특이적으로 결정되어 있다. E3 효소는 크게 2가지 형태로 나눌 수 있는데, RING 도메인을 갖는 것과 HECT 도메인을 갖는 것이 그것이다. RING 도메인을 갖는 E3 효소들은 E2와 기질이 서로 가깝게 위치하도록 도와주는 역할을 한다. 즉, E2와 기질 두 물질이 E3와 결합을 하면, E2에 있는 유비퀴틴과 기질 사이에 충분히 가까운 거리가 형성되고 이 때 화학적으로 E2에 있던 유비퀴틴이 기질로 이동을 하게 된다. 반면 HECT 도메인을 갖고 있는 E3 효소에 속하는 것들은, E2에서 유비퀴틴을 전달받은 후, 이것을 기질로 이동을 시키게 된다.
There is only one type of E1 enzyme in an individual, and the number is the highest. There are several types of E2, and generally plays a role of transferring ubiquitin from E1 to E3 or to the substrate. E3, also known as the E3 ligase enzyme, is the final enzyme that attaches ubiquitin to the substrate. E3 determines the specificity of the substrate to be ubiquitinated. That is, the substrate capable of interacting with a given E3 enzyme has been specifically determined. The E3 enzyme can be divided into two types, one having a RING domain and one having an HECT domain. The E3 enzymes with the RING domain play a role in helping E2 and the substrate to be located close to each other. That is, when the two substances E2 and the substrate bind to E3, a sufficiently close distance is formed between the ubiquitin in E2 and the substrate, and at this time, the ubiquitin in E2 is chemically transferred to the substrate. On the other hand, those belonging to the E3 enzyme that has the HECT domain, after receiving ubiquitin from E2, transfers it to the substrate.

유비퀴틴의 63번째 라이신을 통한 폴리유비퀴틴 사슬은 신호 전달에 관여하는 것으로 알려져 있다. 대표적인 것으로는 염증 반응을 유발하는 NF-κB 의 활성화가 있다. 이 뿐만 아니라, 세포막의 엔도사이토시스(endocytosis)에는 유비퀴틴 한 분자가 붙어 관여하는 것이 알려져 있고, 전사가 일어나는 과정에 DNA의 올바른 전사를 결정하는 TCR(transcription coupled repair)에도 유비퀴틴이 관여하는 것으로 알려져 있다.The polyubiquitin chain through the 63rd lysine of ubiquitin is known to be involved in signal transduction. A typical example is the activation of NF-κB that induces an inflammatory response. In addition, it is known that one molecule of ubiquitin is attached to and involved in endocytosis of the cell membrane, and it is known that ubiquitin is also involved in TCR (transcription coupled repair), which determines the correct transcription of DNA in the process of transcription. .

유비퀴티네이션은 식물 뿐 아니라 모든 고등 생명체가 가지는 하나의 메카니즘으로써, 다양한 기능을 담당하고 있는 것으로 알려져 있으나, 비생물학적 스트레스에 관여하는 유전자는 거의 알려진 바가 없다. 본 발명은 애기장대의 비생물학적 스트레스 및 ABA 호르몬에 의해 발현이 유도되는 AtAIRP1 유전자를 분리획득 한 후, 이들 유전자의 과다발현 형질전환체 및 발현 억제 돌연변이체를 제작하여 이들의 생리적인 표현형을 분석하였다.
Ubiquitination is a mechanism that not only plants but all higher life organisms have, and is known to play a variety of functions, but little is known about genes involved in abiotic stress. The present invention analyzed the physiological phenotype of the AtAIRP1 gene, which is induced by the abiotic stress of Arabidopsis thaliana, and the ABA hormone, and then the overexpression transformant and the expression inhibiting mutant were prepared. .

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
Throughout this specification, a number of papers and patent documents are referenced and citations are indicated. The disclosure contents of cited papers and patent documents are incorporated by reference in this specification as a whole, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly described.

본 발명자들은 식물체의 건조 스트레스에 대한 저항성을 향상시킬 수 있는 유전자를 발굴하고자 예의 연구 노력하였다. 그 결과, 서열목록 제2서열의 아미노산 서열을 코딩하는 뉴클레오타이드 서열, 바람직하게는 서열목록 제1서열의 뉴클레오타이드 서열이 상술한 식물체의 형질에 관여를 하고 이를 식물체에 형질전환시킨 경우 상술한 개선된 형질을 갖는 형질전환 식물체를 수득할 수 있음을 확인하였으며, 뿐만 아니라 상기 뉴클레오타이드 서열의 발현 억제가 식물체의 발아를 촉진시킨다는 사실을 확인함으로써, 본 발명을 완성하게 되었다.The present inventors have made intensive research efforts to discover genes that can improve the resistance to drying stress of plants. As a result, when the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, preferably the nucleotide sequence of SEQ ID NO: 1 is involved in the above-described plant trait and transformed into the plant, the above-described improved trait It was confirmed that a transgenic plant having a can be obtained, as well as the fact that inhibition of the expression of the nucleotide sequence promotes the germination of the plant, thereby completing the present invention.

따라서 본 발명의 목적은 식물체의 건조 스트레스 저항성 증진용 조성물을 제공하는 데 있다.Accordingly, an object of the present invention is to provide a composition for improving the resistance to dry stress of plants.

본 발명의 다른 목적은 건조 스트레스 저항성이 증진된 형질전환 식물체를 제조하는 방법을 제공하는 데 있다. Another object of the present invention is to provide a method for producing a transgenic plant with improved resistance to dry stress.

본 발명의 또 다른 목적은 식물체의 건조 스트레스 저항성 증진 방법을 제공하는 데 있다. Another object of the present invention is to provide a method for improving the resistance to dry stress of plants.

본 발명의 또 다른 목적은 식물체의 발아 촉진용 조성물을 제공하는 데 있다. Another object of the present invention is to provide a composition for promoting the germination of plants.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
Other objects and advantages of the present invention will become more apparent by the following detailed description, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 서열목록 제2서열의 아미노산 서열을 코딩하는 뉴클레오타이드 서열을 포함하는 식물체의 건조 스트레스 저항성 증진용 조성물을 제공한다.
According to one aspect of the present invention, the present invention provides a composition for enhancing dry stress resistance of a plant comprising a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 2.

본 발명자들은 식물체의 건조 스트레스 저항성을 향상시킬 수 있는 유전자를 발굴하고자 예의 연구 노력하였다. 그 결과, 서열목록 제2서열의 아미노산 서열을 코딩하는 뉴클레오타이드 서열 바람직하게는 서열목록 제1서열의 뉴클레오타이드 서열이 상술한 식물체의 형질에 관여를 하고 이를 식물체에 형질전환시킨 경우에는 상술한 개선된 형질을 갖는 형질전환 식물체를 수득할 수 있음을 확인하였다.
The present inventors have made intensive research efforts to discover genes that can improve the drying stress resistance of plants. As a result, when the nucleotide sequence encoding the amino acid sequence of Sequence Listing 2, preferably the nucleotide sequence of Sequence Listing 1, is involved in the above-described plant trait and transformed into the plant, the above-described improved trait It was confirmed that a transgenic plant having a can be obtained.

본 발명의 바람직한 구현예에 따르면, 식물체의 건조 스트레스 저항성 증진을 위하여 사용되는 뉴클레오타이드 서열은 서열목록 제1서열의 뉴클레오타이드 서열이다.According to a preferred embodiment of the present invention, the nucleotide sequence used for enhancing the dry stress resistance of the plant is the nucleotide sequence of the first sequence of the sequence listing.

본 발명에서 이용되는 뉴클레오타이드 서열은 첨부한 서열목록에 기재된 뉴클레오타이드 서열에 한정되지 않는다는 것은 당업자에게 명확하다.It is clear to those skilled in the art that the nucleotide sequence used in the present invention is not limited to the nucleotide sequence described in the attached sequence listing.

뉴클레오타이드에서의 변이는 단백질에서 변화를 가져오지 않는 것도 있다. 이러한 핵산은 기능적으로 균등한 코돈 또는 동일한 아미노산을 코딩하는 코돈 (예를 들어, 코돈의 축퇴성에 의해, 아르기닌 또는 세린에 대한 코돈은 여섯 개이다), 또는 생물학적으로 균등한 아미노산을 코딩하는 코돈을 포함하는 핵산분자를 포함한다. In some cases, variations in nucleotides do not result in changes in proteins. Such nucleic acids include functionally equivalent codons or codons encoding the same amino acid (e.g., by the degeneracy of codons, there are six codons for arginine or serine), or codons encoding biologically equivalent amino acids. It includes a nucleic acid molecule.

상술한 생물학적 균등 활성을 갖는 변이를 고려한다면, 본 발명에서 이용되는 핵산 분자는 서열목록에 기재된 서열과 실질적인 동일성(substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, 상기한 본 발명의 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 60%의 상동성, 보다 바람직하게는 70%의 상동성, 보다 더 바람직하게는 80%의 상동성, 가장 바람직하게는 90%의 상동성을 나타내는 서열을 의미한다. 서열비교를 위한 얼라인먼트 방법은 당업계에 공지되어 있다. 얼라인먼트에 대한 다양한 방법 및 알고리즘은 Smith and Waterman, Adv . Appl . Math . 2:482(1981); Needleman and Wunsch, J. Mol . Bio . 48:443(1970); Pearson and Lipman, Methods in Mol . Biol . 24: 307-31(1988); Higgins and Sharp, Gene 73:237-44(1988); Higgins and Sharp, CABIOS 5:151-3(1989); Corpet et al., Nuc . Acids Res . 16:10881-90(1988); Huang et al., Comp . Appl . BioSci . 8:155-65(1992) and Pearson et al., Meth . Mol . Biol . 24:307-31(1994)에 개시되어 있다. NCBI Basic Local Alignment Search Tool(BLAST)(Altschul et al., J. Mol . Biol . 215:403-10(1990))은 NBCI(National Center for Biological Information) 등에서 접근 가능하며, 인터넷 상에서 blastp, blasm, blastx, tblastn and tblastx와 같은 서열 분석 프로그램과 연동되어 이용할 수 있다. BLSAT는 http://www.ncbi.nlm.nih.gov/BLAST/에서 접속 가능하다. 이 프로그램을 이용한 서열 상동성 비교 방법은 http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html에서 확인할 수 있다.
Considering the above-described mutation having biologically equivalent activity, it is interpreted that the nucleic acid molecule used in the present invention also includes a sequence exhibiting substantial identity with the sequence listed in the sequence listing. The actual identity of the above is at least 60% when the sequence of the present invention and any other sequence described above are aligned to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. It means a sequence that exhibits homology, more preferably 70% homology, even more preferably 80% homology, and most preferably 90% homology. Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment are described in Smith and Waterman, Adv . Appl . Math . 2:482 (1981) ; Needleman and Wunsch, J. Mol . Bio . 48:443 (1970); Pearson and Lipman, Methods in Mol . Biol . 24: 307-31 (1988); Higgins and Sharp, Gene 73:237-44 (1988); Higgins and Sharp, CABIOS 5:151-3 (1989); Corpet et al., Nuc . Acids Res . 16:10881-90 (1988); Huang et al., Comp . Appl . BioSci . 8:155-65 (1992) and Pearson et al., Meth . Mol . Biol . 24:307-31 (1994). NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol . Biol . 215:403-10(1990)) can be accessed from NBCI (National Center for Biological Information), etc. It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx. The BLSAT is accessible at http://www.ncbi.nlm.nih.gov/BLAST/. A method for comparing sequence homology using this program can be found at http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html.

본 발명의 다른 양태에 따르면, 본 발명은 (a) 서열목록 제2서열의 아미노산 서열을 코딩하는 뉴클레오타이드 서열; (b)상기 뉴클레오타이드 서열에 작동적으로 결합(operatively linked)되어있고 식물세포에서 RNA 분자를 형성시키는 프로모터; 및 (c)식물세포에서 작용하여 RNA 분자의 3'-말단의 폴리아데닐화를 야기시키는 폴리 A 시그널 서열을 포함하는 식물발현용 재조합 벡터를 포함하는 식물체의 건조 스트레스 저항성 증진용 조성물을 제공한다.According to another aspect of the present invention, the present invention provides (a) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2; (b) a promoter that is operatively linked to the nucleotide sequence and forms an RNA molecule in plant cells; And (c) a recombinant vector for plant expression comprising a poly A signal sequence that acts on the plant cell to cause polyadenylation of the 3'-end of the RNA molecule.

본 명세서에서 용어 “작동적으로 결합”은 핵산 발현 조절 서열 (예: 프로모터, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 트랜스레이션을 조절하게 된다.In the present specification, the term “operably linked” refers to a functional linkage between a nucleic acid expression control sequence (eg, a promoter, a signal sequence, or an array of transcriptional regulatory factor binding sites) and another nucleic acid sequence, whereby the control sequence Controls the transcription and/or translation of the other nucleic acid sequences.

본 발명의 벡터 시스템은 당업계에 공지된 다양한 방법을 통해 구축될 수 있으며, 이에 대한 구체적인 방법은 Sambrook et al. Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Laboratory Press(2001)에 개시되어 있다.The vector system of the present invention can be constructed through various methods known in the art, and specific methods for this are described by Sambrook et al. Molecular Cloning , A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001).

본 발명에 적합한 프로모터는, 식물체의 유전자 도입을 위해 당업계에서 통상적으로 이용되는 어떠한 것도 이용될 수 있으며, 예를 들어, SP6 프로모터, T7 프로모터, T3 프로모터, PM 프로모터, 옥수수의 유비퀴틴 프로모터, 컬리플라워 모자이크 바이러스 (CaMV) 35S 프로모터, 노팔린 씬타아제 (nos) 프로모터, 피그워트 모자이크 바이러스 35S 프로모터, 수가크레인 바실리폼 바이러스 프로모터, 콤멜리나 엘로우 모틀 바이러스 프로모터, 리불로오스-1,5-비스-포스페이트 카르복실라아제 스몰 서브유티트 (ssRUBISCO)의 광유도성 프로모터, 벼 사이토졸 트리오스포스페이트 이소머라아제 (TPI) 프로모터, 아라비돕시스의 아데닌 포스포리보실트랜스퍼라아제 (APRT) 프로모터 및 옥토파인 신타아제 프로모터를 포함한다.Promoter suitable for the present invention may be any commonly used in the art for gene introduction into plants, for example, SP6 promoter, T7 promoter, T3 promoter, PM promoter, ubiquitin promoter of corn, cauliflower Mosaic virus (CaMV) 35S promoter, nopaline sintase (nos) promoter, Pigwort mosaic virus 35S promoter, Sugacrane Basiliform virus promoter, Commelina Yellow Mottle virus promoter, ribulose-1,5-bis-phosphate car Including the photoinducible promoter of the boxylase small subunit (ssRUBISCO), the rice cytosol triosphosphate isomerase (TPI) promoter, the adenine phosphoribosyltransferase (APRT) promoter from Arabidopsis, and the octopine synthase promoter. do.

