KR20120114084A - Dna methylation markers for detecting hepatogenesis and a method for detecting using the same - Google Patents

Dna methylation markers for detecting hepatogenesis and a method for detecting using the same Download PDF

Info

Publication number
KR20120114084A
KR20120114084A KR1020110031848A KR20110031848A KR20120114084A KR 20120114084 A KR20120114084 A KR 20120114084A KR 1020110031848 A KR1020110031848 A KR 1020110031848A KR 20110031848 A KR20110031848 A KR 20110031848A KR 20120114084 A KR20120114084 A KR 20120114084A
Authority
KR
South Korea
Prior art keywords
genbank accession
gene
accession
accession number
genbank
Prior art date
Application number
KR1020110031848A
Other languages
Korean (ko)
Other versions
KR101381319B1 (en
Inventor
김용성
김미랑
강태욱
김선영
이한철
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to KR1020110031848A priority Critical patent/KR101381319B1/en
Publication of KR20120114084A publication Critical patent/KR20120114084A/en
Application granted granted Critical
Publication of KR101381319B1 publication Critical patent/KR101381319B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

PURPOSE: A detection method using a DNA methylation marker for detecting hepatocyte differentiation is provided to determine differentiation stage of human embryonic stem cells to hepatocytes. CONSTITUTION: A microarray chip for determining differentiation of human embryonic stem cells(ES) into hepatocytes contains a nucleic acid oligonucleotide of a gene and a complementary strand thereof. The gene is an ES cell-specific gene, endoderm progenitor(EP)-specific gene, and mature hepatocyte(MH)-specific gene. A method for determining differentiation of human ES cells into hepatocytes comprises: a step of preparing a sample from the human ES cells; a step of measuring expression level of the gene; and a step of differentiating into hepatocytes when the MH-specific gene expression level is increased.

Description

간세포 분화 탐지용 DNA 메틸화 마커 및 이를 이용한 탐지 방법{DNA methylation markers for detecting hepatogenesis and a method for detecting using the same}DNA methylation markers for detecting hepatogenesis and a method for detecting using the same}

본 발명은 간세포 분화 탐지용 DNA 메틸화 마커 및 이를 이용한 탐지 방법에 관한 것으로, 보다 구체적으로는 간세포 분화 탐지용 DNA 메틸화 마커가 집적된 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩 및 이를 이용한 인간 배아 줄기 세포의 간세포(hepatocytes)로의 분화 단계 판별 방법에 관한 것이다.
The present invention relates to a DNA methylation marker for detecting hepatocyte differentiation and a detection method using the same. More specifically, a microarray chip for discriminating a differentiation stage from human embryonic stem cells in which DNA methylation marker for detecting hepatocyte differentiation is integrated into hepatocytes And it relates to a method for determining the stage of differentiation of human embryonic stem cells into hepatocytes (hepatocytes) using the same.

인간 배아 줄기 세포(embrynic stem cells, ES)로부터 간세포(hepatocytes)로 분화시키는 것은 재생 의약 및 시험관 내 의약 시험을 위해 간세포의 다른 원료로 생각된다. 간은 놀라운 재생 가능성을 갖지만, 재생은 만성 간 질환에서는 결국 실패한다. 간 질환의 마지막 단계를 위해서는 간 이식이 유일한 효과적 치료법이다(Kung JW et al ., Curr Opin Biotechnol 2009;20:568-574). 현재 줄기-세포 기술은 배아 줄기 세포(ES)-유래된 간세포를 사용하는 것이 간 질환을 치료하는 대체적인 전략이 될 수 있다는 것을 보여준다(Ogawa S. et al ., Surg Today 2009;39:1019-1025). 게다가, 간은 인체에서 해독을 하는 주요 기관이다. 따라서, 배아 줄기 세포(ES)-유래된 간세포는 또한 독성학 연구 및 의약 대사 실험에도 유용할 수 있다(Rogiers V. et al ., Methods Mol Biol 1998;107:279-294).
Differentiation from human embryonic stem cells (ES) into hepatocytes is thought to be another source of hepatocytes for regenerative medicine and in vitro drug testing. The liver has amazing regeneration potential, but regeneration eventually fails in chronic liver disease. For the last stage of liver disease, liver transplantation is the only effective treatment (Kung JW et. al . , Curr Opin Biotechnol 2009; 20: 568-574). Current stem-cell technology shows that using embryonic stem cell (ES) -derived hepatocytes may be an alternative strategy to treat liver disease (Ogawa S. et. al . , Surg Today 2009; 39: 1019-1025). In addition, the liver is the main organ of detoxification in the human body. Thus, embryonic stem cell (ES) -derived hepatocytes may also be useful for toxicology studies and medical metabolic experiments (Rogiers V. et. al . , Methods Mol Biol 1998; 107: 279-294).

최근, 몇몇 그룹들이 간세포로의 배아 줄기 세포(ES)의 분화를 보고하였다(Cai J. et al ., Hepatology 2007;45:1229-1239; Touboul T. et al ., Hepatology 2010;51:1754-1765; Schwartz RE. et al ., Stem Cells Dev 2005;14:643-655; Hay DC. et al ., Stem Cells 2008;26:894-902). Cai et al .은 시험관 내 간세포로의 분화는 3 단계로 이루어진다는 것을 보고하였다; 첫 번째로 배아 줄기 세포(ES)는 내배엽 전구체(endoderm progenitor, EP)로 분화되고, 그 후에 초기 간 세포(early hepatic cells)로 분화되며, 최종적으로 성숙한 간세포(mature hepatocytes, MH)로 분화된다(Cai J. et al ., Hepatology 2007;45:1229-1239). 간 질환에서 배아 줄기 세포(ES)의 임상적 적용을 위해서는, 분화의 명확하고 효과적인 프로토콜이 요구되지만, 분화의 각 단계를 구별하는데 사용되는 마커가 한정되어 있다(Kung JW. et al ., Curr Opin Biotechnol 2009;20:568-574).
Recently, several groups have reported the differentiation of embryonic stem cells (ES) into hepatocytes (Cai J. et. al . , Hepatology 2007; 45: 1229-1239; Touboul T. et al . , Hepatology 2010; 51: 1754-1765; Schwartz RE. meat al . Stem Cells Dev 2005; 14: 643-655; Hay DC. meat al . Stem Cells 2008; 26: 894-902. Cai et al . Reported that differentiation into hepatocytes in vitro occurs in three stages; Embryonic stem cells (ES) first differentiate into endoderm progenitors (EPs), then into early hepatic cells, and finally into mature hepatocytes (MH). Cai J. et al . , Hepatology 2007; 45: 1229-1239). Clinical application of embryonic stem cells (ES) in liver disease requires a clear and effective protocol of differentiation, but the markers used to distinguish each stage of differentiation are limited (Kung JW. Et . al . , Curr Opin Biotechnol 2009; 20: 568-574).

시험관 내 간생성의 발생학적 계통을 이해하는 것은 발생생물학뿐만 아니라 간 질환의 치료에도 중요하다. DNA 메틸화 및 히스톤 변형을 포함하는, 후성적 조절은 배아 줄기 세포(ES) 분화에 주요한 역할을 한다(Reik W. et al ., Nature 2007;447:425-432). DNA 메틸화의 게놈-범위 리프로그래밍(reprogramming)이 초기 생식 세포 발생에서 일어난다. 부모로부터 온 게놈은 수정 후 능동적인 DNA 탈메틸화를 거치고, 복제-의존적인 수동적인 탈메틸화가 착상 전 배아에서 일어난다. 착상에 의하여, DNA 메틸전이효소(methyltransferases)가 활성화되고, DNA 메틸화 수준은 빠르게 증가된다(Seki Y.et al ., Dev Biol 2005;278:440-458). 배아 줄기 세포(ES)는 배반포(blastocyst) 단계에서 배아의 내배엽(inner cell mass)으로 부터 유개되고, 그것은 DNA 메틸화를 포함하는 후성적 활성이 높은 수준으로 나타나는 특징이 있다(Keller G.et al . Genes Dev 2005;19:1129-1155).
Understanding the developmental lineage of hepatic in vitro is important not only for developmental biology but also for the treatment of liver disease. Epigenetic regulation, including DNA methylation and histone modifications, plays a major role in embryonic stem cell (ES) differentiation (Reik W. et. al ., Nature 2007; 447: 425-432). Genome-range reprogramming of DNA methylation occurs in early germ cell development. The genome from the parent undergoes active DNA demethylation after fertilization, and replication-dependent passive demethylation occurs in preimplantation embryos. By implantation, DNA methyltransferases are activated and DNA methylation levels are rapidly increased (Seki Y. et. al . Dev Biol 2005; 278: 440-458. Embryonic stem cells (ES) are derived from the inner cell mass of the embryo at the blastocyst stage, which is characterized by high levels of epigenetic activity, including DNA methylation (Keller G. et. al . Genes Dev 2005; 19: 1129-1155).

전형적으로, DNA 메틸화 연구는 근위 프로모터 영역(proximal promoter regions)에 초점이 맞추어져 왔다. 많은 단일-유전자(single-gene) 연구들은 프로모터 메틸화가 하류의 유전자의 불활성된 전사와 연관된다는 것을 보여주었다. 그러나, 프로모터들의 한정된 숫자들만이 계통-특이적인 DNA 메틸화를 보인다(Mohn F. et al ., Mol Cell 2008;30:755-766). 최근, 게놈-범위의 DNA 메틸화 연구들은 프로모터-원위 영역(promoter-distal regions)에서의 DNA 메틸화가 발생 과정 동안에 광범위하게 바뀐다는 것으로 알려져 있다(Meissner A. et al ., Nature 2008;454:766-770; Schmidl C. et al ., Genome Res 2009;19:1165-1174).
Typically, DNA methylation studies have focused on proximal promoter regions. Many single-gene studies have shown that promoter methylation is associated with inactivated transcription of downstream genes. However, only a limited number of promoters show lineage-specific DNA methylation (Mohn F. et. al . , Mol Cell 2008; 30: 755-766. Recently, genome-wide DNA methylation studies have been known to vary widely during development of DNA methylation in promoter-distal regions (Meissner A. et. al . , Nature 2008; 454: 766-770; Schmidl C. et al . Genome Res 2009; 19: 1165-1174).

이에 본 발명자들은 배아 줄기 세포(ES), 내배엽 전구체(EP), 및 성숙한 간세포(MH)의 3 분화단계에서 게놈-범위의 DNA 메틸화 및 유전자 발현을 분석하기 위한 마이크로어레이를 사용하여, 16개의 배아 줄기 세포(ES)-특이적, 11개의 내배엽 전구체(EP)-특이적, 및 40개의 성숙한 간세포(MH)-특이적 DNA 메틸화 마커들을 동정함으로써 본 발명을 완성하였다. 또한, 시험관 내 간세포로 분화하는 동안 DNA 메틸화의 전체-게놈 모습을 제공하기 위하여 메틸화된 DNA 결합 도메인 서열분석(methylated DNA binding domain sequencing, MBD-seq)을 사용하였다.
In this regard, we used 16 embryos, using microarrays to analyze genome-range DNA methylation and gene expression in three differentiation stages of embryonic stem cells (ES), endoderm precursors (EP), and mature hepatocytes (MH). The present invention was completed by identifying stem cell (ES) -specific, 11 endoderm precursor (EP) -specific, and 40 mature hepatocyte (MH) -specific DNA methylation markers. In addition, methylated DNA binding domain sequencing (MBD-seq) was used to provide a full-genomic view of DNA methylation during differentiation into hepatocytes in vitro.

본 발명의 목적은 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩 및 이를 포함하는 키트를 제공하는 것이다.An object of the present invention is to provide a microarray chip for determining the stage of differentiation from human embryonic stem cells to hepatocytes and a kit comprising the same.

본 발명의 다른 목적은 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별 방법을 제공하는 것이다.Another object of the present invention is to provide a method for determining the stage of differentiation from human embryonic stem cells into hepatocytes.

아울러, 본 발명의 다른 목적은 인간 줄기 세포로부터 간세포로의 분화를 촉진하는 후보 물질을 스크리닝하는 방법을 제공하는 것이다.
In addition, another object of the present invention is to provide a method for screening candidate substances that promote differentiation from human stem cells to hepatocytes.

상기 목적을 달성하기 위하여, 본 발명은 하기의 군으로부터 선택되는 어느 하나 이상의 유전자의 핵산 서열 올리고뉴클레오티드 또는 그의 상보가닥 분자가 집적된, 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩을 제공한다:In order to achieve the above object, the present invention provides a microarray for differentiating stages from human embryonic stem cells to hepatocytes, in which nucleic acid sequence oligonucleotides or complementary strand molecules of any one or more genes selected from the following groups are integrated. Provides chips:

POU5F1(POU class 5 homeobox 1, 유전자 등록 번호(Genbank Accession No.) NM_002701), DPPA2(developmental pluripotency associated 2, 유전자 등록 번호(Genbank Accession No.) NM_138815), DPEP3(dipeptidase 3, 유전자 등록 번호(Genbank Accession No.) NM_022357), SLC15A3(solute carrier family 15, member 3, 유전자 등록 번호(Genbank Accession No.) NM_016582), USP44(ubiquitin specific peptidase 44, 유전자 등록 번호(Genbank Accession No.) NM_032147), SOX2(SRY (sex determining region Y)-box 2, 유전자 등록 번호(Genbank Accession No.) NM_003106), MT1F(metallothionein 1F, 유전자 등록 번호(Genbank Accession No.) NM_005949), CRABP1(cellular retinoic acid binding protein 1, 유전자 등록 번호(Genbank Accession No.) NM_004378), LECT1(leukocyte cell derived chemotaxin 1, 유전자 등록 번호(Genbank Accession No.) NM_007015), VGF(VGF nerve growth factor inducible, 유전자 등록 번호(Genbank Accession No.) NM_007015), SFRP2(secreted frizzled related protein 2, 유전자 등록 번호(Genbank Accession No.) NT_016354), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), 유전자 등록 번호(Genbank Accession No.) NM_005378), UTF1(undifferentiated embryonic cell transcription factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003577), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, 유전자 등록 번호(Genbank Accession No.) NM_005769), PRDM14(PR domain containing 14, 유전자 등록 번호(Genbank Accession No.) NM_024504), MT1G(metallothionein 1G, 유전자 등록 번호(Genbank Accession No.) NM_005950), CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_005454), GATA4(GATA binding protein 4, 유전자 등록 번호(Genbank Accession No.) NT_077531), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_031944), LEFTY1(left-right determination factor 1, 유전자 등록 번호(Genbank Accession No.) NM_020997), VWF(von Willebrand factor, 유전자 등록 번호(Genbank Accession No.) NM_000552), NODAL(nodal homolog (mouse), 유전자 등록 번호(Genbank Accession No.) NM_018055), DLX5(distal-less homeobox 5, 유전자 등록 번호(Genbank Accession No.) NT_007933), FOXC1(forkhead box C1, 유전자 등록 번호(Genbank Accession No.) NM_001453), KCNK12(potassium channel, subfamily K, member 12, 유전자 등록 번호(Genbank Accession No.) NM_022055), SOX17(SRY (sex determining region Y)-box 17, 유전자 등록 번호(Genbank Accession No.) NM_022454), LEFTY2(left-right determination factor 2, 유전자 등록 번호(Genbank Accession No.) NM_003240), SERPINA3(serpin peptidase inhibitor, clade A , member 3, 유전자 등록 번호(Genbank Accession No.) NM_001085), AGT(angiotensinogen, 유전자 등록 번호(Genbank Accession No.) NM_000029), AFP(alpha-fetoprotein, 유전자 등록 번호(Genbank Accession No.) NM_001134), TM4SF4(transmembrane 4 L six family member 4, 유전자 등록 번호(Genbank Accession No.) NM_004617), APOA4(apolipoprotein A-IV, 유전자 등록 번호(Genbank Accession No.) NM_000482), SPINK1(serine peptidase inhibitor, Kazal type 1, 유전자 등록 번호(Genbank Accession No.) NM_003122), KNG1(kininogen 1, 유전자 등록 번호(Genbank Accession No.) NM_000893), CFH(complement factor H, 유전자 등록 번호(Genbank Accession No.) NM_000186), ALDH1A1(aldehyde dehydrogenase 1 family, member A1, 유전자 등록 번호(Genbank Accession No.) NM_000689), C11orf9(chromosome 11 open reading frame 9, 유전자 등록 번호(Genbank Accession No.) NM_013279), SLCO2B1(solute carrier organic anion transporter family, member 2B1, 유전자 등록 번호(Genbank Accession No.) NM_007256), RIN2(Ras and Rab interactor 2, 유전자 등록 번호(Genbank Accession No.) NM_018993), SRPX2(sushi-repeat-containing protein, X-linked 2, 유전자 등록 번호(Genbank Accession No.) NM_014467), FGG(fibrinogen gamma chain, 유전자 등록 번호(Genbank Accession No.) NM_000509), VTN(vitronectin, 유전자 등록 번호(Genbank Accession No.) NM_000638), KLB(klotho beta, 유전자 등록 번호(Genbank Accession No.) NM_175737), TIMP3(TIMP metallopeptidase inhibitor 3, 유전자 등록 번호(Genbank Accession No.) NT_011520), CREB3L3(cAMP responsive element binding protein 3-like 3, 유전자 등록 번호(Genbank Accession No.) NM_032607), DEFB1(defensin, beta 1, 유전자 등록 번호(Genbank Accession No.) NM_005218), CIDEC(cell death-inducing DFFA-like effector c, 유전자 등록 번호(Genbank Accession No.) NM_022094), ANGPTL6(angiopoietin-like 6, 유전자 등록 번호(Genbank Accession No.) NM_031917), KBTBD10(kelch repeat and BTB (POZ) domain containing 10, 유전자 등록 번호(Genbank Accession No.) NM_006063), VCAM1(vascular cell adhesion molecule 1, 유전자 등록 번호(Genbank Accession No.) NM_001078), CSF1R(colony stimulating factor 1 receptor, 유전자 등록 번호(Genbank Accession No.) NM_005211), KYNU(kynureninase (L-kynurenine hydrolase), 유전자 등록 번호(Genbank Accession No.) NM_003937), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1, 유전자 등록 번호(Genbank Accession No.) NM_003167), RAMP1(receptor (G protein-coupled) activity modifying protein 1, 유전자 등록 번호(Genbank Accession No.) NM_005855), TDO2(tryptophan 2,3-dioxygenase, 유전자 등록 번호(Genbank