본 발명의 바람직한 구현예에 따르면, 본 발명에 적합한 3'-말단의 폴리아데닐화를 야기시키는 폴리 A 시그널 서열은 아그로박테리움 투메파시엔스의 노팔린 신타아제 유전자로부터 유래된 것 (NOS 3' end) (Bevan et al. Nucleic Acids Research, 11(2):369-385(1983)), 아그로박테리움 튜머페이션스의 옥토파인 신타아제 유전자로부터 유래된 것, 토마토 또는 감자의 프로테아제 억제자 I 또는 Ⅱ 유전자의 3' 말단 부분, CaMV 35S 터미네이터 및 OCS 터미네이터(octopine synthase terminator)서열을 포함한다. 가장 바람직하게는 본 발명에 적합한 폴리아데닐화를 야기시키는 3'-말단 폴리 A 시그널 서열은 NOS 서열이다.According to a preferred embodiment of the present invention, the poly A signal sequence causing polyadenylation at the 3'-end suitable for the present invention is derived from the nopaline synthase gene of Agrobacterium tumefaciens (NOS 3'end ) (Bevan et al. Nucleic Acids Research , 11(2):369-385(1983)), derived from the octopine synthase gene of Agrobacterium tumerphasians, the 3'end portion of the protease inhibitor I or II gene of tomato or potato, CaMV 35S terminator and OCS terminator (octopine synthase terminator) sequences. Most preferably the 3'-terminal poly A signal sequence causing polyadenylation suitable for the present invention is a NOS sequence.

선택적으로, 상기 벡터는 리포터 분자(예: 루시퍼라아제 및 β-글루쿠로니다아제)를 코딩하는 유전자를 추가적으로 운반할 수 있다. 또한, 본 발명의 벡터는 선택 표지로서 항생제 (예: 네오마이신, 카베니실린, 카나마이신, 스펙티노마이신, 하이그로마이신 등) 내성 유전자 (예: 네오마이신 포스포트랜스퍼라아제 (npt Ⅱ), 하이그로마이신 포스포트랜스퍼라아제 (hpt), 등)를 포함할 수 있다.Optionally, the vector may additionally carry a gene encoding a reporter molecule (eg, luciferase and β-glucuronidase). In addition, the vector of the present invention is an antibiotic (eg, neomycin, carbenicillin, kanamycin, spectinomycin, hygromycin, etc.) resistance gene (eg, neomycin phosphotransferase ( npt II ), high Gromycin phosphotransferase (hpt ), etc.).

본 발명의 바람직한 구현예에 따르면, 본 발명의 식물발현용 재조합벡터는 아그로박테리움(Agrobacterium) 바이너리 벡터이다.According to a preferred embodiment, a recombinant vector for plant expression of the invention is Agrobacterium (Agrobacterium) binary vector.

본 명세서에서 용어“바이너리 벡터”는 Ti(tumor inducible) 플라스미드에서 이동에 필요한 부분인 LB(left border)와 RB(right border)를 가지는 플라스미드와 타겟 뉴클레오타이드를 옮기는데 필요한 유전자를 가진 플라스미드를 두 개로 나누어 놓은 벡터를 말한다. 본 발명의 형질전환용 아그로박테리움은 본 발명의 상기 뉴클레오타이드 서열의 발현에 적합한 것이면 어느 것이라도 좋고, 특히 본 발명에서 식물 형질전환용 아그로박테리움 균주로는 통상 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens)GV3101이 바람직하다. In the present specification, the term "binary vector" is a plasmid having a left border (LB) and a right border (RB), which are parts necessary for movement in a Ti (tumor inducible) plasmid, and a plasmid having a gene required to transfer the target nucleotide. Say vector. The Agrobacterium for transformation of the present invention may be any one suitable for the expression of the nucleotide sequence of the present invention. In particular, the Agrobacterium strain for plant transformation in the present invention is usually Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) GV3101 is preferred.

본 발명의 재조합 벡터를 아그로박테리움에 도입하는 방법은 당업자에게 공지된 다양한 방법을 통해 실시될 수 있으며, 예를 들면 입자 충격법(particle bombardment), 전기천공법(electroporation), 형질감염법(transfection), 리튬아세테이트법(lithium acetate method) 및 열충격법(heat shock) 등이 있다. 바람직하게는 전기천공법을 사용한다.
The method of introducing the recombinant vector of the present invention into Agrobacterium can be carried out through various methods known to those skilled in the art, for example, particle bombardment, electroporation, and transfection. ), lithium acetate method, and heat shock method. Preferably, an electroporation method is used.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 뉴클레오타이드 서열 또는 식물발현용 재조합 벡터로 형질 전환된 식물세포를 제공한다. According to another aspect of the present invention, the present invention provides a plant cell transformed with the nucleotide sequence or a recombinant vector for plant expression.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 뉴클레오타이드 서열 또는 식물발현용 재조합 벡터로 형질 전환된 식물체를 제공한다.According to another aspect of the present invention, the present invention provides a plant transformed with the nucleotide sequence or a recombinant vector for plant expression.

본 발명의 형질전환 식물세포 및 형질전환 식물체를 제조하기 위하여 당업계에 일반적으로 공지된 방법(Methods of Enzymology, Vol. 153, (1987))에 따라 실시될 수 있다. 외래성 폴리뉴클레오티드를 플라스미드나 바이러스 등과 같은 벡터 등의 운반체에 삽입하여 식물을 형질전환시킬 수 있고, 아그로박테리움 박테리아를 매개체로 사용할 수 있으며(Chilton et ai. Cell 11:263:271(1977)), 직접 외래성 폴리뉴클레오티드를 식물 세포내로 도입시켜 식물을 형질전환시킬 수 있다(Lorz et ai. Mol . Genet . 199:178-182;(1985)). 예를 들어, T-DNA 부위를 포함하지 않는 벡터를 이용하는 경우에는 전기천공법(electroporation), 입자충격법(microparticle bombardment), 폴리에틸렌 글리콜 침전법(polyethylene glycol-mediated uptake)을 이용할 수 있다. Methods generally known in the art for producing the transgenic plant cells and transgenic plants of the present invention (Methods of Enzymology , Vol. 153, (1987)). Plants can be transformed by inserting foreign polynucleotides into carriers such as plasmids or viruses, etc., and Agrobacterium bacteria can be used as mediators (Chilton et ai. Cell 11:263:271 (1977)), Plants can be transformed by directly introducing foreign polynucleotides into plant cells (Lorz et ai. Mol . Genet . 199:178-182; (1985)). For example, when a vector not containing a T-DNA site is used, an electroporation method, a microparticle bombardment method, and a polyethylene glycol-mediated uptake method may be used.

일반적으로 식물을 형질전환시킴에 있어 많이 사용되는 것이 외래성 폴리뉴클레오티드로 형질전환 된 아그로박테리움 투메페이시언스(Agrobacterium tumefaciens)로 식물 세포나 종자 등을 감염시키는 방법이다(참조: 미합중국 특허 제 5,004,863, 5,349,124 및 5,416,011 호). 당업자는 공지된 적절한 조건하에서 형질전환된 식물 세포나 종자를 배양 또는 재배하여 식물로 발육시킬 수 있다.In general, it is a method of infecting plant cells or seeds with Agrobacterium tumefaciens transformed with foreign polynucleotides that are widely used in transforming plants (see: U.S. Patent No. 5,004,863, 5,349,124 and 5,416,011). Those skilled in the art can develop a plant by culturing or cultivating transformed plant cells or seeds under known appropriate conditions.

본 명세서에서, 용어 “식물(체)”는 성숙한 식물뿐만 아니라 성숙한 식물로 발육할 있는 식물 세포, 식물 조직 및 식물의 종자 등을 모두 포함하는 의미로서 이해된다.In the present specification, the term “plant (body)” is understood to include not only mature plants but also plant cells, plant tissues, and seeds of plants that can develop into mature plants.

본 발명의 방법이 적용될 수 있는 식물체는 특별하게 제한되지 않는다. 본 발명의 방법이 적용될 수 있는 식물로는 상치, 배추, 감자 및 무를 포함하는 대부분의 쌍자엽 식물(dicotyledonous plant) 또는 벼, 보리, 바나나 등의 단자엽 식물 (monocotyledonous plant)을 모두 이용될 수 있으며, 특히 토마토와 같이 과피가 얇아 노화에 따른 품질 저하가 급격히 나타나는 식용 채소 또는 과일 그리고 잎이 주된 상품으로 거래되는 식물 등에 적용할 경우 저장 효율을 높이는 데 효과적이다. 바람직하게는, 본 발명의 방법은 벼, 밀, 보리, 옥수수, 콩, 감자, 밀, 팥, 귀리 및 수수를 포함하는 식량 작물류; 아라비돕시스, 배추, 무, 고추, 딸기, 토마토, 수박, 오이, 양배추, 참외, 호박, 파, 양파 및 당근을 포함하는 채소 작물류; 인삼, 담배, 목화, 참깨, 사탕수수, 사탕무우, 들깨, 땅콩 및 유채를 포함하는 특용작물류; 사과나무, 배나무, 대추나무, 복숭아, 양다래, 포도, 감귤, 감, 자두, 살구 및 바나나를 포함하는 과수류; 장미, 글라디올러스, 거베라, 카네이션, 국화, 백합 및 튤립을 포함하는 화훼류; 및 라이그라스, 레드클로버, 오차드그라스, 알파알파, 톨페스큐 및 페레니얼라이그라스를 포함하는 사료작물류로 구성된 군으로부터 선택되는 식물체에 적용된다.
Plants to which the method of the present invention can be applied are not particularly limited. As plants to which the method of the present invention can be applied, most dicotyledonous plants including lettuce, Chinese cabbage, potatoes and radishes, or monocotyledonous plants such as rice, barley, and banana may be used. It is effective in enhancing storage efficiency when applied to edible vegetables or fruits that have a sharp decline in quality due to aging due to the thin skin like tomatoes, and plants whose leaves are traded as a main product. Preferably, the method of the present invention comprises food crops including rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, oats and sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion and carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut and rapeseed; Fruit trees including apple tree, pear tree, jujube tree, peach, parsley, grapes, tangerines, persimmons, plums, apricots and bananas; Flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And forage crops including ryegrass, red clover, orchardgrass, alpha alpha, tall fescue and perennial ryegrass.

본 발명의 또 다른 양태에 따르면, 본 발명은 다음의 단계를 포함하는 건조 스트레스 저항성이 증진된 형질전환 식물체를 제조하는 방법을 제공한다: According to another aspect of the present invention, the present invention provides a method for producing a transgenic plant with improved resistance to dry stress, comprising the following steps:

(a) 본 발명의 뉴클레오타이드 또는 식물발현용 재조합 벡터를 식물 세포에 도입시키는 단계; 및 (a) introducing the nucleotide or the recombinant vector for plant expression of the present invention into plant cells; And

(b) 상기 식물세포로부터 건조 스트레스 저항성이 증진된 형질전환 식물체를 수득하는 단계.(b) obtaining a transgenic plant having increased resistance to dry stress from the plant cell.

본 발명의 또 다른 양태에 따르면, 본 발명은 다음의 단계를 포함하는 식물체의 건조 스트레스 저항성 증진 방법을 제공한다: According to another aspect of the present invention, the present invention provides a method for enhancing dry stress resistance of a plant comprising the following steps:

(a) 본 발명의 뉴클레오타이드 또는 식물발현용 재조합 벡터를 식물 세포에 도입시키는 단계; 및 (a) introducing the nucleotide or the recombinant vector for plant expression of the present invention into plant cells; And

(b) 상기 식물세포로부터 건조 스트레스 저항성이 증진된 형질전환 식물체를 수득하는 단계.
(b) obtaining a transgenic plant having increased resistance to dry stress from the plant cell.

식물발현용 재조합 벡터를 식물세포에 도입하는 방법은 당업계에 공지된 다양한 방법으로 실시될 수 있다.The method of introducing the recombinant vector for plant expression into plant cells may be carried out by various methods known in the art.

형질전환된 식물세포의 선별은 형질전환 배양물을 선택제(예: 대사 억제제, 항생제 및 제초제)에 노출시켜 실시될 수 있다. 형질전환되고 선택제 내성을 부여하는 표지 유전자를 안정되게 포함하고 있는 식물세포는 상기한 배양물에서 성장하고 분할한다. 예시적인 표지는, 하이그로마이신 포스포트랜스퍼라아제 유전자, 글리코포스페이트 내성 유전자 및 네오마이신 포스포트랜스퍼라아제 (nptII) 시스템을 포함하나, 이에 한정되는 것은 아니다. 식물 원형질 또는 다양한 익스플랜드로부터 식물체의 발달 또는 재분화시키는 방법은 당업계에 잘 알려져 있다. 아그로박테리움에 의해 도입된 외래 유전자를 포함하는 식물체의 발달 또는 재분화는 당업계에 공지된 방법에 따라 달성될 수 있다(참조: 미합중국 특허 제 5,004,863, 5,349,124 및 5,416,011 호).Selection of transformed plant cells may be carried out by exposing the transformed culture to a selection agent (eg, metabolic inhibitors, antibiotics, and herbicides). Plant cells that have been transformed and stably contain a marker gene that confers selection agent resistance are grown and divided in the above-described culture. Exemplary labels include, but are not limited to, the hygromycin phosphotransferase gene, the glycophosphate resistance gene, and the neomycin phosphotransferase (nptII) system. Methods of developing or regenerating plants from plant protoplasms or from various explands are well known in the art. The development or regeneration of plants containing foreign genes introduced by Agrobacterium can be achieved according to methods known in the art (see U.S. Patent Nos. 5,004,863, 5,349,124 and 5,416,011).