Accession No.) NM_005651), AQP10(aquaporin 10, 유전자 등록 번호(Genbank Accession No.) NM_080429), CTSE(cathepsin E, 유전자 등록 번호(Genbank Accession No.) NM_001910), SLPI(secretory leukocyte peptidase inhibitor, 유전자 등록 번호(Genbank Accession No.) NM_003064), APOC2(apolipoprotein C-II, 유전자 등록 번호(Genbank Accession No.) NM_000483), SEPP1(selenoprotein P, plasma, 1, 유전자 등록 번호(Genbank Accession No.) NM_005410), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila), 유전자 등록 번호(Genbank Accession No.) NM_001343), TFF1(trefoil factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003225), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13, 유전자 등록 번호(Genbank Accession No.) NM_002242), FMO1(flavin containing monooxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_002021), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2, 유전자 등록 번호(Genbank Accession No.) NM_002153), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_000302) 및 HKDC1(hexokinase domain containing 1, 유전자 등록 번호(Genbank Accession No.) NM_025130).
POU5F1 (POU class 5 homeobox 1, Genbank Accession No. NM_002701), DPPA2 (developmental pluripotency associated 2), Gene Accession Number (Genbank Accession No.) NM_138815, DPEP3 (dipeptidase 3, Gene Accession Number (Genbank Accession) No.) NM_022357), SLC15A3 (solute carrier family 15, member 3, Gene Accession No. NM_016582), USP44 (ubiquitin specific peptidase 44, Gene Accession No. NM_032147), SOX2 (SRY (sex determining region Y) -box 2, Genbank Accession No. NM_003106, MT1F (metallothionein 1F, Genbank Accession No. NM_005949), CRABP1 (cellular retinoic acid binding protein 1, gene registration Number (Genbank Accession No.) NM_004378), LECT1 (leukocyte cell derived chemotaxin 1, gene accession number (Genbank Accession No.) NM_007015), VGF (VGF nerve growth factor inducible, gene accession number (Genbank Accession No.) NM_007015), SFRP2 (secreted frizzled relat ed protein 2, gene accession number (Genbank Accession No.) NT_016354), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), gene accession number (Genbank Accession No.) NM_005378), UTF1 (undifferentiated embryonic cell transcription factor 1, Genbank Accession No. NM_003577), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, Genebank Accession No. NM_005769), PRDM14 (PR domain containing 14, gene accession number (Genbank Accession No.) NM_024504), MT1G (metallothionein 1G, gene accession number (Genbank Accession No.) NM_005950), CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), gene accession number (Genbank Accession No.) NM_005454), GATA4 (GATA binding protein 4, Genbank Accession No.) NT_077531), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis), Gene Accession No. NM_031944), LEFTY1 (left- right determination factor 1, u Electronic Bank Identification Number (Genbank Accession No.) NM_020997, VWF (von Willebrand factor, Genbank Accession No. NM_000552), NODAL (nodal homolog (mouse), Gene Bank Accession No. NM_018055), DLX5 (distal-less homeobox 5, Genbank Accession No. NT_007933), FOXC1 (forkhead box C1, Genbank Accession No. NM_001453), KCNK12 (potassium channel, subfamily K, member 12, gene Genbank Accession No. (NM_022055), SOX17 (sex determining region Y) -box 17, Genbank Accession No. (NM_022454), LEFTY2 (left-right determination factor 2, gene registration number (Genbank) Accession No.) NM_003240), SERPINA3 (serpin peptidase inhibitor, clade A, member 3, Genbank Accession No. NM_001085), AGT (angiotensinogen, Genbank Accession No.) NM_000029), AFP (alpha) fetoprotein, Genbank Accession No. NM_001134, TM4SF4 (t ransmembrane 4 L six family member 4, gene accession number (Genbank Accession No.) NM_004617), APOA4 (apolipoprotein A-IV, gene accession number (Genbank Accession No.) NM_000482), SPINK1 (serine peptidase inhibitor, Kazal type 1, gene Accession number (Genbank Accession No.) NM_003122), KNG1 (kininogen 1, gene accession number (Genbank Accession No.) NM_000893), CFH (complement factor H, Genbank Accession No.) NM_000186), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1, Genbank Accession No. NM_000689), C11orf9 (chromosome 11 open reading frame 9, Gene Accession No. NM_013279), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 , Genbank Accession No. NM_007256, RIN2 (Ras and Rab interactor 2, Genbank Accession No. NM_018993), SRPX2 (sushi-repeat-containing protein, X-linked 2, gene accession number (Genbank Accession No.) NM_014467), FGG (fi brinogen gamma chain, Genbank Accession No. NM_000509, VTN (vitronectin, Genbank Accession No. NM_000638), KLB (klotho beta, Genbank Accession No. NM_175737), TIMP3 (TIMP metallopeptidase inhibitor 3, Genbank Accession No. NT_011520), CREB3L3 (cAMP responsive element binding protein 3-like 3, Gene accession No. NM_032607), DEFB1 (defensin, beta 1, gene Accession number (Genbank Accession No.) NM_005218), cell death-inducing DFFA-like effector c, gene accession number (Genbank Accession No.) NM_022094), ANGPTL6 (angiopoietin-like 6, gene accession number (Genbank Accession No. ) NM_031917), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10, Genebank Accession No. NM_006063), VCAM1 (vascular cell adhesion molecule 1, Genebank Accession No. NM_001078), CSF1R (colony stimulating factor 1 receptor, gene GenBank Accession No. NM_005211, kynureninase (KYNU) (L-kynurenine hydrolase), Genbank Accession No. NM_003937, SULT2A1 (sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1, Genbank Accession No. NM_003167), RAMP1 (receptor (G protein-coupled) activity modifying protein 1, Genebank Accession No.) NM_005855), TDO2 (tryptophan 2,3-dioxygenase, gene Accession number (Genbank Accession No.) NM_005651), AQP10 (aquaporin 10, gene accession number (Genbank Accession No.) NM_080429), CTSE (cathepsin E, gene accession number (Genbank Accession No.) NM_001910), secretory leukocyte peptidase inhibitor, gene accession number (Genbank Accession No.) NM_003064), APOC2 (apolipoprotein C-II, gene accession number (Genbank Accession No.) NM_000483), SEPP1 (selenoprotein P, plasma, 1, gene accession number (Genbank Accession No. NM_005410), DAB2 (disabled homolog 2, mitogen-re sponsive phosphoprotein (Drosophila), Genbank Accession No. NM_001343, TFF1 (trefoil factor 1, Genbank Accession No. NM_003225), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13, gene Accession number (Genbank Accession No.) NM_002242), FMO1 (flavin containing monooxygenase 1, gene accession number (Genbank Accession No.) NM_002021), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2, gene accession number (Genbank Accession No.) NM_002153), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, Genbank Accession No. NM_000302) and HKDC1 (hexokinase domain containing 1, Genebank Accession No. NM_025130).

또한, 본 발명은 본 발명에 따른 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩을 포함하는 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 키트를 제공한다.
The present invention also provides a kit for determining the differentiation stage from human embryonic stem cells to hepatocytes comprising a microarray chip for determining the differentiation stage from human embryonic stem cells to hepatocytes according to the present invention.

또한, 본 발명은 하기의 단계를 포함하는 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별 방법을 제공한다;The present invention also provides a method for determining the differentiation stage from human embryonic stem cells to hepatocytes comprising the following steps;

⑴ 인간 배아 줄기 세포로부터 시료를 얻는 단계; 시료 obtaining a sample from human embryonic stem cells;

⑵ 하기로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량 을 측정하는 단계: 측정 measuring the expression level of any one or more genes selected from the group consisting of:

POU5F1(POU class 5 homeobox 1, 유전자 등록 번호(Genbank Accession No.) NM_002701), DPPA2(developmental pluripotency associated 2, 유전자 등록 번호(Genbank Accession No.) NM_138815), DPEP3(dipeptidase 3, 유전자 등록 번호(Genbank Accession No.) NM_022357), SLC15A3(solute carrier family 15, member 3, 유전자 등록 번호(Genbank Accession No.) NM_016582), USP44(ubiquitin specific peptidase 44, 유전자 등록 번호(Genbank Accession No.) NM_032147), SOX2(SRY (sex determining region Y)-box 2, 유전자 등록 번호(Genbank Accession No.) NM_003106), MT1F(metallothionein 1F, 유전자 등록 번호(Genbank Accession No.) NM_005949), CRABP1(cellular retinoic acid binding protein 1, 유전자 등록 번호(Genbank Accession No.) NM_004378), LECT1(leukocyte cell derived chemotaxin 1, 유전자 등록 번호(Genbank Accession No.) NM_007015), VGF(VGF nerve growth factor inducible, 유전자 등록 번호(Genbank Accession No.) NM_007015), SFRP2(secreted frizzled related protein 2, 유전자 등록 번호(Genbank Accession No.) NT_016354), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), 유전자 등록 번호(Genbank Accession No.) NM_005378), UTF1(undifferentiated embryonic cell transcription factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003577), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, 유전자 등록 번호(Genbank Accession No.) NM_005769), PRDM14(PR domain containing 14, 유전자 등록 번호(Genbank Accession No.) NM_024504), MT1G(metallothionein 1G, 유전자 등록 번호(Genbank Accession No.) NM_005950), CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_005454), GATA4(GATA binding protein 4, 유전자 등록 번호(Genbank Accession No.) NT_077531), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_031944), LEFTY1(left-right determination factor 1, 유전자 등록 번호(Genbank Accession No.) NM_020997), VWF(von Willebrand factor, 유전자 등록 번호(Genbank Accession No.) NM_000552), NODAL(nodal homolog (mouse), 유전자 등록 번호(Genbank Accession No.) NM_018055), DLX5(distal-less homeobox 5, 유전자 등록 번호(Genbank Accession No.) NT_007933), FOXC1(forkhead box C1, 유전자 등록 번호(Genbank Accession No.) NM_001453), KCNK12(potassium channel, subfamily K, member 12, 유전자 등록 번호(Genbank Accession No.) NM_022055), SOX17(SRY (sex determining region Y)-box 17, 유전자 등록 번호(Genbank Accession No.) NM_022454), LEFTY2(left-right determination factor 2, 유전자 등록 번호(Genbank Accession No.) NM_003240), SERPINA3(serpin peptidase inhibitor, clade A , member 3, 유전자 등록 번호(Genbank Accession No.) NM_001085), AGT(angiotensinogen, 유전자 등록 번호(Genbank Accession No.) NM_000029), AFP(alpha-fetoprotein, 유전자 등록 번호(Genbank Accession No.) NM_001134), TM4SF4(transmembrane 4 L six family member 4, 유전자 등록 번호(Genbank Accession No.) NM_004617), APOA4(apolipoprotein A-IV, 유전자 등록 번호(Genbank Accession No.) NM_000482), SPINK1(serine peptidase inhibitor, Kazal type 1, 유전자 등록 번호(Genbank Accession No.) NM_003122), KNG1(kininogen 1, 유전자 등록 번호(Genbank Accession No.) NM_000893), CFH(complement factor H, 유전자 등록 번호(Genbank Accession No.) NM_000186), ALDH1A1(aldehyde dehydrogenase 1 family, member A1, 유전자 등록 번호(Genbank Accession No.) NM_000689), C11orf9(chromosome 11 open reading frame 9, 유전자 등록 번호(Genbank Accession No.) NM_013279), SLCO2B1(solute carrier organic anion transporter family, member 2B1, 유전자 등록 번호(Genbank Accession No.) NM_007256), RIN2(Ras and Rab interactor 2, 유전자 등록 번호(Genbank Accession No.) NM_018993), SRPX2(sushi-repeat-containing protein, X-linked 2, 유전자 등록 번호(Genbank Accession No.) NM_014467), FGG(fibrinogen gamma chain, 유전자 등록 번호(Genbank Accession No.) NM_000509), VTN(vitronectin, 유전자 등록 번호(Genbank Accession No.) NM_000638), KLB(klotho beta, 유전자 등록 번호(Genbank Accession No.) NM_175737), TIMP3(TIMP metallopeptidase inhibitor 3, 유전자 등록 번호(Genbank Accession No.) NT_011520), CREB3L3(cAMP responsive element binding protein 3-like 3, 유전자 등록 번호(Genbank Accession No.) NM_032607), DEFB1(defensin, beta 1, 유전자 등록 번호(Genbank Accession No.) NM_005218), CIDEC(cell death-inducing DFFA-like effector c, 유전자 등록 번호(Genbank Accession No.) NM_022094), ANGPTL6(angiopoietin-like 6, 유전자 등록 번호(Genbank Accession No.) NM_031917), KBTBD10(kelch repeat and BTB (POZ) domain containing 10, 유전자 등록 번호(Genbank Accession No.) NM_006063), VCAM1(vascular cell adhesion molecule 1, 유전자 등록 번호(Genbank Accession No.) NM_001078), CSF1R(colony stimulating factor 1 receptor, 유전자 등록 번호(Genbank Accession No.) NM_005211), KYNU(kynureninase (L-kynurenine hydrolase), 유전자 등록 번호(Genbank Accession No.) NM_003937), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1, 유전자 등록 번호(Genbank Accession No.) NM_003167), RAMP1(receptor (G protein-coupled) activity modifying protein 1, 유전자 등록 번호(Genbank Accession No.) NM_005855), TDO2(tryptophan 2,3-dioxygenase, 유전자 등록 번호(Genbank Accession No.) NM_005651), AQP10(aquaporin 10, 유전자 등록 번호(Genbank Accession No.) NM_080429), CTSE(cathepsin E, 유전자 등록 번호(Genbank Accession No.) NM_001910), SLPI(secretory leukocyte peptidase inhibitor, 유전자 등록 번호(Genbank Accession No.) NM_003064), APOC2(apolipoprotein C-II, 유전자 등록 번호(Genbank Accession No.) NM_000483), SEPP1(selenoprotein P, plasma, 1, 유전자 등록 번호(Genbank Accession No.) NM_005410), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila), 유전자 등록 번호(Genbank Accession No.) NM_001343), TFF1(trefoil factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003225), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13, 유전자 등록 번호(Genbank Accession No.) NM_002242), FMO1(flavin containing monooxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_002021), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2, 유전자 등록 번호(Genbank Accession No.) NM_002153), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_000302) 및 HKDC1(hexokinase domain containing 1, 유전자 등록 번호(Genbank Accession No.) NM_025130).; 및POU5F1 (POU class 5 homeobox 1, Genbank Accession No. NM_002701), DPPA2 (developmental pluripotency associated 2), Gene Accession Number (Genbank Accession No.) NM_138815, DPEP3 (dipeptidase 3, Gene Accession Number (Genbank Accession) No.) NM_022357), SLC15A3 (solute carrier family 15, member 3, Gene Accession No. NM_016582), USP44 (ubiquitin specific peptidase 44, Gene Accession No. NM_032147), SOX2 (SRY (sex determining region Y) -box 2, Genbank Accession No. NM_003106, MT1F (metallothionein 1F, Genbank Accession No. NM_005949), CRABP1 (cellular retinoic acid binding protein 1, gene registration No. (Genbank Accession No.) NM_004378), LECT1 (leukocyte cell derived chemotaxin 1, Gene accession number (Genbank Accession No.) NM_007015), VGF (VGF nerve growth factor inducible, Genbank Accession No. NM_007015), SFRP2 (secreted frizzled relat ed protein 2, gene accession number (Genbank Accession No.) NT_016354), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), gene accession number (Genbank Accession No.) NM_005378), UTF1 (undifferentiated embryonic cell transcription factor 1, Genbank Accession No. NM_003577), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, Genebank Accession No. NM_005769), PRDM14 (PR domain containing 14, gene accession number (Genbank Accession No.) NM_024504), MT1G (metallothionein 1G, gene accession number (Genbank Accession No.) NM_005950), CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), gene accession number (Genbank Accession No.) NM_005454), GATA4 (GATA binding protein 4, Genbank Accession No.) NT_077531), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis), Gene Accession No. NM_031944), LEFTY1 (left- right determination factor 1, u Electronic Bank Identification Number (Genbank Accession No.) NM_020997, VWF (von Willebrand factor, Genbank Accession No. NM_000552), NODAL (nodal homolog (mouse), Gene Bank Accession No. NM_018055), DLX5 (distal-less homeobox 5, Genbank Accession No. NT_007933), FOXC1 (forkhead box C1, Genbank Accession No. NM_001453), KCNK12 (potassium channel, subfamily K, member 12, gene Genbank Accession No. (NM_022055), SOX17 (sex determining region Y) -box 17, Genbank Accession No. (NM_022454), LEFTY2 (left-right determination factor 2, gene registration number (Genbank) Accession No.) NM_003240), SERPINA3 (serpin peptidase inhibitor, clade A, member 3, Genbank Accession No. NM_001085), AGT (angiotensinogen, Genbank Accession No.) NM_000029), AFP (alpha) fetoprotein, Genbank Accession No. NM_001134, TM4SF4 (t ransmembrane 4 L six family member 4, gene accession number (Genbank Accession No.) NM_004617), APOA4 (apolipoprotein A-IV, gene accession number (Genbank Accession No.) NM_000482), SPINK1 (serine peptidase inhibitor, Kazal type 1, gene Accession number (Genbank Accession No.) NM_003122), KNG1 (kininogen 1, gene accession number (Genbank Accession No.) NM_000893), CFH (complement factor H, Genbank Accession No.) NM_000186), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1, Genbank Accession No. NM_000689), C11orf9 (chromosome 11 open reading frame 9, Gene Accession No. NM_013279), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 , Genbank Accession No. NM_007256, RIN2 (Ras and Rab interactor 2, Genbank Accession No. NM_018993), SRPX2 (sushi-repeat-containing protein, X-linked 2, gene accession number (Genbank Accession No.) NM_014467), FGG (fi brinogen gamma chain, Genbank Accession No. NM_000509, VTN (vitronectin, Genbank Accession No. NM_000638), KLB (klotho beta, Genbank Accession No. NM_175737), TIMP3 (TIMP metallopeptidase inhibitor 3, Genbank Accession No. NT_011520), CREB3L3 (cAMP responsive element binding protein 3-like 3, Gene accession No. NM_032607), DEFB1 (defensin, beta 1, gene Accession number (Genbank Accession No.) NM_005218), cell death-inducing DFFA-like effector c, gene accession number (Genbank Accession No.) NM_022094), ANGPTL6 (angiopoietin-like 6, gene accession number (Genbank Accession No. ) NM_031917), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10, Genebank Accession No. NM_006063), VCAM1 (vascular cell adhesion molecule 1, Genebank Accession No. NM_001078), CSF1R (colony stimulating factor 1 receptor, gene GenBank Accession No. (NM_005211), kynureninase (L-kynurenine hydrolase), KYNU, Genbank Accession No. (NM_003937), SULT2A1 (sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1, Genbank Accession No. NM_003167), RAMP1 (receptor (G protein-coupled) activity modifying protein 1, Genebank Accession No.) NM_005855), TDO2 (tryptophan 2,3-dioxygenase, gene Accession number (Genbank Accession No.) NM_005651), AQP10 (aquaporin 10, gene accession number (Genbank Accession No.) NM_080429), CTSE (cathepsin E, gene accession number (Genbank Accession No.) NM_001910), secretory leukocyte peptidase inhibitor, gene accession number (Genbank Accession No.) NM_003064), APOC2 (apolipoprotein C-II, gene accession number (Genbank Accession No.) NM_000483), SEPP1 (selenoprotein P, plasma, 1, gene accession number (Genbank Accession No. NM_005410), DAB2 (disabled homolog 2, mitogen-re sponsive phosphoprotein (Drosophila), Genbank Accession No. NM_001343, TFF1 (trefoil factor 1, Genbank Accession No. NM_003225), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13, gene Accession number (Genbank Accession No.) NM_002242), FMO1 (flavin containing monooxygenase 1, gene accession number (Genbank Accession No.) NM_002021), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2, gene accession number (Genbank Accession No.) NM_002153), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, Genbank Accession No. NM_000302) and HKDC1 (hexokinase domain containing 1, Genebank Accession No. NM_025130); And