본 발명의 바람직한 구현예에 따르면, 본 발명의 식물체는 벼, 밀, 보리, 옥수수, 콩, 감자, 밀, 팥, 귀리 및 수수를 포함하는 식량 작물류; 아라비돕시스, 배추, 무, 고추, 딸기, 토마토, 수박, 오이, 양배추, 참외, 호박, 파, 양파 및 당근을 포함하는 채소 작물류; 인삼, 담배, 목화, 참깨, 사탕수수, 사탕무우, 들깨, 땅콩 및 유채를 포함하는 특용작물류; 사과나무, 배나무, 대추나무, 복숭아, 양다래, 포도, 감귤, 감, 자두, 살구 및 바나나를 포함하는 과수류; 장미, 글라디올러스, 거베라, 카네이션, 국화, 백합 및 튤립을 포함하는 화훼류; 및 라이그라스, 레드클로버, 오차드그라스, 알파알파, 톨페스큐 및 페레니얼라이그라스를 포함하는 사료작물류로 구성된 군으로부터 선택된다. 보다 바람직하게는, 상기 식물체는 벼, 밀, 보리, 옥수수, 콩, 감자, 밀, 팥, 귀리 및 수수를 포함하는 식량 작물류이다.
According to a preferred embodiment of the present invention, the plant of the present invention includes food crops including rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, oats and sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion and carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut and rapeseed; Fruit trees including apple tree, pear tree, jujube tree, peach, parsley, grapes, tangerines, persimmons, plums, apricots and bananas; Flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And feed crops including ryegrass, red clover, orchardgrass, alpha alpha, tall fescue and perennial ryegrass. More preferably, the plant is a food crop including rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, oats and sorghum.

본 발명의 또 다른 양태에 따르면, 본 발명은 본 발명의 뉴클레오타이드 서열의 발현을 억제하는 핵산 분자를 포함하는 식물체의 발아 촉진용 조성물을 제공한다. 본 발명에 따르면, 본 발명의 뉴클레오타이드 서열의 발현을 억제할 경우, 미숙발아를 억제하는 ABA 호르몬에 대한 민감성이 감소되면서 발아율이 증가된 것을 확인하였다(도 6b). According to another aspect of the present invention, the present invention provides a composition for promoting germination of a plant comprising a nucleic acid molecule that inhibits the expression of the nucleotide sequence of the present invention. According to the present invention, when inhibiting the expression of the nucleotide sequence of the present invention, it was confirmed that the germination rate was increased while the sensitivity to the ABA hormone inhibiting premature germination was decreased (FIG. 6B).

본 명세서에서 용어“발현 억제”는 표적 유전자의 기능 저하를 야기하는 뉴클레오타이드 서열상의 변형을 의미하며, 바람직하게는 이에 의해 표적 유전자 발현이 탐지 불가능해지거나 무의미한 수준으로 존재하게 되는 것을 의미한다. In the present specification, the term "expression inhibition" refers to a modification on a nucleotide sequence that causes a decrease in the function of a target gene, and preferably, it means that the expression of the target gene becomes undetectable or is present at an insignificant level.

본 발명의 바람직한 구현예에 따르면, 본 발명의 핵산분자는 T-DNA, siRNA, shRNA, miRNA, 리보자임(ribozyme), PNA(peptide nucleic acids) 또는 안티센스 올리고뉴클레오타이드이다. 보다 바람직하게는, 본 발명의 핵산분자는 T-DNA이다.According to a preferred embodiment of the present invention, the nucleic acid molecule of the present invention is T-DNA, siRNA, shRNA, miRNA, ribozyme, peptide nucleic acids (PNA), or antisense oligonucleotide. More preferably, the nucleic acid molecule of the present invention is T-DNA.

본 명세서에서 용어 “siRNA”는 특정 mRNA의 절단(cleavage)을 통하여 RNAi(RNA interference) 현상을 유도할 수 있는 짧은 이중사슬 RNA를 의미한다. 타겟 유전자의 mRNA와 상동인 서열을 가지는 센스 RNA 가닥과 이와 상보적인 서열을 가지는 안티센스 RNA 가닥으로 구성된다. siRNA는 타겟 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운 방법으로서 또는, 유전자치료(gene therapy)의 방법으로 제공된다.As used herein, the term “siRNA” refers to a short double-stranded RNA capable of inducing RNAi (RNA interference) through cleavage of a specific mRNA. It is composed of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a sequence complementary thereto. Since siRNA can suppress the expression of a target gene, it is provided as an efficient gene knockdown method or as a method of gene therapy.

siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음)등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 전체 길이는 10 내지 100 염기, 바람직하게는 15 내지 80 염기, 가장 바람직하게는 20 내지 70 염기이다. siRNA 말단 구조는 타겟 유전자의 발현을 RNAi 효과에 의하여 억제할 수 있는 것이면 평활(blunt)말단 혹은 점착(cohesive) 말단 모두 가능하다. 점착 말단 구조는 3 말단 돌출한 구조와 5 말단 쪽이 돌출한 구조 모두 가능하다. 돌출하는 염기 수는 한정되지 않는다. 예를 들어, 염기 수로는 1 내지 8 염기 , 바람직하게는 2 내지 6 염기로 할 수 있다. 또한, siRNA는 타겟 유전자의 발현억제 효과를 유지할 수 있는 범위에서 예를 들어, 한 쪽 말단의 돌출 부분에 저분자 RNA(예를 들어, tRNA, rRNA, 바이러스 RNA와 같은 천연의 RNA분자 또는 인공의 RNA분자)를 포함할 수 있다. siRNA 말단구조는 양측 모두 절단 구조를 가질 필요는 없고, 이중사슬 RNA의 일방의 말단 부위가 링커 RNA에 의하여 접속된 스템 루프형 구조일 수도 있다. 링커의 길이는 스템 부분의 쌍을 이루는 데 지장이 없는 길이면 특별히 한정되지 않는다.siRNA is not limited to a complete pair of double-stranded RNA portions that pair with each other, and is not paired by mismatch (the corresponding base is not complementary), bulge (there is no base corresponding to one chain), etc. May contain parts that do not. The total length is 10 to 100 bases, preferably 15 to 80 bases, and most preferably 20 to 70 bases. The siRNA terminal structure can be either a blunt end or a cohesive end as long as the expression of the target gene can be suppressed by the RNAi effect. The structure of the adhesive end can be a structure that protrudes at the 3 end and a structure at which the 5 end side protrudes. The number of protruding bases is not limited. For example, the number of bases may be 1 to 8 bases, preferably 2 to 6 bases. In addition, siRNA is a low-molecular RNA (e.g., a natural RNA molecule such as tRNA, rRNA, viral RNA, or artificial RNA) in the protruding portion of one end in the range that can maintain the expression-inhibiting effect of the target gene. Molecule). The siRNA terminal structure need not have a cleavage structure on both sides, and may be a stem loop structure in which one terminal portion of the double-stranded RNA is connected by a linker RNA. The length of the linker is not particularly limited as long as it does not interfere with forming a pair of stem portions.

본 명세서에서 용어 “shRNA”는 단일 가닥으로 50-70개로 구성된 뉴클레오타이드를 의미하며, in vivo상에서 스템-루프(stem-loop) 구조를 이루고 있다. 5-10개의 뉴클레오타이드의 루프 부위 양쪽으로 상보적으로 19-29개의 뉴클레오타이드의 긴 RNA가 염기쌍을 이루어 이중가닥의 스템을 형성한다.In the present specification, the term “shRNA” refers to a nucleotide consisting of 50-70 single strands, in It has a stem-loop structure in vivo. Long RNAs of 19-29 nucleotides complementarily on both sides of the loop portion of 5-10 nucleotides form a base pair to form a double-stranded stem.

본 명세서에서 용어 “miRNA(microRNA)”는 유전자 발현을 조절하며, 전장 20-50개 뉴클레오타이드, 바람직하게는 20-45개 뉴클레오타이드, 보다 바람직하게는 20-40개 뉴클레오타이드, 보다 더 바람직하게는 20-30개 뉴클레오타이드, 가장 바람직하게는 21-23개의 뉴클레오타이드로 구성된 단일 가닥 RNA분자를 의미한다. miRNA는 세포내에서 발현되지 않는 올리고뉴클레오타이드이며, 짧은 스템-루프 구조를 가진다. miRNA는 1 또는 2이상의 mRNA(messenger RNA)와 전체 또는 부분적으로 상동성을 가지며, 상기 mRNA와 상보적인 결합을 통하여 타겟 유전자 발현을 억제시킨다.In the present specification, the term “miRNA (microRNA)” regulates gene expression, and is 20-50 nucleotides in total length, preferably 20-45 nucleotides, more preferably 20-40 nucleotides, and even more preferably 20- It refers to a single-stranded RNA molecule consisting of 30 nucleotides, most preferably 21-23 nucleotides. miRNA is an oligonucleotide that is not expressed in cells and has a short stem-loop structure. miRNAs have whole or partial homology with one or two or more messenger RNAs (mRNAs), and inhibit target gene expression through complementary binding to the mRNA.

본 명세서에서 용어 “리보자임(ribozyme)”은 RNA의 일종으로 특정한 RNA의 염기 서열을 인식하여 자체적으로 이를 절단하는 효소와 같은 기능을 가진 RNA 분자를 의미한다. 리보자임은 타겟 전령 RNA 가닥의 상보적인 염기서열로 특이성을 가지고 결합하는 영역과 타겟 RNA를 절단하는 영역으로 되어 있다.In the present specification, the term "ribozyme" refers to an RNA molecule that has the same function as an enzyme that recognizes the base sequence of a specific RNA and cuts it by itself as a kind of RNA. Ribozyme consists of a region that binds with specificity with a complementary nucleotide sequence of the target messenger RNA strand and a region that cleaves the target RNA.

본 명세서에서 용어 “PNA(Peptide nucleic acid)”는 핵산과 단백질의 성질을 모두 가지고 있는 분자로서, DNA 또는 RNA와 상보적으로 결합이 가능한 분자를 의미한다. PNA는 핵산염기(nucleobase)가 펩티드 결합으로 연결된 유사 DNA로 1999년에 처음 보고되었다(문헌 [Nielsen PE, Egholm M, Berg RH, Buchardt O, "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide", Science 1991, Vol. 254: pp1497-1500]). PNA는 자연계에서는 발견되지 않고 인공적으로 화학적인 방법으로 합성된다. PNA는 상보적인 염기 서열의 천연 핵산과 혼성화(hybridization) 반응을 일으켜서 이중가닥을 형성한다. 길이가 같은 경우 PNA/DNA 이중가닥은 DNA/DNA 이중가닥보다, PNA/RNA 이중가닥은 DNA/RNA 이중가닥보다 안정하다. 펩티드 기본 골격으로는 N-(2-아미노에틸)글리신이 아미드 결합에 의해 반복적으로 연결된 것이 가장 흔히 쓰이며, 이 경우 펩티드 핵산의 기본골격(backbone)은 음전하를 띠는 천연 핵산의 기본골격과 달리 전기적으로 중성이다. PNA에 존재하는 4개의 핵산염기는 공간적 크기와 핵산염기 사이의 거리가 천연 핵산의 경우와 거의 같다. PNA는 화학적으로 천연 핵산보다 안정할 뿐 아니라 핵산분해효소(nuclease)나 단백질분해효소(protease)에 의해 분해되지 않아 생물학적으로도 안정하다.In the present specification, the term “PNA (Peptide nucleic acid)” refers to a molecule that has both nucleic acid and protein properties and is capable of complementarily binding to DNA or RNA. PNA was first reported in 1999 as a DNA similar to which nucleobases are linked by peptide bonds (Nielsen PE, Egholm M, Berg RH, Buchardt O, "Sequence-selective recognition of DNA by strand displacement with a thymine- substituted polyamide", Science 1991, Vol. 254: pp1497-1500]). PNA is not found in nature and is artificially synthesized by chemical methods. PNA undergoes a hybridization reaction with a natural nucleic acid having a complementary nucleotide sequence to form a double strand. When the length is the same, the PNA/DNA double strand is more stable than the DNA/DNA double strand, and the PNA/RNA double strand is more stable than the DNA/RNA double strand. The most commonly used peptide skeleton is that N-(2-aminoethyl) glycine is repetitively linked by an amide bond. In this case, the backbone of the peptide nucleic acid is electrically charged, unlike the basic skeleton of a natural nucleic acid that carries a negative charge. As neutral. The four nucleotide bases present in the PNA have a spatial size and a distance between the nucleotide bases that are almost the same as those of a natural nucleic acid. PNA is not only chemically more stable than natural nucleic acids, but also biologically stable because it is not degraded by nucleases or proteases.

본 명세서에서 용어 “안티센스 올리고뉴클레오타이드”이란 특정 mRNA의 서열에 상보적인 뉴클레오타이드 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하고, mRNA내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 특징이 오타이드 본 발명의 안티센스 뉴클레오타이드 서열은 타겟 유전자의 mRNA에 상보적이고 타겟 유전자의 mRNA에 결합할 수 있는 DNA 또는 RNA 서열을 의미하고 타겟 유전자의 mRNA의 번역, 세포질내로의 전위(trans의 cation), 성숙(maturation) 또는 다른 모든 전체적인 생물학적 기능에 대한 필수적인 활성을 저해할 수 있다. 안티센스 올리고뉴클레오타이드의 길이는 6 내지 100 염기이고, 바람직하게는 10 내 40 염기이다.As used herein, the term “antisense oligonucleotide” refers to DNA or RNA containing a nucleotide sequence complementary to a specific mRNA sequence, or a derivative thereof, and inhibits translation of mRNA into a protein by binding to a complementary sequence in the mRNA. Characteristic Otide The antisense nucleotide sequence of the present invention refers to a DNA or RNA sequence that is complementary to the mRNA of the target gene and capable of binding to the mRNA of the target gene. ), maturation, or any other essential activity for overall biological function. The length of the antisense oligonucleotide is 6 to 100 bases, preferably 10 to 40 bases.