⑶ 하기 ⒜의 군으로부터 선택되는 어느 하나 이상의 유전자가 배아 줄기 세포-특이적으로 유전자의 발현량이 증가하면 미분화 단계인 것으로 판별하고, 하기 ⒝의 군으로부터 선택되는 어느 하나 이상의 유전자가 내배엽 전구체-특이적으로 유전자의 발현량이 증가하면 분화 중인 단계인 것으로 판별하며, 또는 하기 ⒞의 군으로부터 선택되는 어느 하나 이상의 유전자가 성숙한 간세포-특이적으로 유전자의 발현량이 증가하면 간세포로 분화한 단계인 것으로 판별하는 단계:어느 Any one or more genes selected from the group of ⑶ below are determined to be embryonic stem cell-specifically when the expression level of the gene is increased, and at least one gene selected from the group of ⒝ is endoderm precursor-specific As a result, when the expression level of the gene is increased, it is determined that it is in the stage of differentiation, or when one or more genes selected from the group of 하기 is mature hepatocytes-specifically, the stage of differentiation into the hepatocytes when the expression level of the gene is increased. :

⒜ POU5F1(POU class 5 homeobox 1), DPPA2(developmental pluripotency associated 2), DPEP3(dipeptidase 3), SLC15A3(solute carrier family 15, member 3), USP44(ubiquitin specific peptidase 44), SOX2(SRY (sex determining region Y)-box 2), MT1F(metallothionein 1F), CRABP1(cellular retinoic acid binding protein 1), LECT1(leukocyte cell derived chemotaxin 1), VGF(VGF nerve growth factor inducible), SFRP2(secreted frizzled related protein 2), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), UTF1(undifferentiated embryonic cell transcription factor 1), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4), PRDM14(PR domain containing 14) 및 MT1G(metallothionein 1G),OU POU5F1 (POU class 5 homeobox 1), DPPA2 (developmental pluripotency associated 2), DPEP3 (dipeptidase 3), SLC15A3 (solute carrier family 15, member 3), USP44 (ubiquitin specific peptidase 44), SOX2 (SRY (sex determining region) Y) -box 2), metallothionein 1F (MT1F), cellular retinoic acid binding protein 1 (CRABP1), leukocyte cell derived chemotaxin 1 (LECT1), VGF nerve growth factor inducible (VGF), secreted frizzled related protein 2 (SFRP2), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), undifferentiated embryonic cell transcription factor 1 (UTF1), carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4) (CHST4), PRDM14 (PR domain containing 14), and MT1G (metallothionein 1G),

⒝ CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4(GATA binding protein 4), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1(left-right determination factor 1), VWF(von Willebrand factor), NODAL(nodal homolog (mouse)), DLX5(distal-less homeobox 5), FOXC1(forkhead box C1), KCNK12(potassium channel, subfamily K, member 12), SOX17(SRY (sex determining region Y)-box 17) 및 LEFTY2(left-right determination factor 2),ER CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4 (GATA binding protein 4), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1 (left-right determination factor 1), VWF ( von Willebrand factor, NODAL (nodal homolog (mouse)), DLX5 (distal-less homeobox 5), FOXC1 (forkhead box C1), KCNK12 (potassium channel, subfamily K, member 12), SOX17 (SRY (sex determining region Y) ) -box 17) and LEFTY2 (left-right determination factor 2),

⒞ SERPINA3(serpin peptidase inhibitor, clade A , member 3), AGT(angiotensinogen), AFP(alpha-fetoprotein), TM4SF4(transmembrane 4 L six family member 4), APOA4(apolipoprotein A-IV), SPINK1(serine peptidase inhibitor, Kazal type 1), KNG1(kininogen 1), CFH(complement factor H), ALDH1A1(aldehyde dehydrogenase 1 family, member A1), C11orf9(chromosome 11 open reading frame 9), SLCO2B1(solute carrier organic anion transporter family, member 2B1), RIN2(Ras and Rab interactor 2), SRPX2(sushi-repeat-containing protein, X-linked 2), FGG(fibrinogen gamma chain), VTN(vitronectin), KLB(klotho beta), TIMP3(TIMP metallopeptidase inhibitor 3), CREB3L3(cAMP responsive element binding protein 3-like 3), DEFB1(defensin, beta 1), CIDEC(cell death-inducing DFFA-like effector c), ANGPTL6(angiopoietin-like 6), KBTBD10(kelch repeat and BTB (POZ) domain containing 10), VCAM1(vascular cell adhesion molecule 1), CSF1R(colony stimulating factor 1 receptor), KYNU(kynureninase (L-kynurenine hydrolase)), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1), RAMP1(receptor (G protein-coupled) activity modifying protein 1), TDO2(tryptophan 2,3-dioxygenase), AQP10(aquaporin 10), CTSE(cathepsin E), SLPI(secretory leukocyte peptidase inhibitor), APOC2(apolipoprotein C-II), SEPP1(selenoprotein P, plasma, 1), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)), TFF1(trefoil factor 1), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13), FMO1(flavin containing monooxygenase 1), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) 및 HKDC1(hexokinase domain containing 1).
RP SERPINA3 (serpin peptidase inhibitor, clade A, member 3), AGT (angiotensinogen), AFP (alpha-fetoprotein), TM4SF4 (transmembrane 4 L six family member 4), APOA4 (apolipoprotein A-IV), SPINK1 (serine peptidase inhibitor) , Kazal type 1), KNG1 (kininogen 1), CFH (complement factor H), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), C11orf9 (chromosome 11 open reading frame 9), SLCO2B1 (solute carrier organic anion transporter family, member 2B1), RIN2 (Ras and Rab interactor 2), SRPX2 (sushi-repeat-containing protein, X-linked 2), fibrinogen gamma chain (FGG), vitronectin (VTN), klotho beta (KLB), and TIMP metallopeptidase inhibitor 3), CREB3L3 (cAMP responsive element binding protein 3-like 3), DEFB1 (defensin, beta 1), CIDEC (cell death-inducing DFFA-like effector c), ANGPTL6 (angiopoietin-like 6), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10), vascular cell adhesion molecule 1 (VCAM1), colony stimulating factor 1 receptor (CSF1R), kynureninase (L-kynurenine hydrolase) (KYNU), SULT2A1 (su lfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1), receptor (G protein-coupled) activity modifying protein 1), TDO2 (tryptophan 2,3-dioxygenase), AQP10 (aquaporin 10), CTSE (cathepsin E), SLPI (secretory leukocyte peptidase inhibitor), APOC2 (apolipoprotein C-II), SEPP1 (selenoprotein P, plasma, 1), DAB2 (disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)), TFF1 (trefoil factor) 1), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13), FMO1 (flavin containing monooxygenase 1), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) and HKDC1 (hexokinase domain containing 1).

또한, 본 발명은 하기의 단계를 포함하는 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별 방법을 제공한다;The present invention also provides a method for determining the differentiation stage from human embryonic stem cells to hepatocytes comprising the following steps;

⑴ 인간 배아 줄기 세포로부터 시료를 얻는 단계; 시료 obtaining a sample from human embryonic stem cells;

⑵ 하기로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 DNA 탈메틸화를 측정하는 단계: DNA measuring DNA demethylation of any one or more genes selected from the group consisting of:

POU5F1(POU class 5 homeobox 1, 유전자 등록 번호(Genbank Accession No.) NM_002701), DPPA2(developmental pluripotency associated 2, 유전자 등록 번호(Genbank Accession No.) NM_138815), DPEP3(dipeptidase 3, 유전자 등록 번호(Genbank Accession No.) NM_022357), SLC15A3(solute carrier family 15, member 3, 유전자 등록 번호(Genbank Accession No.) NM_016582), USP44(ubiquitin specific peptidase 44, 유전자 등록 번호(Genbank Accession No.) NM_032147), SOX2(SRY (sex determining region Y)-box 2, 유전자 등록 번호(Genbank Accession No.) NM_003106), MT1F(metallothionein 1F, 유전자 등록 번호(Genbank Accession No.) NM_005949), CRABP1(cellular retinoic acid binding protein 1, 유전자 등록 번호(Genbank Accession No.) NM_004378), LECT1(leukocyte cell derived chemotaxin 1, 유전자 등록 번호(Genbank Accession No.) NM_007015), VGF(VGF nerve growth factor inducible, 유전자 등록 번호(Genbank Accession No.) NM_007015), SFRP2(secreted frizzled related protein 2, 유전자 등록 번호(Genbank Accession No.) NT_016354), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), 유전자 등록 번호(Genbank Accession No.) NM_005378), UTF1(undifferentiated embryonic cell transcription factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003577), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, 유전자 등록 번호(Genbank Accession No.) NM_005769), PRDM14(PR domain containing 14, 유전자 등록 번호(Genbank Accession No.) NM_024504), MT1G(metallothionein 1G, 유전자 등록 번호(Genbank Accession No.) NM_005950), CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_005454), GATA4(GATA binding protein 4, 유전자 등록 번호(Genbank Accession No.) NT_077531), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_031944), LEFTY1(left-right determination factor 1, 유전자 등록 번호(Genbank Accession No.) NM_020997), VWF(von Willebrand factor, 유전자 등록 번호(Genbank Accession No.) NM_000552), NODAL(nodal homolog (mouse), 유전자 등록 번호(Genbank Accession No.) NM_018055), DLX5(distal-less homeobox 5, 유전자 등록 번호(Genbank Accession No.) NT_007933), FOXC1(forkhead box C1, 유전자 등록 번호(Genbank Accession No.) NM_001453), KCNK12(potassium channel, subfamily K, member 12, 유전자 등록 번호(Genbank Accession No.) NM_022055), SOX17(SRY (sex determining region Y)-box 17, 유전자 등록 번호(Genbank Accession No.) NM_022454), LEFTY2(left-right determination factor 2, 유전자 등록 번호(Genbank Accession No.) NM_003240), SERPINA3(serpin peptidase inhibitor, clade A , member 3, 유전자 등록 번호(Genbank Accession No.) NM_001085), AGT(angiotensinogen, 유전자 등록 번호(Genbank Accession No.) NM_000029), AFP(alpha-fetoprotein, 유전자 등록 번호(Genbank Accession No.) NM_001134), TM4SF4(transmembrane 4 L six family member 4, 유전자 등록 번호(Genbank Accession No.) NM_004617), APOA4(apolipoprotein A-IV, 유전자 등록 번호(Genbank Accession No.) NM_000482), SPINK1(serine peptidase inhibitor, Kazal type 1, 유전자 등록 번호(Genbank Accession No.) NM_003122), KNG1(kininogen 1, 유전자 등록 번호(Genbank Accession No.) NM_000893), CFH(complement factor H, 유전자 등록 번호(Genbank Accession No.) NM_000186), ALDH1A1(aldehyde dehydrogenase 1 family, member A1, 유전자 등록 번호(Genbank Accession No.) NM_000689), C11orf9(chromosome 11 open reading frame 9, 유전자 등록 번호(Genbank Accession No.) NM_013279), SLCO2B1(solute carrier organic anion transporter family, member 2B1, 유전자 등록 번호(Genbank Accession No.) NM_007256), RIN2(Ras and Rab interactor 2, 유전자 등록 번호(Genbank Accession No.) NM_018993), SRPX2(sushi-repeat-containing protein, X-linked 2, 유전자 등록 번호(Genbank Accession No.) NM_014467), FGG(fibrinogen gamma chain, 유전자 등록 번호(Genbank Accession No.) NM_000509), VTN(vitronectin, 유전자 등록 번호(Genbank Accession No.) NM_000638), KLB(klotho beta, 유전자 등록 번호(Genbank Accession No.) NM_175737), TIMP3(TIMP metallopeptidase inhibitor 3, 유전자 등록 번호(Genbank Accession No.) NT_011520), CREB3L3(cAMP responsive element binding protein 3-like 3, 유전자 등록 번호(Genbank Accession No.) NM_032607), DEFB1(defensin, beta 1, 유전자 등록 번호(Genbank Accession No.) NM_005218), CIDEC(cell death-inducing DFFA-like effector c, 유전자 등록 번호(Genbank Accession No.) NM_022094), ANGPTL6(angiopoietin-like 6, 유전자 등록 번호(Genbank Accession No.) NM_031917), KBTBD10(kelch repeat and BTB (POZ) domain containing 10, 유전자 등록 번호(Genbank Accession No.) NM_006063), VCAM1(vascular cell adhesion molecule 1, 유전자 등록 번호(Genbank Accession No.) NM_001078), CSF1R(colony stimulating factor 1 receptor, 유전자 등록 번호(Genbank Accession No.) NM_005211), KYNU(kynureninase (L-kynurenine hydrolase), 유전자 등록 번호(Genbank Accession No.) NM_003937), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1, 유전자 등록 번호(Genbank Accession No.) NM_003167), RAMP1(receptor (G protein-coupled) activity modifying protein 1, 유전자 등록 번호(Genbank Accession No.) NM_005855), TDO2(tryptophan 2,3-dioxygenase, 유전자 등록 번호(Genbank Accession No.) NM_005651), AQP10(aquaporin 10, 유전자 등록 번호(Genbank Accession No.) NM_080429), CTSE(cathepsin E, 유전자 등록 번호(Genbank Accession No.) NM_001910), SLPI(secretory leukocyte peptidase inhibitor, 유전자 등록 번호(Genbank Accession No.) NM_003064), APOC2(apolipoprotein C-II, 유전자 등록 번호(Genbank Accession No.) NM_000483), SEPP1(selenoprotein P, plasma, 1, 유전자 등록 번호(Genbank Accession No.) NM_005410), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila), 유전자 등록 번호(Genbank Accession No.) NM_001343), TFF1(trefoil factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003225), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13, 유전자 등록 번호(Genbank Accession No.) NM_002242), FMO1(flavin containing monooxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_002021), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2, 유전자 등록 번호(Genbank Accession No.) NM_002153), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_000302) 및 HKDC1(hexokinase domain containing 1, 유전자 등록 번호(Genbank Accession No.) NM_025130).; 및POU5F1 (POU class 5 homeobox 1, Genbank Accession No. NM_002701), DPPA2 (developmental pluripotency associated 2), Gene Accession Number (Genbank Accession No.) NM_138815, DPEP3 (dipeptidase 3, Gene Accession Number (Genbank Accession) No.) NM_022357), SLC15A3 (solute carrier family 15, member 3, Gene Accession No. NM_016582), USP44 (ubiquitin specific peptidase 44, Gene Accession No. NM_032147), SOX2 (SRY (sex determining region Y) -box 2, Genbank Accession No. NM_003106, MT1F (metallothionein 1F, Genbank Accession No. NM_005949), CRABP1 (cellular retinoic acid binding protein 1, gene registration No. (Genbank Accession No.) NM_004378), LECT1 (leukocyte cell derived chemotaxin 1, Gene accession number (Genbank Accession No.) NM_007015), VGF (VGF nerve growth factor inducible, Genbank Accession No. NM_007015), SFRP2 (secreted frizzled relat ed protein 2, gene accession number (Genbank Accession No.) NT_016354), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), gene accession number (Genbank Accession No.) NM_005378), UTF1 (undifferentiated embryonic cell transcription factor 1, Genbank Accession No. NM_003577), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, Genebank Accession No. NM_005769), PRDM14 (PR domain containing 14, gene accession number (Genbank Accession No.) NM_024504), MT1G (metallothionein 1G, gene accession number (Genbank Accession No.) NM_005950), CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), gene accession number (Genbank Accession No.) NM_005454), GATA4 (GATA binding protein 4, Genbank Accession No.) NT_077531), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis), Gene Accession No. NM_031944), LEFTY1 (left- right determination factor 1, u Electronic Bank Identification Number (Genbank Accession No.) NM_020997, VWF (von Willebrand factor, Genbank Accession No. NM_000552), NODAL (nodal homolog (mouse), Gene Bank Accession No. NM_018055), DLX5 (distal-less homeobox 5, Genbank Accession No. NT_007933), FOXC1 (forkhead box C1, Genbank Accession No. NM_001453), KCNK12 (potassium channel, subfamily K, member 12, gene Genbank Accession No. (NM_022055), SOX17 (sex determining region Y) -box 17, Genbank Accession No. (NM_022454), LEFTY2 (left-right determination factor 2, gene registration number (Genbank) Accession No.) NM_003240), SERPINA3 (serpin peptidase inhibitor, clade A, member 3, Genbank Accession No. NM_001085), AGT (angiotensinogen, Genbank Accession No.) NM_000029), AFP (alpha) fetoprotein, Genbank Accession No. NM_001134, TM4SF4 (t ransmembrane 4 L six family member 4, gene accession number (Genbank Accession No.) NM_004617), APOA4 (apolipoprotein A-IV, gene accession number (Genbank Accession No.) NM_000482), SPINK1 (serine peptidase inhibitor, Kazal type 1, gene Accession number (Genbank Accession No.) NM_003122), KNG1 (kininogen 1, gene accession number (Genbank Accession No.) NM_000893), CFH (complement factor H, Genbank Accession No.) NM_000186), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1, Genbank Accession No. NM_000689), C11orf9 (chromosome 11 open reading frame 9, Gene Accession No. NM_013279), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 , Genbank Accession No. NM_007256, RIN2 (Ras and Rab interactor 2, Genbank Accession No. NM_018993), SRPX2 (sushi-repeat-containing protein, X-linked 2, gene accession number (Genbank Accession No.) NM_014467), FGG (fi brinogen gamma chain, Genbank Accession No. NM_000509, VTN (vitronectin, Genbank Accession No. NM_000638), KLB (klotho beta, Genbank Accession No. NM_175737), TIMP3 (TIMP metallopeptidase inhibitor 3, Genbank Accession No. NT_011520), CREB3L3 (cAMP responsive element binding protein 3-like 3, Gene accession No. NM_032607), DEFB1 (defensin, beta 1, gene Accession number (Genbank Accession No.) NM_005218), cell death-inducing DFFA-like effector c, gene accession number (Genbank Accession No.) NM_022094), ANGPTL6 (angiopoietin-like 6, gene accession number (Genbank Accession No. ) NM_031917), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10, Genebank Accession No. NM_006063), VCAM1 (vascular cell adhesion molecule 1, Genebank Accession No. NM_001078), CSF1R (colony stimulating factor 1 receptor, gene GenBank Accession No. (NM_005211), kynureninase (L-kynurenine hydrolase), KYNU, Genbank Accession No. (NM_003937), SULT2A1 (sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1, Genbank Accession No. NM_003167), RAMP1 (receptor (G protein-coupled) activity modifying protein 1, Genebank Accession No.) NM_005855), TDO2 (tryptophan 2,3-dioxygenase, gene Accession number (Genbank Accession No.) NM_005651), AQP10 (aquaporin 10, gene accession number (Genbank Accession No.) NM_080429), CTSE (cathepsin E, gene accession number (Genbank Accession No.) NM_001910), secretory leukocyte peptidase inhibitor, gene accession number (Genbank Accession No.) NM_003064), APOC2 (apolipoprotein C-II, gene accession number (Genbank Accession No.) NM_000483), SEPP1 (selenoprotein P, plasma, 1, gene accession number (Genbank Accession No. NM_005410), DAB2 (disabled homolog 2, mitogen-re sponsive phosphoprotein (Drosophila), Genbank Accession No. NM_001343, TFF1 (trefoil factor 1, Genbank Accession No. NM_003225), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13, gene Accession number (Genbank Accession No.) NM_002242), FMO1 (flavin containing monooxygenase 1, gene accession number (Genbank Accession No.) NM_002021), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2, gene accession number (Genbank Accession No.) NM_002153), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, Genbank Accession No. NM_000302) and HKDC1 (hexokinase domain containing 1, Genebank Accession No. NM_025130); And