상기 안티센스 올리고뉴클레오타이드는 효능을 증진시키기 위하여 하나 이상의 염기, 당 또는 골격(backbone)의 위치에서 변형될 수 있다(De Mesmaeker et al., Curr Opin Struct Biol ., 5(3):343-55, 1995). 올리고뉴클레오타이드 골격은 포스포로티오에이트, 포스포트리에스테르, 메틸 포스포네이트, 단쇄 알킬, 시클로알킬, 단쇄 헤테로아토믹, 헤테로시클릭 당간 결합 등으로 변형될 수 있다. 또한, 안티센스 핵산은 하나 이상의 치환된 당 모이어티(sugar moiety)를 포함할 수 있다. 안티센스 올리고뉴클레오타이드는 변형된 염기를 포함할 수 있다. 변형된 염기에는 하이포크잔틴, 6-메틸아데닌, 5-me 피리미딘(특히 5-메틸시토신), 5-하이드록시메틸시토신(HMC), 글리코실 HMC, 젠토비오실 HMC, 2-아미노아데닌, 2-티오우라실, 2-티오티민, 5-브로모우라실, 5-하이드록시메틸우라실, 8-아자구아닌, 7-데아자구아닌, N6 (6-아미노헥실)아데닌, 2,6-디아미노퓨린 등이 있다.The antisense oligonucleotide may be modified at one or more bases, sugars, or backbone positions to enhance efficacy (De Mesmaeker et al., Curr. Opin Struct Biol . , 5(3):343-55, 1995). The oligonucleotide skeleton may be modified with phosphorothioate, phosphotriester, methyl phosphonate, short-chain alkyl, cycloalkyl, short-chain heteroatomic, heterocyclic inter-sugar bond, and the like. In addition, antisense nucleic acids may contain one or more substituted sugar moieties. Antisense oligonucleotides may contain modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-me pyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenin, 2 -Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine, etc. There is this.

본 명세서에서 용어“T-DNA”는 Agrobacterium 종의 Ti(tumor-inducing) 플라스미드의 전달(transfer) DNA로서 숙주 식물세포의 핵으로 전달되는 DNA 절편을 말한다. T-DNA의 양 끝 가장자리에는 25 bp의 반복서열이 존재하며, 전달은 왼쪽 경계(border)에서 전달이 시작되어 오른쪽 경계에서 종료된다. 박테리아 T-DNA는 약 20,000 bp 길이로서 이들의 삽입에 의하여 타겟 유전자를 붕괴시킴으로서 삽입 돌연변이(insertional mutagenesis)를 일으키는 데에 사용되며, 삽입된 T-DNA 서열은 돌연변이를 일으킬 뿐 아니라 타겟 유전자를 표지하기도 한다. 본 발명에 따르면, 본 발명자들은 Ti 플라스미드의 형질도입을 통하여 AtAIRP1 유전자의 발현억제 돌연변이체를 제작하였으며, T-DNA 보더 프라이머(boder primer)(LB_6313R)와 T-DNA가 삽입된 부위의 앞, 뒤 부분의 프라이머를 이용하여 지노타이핑 PCR을 진행한 결과 T-DNA가 네 번째 엑손에 삽입된 것을 확인하였으며, 발현억제 돌연변이체의 RNA를 추출하여 RT-PCR의 방법으로 유전자의 발현이 억제되었음을 확인하였다.
In the present specification, the term "T-DNA" refers to Agrobacterium It refers to a DNA fragment that is transferred to the nucleus of a host plant cell as the transfer DNA of a species Ti (tumor-inducing) plasmid. A 25 bp repeat sequence exists at both ends of the T-DNA, and transfer begins at the left border and ends at the right border. Bacterial T-DNA is about 20,000 bp long and is used to cause insertional mutagenesis by disrupting the target gene by their insertion, and the inserted T-DNA sequence not only causes mutations, but also labels the target gene. do. According to the present invention, the present inventors produced an expression inhibiting mutant of the AtAIRP1 gene through transduction of the Ti plasmid, and the front and rear of the T-DNA border primer (LB_6313R) and the T-DNA insertion site. As a result of performing genotyping PCR using the primers of the part, it was confirmed that T-DNA was inserted into the fourth exon, and RNA of the expression inhibitory mutant was extracted and the expression of the gene was suppressed by the method of RT-PCR. .

본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:

(a) 본 발명은 식물체의 건조 스트레스 저항성 증진용 조성물, 상기 조성물이 도입된 형질전환 식물체, 상기 형질전환 식물체의 제조방법 및 식물체의 건조 스트레스 저항성 증진 방법을 제공한다.(a) The present invention provides a composition for enhancing dry stress resistance of a plant, a transgenic plant into which the composition is introduced, a method for preparing the transgenic plant, and a method for enhancing dry stress resistance of a plant.

(b) 본 발명은 식물체의 발아 촉진용 조성물을 제공한다.(b) The present invention provides a composition for promoting germination of plants.

(c) 본 발명에서 이용되는 뉴클레오타이드 서열은 식물체의 건조 스트레스에 대한 저항성 및 발아능에 관여를 하며, 이를 이용하여 식물체를 형질전환 또는 발현 억제를 함으로서 탁월하여 가뭄 내성이 탁월하거나 또는 속성재배가 가능한 신기능 식물체로서 유용하게 이용될 수 있다.
(c) The nucleotide sequence used in the present invention is involved in the resistance to dry stress and germination ability of the plant, and by using it to transform or inhibit the expression of the plant, it is excellent, so it has excellent drought tolerance or a new function capable of rapid cultivation. It can be usefully used as a plant.

도 1은 AtAIRP1 유전자 및 단백질 서열을 분석한 그림이다. AtAIRP1(Arabidopsis Thaliana : ABA insensitive Ring protein 1) 유전자는 애기장대에 단일 카피로 존재하며, 5개의 엑손과 4개의 인트론으로 으로 구성된 1904 bp 유전자이다(도 1a). 도 1b는 애기장대 AtAIRP1 단백질과 유사도를 보이는 다른 종에서의 단백질들과의 다중 정렬(multiple alignment) 결과이다. N-말단 부근의 잘 보존된 시퀀스 조합과, C-말단 부근의 C3H2C3 타입의 링 핑거 도메인을 가지는 것을 알 수 있었다. 애기장대의 AtAIRP1 단백질은 냉이(capsella)와 가장 가까운 유사도를 보이며, 다른 종들과도 그림과 같은 유사성을 보이는 것을 알 수 있었다(도 1c).
도 2는 다양한 비생물학적 스트레스에서 AtAIRP1 유전자의 발현을 분석한 결과를 나타낸 그림이다. 도 2a는 저온 및 건조 스트레스, 도 2b는 소금물 100 mM의 농도로 처리를 하였을 때, 도 2c는 ABA 호르몬을 각각 처리한 후 각각의 RNA를 뽑아서 그 유전자의 발현 패턴을 확인하였다. 저온, 건조 및 염분 처리의 대표적인 컨트롤 유전자로 RD29a를 사용하였고, ABA 처리구에서는 Rab18 유전자를 사용하였다.
도 3은 AtAIRP1 단백질의 효소 활성을 분석한 결과를 나타낸 그림이다. AtAIRP1 단백질들에 MBP(maltose binding protein)를 붙인 UBA1, UBC8, 유비퀴틴, AtAIRP1WT 또는 AtAIRP1H127Y 를 배양 후 웨스턴 블롯으로 단백질 변화를 확인한 결과 AtAIRP1WT 단백질의 분자량이 증가하고 AtAIRP1H127Y 단백질은 반응이 일어나지 않음을 알 수 있었다.
도 4는 AtAIRP1 유전자의 발현억제 돌연변이체 제작 및 건조스트레스 저항성을 분석한 결과를 나타낸 그림이다. 도 4a는 AtAIRP1 유전자의 발현억제 돌연변이체에 관한 그림이다. 유전자의 엑손에 T-DNA가 삽입된 위치를 보여주며, 이들 유전자와 T-DNA 부근의 프라이머를 이용하여 PCR의 방법으로 T-DNA가 삽입됨을 보여준다. 돌연변이체의 RNA를 추출하여 RT-PCR의 방법으로 유전자의 발현을 조사한 것이다. 이들 결과를 토대로 atairp1 돌연변이체는 해당 유전자의 발현이 억제됨을 알 수 있었다. 도 4b는 AtAIRP1 유전자의 발현억제 돌연변이체와 야생형 애기장대의 가뭄 스트레스에 대한 저항성을 비교한 그림이다. 2주 동안 키운 각각의 식물체에 10일 동안 물을 주지 않고 가뭄 스트레스를 가한 후, 물을 충분히 주고 살아난 개체 수를 비교하였다. 그 결과 돌연변이체가 야생형에 비해서 가뭄 스트레스에 대해 저항성이 낮은 것으로 나타났다.
도 5는 AtAIRP1 유전자의 과다발현 형질전환체 제작 및 건조 스트레스 저항성을 분석한 그림이다. 도 5a는 AtAIRP1 유전자의 과다발현 형질전환체에 관한 그림이다. 35S:: AtAIRP1 - GFP 재조합 벡터로 형질전환된 애기장대를 제작하여 RT-PCR을 통하여 확인을 한 것이다. 본 그림은 상기 과다발현 식물체는 야생형 또는 GFP만 과다발현되는 형질전환체에 비해서 AtAIRP1 유전자를 과다발현하고 있다는 것을 알 수 있었다. 도 5b는 면역 블롯팅 분석을 나타낸 그림이다. RT-PCR을 통하여 AtAIRP1 유전자가 과다 발현되는 것이 확인된 형질전환체를 GFP 항체를 이용하여 이들 단백질이 잘 만들어진 것을 확인할 수 있었고, 로딩 컨트롤로 액틴 항체를 이용하여 확인하였다. AtAIRP1-sGFP단백질이 과다발현되는 것을 다시 확인할 수 있었다. 도 5c는 AtAIRP1 유전자의 과다발현 형질전환체와 야생형 애기장대의 가뭄 스트레스에 대한 저항성을 비교한 그림이다. 2주 동안 키운 각각의 식물체에 11일 동안 물을 주지 않고 가뭄 스트레스를 가한 후, 물을 충분히 주고 살아난 개체 수를 비교하였다. 그 결과 과다발현 형질전환체가 야생형 또는 GFP만 과다발현되는 형질전환체에 비해서 가뭄 스트레스에 대해 저항성이 높은 것으로 나타났다.
도 6은 AtAIRP1 유전자의 발현억제 돌연변이체 및 과다발현 형질전환체의 ABA호르몬에 관한 표현형 분석을 나타낸 그림이다. 도 6a는 ABA 호르몬을 각각 0.1, 0.5, 1 μM 의 농도로 처리된 배지에 야생형, atairp1 돌연변이체, 벡터 컨트롤 및 AtAIRP1 - sGFP 과다발현 형질전환 식물체를 심은 후 10일 동안 키운 사진을 찍은 것이다. AtAIRP1 유전자의 과다발현 형질전환 식물체의 경우 ABA호르몬에 민감성을 보이는 것을 알 수 있었고, 또한 해당 유전자의 발현억제 돌연변이체는 같은 조건에서 저항성을 보임을 알 수 있었다. 도 6b는 AtAIRP1 유전자의 돌연변이 및 과다발현 형질전환 식물체의 발아 테스트를 한 결과이다. 역시 ABA호르몬에 의해 과다발현 형질전환체는 발아율이 떨어지며, 발현억제 돌연변이체는 발아율이 증가된 것을 알 수 있었다.
도 7은 AtAIRP1 유전자의 발현억제 돌연변이체 및 과다발현 형질전환체의 ABA호르몬에 관한 기공 개폐를 분석한 그림이다. 도 7a는 흙에서 5주 동안 키운 야생형 애기장대, AtAIRP1 유전자의 발현억제 돌연변이체 및 과다발현 형질전환체의 잎에 ABA 호르몬을 각각 0.1, 1, 10 μM 의 농도로 처리한 후 기공 개폐의 정도를 비교한 그림이다. 도 7b는 각 해당 식물체에 ABA 호르몬을 각각 0.1, 1, 10 μM 의 농도로 처리한 후 광학현미경으로 기공 개폐의 정도를 분석하여 그래프로 나타낸 그림이다. 1 is a diagram showing the analysis of the AtAIRP1 gene and protein sequence. AtAIRP1 (Arabidopsis Thaliana : The ABA insensitive Ring protein 1) gene exists as a single copy in Arabidopsis thaliana, and is a 1904 bp gene composed of 5 exons and 4 introns (FIG. 1A). 1B is a result of multiple alignment with proteins from other species showing similarity to Arabidopsis AtAIRP1 protein. It was found that it has a well-conserved sequence combination near the N-terminus and a C3H2C3 type ring finger domain near the C-terminus. AtAIRP1 protein of Arabidopsis thaliana showed the closest similarity to capsella, and it could be seen that the similarity to other species was shown in the figure (Fig. 1c).
2 is a diagram showing the results of analyzing the expression of the AtAIRP1 gene under various abiotic stresses. Figure 2a is a low temperature and dry stress, Figure 2b is when treated with a concentration of salt water 100 mM, Figure 2c shows the expression pattern of the gene by extracting each RNA after each treatment with the ABA hormone. RD29a was used as a representative control gene for low temperature, drying and salt treatment, and Rab18 gene was used in the ABA treatment group.
3 is a diagram showing the results of analyzing the enzyme activity of the AtAIRP1 protein. After culturing UBA1, UBC8, ubiquitin, AtAIRP1 WT or AtAIRP1 H127Y with MBP (maltose binding protein) attached to AtAIRP1 proteins, the protein change was confirmed by Western blot. As a result, the molecular weight of AtAIRP1 WT protein increased and AtAIRP1 H127Y It was found that the reaction did not occur in the protein.
4 is AtAIRP1 This figure shows the results of the analysis of the production of a gene expression inhibitory mutant and resistance to dry stress. Figure 4a is AtAIRP1 This is a picture of a mutant that inhibits expression of a gene. It shows the location where T-DNA is inserted in the exon of the gene, and shows that the T-DNA is inserted by the method of PCR using primers near these genes and T-DNA. The mutant RNA was extracted and the expression of the gene was investigated by RT-PCR. Based on these results, it was found that the atairp1 mutant inhibited the expression of the corresponding gene. Figure 4b is AtAIRP1 This is a picture comparing the resistance to drought stress of the gene expression suppressing mutant and wild-type Arabidopsis. Each plant grown for 2 weeks was subjected to drought stress without watering for 10 days, and then sufficiently watered and the number of surviving individuals was compared. The results showed that the mutant was less resistant to drought stress than the wild type.
5 is a diagram illustrating the construction of a transformant overexpressing the AtAIRP1 gene and analysis of resistance to dry stress. 5A is a diagram of a transformant overexpressing the AtAIRP1 gene. 35S:: AtAIRP1 - GFP Arabidopsis transformed with a recombinant vector was produced and confirmed through RT-PCR. This figure shows that the overexpressing plant is AtAIRP1 compared to the wild-type or transformant overexpressing only GFP. It was found that it was overexpressing the gene. Figure 5b is a figure showing the immunoblotting analysis. Through RT-PCR, the transformant confirmed that the AtAIRP1 gene was overexpressed was confirmed that these proteins were well made using a GFP antibody, and it was confirmed using an actin antibody as a loading control. It was confirmed again that the AtAIRP1-sGFP protein was overexpressed. Figure 5c is AtAIRP1 This is a diagram comparing the resistance to drought stress of the overexpressing transformant of the gene and the wild-type Arabidopsis thaliana. Each plant grown for 2 weeks was subjected to drought stress without watering for 11 days, and then sufficiently watered and the number of surviving individuals was compared. As a result, it was found that the overexpressing transformant is more resistant to drought stress than the wild type or the transformant overexpressing only GFP.
6 is a diagram showing a phenotypic analysis of the ABA hormone of an expression inhibiting mutant and an overexpression transformant of the AtAIRP1 gene. Figure 6a is a picture taken for 10 days after planting a wild-type, atairp1 mutant, vector control, and AtAIRP1 - sGFP overexpressing transgenic plants in a medium treated with a concentration of 0.1, 0.5, and 1 μM of ABA hormone, respectively. Transgenic plants overexpressing the AtAIRP1 gene were found to be sensitive to ABA hormone, and the mutants that inhibited the expression of the gene showed resistance under the same conditions. 6B is a result of a germination test of a mutant and overexpressing transgenic plant of the AtAIRP1 gene. Also, it was found that the germination rate of the overexpressing transformants decreased by the ABA hormone, and the germination rate of the expression-inhibiting mutants increased.
7 is a diagram illustrating pore opening and closing of the ABA hormone of the AtAIRP1 gene expression inhibitory mutant and overexpression transformant. Figure 7a shows the degree of pore opening and closing after treatment with ABA hormone at concentrations of 0.1, 1, and 10 μM, respectively, on leaves of wild-type Arabidopsis thaliana, AtAIRP1 gene expression inhibitory mutants and overexpression transformants grown in soil for 5 weeks. This is a comparison picture. 7B is a graph showing the degree of pore opening and closing with an optical microscope after treatment with the ABA hormone in each corresponding plant at a concentration of 0.1, 1, and 10 μM, respectively.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

실시예Example

실험방법Experiment method

유전자의 분리 획득Segregation of genes

본 발명자들은 ABA 호르몬 및 비생물학적 스트레스에 의해서 유도되는 AtAIRP1 유전자를 애기장대의 cDNA로부터 분리 획득하였다. 10일된 야생형 애기장대의 유묘를 액체 질소를 사용하여 막자 사발에서 갈아 파우더로 만든 다음 1 g 당 2 ml 의 추출 완충액(4 M 구아니딘-HCl 20 mM, 10 mM EDTA, 10 mM EGTA(USB), 0.5% 사르코실(SIGMA, pH 9)과 β-머캅토에탄올(SIGMA-ALDRICH)을 이용하여 추출한 후 코니칼 튜브로 옮긴 다음 이를 동량의 PCI(페놀 : 클로로포름 : 이소아밀알콜 = 25 : 24 : 1)와 혼합하여 5분간 흔들어 준 다음 3,500 rpm에서 25분간 원심분리(한일 원심분리기, HA-1000-3)하였다. 원심분리 후 상층의 유기 용매층을 제거하고, 동량의 PCI를 혼합하여 흔든 다음 원심분리하는 과정을 2회 반복하여 수행하고, 이때 형성된 아래의 수용액 층을 2회 에탄올 침전 및 1회 LiCl 침전 방법을 사용하여 RNA를 분리하였다. 정량을 통해 2 μg 의 RNA를 올리고 dT 프라이머와 MMLV 역전사효소(Fermentas)를 이용하여 단일가닥 cDNA를 합성하였다. PCR 수행을 위해 주형으로 20 ng의 cDNA를 사용하였으며 두 종류의 프라이머를 각각 10 pmole 씩, 10 x Taq 폴리머라제 완충용액(Takara) 5 ㎕, dNTP 혼합액(각 1.25 mM) 8 ㎕ 및 1 유닛의 Taq DNA 폴리머라제(Takara)를 넣어 총 부피를 50 ㎕ 로 만들었다. Perkin Elmer DNA 써멀 사이클러로 PCR을 수행하였다. 사용한 프라이머는 5'-ATGGGTTGCTGCTGTTGTCTC-3'(AtAIRP1 ORF FW: 서열목록 제 3 서열) 및 5'-TTATGATTCAGTGAGCACTAAT-3'(AtAIRP1 ORF RV: 서열목록 제 4 서열)이다. 먼저 94℃에서 2분간 변성시킨 후, 94℃에서 30초, 52℃에서 30초, 72℃에서 1분을 반복하는 것을 30회 수행하였고, 30회 반복이 끝난 후 72℃에서 5분간 추가로 중합반응을 수행한 다음 전기영동 방법을 이용하여 AtAIRP1 유전자의 증폭을 확인하였고, 이 DNA를 시퀀싱하여 다시 한번 확인하였다. The present inventors obtained ABA hormone and AtAIRP1 gene induced by abiotic stress isolated from cDNA of Arabidopsis thaliana. 10-day-old wild type Arabidopsis seedlings are ground in a mortar using liquid nitrogen to powder, and then 2 ml of extraction buffer per 1 g (4 M guanidine-HCl 20 mM, 10 mM EDTA, 10 mM EGTA (USB), 0.5 % Sarcosyl (SIGMA, pH 9) and β-mercaptoethanol (SIGMA-ALDRICH) are used to extract and transfer to a conical tube, and then the same amount of PCI (phenol: chloroform: isoamyl alcohol = 25: 24: 1) After mixing and shaking for 5 minutes, centrifugation was performed at 3,500 rpm for 25 minutes (Hanil centrifuge, HA-1000-3) After centrifugation, the upper organic solvent layer was removed, mixed with the same amount of PCI, shaken, and then centrifuged. The process was repeated twice, and RNA was separated using the two ethanol precipitation and LiCl precipitation methods in the lower aqueous layer formed at this time, 2 μg of RNA was added by quantification, and dT primer and MMLV reverse transcriptase were performed. Single-stranded cDNA was synthesized using (Fermentas) 20 ng of cDNA was used as a template for PCR, and 10 pmoles of each of the two primers, 5 µl of 10 x Taq polymerase buffer (Takara), dNTP Mixture (each 1.25 mM) 8 µl and 1 unit of Taq DNA polymerase (Takara) were added to make a total volume of 50 µl PCR was performed with a Perkin Elmer DNA thermal cycler The primer used was 5'-ATGGGTTGCTGCTGTTGTCTC-3 '(AtAIRP1 ORF FW: 3rd sequence of Sequence Listing) and 5'-TTATGATTCAGTGAGCACTAAT-3' (AtAIRP1 ORF RV: 4th sequence of Sequence Listing) First, denatured at 94°C for 2 minutes, then at 94°C for 30 seconds, 52 Repetition of 30 seconds at ℃ and 1 minute at 72 ℃ was performed 30 times. After 30 repetitions were completed, polymerization was further performed at 72 ℃ for 5 minutes, and then the AtAIRP1 gene was amplified using an electrophoresis method. Was confirmed, and this DNA was sequenced and confirmed again.

식물 성장조건 및 시료 채취Plant growth conditions and sample collection

AtAIRP1 유전자의 과다발현 형질전환체 제작을 위하여 Invitrogen gateway 시스템을 이용하여 컨스트럭션을 하였다. 먼저 pENTR SD Topo 벡터(Invitrogen, USA)에 AtAIRP1-sGFP를 넣어준 후, LR clonase 효소(Invitrogen)를 이용하여 식물체의 pEarlygate 100 벡터(Arabidopsis research center, USA)에 치환시켰다. AtAIRP1 발현억제 돌연변이 식물체는 AtAIRP1의 유전자에 T-DNA가 삽입된 돌연변이 애기장대의 종자(종자번호: Salk_110094)를 SIGNAL Salk Institute Genomuc Analysis Laboratory (http://signal.salk.edu/)에서 구입하였다. AtAIRP1 In order to produce a gene overexpression transformant, a construction was performed using the Invitrogen gateway system. First, AtAIRP1-sGFP was put into the pENTR SD Topo vector (Invitrogen, USA), and then replaced with the pEarlygate 100 vector (Arabidopsis research center, USA) of the plant using LR clonase enzyme (Invitrogen). AtAIRP1 expression inhibiting mutant plants were purchased from SIGNAL Salk Institute Genomuc Analysis Laboratory (http://signal.salk.edu/) a mutant Arabidopsis seed (seed number: Salk_110094) with T-DNA inserted into the gene of AtAIRP1.

이러한 AtAIRP1 유전자의 과다발현 형질전환체, AtAIRP1 유전자가 파괴된 돌연변이체 및 야생형 애기장대 종자를 30% 락스(유한-크로락스)와 0.025%의 트리톤 X-100에 10분간 살균 처리한 후 물로 10번 이상 세척하였다. 처리된 종자는 3% 수크로스, B5 비타민 (12 mg/L), 0.8% 아가로 구성-되어있는 MS 배지(Duchedfa Biochemie)에 수직으로 심은 후 약 2주간 생장 챔버(16시간 광 조건/ 8시간 암 조건)에서 키운 식물을 재료로 하여 수행하였다. 빛 조건의 전체 식물체(Green whole plant)를 재료로 사용한 경우는 종자를 Sunshine MIX #5 (Sun GroHorticulture) 흙을 넣어 준 화분에 심어서 약 3주간 생장 챔버(16시간 광 조건/8시간 암 조건)에서 성장시킨 식물을 재료로 하여 수행하였다.Such AtAIRP1 Gene overexpression transformant, AtAIRP1 The mutant and wild-type Arabidopsis seeds in which the gene was destroyed were sterilized in 30% Lax (Yuhan-Clorax) and 0.025% Triton X-100 for 10 minutes, and then washed 10 times or more with water. Treated seeds were planted vertically in MS medium (Duchedfa Biochemie) consisting of 3% sucrose, B5 vitamin (12 mg/L), and 0.8% agar, and then planted in a growth chamber for about 2 weeks (16 hours light condition / 8 hours). It was carried out using plants grown in dark conditions) as a material. In the case of using a green whole plant in light conditions, seeds are planted in a pot with Sunshine MIX #5 (Sun GroHorticulture) soil and a growth chamber for about 3 weeks (16 hours light condition / 8 hours dark condition) It was carried out using the plant grown in the material.

스트레스(염, 저온, 건조) 처리Stress (salt, low temperature, dry) treatment

스트레스에 대한 AtAIRP1 유전자의 발현을 확인하기 위해, 건조 스트레스는 배지에서 2주간 키운 야생형 애기장대 유묘를 공기 중에 노출한 후 1시간 및 2시간 후에 샘플링하였다. 염 스트레스는 2주간 키운 애기장대에 100 mM 의 염화나트륨을 처리한 후 1시간, 2시간이 경과한 후 샘플링하였다. 저온 스트레스는 배지에서 2주간 키운 애기장대 유묘를 4℃가 유지되는 인큐베이터에서 6시간, 12시간 동안 배양하고 조직을 샘플링하였다. ABA 호르몬 처리는 2주간 키운 애기장대 유묘를 100 μM의 ABA(SIGMA)를 처리한 후 1.5시간 및 3시간이 경과한 후 샘플링 하였다. 샘플링 된 조직을 액체 질소를 사용하여 막자 사발에서 갈아 가루로 만든 다음 1 g 당 2 ml의 추출 완충액(4 M 구아니딘-HCl 20 mM, 10 mM EDTA, 10 mM EGTA(USB), 0.5% 사르코실(SIGMA), pH 9)과 β-머캅토에탄올(SIGMA-ALDRICH)을 이용하여 추출한 후 코니칼 튜브로 옮긴 다음 이를 동량의 PCI(페놀 : 클로로포름 : 이소아밀알콜 = 25 : 24 : 1)와 혼합하여 5분간 흔들어 준 다음 3,500 rpm에서 25분간 원심분리(한일 원심분리기, HA-1000-3)하였다. 원심분리 후 상층의 유기 용매층을 제거하고, 동량의 PCI를 혼합하여 흔든 다음 원심분리하는 과정을 2회 반복하여 수행하고, 이때 형성된 아래의 수용액 층을 2회 에탄올 침전 및 1회 LiCl 침전 방법을 사용하여 RNA를 분리하였다.
In order to confirm the expression of the AtAIRP1 gene against stress, dry stress was sampled 1 hour and 2 hours after exposure of wild-type Arabidopsis seedlings grown for 2 weeks in a medium to air. Salt stress was sampled after 1 hour and 2 hours after treatment with 100 mM sodium chloride on Arabidopsis grown for 2 weeks. For low temperature stress, Arabidopsis seedlings grown for 2 weeks in a medium were cultured in an incubator maintained at 4° C. for 6 hours and 12 hours, and the tissues were sampled. In the ABA hormone treatment, Arabidopsis seedlings grown for 2 weeks were sampled after 1.5 hours and 3 hours after treatment with 100 μM of ABA (SIGMA). The sampled tissue is ground in a mortar bowl using liquid nitrogen and then 2 ml of extraction buffer per 1 g (4 M guanidine-HCl 20 mM, 10 mM EDTA, 10 mM EGTA (USB), 0.5% sarcosyl ( SIGMA), pH 9) and β-mercaptoethanol (SIGMA-ALDRICH) after extraction, transferred to a conical tube, and then mixed with the same amount of PCI (phenol: chloroform: isoamyl alcohol = 25: 24: 1) After shaking for 5 minutes, centrifugation was performed at 3,500 rpm for 25 minutes (Hanil centrifuge, HA-1000-3). After centrifugation, the upper organic solvent layer was removed, the same amount of PCI was mixed and shaken, and the process of centrifugation was repeated twice, and the lower aqueous solution layer formed at this time was subjected to two ethanol precipitation and one LiCl precipitation method. RNA was isolated using.