⑶ 하기 ⒜의 군으로부터 선택되는 어느 하나 이상의 유전자가 배아 줄기 세포-특이적으로 DNA 탈메틸화되면 미분화 단계인 것으로 판별하고, 하기 ⒝의 군으로부터 선택되는 어느 하나 이상의 유전자가 내배엽 전구체-특이적으로 DNA 탈메틸화되면 분화 중인 단계인 것으로 판별하며, 또는 하기 ⒞의 군으로부터 선택되는 어느 하나 이상의 유전자가 성숙한 간세포-특이적으로 DNA 탈메틸화되면 간세포로 분화한 단계인 것으로 판별하는 단계:어느 any one or more genes selected from the group of VII are determined to be undifferentiated when embryonic stem cell-specifically DNA demethylated, and at least one gene selected from the group of VII is endoderm precursor-specific DNA Determining that it is in the stage of differentiation upon demethylation, or determining that any one or more genes selected from the group of the following is a stage for differentiation into hepatocytes when mature hepatocyte-specific DNA demethylation:

⒜ POU5F1(POU class 5 homeobox 1), DPPA2(developmental pluripotency associated 2), DPEP3(dipeptidase 3), SLC15A3(solute carrier family 15, member 3), USP44(ubiquitin specific peptidase 44), SOX2(SRY (sex determining region Y)-box 2), MT1F(metallothionein 1F), CRABP1(cellular retinoic acid binding protein 1), LECT1(leukocyte cell derived chemotaxin 1), VGF(VGF nerve growth factor inducible), SFRP2(secreted frizzled related protein 2), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), UTF1(undifferentiated embryonic cell transcription factor 1), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4), PRDM14(PR domain containing 14) 및 MT1G(metallothionein 1G),OU POU5F1 (POU class 5 homeobox 1), DPPA2 (developmental pluripotency associated 2), DPEP3 (dipeptidase 3), SLC15A3 (solute carrier family 15, member 3), USP44 (ubiquitin specific peptidase 44), SOX2 (SRY (sex determining region) Y) -box 2), metallothionein 1F (MT1F), cellular retinoic acid binding protein 1 (CRABP1), leukocyte cell derived chemotaxin 1 (LECT1), VGF nerve growth factor inducible (VGF), secreted frizzled related protein 2 (SFRP2), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), undifferentiated embryonic cell transcription factor 1 (UTF1), carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4) (CHST4), PRDM14 (PR domain containing 14), and MT1G (metallothionein 1G),

⒝ CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4(GATA binding protein 4), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1(left-right determination factor 1), VWF(von Willebrand factor), NODAL(nodal homolog (mouse)), DLX5(distal-less homeobox 5), FOXC1(forkhead box C1), KCNK12(potassium channel, subfamily K, member 12), SOX17(SRY (sex determining region Y)-box 17) 및 LEFTY2(left-right determination factor 2),ER CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4 (GATA binding protein 4), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1 (left-right determination factor 1), VWF ( von Willebrand factor, NODAL (nodal homolog (mouse)), DLX5 (distal-less homeobox 5), FOXC1 (forkhead box C1), KCNK12 (potassium channel, subfamily K, member 12), SOX17 (SRY (sex determining region Y) ) -box 17) and LEFTY2 (left-right determination factor 2),

⒞ SERPINA3(serpin peptidase inhibitor, clade A , member 3), AGT(angiotensinogen), AFP(alpha-fetoprotein), TM4SF4(transmembrane 4 L six family member 4), APOA4(apolipoprotein A-IV), SPINK1(serine peptidase inhibitor, Kazal type 1), KNG1(kininogen 1), CFH(complement factor H), ALDH1A1(aldehyde dehydrogenase 1 family, member A1), C11orf9(chromosome 11 open reading frame 9), SLCO2B1(solute carrier organic anion transporter family, member 2B1), RIN2(Ras and Rab interactor 2), SRPX2(sushi-repeat-containing protein, X-linked 2), FGG(fibrinogen gamma chain), VTN(vitronectin), KLB(klotho beta), TIMP3(TIMP metallopeptidase inhibitor 3), CREB3L3(cAMP responsive element binding protein 3-like 3), DEFB1(defensin, beta 1), CIDEC(cell death-inducing DFFA-like effector c), ANGPTL6(angiopoietin-like 6), KBTBD10(kelch repeat and BTB (POZ) domain containing 10), VCAM1(vascular cell adhesion molecule 1), CSF1R(colony stimulating factor 1 receptor), KYNU(kynureninase (L-kynurenine hydrolase)), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1), RAMP1(receptor (G protein-coupled) activity modifying protein 1), TDO2(tryptophan 2,3-dioxygenase), AQP10(aquaporin 10), CTSE(cathepsin E), SLPI(secretory leukocyte peptidase inhibitor), APOC2(apolipoprotein C-II), SEPP1(selenoprotein P, plasma, 1), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)), TFF1(trefoil factor 1), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13), FMO1(flavin containing monooxygenase 1), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) 및 HKDC1(hexokinase domain containing 1).
RP SERPINA3 (serpin peptidase inhibitor, clade A, member 3), AGT (angiotensinogen), AFP (alpha-fetoprotein), TM4SF4 (transmembrane 4 L six family member 4), APOA4 (apolipoprotein A-IV), SPINK1 (serine peptidase inhibitor) , Kazal type 1), KNG1 (kininogen 1), CFH (complement factor H), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), C11orf9 (chromosome 11 open reading frame 9), SLCO2B1 (solute carrier organic anion transporter family, member 2B1), RIN2 (Ras and Rab interactor 2), SRPX2 (sushi-repeat-containing protein, X-linked 2), fibrinogen gamma chain (FGG), vitronectin (VTN), klotho beta (KLB), and TIMP metallopeptidase inhibitor 3), CREB3L3 (cAMP responsive element binding protein 3-like 3), DEFB1 (defensin, beta 1), CIDEC (cell death-inducing DFFA-like effector c), ANGPTL6 (angiopoietin-like 6), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10), vascular cell adhesion molecule 1 (VCAM1), colony stimulating factor 1 receptor (CSF1R), kynureninase (L-kynurenine hydrolase) (KYNU), SULT2A1 (su lfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1), receptor (G protein-coupled) activity modifying protein 1), TDO2 (tryptophan 2,3-dioxygenase), AQP10 (aquaporin 10), CTSE (cathepsin E), SLPI (secretory leukocyte peptidase inhibitor), APOC2 (apolipoprotein C-II), SEPP1 (selenoprotein P, plasma, 1), DAB2 (disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)), TFF1 (trefoil factor) 1), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13), FMO1 (flavin containing monooxygenase 1), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) and HKDC1 (hexokinase domain containing 1).

아울러, 본 발명은 하기의 단계를 포함하는 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화를 촉진하는 후보 물질을 스크리닝하는 방법을 제공한다;In addition, the present invention provides a method for screening a candidate substance for promoting differentiation from human embryonic stem cells into hepatocytes comprising the following steps;

⑴ 제 1항의 마이크로어레이 칩에 피검 화합물 또는 조성물을 처리하는 단계;(B) treating the test compound or composition to the microarray chip of claim 1;

⑵ 상기 마이크로어레이 칩에 집적된 유전자의 발현량 또는 DNA 탈메틸화를 측정하는 단계; 및Measuring DNA expression or DNA demethylation of the gene integrated in the microarray chip; And

⑶ 단계 ⑵의 내배엽 전구체-특이적 유전자 또는 성숙한 간세포-특이적 유전자의 발현량을 증가시키거나, 또는 내배엽 전구체-특이적 유전자 또는 성숙한 간세포-특이적 유전자를 DNA 탈메틸화시키는 피검 화합물 또는 조성물을 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화를 촉진하는 후보 물질로 판정하는 단계.
A test compound or composition which increases the expression level of the endoderm precursor-specific gene or mature hepatocyte-specific gene of step VII or DNA demethylates the endoderm precursor-specific gene or mature hepatocyte-specific gene. Determining as a candidate to promote differentiation from embryonic stem cells to hepatocytes.

본 발명의 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩을 사용하여 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계를 판별하는데 유용하게 사용될 수 있다. 또한, 상기 마이크로어레이 칩을 이용하여 줄기세포의 분화를 촉진하는 물질을 스크리닝할 수 있을 뿐만 아니라, 상기 마이크로어레이 칩을 이용하여 상기 마이크로어레이 칩에 집적된 마커를 탈메틸화 시키는 물질을 스크리닝할 수 있다.
The microarray chip for determining the stage of differentiation from human embryonic stem cells to hepatocytes can be usefully used to determine the stage of differentiation from human embryonic stem cells to hepatocytes. In addition, the microarray chip may be used to screen a substance that promotes differentiation of stem cells, and the microarray chip may be used to screen a material that demethylates the marker integrated in the microarray chip. .