정량적 Quantitative 역전사효소Reverse transcriptase (( RTRT )-)- PCRPCR

발현억제 돌연변이 식물체 및 과발현 형질전환 식물체와 야생종의 잎으로부터 전체 RNA를 추출하여 올리고 dT 프라이머와 MMLV 역전사효소(Fermentas)를 이용하여 단일가닥 cDNA를 합성하였다. PCR 수행을 위해 주형으로 20 ng의 cDNA를 사용하였으며 두 종류의 프라이머를 각각 10 pmole 씩, 10 x Taq 폴리머라제 완충용액(Intron) 5 ㎕, dNTP 혼합액(각 1.25 mM) 8 ㎕ 및 1 유닛의 Taq DNA 폴리머라제(intron)를 넣어 총 부피를 50 ㎕ 로 만들었다. Perkin Elmer DNA 써멀 사이클러로 PCR을 수행하였다. 먼저 94℃에서 2분간 변성시킨 후, 94℃에서 30초, 52℃에서 30초, 72℃에서 1분을 반복하는 것을 25회 수행하였고, 25회 반복이 끝난 후 72℃에서 5분간 추가로 중합반응을 수행한 다음 -20℃에 냉동 보관하였다. 사용된 유전자의 프라이머는 아래의 표 1과 같다.Single-stranded cDNA was synthesized using oligo dT primers and MMLV reverse transcriptase (Fermentas) by extracting total RNA from the leaves of expression-inhibiting mutant plants, overexpressing transgenic plants, and wild species. For PCR, 20 ng of cDNA was used as a template. Each of the two primers was 10 pmoles, 5 µl of 10 x Taq polymerase buffer (Intron), 8 µl of dNTP mixture (1.25 mM each) and 1 unit of Taq. DNA polymerase (intron) was added to make a total volume of 50 µl. PCR was performed with a Perkin Elmer DNA thermal cycler. First, after denaturing at 94°C for 2 minutes, repeating at 94°C for 30 seconds, at 52°C for 30 seconds, and at 72°C for 1 minute was performed 25 times, and after 25 repetitions were completed, further polymerization at 72°C for 5 minutes. After performing the reaction, it was stored frozen at -20 ℃. The primers of the used genes are shown in Table 1 below.

RT-PCR에 사용된 유전자의 프라이머 Primers of genes used in RT-PCR 프라이머primer 서열order AtAIRP1 FW1(서열목록 제 5 서열)AtAIRP1 FW1 (SEQ ID NO: 5) 5'- GAGCTGCTATACACTGATCTGAG -3'5'- GAGCTGCTATACACTGATCTGAG -3' AtAIRP1 FW2(서열목록 제 6 서열)AtAIRP1 FW2 (SEQ ID NO: 6) 5'- GAGATTGATAACCCGAAATTGC -3'5'- GAGATTGATAACCCGAAATTGC -3' AtAIRP1 RV1(서열목록 제 7 서열)AtAIRP1 RV1 (SEQ ID NO: 7) 5'- CTCTGAATTTTCAGGCTCTTCT -3'5'- CTCTGAATTTTCAGGCTCTTCT -3' AtAIRP1 RV2(서열목록 제 8 서열)AtAIRP1 RV2 (SEQ ID NO: 8) 5'- ACAAATTGGACATTCATCG -3'5'- ACAAATTGGACATTCATCG -3' AtAIRP1 ORF FW(서열목록 제 9 서열)AtAIRP1 ORF FW (SEQ ID NO: 9) 5'- ATGGGTTGCTGCTGTTTCTC -3'5'-ATGGGTTGCTGCTGTTTCTC -3' AtAIRP1 ORF RV(서열목록 제 10 서열)AtAIRP1 ORF RV (SEQ ID NO: 10) 5'- GTGAGCACTAATTCCTTATCGC -3'5'- GTGAGCACTAATTCCTTATCGC -3' Rab18 FW(서열목록 제 11 서열)Rab18 FW (SEQ ID NO: 11) 5'- GCGTCTTACCAGAACCGTCC -3'5'- GCGTCTTACCAGAACCGTCC -3' Rab18 RV(서열목록 제 12 서열)Rab18 RV (SEQ ID NO: 12) 5'-CCCTTCTTCTCGTGGTGC -3'5'-CCCTTCTTCTCGTGGTGC -3' RD29a FW(서열목록 제 13 서열)RD29a FW (SEQ ID NO: 13) 5'- CAGGTGAATCAGGAGTTGTT -3'5'- CAGGTGAATCAGGAGTTGTT -3' RD29a RV(서열목록 제 14 서열)RD29a RV (SEQ ID NO: 14 sequence) 5'- CCGGAAATTTATCCTCTTCT -3'5'- CCGGAAATTTATCCTCTTCT -3' UBC10 FW(서열목록 제 15 서열)UBC10 FW (SEQ ID NO: 15 sequence) 5'- TGGATATGGCGTCGAAGC -3'5'- TGGATATGGCGTCGAAGC -3' UBC10 RV(서열목록 제 16 서열)UBC10 RV (SEQ ID NO: 16) 5'- GTGGGATTTTCCATTTAGCC -3'5'- GTGGGATTTTCCATTTAGCC -3'

T-T- DNADNA 가 삽입된 돌연변이체의 지놈 The genome of the mutant that has been inserted DNADNA 추출 및 동형접합 돌연변이체 획득 Extraction and acquisition of homozygous mutants

야생형 및 발현억제 돌연변이 애기장대의 종자를 흙에 심어 2주 동안 키운 뒤 각각의 잎을 샘플링한 후 액체질소를 이용하여 간 후 CTAB 완충액(2 % CTAB, 100 mM Tris pH 8, 20 mM EDTA, 1.4 M NaCl, 2 % PVP) 700 ml 를 넣고 혼합하고 65℃에서 10분 동안 가열하였다. 클로로포름 200 ml 를 넣고 혼합한 후 원심분리를 통해 상층액을 얻어내고 이소프로판올을 섞어 DNA를 침전시켰다. 원심분리 후 얻어진 침전물을 70% 에탄올로 세척한 뒤 말려서 얻어진 지놈 DNA를 물로 녹여서 사용하였다. 이후 T-DNA 보더 프라이머(boder primer)(LB_6313R)와 T-DNA가 삽입된 부위의 앞, 뒤 부분의 프라이머를 이용하여 지노타이핑 PCR을 진행하였다.Wild-type and expression-inhibiting mutant Arabidopsis seeds were planted in soil, grown for 2 weeks, and each leaf was sampled and then liver with liquid nitrogen, followed by CTAB buffer (2% CTAB, 100 mM Tris pH 8, 20 mM EDTA, 1.4). M NaCl, 2% PVP) 700 ml were added, mixed, and heated at 65° C. for 10 minutes. After adding 200 ml of chloroform and mixing, a supernatant was obtained through centrifugation, and isopropanol was mixed to precipitate DNA. The precipitate obtained after centrifugation was washed with 70% ethanol, dried, and the resulting genomic DNA was dissolved in water and used. Thereafter, genotyping PCR was performed using a T-DNA boder primer (LB_6313R) and a primer at the front and rear portions of the T-DNA insertion site.

지노타이핑 PCR에 사용된 프라이머Primers used for genotyping PCR 프라이머primer 서열order LB_6313R(서열목록 제 17 서열)LB_6313R (SEQ ID NO: 17 sequence) 5'- GAGCTGCTATACACTGATCTGAG -3'5'- GAGCTGCTATACACTGATCTGAG -3' AtAIRP1 FW1(서열목록 제 18 서열)AtAIRP1 FW1 (SEQ ID NO: 18 sequence) 5'- GAGATTGATAACCCGAAATTGC -3'5'- GAGATTGATAACCCGAAATTGC -3' AtAIRP1 FW2(서열목록 제 19 서열)AtAIRP1 FW2 (SEQ ID NO: 19 sequence) 5'- CTCTGAATTTTCAGGCTCTTCT -3'5'- CTCTGAATTTTCAGGCTCTTCT -3' AtAIRP1 RV1(서열목록 제 20 서열)AtAIRP1 RV1 (SEQ ID NO: 20) 5'- ACAAATTGGACATTCATCG -3'5'- ACAAATTGGACATTCATCG -3' AtAIRP1 RV2(서열목록 제 21 서열)AtAIRP1 RV2 (SEQ ID NO: 21 sequence) 5'- ATGGGTTGCTGCTGTTTCTC -3'5'-ATGGGTTGCTGCTGTTTCTC -3'

AtAIRP1 유전자의 발현억제 돌연변이체에 있어서 T-DNA가 네 번째 엑손에 삽입된 것을 알 수 있었고, T-DNA가 삽입된 지역의 앞, 뒤 부분 및 T-DNA의 보더 프라이머를 이용하여 PCR의 방법으로 T-DNA가 삽입됨을 보여준다. 또한 발현억제 돌연변이체의 RNA를 추출하여 RT-PCR의 방법으로 유전자의 발현이 억제된 것을 알 수 있었다(도 4a).
 In the expression inhibiting mutant of the AtAIRP1 gene, it was found that T-DNA was inserted into the fourth exon, and by PCR method using the front and rear portions of the T-DNA-inserted region and the border primers of T-DNA. It shows that T-DNA is inserted. In addition, it was found that the expression of the gene was suppressed by the method of RT-PCR by extracting the RNA of the expression inhibiting mutant (Fig. 4a).

AtAIRP1AtAIRP1 유전자의 벡터 구축물의 제조 Preparation of vector constructs of genes

말토오즈에 결합하는 단백질과 AtAIRP1을 융합시켜 발현시킬 플라스미드를 재조합하기 위해 AtAIRP1의 코딩 부분의 5' 및 3'쪽에 EcoRI 제한효소에 해당하는 서열을 연결한 프라이머 세트를 이용하여 PCR을 수행하였다. PCR 결과물과 pMAL-X 벡터(New England Biolabs, Beverly,MA)를 EcoRI 제한효소로 자른 다음 T4 DNA 라이가제(New England Bio Lab) 효소를 이용하여 라이게이션(ligation) 하였다. 재조합된 MBP-AtAIRP1을 대장균 BL21-CodonPlus(DE3) RIL(스트라테이진)에 발현시킨 후, 아밀로즈 컬럼 크로마토그래피를 이용해 정제하였다. 단백질은 표준 단백질로 BSA를 이용해 정량하였다. 또한, 본 발명에서는 형질전환체 제작을 위하여 Invitrogen gateway 시스템을 이용하여 컨스트럭션을 하였다. 먼저 pENTR SD topo 벡터(Invitrogen, USA)에 AtAIRP1-sGFP를 넣어준 후, LR clonase 효소(Invitrogen)를 이용하여 식물체의 pEarlygate 100 벡터(Arabidopsis research center, USA)에 치환시켰다.In order to recombinate the plasmid to be expressed by fusing the protein binding to maltose with AtAIRP1, PCR was performed using a primer set in which the sequence corresponding to the Eco RI restriction enzyme was ligated to the 5'and 3'sides of the coding portion of AtAIRP1. The PCR result and pMAL-X vector (New England Biolabs, Beverly, MA) were cut with Eco RI restriction enzyme and then ligated using T4 DNA ligase (New England Bio Lab) enzyme. The recombinant MBP-AtAIRP1 was expressed in E. coli BL21-CodonPlus (DE3) RIL (strateigene), and then purified using amylose column chromatography. Protein was quantified using BSA as a standard protein. In addition, in the present invention, the construction was performed using an Invitrogen gateway system for the production of transformants. First, AtAIRP1-sGFP was put into the pENTR SD topo vector (Invitrogen, USA), and then replaced with the pEarlygate 100 vector (Arabidopsis research center, USA) of the plant using LR clonase enzyme (Invitrogen).

아그로박테리움으로 To Agrobacterium AtAIRP1AtAIRP1 형질전환 및 형질전환 애기장대 식물체의 제조Transformation and production of transgenic Arabidopsis thaliana plants

제작된 구축물은 아그로박테리움(GV3101)에 전기천공법을 이용하여 형질전환 하였으며 유전자의 존재 유무는 PCR을 이용하여 확인하였다. 약 4 주된 애기장대(columbia [Col-0])의 지상 부위를 0.05% 실웨트가 포함된 MS 배지(Duchefa Biochemie)에 1분 30초간 담구는 방법으로 형질전환 시켰다(clough and Bent, 1998, Plant J 16; 735-743). 약 3주간 23℃의 생장 챔버에서 배양하고, 종자를 받은 후(T1), 25 ㎍/㎖ 의 카나마이신과 250 ㎍/㎖의 카르베니실린이 포함된 배지에서 살아남는 개체들을 골라 형질전환 유전자의 존재 여부를 RT-PCR 및 웨스턴 블롯을 통해 검증하였다. 과다발현은 항-GFP 항체를 이용해 관찰하였고 단백질양은 항-액틴 항체를 이용해 보정하였다.
The constructed construct was transformed into Agrobacterium (GV3101) using electroporation, and the presence or absence of the gene was confirmed by PCR. About 4 weeks old Arabidopsis (columbia [Col-0]) was transformed by immersing the above-ground part in MS medium (Duchefa Biochemie) containing 0.05% silwet for 1 minute 30 seconds (clough and Bent, 1998, Plant J 16; 735-743). After culturing in a growth chamber at 23°C for about 3 weeks, and receiving seeds (T1), select individuals that survive in a medium containing 25 µg/ml kanamycin and 250 µg/ml carbenicillin for the presence of a transgenic gene. Was verified through RT-PCR and Western blot. Overexpression was observed using an anti-GFP antibody, and the amount of protein was corrected using an anti-actin antibody.

AtAIRP1AtAIRP1 단백질의 효소활성 분석 Protein enzyme activity analysis

본 발명에서는 AtAIRP1 단백질의 효소활성 분석을 위해, pMAL-X 벡터에 AtAIRP1 유전자의 ORF를 MBP(maltose binding protein) 프레임에 맞게 서브클로닝을 수행하였다. 또한, 효소 활성을 결정짓는 링 핑거 도메인(Ring finger domain)의 127번째 히스티딘 아미노산을 타이로신으로 치환한 유전자 역시 서브클로닝을 수행하였다. 40 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2mM ATP, 2 mM 디티오트레이톨(DTT), 300 ng/㎕ 유비퀴틴(Sigma), 25 μM MG132(A.G. Scientific Inc.), 500 ng UBA1(ABRC, http://www.arabidopsis.org), 500 ng UBC8(ABRC, http://www.arabidopsis.org), MBP-AtAIRP1 500 ng을 각각의 튜브에 넣어준 후 30℃ 배양기에서 배양하였다. 샘플 완충용액을 넣어준 다음 100℃에서 5분간 끓이고 항-MBP(New England Bio Labs), 항-유비퀴틴(Santa Cruz) 항체를 이용하여 웨스턴 블롯을 수행하였다.In the present invention, in order to analyze the enzyme activity of the AtAIRP1 protein, the ORF of the AtAIRP1 gene in the pMAL-X vector was subcloned in accordance with the maltose binding protein (MBP) frame. In addition, a gene substituted with tyrosine for the 127th histidine amino acid of the ring finger domain, which determines enzyme activity, was also subcloned. 40 mM Tris-HCl, pH 7.5, 5 mM MgCl 2 , 2 mM ATP, 2 mM dithiothreitol (DTT), 300 ng/μL ubiquitin (Sigma), 25 μM MG132 (AG Scientific Inc.), 500 ng UBA1 ( ABRC, http://www.arabidopsis.org), 500 ng UBC8 (ABRC, http://www.arabidopsis.org), and 500 ng MBP-AtAIRP1 were added to each tube and cultured in a 30° C. incubator. After the sample buffer was added, boiled at 100° C. for 5 minutes, and Western blot was performed using anti-MBP (New England Bio Labs) and anti-ubiquitin (Santa Cruz) antibodies.

식물체 생장 비교Plant growth comparison

ABA 호르몬에 대한 표현형을 비교하기 위해서 야생형, AtAIRP1 발현억제 돌연변이 식물체, AtAIRP1 과다발현 식물체에서 얻어진 종자를 ABA 호르몬이 0, 0.1, 0.5 및 1 μM 로 첨가된 배지에서 5일 동안 키운 후 발아된 정도를 비교하였다. 또한 식물의 성장을 비교하기 위해서 0, 0.1, 0.5 및 1 μM 로 첨가된 배지에서 10일 동안 키운 후 유묘의 생장 차이를 비교하였다.In order to compare the phenotype for ABA hormone, seeds obtained from wild type, AtAIRP1 expression-inhibiting mutant plants, and AtAIRP1 overexpressing plants were grown for 5 days in a medium to which ABA hormone was added at 0, 0.1, 0.5 and 1 μM, and then the degree of germination was determined. Compared. In addition, in order to compare the growth of plants, differences in growth of seedlings were compared after growing for 10 days in a medium added with 0, 0.1, 0.5 and 1 μM.

성체 식물의 건조 스트레스에 대한 민감도 측정Determination of the sensitivity of adult plants to drying stress

야생형 및 AtAIRP1 발현억제 돌연변이 식물체, 과다발현 식물체의 종자를 흙에서 2주 동안 키운 뒤, 각각 10일 또는 11일 동안 물을 주지 않다가 다시 물을 준 후 건조 스트레스에 내성을 갖는 정도를 측정하였다.The seeds of wild-type and AtAIRP1 expression-inhibiting mutant plants and overexpressing plants were grown in soil for 2 weeks, and then watered without watering for 10 or 11 days, respectively, and then the degree of resistance to drying stress was measured.

기공개폐(Opening and Closing ( stomatalstomatal apertureaperture ) 측정) Measure

5주 동안 흙에서 키운 야생형 및 AtAIRP1 발현억제 돌연변이 식물체, 과다발현 식물체의 잎을 딴 후 기공 개방 용액(10mM MES-KOH, 50 mM CaCl2, 10 mM KCl)에 2시간 동안 담근 후 기공이 모두 열리면 농도별로 ABA호르몬이 첨가된 개방 용액으로 옮겨 2시간 동안 담궈 놓았다. 이후 광학 현미경을 통하여 기공개폐의 정도를 측정하였다.
After picking leaves of wild-type and AtAIRP1 expression-inhibiting mutant plants grown in soil for 5 weeks, and overexpressing plants, soak them in pore opening solution (10 mM MES-KOH, 50 mM CaCl 2 , 10 mM KCl) for 2 hours and then all pores are opened. It was transferred to the open solution to which ABA hormone was added by concentration, and soaked for 2 hours. Afterwards, the degree of pore opening and closing was measured through an optical microscope.

실험결과Experiment result

스트레스(염, 저온, 건조) 처리시 In case of stress (salt, low temperature, dry) treatment AtAIRP1AtAIRP1 의 발현양상Manifestation pattern of

다양한 비생물학적 스트레스에서 AtAIRP1 유전자의 발현을 RT-PCR로 확인하였다. 저온(6시간, 12시간) 및 건조 스트레스(1시간, 2시간)(도 2a) (B)100 mM 농도의 소금물을 1.5 시간 및 3시간 처리한 후(도 2b), 100 μM ABA 호르몬을 1.5시간 및 3시간 처리한 후(도 2c) 각각의 RNA를 뽑아서 그 유전자의 발현 패턴을 확인한 결과 각각의 스트레스 및 호르몬을 처리하지 않았을 때보다 유전자의 발현이 증가되는 것을 확인하였으며, 이에 AtAIRP1 유전자는 저온, 건조, 염분 스트레스 및 ABA 호르몬에 의해서 발현이 유도됨을 확인하였다.
 Expression of the AtAIRP1 gene under various abiotic stresses was confirmed by RT-PCR. Low temperature (6 hours, 12 hours) and dry stress (1 hour, 2 hours) (Figure 2a) (B) After 1.5 hours and 3 hours treatment with 100 mM brine (Figure 2b), 100 μM ABA hormone was 1.5 After treatment for a period of time and 3 hours (Fig. 2c), each RNA was extracted and the expression pattern of the gene was checked. As a result, it was confirmed that the expression of the gene was increased compared to when each stress and hormone were not treated. Accordingly, the AtAIRP1 gene was at low temperature. , It was confirmed that the expression was induced by dryness, salt stress and ABA hormone.

AtAIRP1AtAIRP1 단백질의 효소활성 분석 Protein enzyme activity analysis

AtAIRP1 단백질들에 MBP(maltose binding protein)를 붙인 다음 셀프-유비퀴티네이션을 수행하기 위하여 UBA1, UBC8, 유비퀴틴, AtAIRP1WT 또는 AtAIRP1H127Y (127번째 아미노산인 히스티딘을 타이로신으로 치환시킨 돌연변이 단백질)를 1시간 동안 30℃에서 배양 후 단백질 변화를 확인하기 위해서 MBP 및 유비퀴틴의 특이적인 항체를 이용하여 웨스턴 블롯 분석을 실시하였다. MBP 항체를 이용한 웨스턴 블롯 분석을 통해 AtAIRP1WT 단백질의 분자량이 증가한다는 사실과 AtAIRP1H127Y 단백질은 반응이 일어나지 않는다는 사실을 확인하였고, 유비퀴틴 항체를 이용하여 이들의 증가가 유비퀴틴에 의한 것임을 확인하였다(도 3). 이 결과를 토대로 AtAIRP1 단백질은 유비퀴틴 단백질을 붙여주는 리가아제의 효소활성 능력을 가짐을 알 수 있었다. 반면 MBP-AtAIRPH127Y 의 경우 링 핑거 도메인의 기능을 상실하여 리가아제의 효소활성 능력을 잃은 것을 확인하였다.
After attaching maltose binding protein (MBP) to AtAIRP1 proteins, UBA1, UBC8, ubiquitin, AtAIRP1 WT or AtAIRP1 H127Y are used to perform self-ubiquitination. (A mutant protein obtained by substituting tyrosine for histidine at the 127th amino acid) was incubated at 30° C. for 1 hour, and then Western blot analysis was performed using specific antibodies of MBP and ubiquitin to confirm the protein change. The fact that the molecular weight of AtAIRP1 WT protein is increased through Western blot analysis using MBP antibody and AtAIRP1 H127Y It was confirmed that the protein did not react, and it was confirmed that their increase was due to ubiquitin using an ubiquitin antibody (FIG. 3). Based on this result, it was found that AtAIRP1 protein has the ability of enzyme activity of ligase that attaches ubiquitin protein. On the other hand, in the case of MBP-AtAIRP H127Y , it was confirmed that the function of the ring finger domain was lost, and thus the enzyme activity of the ligase was lost.

식물체 생장 비교Plant growth comparison

ABA 호르몬을 각각 0.1, 0.5, 1 μM 의 농도로 처리된 배지에 야생형, atairp1 돌연변이체, 벡터 컨트롤 및 AtAIRP1 - sGFP 과다발현 형질전환 식물체를 심은 후 10일 동안 키운 결과, AtAIRP1 유전자의 과다발현 형질전환 식물체의 경우 ABA호르몬에 민감성을 보이는 것을 알 수 있었고, 해당 유전자의 돌연변이체는 같은 조건에서 저항성을 보임을 알 수 있었다(도 6a). AtAIRP1 유전자의 발현억제 돌연변이 및 과다발현 형질전환 식물체의 발아 테스트를 한 결과, 역시 ABA호르몬에 의해 과다발현 형질전환체는 발아율이 떨어지며, 발현억제 돌연변이체는 발아율이 증가된 것을 알 수 있었다(도 6b).
 Wild-type, atairp1 mutant, vector control, and AtAIRP1 - sGFP overexpressing transgenic plants were planted in a medium treated with ABA hormone at concentrations of 0.1, 0.5, and 1 μM, respectively, and grown for 10 days, resulting in overexpression of the AtAIRP1 gene. Plants were found to be sensitive to ABA hormone, and the mutant of the gene was found to show resistance under the same conditions (FIG. 6A). As a result of a germination test of the AtAIRP1 gene expression inhibitory mutation and overexpression transgenic plants, it was also found that the overexpression transformant decreased the germination rate by the ABA hormone, and the expression inhibitory mutant increased the germination rate (Fig. 6b). ).

성체 식물의 건조 스트레스에 대한 민감도 측정Determination of the sensitivity of adult plants to drying stress

AtAIRP1 유전자의 발현억제 돌연변이체와 야생형 애기장대의 건조 스트레스에 대한 저항성을 측정하기 위하여 2주 동안 키운 각각의 식물체에 10일 동안 물을 주지 않고 건조 스트레스를 가한 후, 물을 충분히 주고 살아난 개체 수를 비교하였다. 그 결과 돌연변이체가 야생형에 비해서 가뭄 스트레스에 대해 저항성이 낮은 것으로 나타났다(도 4b). AtAIRP1 In order to measure the resistance to dry stress of gene expression-inhibiting mutants and wild-type Arabidopsis, dry stress was applied to each plant grown for 2 weeks without water for 10 days, and then sufficiently watered and the number of surviving individuals was compared. I did. As a result, it was found that the mutant was less resistant to drought stress compared to the wild type (FIG. 4B ).

AtAIRP1 유전자의 발현억제 돌연변이체와 야생형 애기장대의 가뭄 스트레스에 대한 저항성을 비교하기 위해 흙에서 2주 동안 키운 각각의 식물체에 10일 동안 물을 주지 않고 가뭄 스트레스를 가한 후, 물을 충분히 주고 살아난 개체 수를 비교하였다. 그 결과 야생형 식물체의 경우 85%가 생존해 있는 반면 발현억제 돌연변이체는 25% 만이 생존해 있어 돌연변이 식물체가 야생형에 비해 건조스트레스에 대한 저항성이 낮은 것을 알 수 있었다. AtAIRP1 In order to compare the resistance to drought stress of the gene expression-inhibiting mutant and wild-type Arabidopsis, each plant grown for 2 weeks in soil was subjected to drought stress without watering for 10 days, followed by sufficient watering and the number of survivors. Was compared. As a result, 85% of the wild-type plants survived, whereas only 25% of the expression-inhibiting mutants survived, indicating that the mutant plants were less resistant to dry stress than the wild-type.

AtAIRP1 유전자의 과다발현 형질전환체 및 GFP만 과다발현 시킨 형질전환체의 유전자 구조를 나타내었다. Basta selection을 통해 얻어진 각각의 형질전환체의 동형접합 식물체를 확보하였다. 여기서 얻어진 종자를 배지에 심어 RNA를 추출해여 RT-PCR을 수행한 결과 A1, A7번의 식물체에서 AtAIRP1 유전자가 과다발현 된 것을 알 수 있었다(도 5a). The gene structures of the transformant overexpressing AtAIRP1 gene and the transformant overexpressing only GFP are shown. Homozygous plants of each transformant obtained through Basta selection were obtained. The seeds obtained here were planted in a medium, RNA was extracted, and RT-PCR was performed. As a result, it was found that the AtAIRP1 gene was overexpressed in plants A1 and A7 (FIG. 5A).

GFP 항체를 이용하여 형질전환체에서 단백질이 잘 만들어짐을 웨스턴 블롯으로 확인하였다(도 5b). AtAIRP1 유전자의 과다발현 형질전환체와 야생형 애기장대그리고 GFP 과다발현 식물체의 가뭄 스트레스에 대한 저항성을 비교하기 위하여 2주 동안 키운 각각의 식물체에 11일 동안 물을 주지 않고 가뭄 스트레스를 가한 후, 물을 충분히 주고 살아난 개체 수를 비교하였다. 야생형의 경우 12.5%, GFP 과다발현 식물체는 22.5%, AtAIRP1 과다발현 식물체인 A1은 75%, A7은 82.5% 살아난 것을 알 수 있었다. 따라서 과다발현 형질전환체가 야생형 또는 GFP 과다발현 식물체들에 비해서 가뭄 스트레스에 대해 저항성이 높다는 것을 알 수 있었다(도 5c).
It was confirmed by Western blot that the protein was well made in the transformant using the GFP antibody (FIG. 5B). AtAIRP1 In order to compare the resistance to drought stress of the overexpressing transformants of the gene, wild-type Arabidopsis and GFP overexpressing plants, each plant grown for 2 weeks was subjected to drought stress without watering for 11 days, followed by sufficient watering. And compared the number of surviving individuals. It was found that 12.5% of wild-type plants survived , 22.5% of GFP overexpressing plants, 75% of AtAIRP1 overexpressing plants, A1, and 82.5% of A7. Therefore, it can be seen that the overexpressing transformants have higher resistance to drought stress compared to wild-type or GFP overexpressing plants (FIG. 5C).

기공개폐(Opening and Closing ( stomatalstomatal apertureaperture ) 측정) Measure

흙에서 5주 동안 키운 야생형 애기장대와 AtAIRP1 유전자의 발현억제 돌연변이체 및 과다발현 형질전환체의 잎을 따서 기공 개방 용액에 2시간 동안 담궈 모든 기공을 열어준 후에 ABA 호르몬이 농도별로 (0, 0.1, 1, 10 μM)로 처리된 개방 용액에 옮긴 후 다시 2시간 동안 담구어둔 후 광학 현미경을 통해 기공의 개폐 정도를 비교했다. 그 결과 AtAIRP1 유전자의 과다발현 형질전환 식물체의 경우 ABA 호르몬에 민감성을 보여 야생형과 발현억제 돌연변이체에 비해서 낮은 농도의 ABA를 처리했을 경우에도 기공이 닫히는 경향을 보였고, 발현억제 돌연변이체는 같은 조건에서 ABA에 대해 저항성을 보여 야생형과 과다발현 형질전환체에 비해서 기공이 높은 농도에서도 상대적으로 열려있는 결과를 보였다(도 7a). 각 해당 식물체에 ABA 호르몬을 각각 0.1, 1, 10 μM의 농도로 처리한 후 광학현미경으로 기공을 분석항 결과 AtAIPR1 유전자의 과다발현 형질전환체는 0.1 μM 의 ABA 처리시에 기공이 0.042-0.050로 야생형에 비해 약 2배 이상 기공이 닫혀 있지만, AtAIRP1 발현억제 돌연변이체는 10 μM 의 ABA 처리 시에도 기공이 0.086로 야생형에 비해서 약 2.6배 열려 있음을 알 수 있었다.
 After picking the leaves of wild-type Arabidopsis thaliana grown in soil for 5 weeks and the expression-inhibiting mutant and overexpressing transformant of the AtAIRP1 gene, immerse it in a pore-opening solution for 2 hours to open all pores, and then the ABA hormones were added according to the concentration (0, 0.1 , 1, 10 μM), and then immersed for 2 hours again, and then the degree of opening and closing of the pores was compared through an optical microscope. As a result, transgenic plants overexpressing the AtAIRP1 gene showed sensitivity to the ABA hormone, showing a tendency to close pores even when treated with a lower concentration of ABA than the wild-type and expression-suppressing mutants, and the expression-suppressing mutants under the same conditions. It showed resistance to ABA, showing a result that the pores were relatively open even at a high concentration compared to the wild-type and overexpressing transformants (FIG. 7A). Each plant was treated with ABA hormone at concentrations of 0.1, 1, and 10 μM, respectively, and the pores were analyzed with an optical microscope. As a result, the overexpressing transformants of the AtAIPR1 gene had a pore of 0.042-0.050 when treated with 0.1 μM of ABA. Although the pores of the AtAIRP1 expression inhibitory mutant were closed at least twice as compared to the wild type, the pores of the AtAIRP1 expression inhibitory mutant were 0.086, which was approximately 2.6 times open compared to the wild type even when treated with 10 μM of ABA.

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
As described above, a specific part of the present invention has been described in detail, and it is obvious that this specific technology is only a preferred embodiment for those of ordinary skill in the art, and the scope of the present invention is not limited thereto. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> Industry-academic Cooperation Foundation Yonsei University <120> Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same <160> 21 <170> KopatentIn 1.71 <210> 1 <211> 462 <212> DNA <213> Arabidopsis thaliana <400> 1 atgggttgct gctgttgtct cccgagtata cccgaaagct caagaactat agatgagcat 60 cttcccttat ctcgtgccac gccttcctct ctctctaatg catacagttc acctctttcg 120 ccgcctattc ctttagccat cacgaatata aatcttcaaa ctagtccacc gaaattgcca 180 agaactcagg gcaattcgag tgaagcatcc ccgggactca cacaagttgt tccagagaag 240 aaaacatggc atgttgatga tctaactgat tttgagctaa agaaacagta tcgagaagca 300 atcgatgaat gtccaatttg cttagaagaa tatgagattg ataacccgaa attgctcact 360 aaatgtggcc atgactttca tctcgcttgc attcttgcat ggatggaaag aagcgaggcg 420 tgtccagttt gcgataagga attagtgctc actgaatcat aa 462 <210> 2 <211> 153 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Gly Cys Cys Cys Cys Leu Pro Ser Ile Pro Glu Ser Ser Arg Thr 1 5 10 15 Ile Asp Glu His Leu Pro Leu Ser Arg Ala Thr Pro Ser Ser Leu Ser 20 25 30 Asn Ala Tyr Ser Ser Pro Leu Ser Pro Pro Ile Pro Leu Ala Ile Thr 35 40 45 Asn Ile Asn Leu Gln Thr Ser Pro Pro Lys Leu Pro Arg Thr Gln Gly 50 55 60 Asn Ser Ser Glu Ala Ser Pro Gly Leu Thr Gln Val Val Pro Glu Lys 65 70 75 80 Lys Thr Trp His Val Asp Asp Leu Thr Asp Phe Glu Leu Lys Lys Gln 85 90 95 Tyr Arg Glu Ala Ile Asp Glu Cys Pro Ile Cys Leu Glu Glu Tyr Glu 100 105 110 Ile Asp Asn Pro Lys Leu Leu Thr Lys Cys Gly His Asp Phe His Leu 115 120 125 Ala Cys Ile Leu Ala Trp Met Glu Arg Ser Glu Ala Cys Pro Val Cys 130 135 140 Asp Lys Glu Leu Val Leu Thr Glu Ser 145 150 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 atgggttgct gctgttgtct c 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ttatgattca gtgagcacta at 22 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gagctgctat acactgatct gag 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gagattgata acccgaaatt gc 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ctctgaattt tcaggctctt ct 22 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 acaaattgga cattcatcg 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 atgggttgct gctgtttctc 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gtgagcacta attccttatc gc 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gcgtcttacc agaaccgtcc 20 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 cccttcttct cgtggtgc 18 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 caggtgaatc aggagttgtt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ccggaaattt atcctcttct 20 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 tggatatggc gtcgaagc 18 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gtgggatttt ccatttagcc 20 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 gagctgctat acactgatct gag 23 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gagattgata acccgaaatt gc 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 ctctgaattt tcaggctctt ct 22 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 acaaattgga cattcatcg 19 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 atgggttgct gctgtttctc 20 <110> Industry-academic Cooperation Foundation Yonsei University <120> Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same <160> 21 <170> KopatentIn 1.71 <210> 1 <211> 462 <212> DNA <213> Arabidopsis thaliana <400> 1 atgggttgct gctgttgtct cccgagtata cccgaaagct caagaactat agatgagcat 60 cttcccttat ctcgtgccac gccttcctct ctctctaatg catacagttc acctctttcg 120 ccgcctattc ctttagccat cacgaatata aatcttcaaa ctagtccacc gaaattgcca 180 agaactcagg gcaattcgag tgaagcatcc ccgggactca cacaagttgt tccagagaag 240 aaaacatggc atgttgatga tctaactgat tttgagctaa agaaacagta tcgagaagca 300 atcgatgaat gtccaatttg cttagaagaa tatgagattg ataacccgaa attgctcact 360 aaatgtggcc atgactttca tctcgcttgc attcttgcat ggatggaaag aagcgaggcg 420 tgtccagttt gcgataagga attagtgctc actgaatcat aa 462 <210> 2 <211> 153 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Gly Cys Cys Cys Cys Leu Pro Ser Ile Pro Glu Ser Ser Arg Thr 1 5 10 15 Ile Asp Glu His Leu Pro Leu Ser Arg Ala Thr Pro Ser Ser Leu Ser 20 25 30 Asn Ala Tyr Ser Ser Pro Leu Ser Pro Pro Ile Pro Leu Ala Ile Thr 35 40 45 Asn Ile Asn Leu Gln Thr Ser Pro Pro Lys Leu Pro Arg Thr Gln Gly 50 55 60 Asn Ser Ser Glu Ala Ser Pro Gly Leu Thr Gln Val Val Pro Glu Lys 65 70 75 80 Lys Thr Trp His Val Asp Asp Leu Thr Asp Phe Glu Leu Lys Lys Gln 85 90 95 Tyr Arg Glu Ala Ile Asp Glu Cys Pro Ile Cys Leu Glu Glu Tyr Glu 100 105 110 Ile Asp Asn Pro Lys Leu Leu Thr Lys Cys Gly His Asp Phe His Leu 115 120 125 Ala Cys Ile Leu Ala Trp Met Glu Arg Ser Glu Ala Cys Pro Val Cys 130 135 140 Asp Lys Glu Leu Val Leu Thr Glu Ser 145 150 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 atgggttgct gctgttgtct c 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ttatgattca gtgagcacta at 22 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gagctgctat acactgatct gag 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gagattgata acccgaaatt gc 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ctctgaattt tcaggctctt ct 22 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 acaaattgga cattcatcg 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 atgggttgct gctgtttctc 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gtgagcacta attccttatc gc 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gcgtcttacc agaaccgtcc 20 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 cccttcttct cgtggtgc 18 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 caggtgaatc aggagttgtt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ccggaaattt atcctcttct 20 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 tggatatggc gtcgaagc 18 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gtgggatttt ccatttagcc 20 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 gagctgctat acactgatct gag 23 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gagattgata acccgaaatt gc 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 ctctgaattt tcaggctctt ct 22 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 acaaattgga cattcatcg 19 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 atgggttgct gctgtttctc 20

Claims (4)

서열목록 제2서열의 아미노산 서열을 코딩하는 뉴클레오타이드 서열의 발현을 억제하는 핵산 분자를 포함하는 식물체의 발아 촉진용 조성물.
A composition for promoting germination of a plant comprising a nucleic acid molecule that inhibits the expression of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2 sequence.
제 1 항에 있어서, 상기 뉴클레오타이드 서열은 서열목록 제1서열의 뉴클레오타이드 서열로 이루어진 것을 특징으로 하는 조성물.
The composition of claim 1, wherein the nucleotide sequence consists of the nucleotide sequence of SEQ ID NO: 1.
제 1 항 또는 제 2 항에 있어서, 상기 핵산 분자는 T-DNA, siRNA, shRNA, miRNA, 리보자임(ribozyme) 또는 안티센스 올리고뉴클레오타이드인 것을 특징으로 하는 조성물.
The composition of claim 1 or 2, wherein the nucleic acid molecule is T-DNA, siRNA, shRNA, miRNA, ribozyme or antisense oligonucleotide.
제 3 항에 있어서, 상기 핵산 분자는 T-DNA인 것을 특징으로 하는 조성물.
4. The composition of claim 3 wherein the nucleic acid molecule is T-DNA.
KR1020120113637A 2012-10-12 2012-10-12 Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same KR101720289B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120113637A KR101720289B1 (en) 2012-10-12 2012-10-12 Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120113637A KR101720289B1 (en) 2012-10-12 2012-10-12 Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020110094506A Division KR20110107787A (en) 2011-09-20 2011-09-20 Gene implicated in drought stress tolerance and transformed plants with the same

Publications (2)

Publication Number Publication Date
KR20120119211A true KR20120119211A (en) 2012-10-30
KR101720289B1 KR101720289B1 (en) 2017-03-27

Family

ID=47286505

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120113637A KR101720289B1 (en) 2012-10-12 2012-10-12 Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same

Country Status (1)

Country Link
KR (1) KR101720289B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11124802B2 (en) 2016-03-15 2021-09-21 National Research Council Of Canada Modulating plant abiotic stress responses using the Kanghan gene family
US11859196B2 (en) 2016-03-15 2024-01-02 National Research Council Of Canada Modulating drought tolerance in Brassicaceae using the Kanghan gene family

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GenBank Accession No.AAY57609: RING finger family protein [Arabidopsis thaliana](2005.06.07.)* *
Plant Physiology. 2009. Vol.150, pp.463-481(온라인 공개일: 2009.03.13.)* *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11124802B2 (en) 2016-03-15 2021-09-21 National Research Council Of Canada Modulating plant abiotic stress responses using the Kanghan gene family
US11859196B2 (en) 2016-03-15 2024-01-02 National Research Council Of Canada Modulating drought tolerance in Brassicaceae using the Kanghan gene family

Also Published As

Publication number Publication date
KR101720289B1 (en) 2017-03-27

Similar Documents

Publication Publication Date Title
KR101200989B1 (en) Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same
KR100896487B1 (en) OsRDCP1 gene increasing plant stress resistance and transgenic plants transformed by OsRDCP1 gene
KR101803500B1 (en) Novel Gene Implicated in Plant Cold Stress Tolerance and Use Thereof
US20160264987A1 (en) Gene associated with non-biological stress resistance, and transformed plant
KR101720289B1 (en) Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same
KR20120111715A (en) Osbhlh148 gene enhancing drought stress tolerance of plant and uses thereof
KR102003114B1 (en) Method for improving the resistance to drought stress using pepper protein phosphatase CaAIPP1 in plants
KR101926962B1 (en) Method for improving the resistance to drought stress using RING finger E3 ligase PIR in plants
KR101285763B1 (en) Genes Related to ABA Mediated Abiotic Stress Resistances and Transformed Plants with the Same
KR101918590B1 (en) Novel Gene Related to Plant Drought Stress Tolerance and Use Thereof
KR101648558B1 (en) Genes Related to Salt or Drought Stress Resistances and Transformed Plants with the Same
KR100990369B1 (en) Loss-of-function atubph1 and atubph2 mutant plants increasing resistance against plant stress and transgenic plants transformed by AtUBPH1 and AtUBPH2 promoting plant growth
KR100859988B1 (en) Above-Ground Specific Promoter and Above-Ground Specific Expression Method of Target Protein Using the Same
KR20110107787A (en) Gene implicated in drought stress tolerance and transformed plants with the same
KR101592357B1 (en) Novel Gene Implicated in Plant Cold Stress Tolerance and Use Thereof
KR102093591B1 (en) Novel gene related to plant cold stress tolerance and use thereof
KR20190083578A (en) Novel Gene Implicated in Plant Environmental Stresses Tolerance and Use Thereof
KR101509032B1 (en) Method for producing transgenic plant with inhibited photorespiration and increased resistance to stress using the gene from cyanobacteria and the plant thereof
KR102072276B1 (en) Novel gene related to plant cold stress tolerance and use thereof
KR101758868B1 (en) Transgenic Plants with enhanced Drought-Stress Tolerance by Introducing LsRZF1 antisense gene
KR101564748B1 (en) Gene Implicated in Drought Stress Tolerance and Transformed Plants with the Same
KR20230036814A (en) Genes Related to drought stress and Salt Stress Resistances and Transformed Plants with the Same
KR101438738B1 (en) Gene Implicated in Abiotic Stress Tolerance and Growth Accelerating and Use Thereof
KR101446253B1 (en) Gene Implicated in Abiotic Stress Tolerance and Growth Accelerating and Use Thereof
KR101550797B1 (en) Novel Gene Implicated in Tolerance for Abiotic Stress of Plant and Use Thereof

Legal Events

Date Code Title Description
A107 Divisional application of patent
E902 Notification of reason for refusal
E601 Decision to refuse application
J201 Request for trial against refusal decision
J301 Trial decision

Free format text: TRIAL NUMBER: 2015101005563; TRIAL DECISION FOR APPEAL AGAINST DECISION TO DECLINE REFUSAL REQUESTED 20150924

Effective date: 20170224

S901 Examination by remand of revocation
GRNO Decision to grant (after opposition)
GRNT Written decision to grant