도 1은 시험관 내(in vitro) 간생성하는 동안에 전사체(transcriptome) 및 메틸화체(methylome)의 프로파일링을 나타내는 그림이다.
(A) 인간 배아줄기세포(ES)는 내배엽 전구체(EP)로, 더 나아가 성숙한 간세포(MH)으로 분화되었다. 각 단계의 세포 형태와 면역형광 염색을 보여준다. POU5F1는 배아 줄기 세포(ES)에서 염색되고, SOX17는 내배엽 전구체(EP)에서 염색되며, 그리고 AFP는 성숙한 간세포(MH)에서 염색된다.
(B) 전체-게놈 발현 비드칩(Whole-Genome Expression BeadChip)에 의한 전사체(transcriptome) 분석 및 인피니엄 인간메틸화27 비드칩(Infinium HumanMethylation27 BeadChip) 및 MBD 서열분석 모두에 의한 메틸화체(methylome) 분석이다.
도 2는 클러스터 1(A)의 67 유전자들, 클러스터 2(B)의 83 유전자들, 및 클러스터 1(C)의 375 유전자들에 대한 유전자 온톨로지 분석을 나타내는 그림이다. DAVID 기능적 주석달기 클러스터링 도구가 유전자 온톨로지 분석에 사용되었다.
도 3은 배아 줄기 세포(ES)-, 내배엽 전구체(EP)-, 및 성숙한 간세포(MH)-특이적 발현을 갖는 유전자들의 클러스터를 나타내는 그림이다.
(A) 3 분화 상태에서의 배아 줄기 세포(ES) 마커(POU5F1, SOX2, 및 NANOG), 내배엽 전구체(EP) 마커(SOX17, FOXA2, 및 GATA4), 및 성숙한 간세포(MH) 마커(ALB, AFP, 및 SERPINA1)의 qRTPCR 분석이다.
(B) 클러스터 1 (배아 줄기 세포(ES)-특이적 발현 유전자들), 클러스터 2 (내배엽 전구체(EP)-특이적 발현 유전자들), 및 클러스터 3 (성숙한 간세포(MH)-특이적 발현 유전자들). 각 분화 단계에서 잘 알려진 마커들과 공동-발현된 유전자들은 클러스터하고 MultiExperiment Viewer로 보여진다.
도 4는 배아 줄기 세포(ES)-특이적 발현 및 탈메틸화를 갖는 유전자들을 나타내는 그림이다.
(A) 마이크로어레이 데이타로부터 16개의 배아 줄기 세포(ES)-특이적 마커들의 mRNA 발현 및 CpG 메틸화 수준이다.
(B) qRT-PCR로 배아 줄기 세포(ES)-특이적 마커들에 대한 발현 마이크로어레이의 확인이다.
(C) 파이로서열분석(pyrosequencing)으로 배아 줄기 세포(ES)-특이적 마커들에 대한 발현 마이크로어레이 메틸화의 확인이다. 10-kb 창(window)에서의 CpG 위치들을 제공한다. 메틸화 비드칩 어레이에서 표적 CpG 위치는 검정 삼각형으로 표시된 것처럼 10-kb 창의 가운데에 위치한다.
도 5는 내배엽 전구체(EP)-특이적 발현 및 탈메틸화를 갖는 유전자들을 나타내는 그림이다.
(A) 마이크로어레이 데이타로부터 11개의 내배엽 전구체(EP)-특이적 마커들의 mRNA 발현 및 CpG 메틸화 수준이다.
(B) qRT-PCR로 마이크로어레이 발현의 확인이다.
(C) 파이로서열분석(pyrosequencing)으로 마이크로어레이 메틸화의 확인이다.
도 6은 성숙한 간세포(MH)--특이적 발현 및 탈메틸화를 갖는 유전자들을 나타내는 그림이다.
(A) 마이크로어레이 데이타로부터 40개의 성숙한 간세포(MH)-특이적 마커들의 mRNA 발현 및 CpG 메틸화 수준이다.
(B) qRT-PCR로 마이크로어레이 발현의 확인이다.
(C) 파이로서열분석(pyrosequencing)으로 마이크로어레이 메틸화의 확인이다.
도 7은 시험관 내 간세포로 분화하는 동안 게놈-규모의 DNA 메틸화 변화를 나타내는 그림이다.
(A) 배아 줄기 세포(ES) 대 내배엽 전구체(EP) 및 내배엽 전구체(EP) 대 성숙한 간세포(MH)에서 인간 게놈의 모든 200-bp 단편(총 15,399,219 단편)에 대한 DNA 메틸화 값을 비교하는 스캐터 플롯(Scatter plots)을 나타낸 그림이다. 과메틸화(빨강)은 메틸화가 2-배 증가한 것으로 정의되고, 저메틸화(녹색)은 메틸화가 2-배 감소한 것으로 정의된다.
(B) 총 10,200,091 단편에 대한, 모든 CpG 단편을 포함하는 200-bp 단편은 CpG 밀도에 따라 분류되었다. 낮은-CpG, 중간-CpG, 및 높은-CpG 단편들이 정의되었다.
(C) 인용(Ref), 과메틸화된(Hyper), 및 저메틸화된(Hypo) 단편들에 대한 단편 분류 분포를 보여주는 히스토그램이다.
(D) 인용(Ref), 과메틸화된(Hyper), 및 저메틸화된(Hypo) 단편들의 게놈 상 모습의 분포이다. 프로모터는 RefSeq 데이타베이스에서 주석을 단 전사 시작점의 2 kb 상류로 정의된다. 또한 다른 게놈의 모습도 RefSeq 데이타베이스로 정의된다. SINE, 짧은 산재된 핵 인자(short interspersed nuclear element); LINE, 긴 산재된 핵 인자(long interspersed nuclear element); LTR, 긴 말단 반복(long terminal repeat).
1 is a diagram showing the profiling of transcriptome and methylome during in vitro hepatic generation.
(A) Human embryonic stem cells (ES) were differentiated into endoderm precursors (EP) and further into mature hepatocytes (MH). Show cell morphology and immunofluorescence staining at each step. POU5F1 is stained in embryonic stem cells (ES), SOX17 is stained in endoderm precursors (EP), and AFP is stained in mature hepatocytes (MH).
(B) Transcriptome analysis by Whole-Genome Expression BeadChip and methylome analysis by both Infinium HumanMethylation27 BeadChip and MBD Sequencing to be.
FIG. 2 shows gene ontology analysis for 67 genes in cluster 1 (A), 83 genes in cluster 2 (B), and 375 genes in cluster 1 (C). DAVID functional annotation clustering tools were used for gene ontology analysis.
3 is a diagram showing clusters of genes with embryonic stem cell (ES)-, endoderm precursor (EP)-, and mature hepatocyte (MH) -specific expression.
(A) Embryonic stem cell (ES) markers in three differentiation states (POU5F1, SOX2, and NANOG), endoderm precursor (EP) markers (SOX17, FOXA2, and GATA4), and mature hepatocyte (MH) markers (ALB, AFP) , And SERTINA1) qRTPCR analysis.
(B) Cluster 1 (embryonic stem cell (ES) -specific expression genes), Cluster 2 (endoderm precursor (EP) -specific expression genes), and cluster 3 (mature hepatocyte (MH) -specific expression gene field). Well-known markers and co-expressed genes at each differentiation stage are clustered and shown in the MultiExperiment Viewer.
4 shows genes with embryonic stem cell (ES) -specific expression and demethylation.
(A) mRNA expression and CpG methylation levels of 16 embryonic stem cell (ES) -specific markers from microarray data.
(B) Identification of expression microarrays for embryonic stem cell (ES) -specific markers by qRT-PCR.
(C) Confirmation of expression microarray methylation for embryonic stem cell (ES) -specific markers by pyrosequencing. Provides CpG locations in a 10-kb window. The target CpG position in the methylated beadchip array is centered in the 10-kb window as indicated by the black triangle.
5 is a diagram showing genes with endoderm precursor (EP) -specific expression and demethylation.
(A) mRNA expression and CpG methylation levels of 11 endoderm precursor (EP) -specific markers from microarray data.
(B) Confirmation of microarray expression by qRT-PCR.
(C) Confirmation of microarray methylation by pyrosequencing.
6 is a diagram showing genes with mature hepatocytes (MH) -specific expression and demethylation.
(A) mRNA expression and CpG methylation levels of 40 mature hepatocyte (MH) -specific markers from microarray data.
(B) Confirmation of microarray expression by qRT-PCR.
(C) Confirmation of microarray methylation by pyrosequencing.
FIG. 7 is a plot showing genome-scale DNA methylation changes during differentiation into hepatocytes in vitro.
(A) Comparison of DNA methylation values for all 200-bp fragments (15,399,219 fragments in the human genome) in embryonic stem cells (ES) versus endoderm precursors (EP) and endoderm precursors (EP) versus mature hepatocytes (MH). Figure shows Scatter plots. Hypermethylation (red) is defined as a 2-fold increase in methylation and hypomethylation (green) is defined as a 2-fold decrease in methylation.
(B) 200-bp fragments, including all CpG fragments, for a total of 10,200,091 fragments were sorted according to CpG density. Low-CpG, medium-CpG, and high-CpG fragments were defined.
(C) Histogram showing fragment classification distribution for Ref, Hypermethylated, and Hypomethylated (Hypo) fragments.
(D) Distribution of genomic features of Ref, Hypermethylated, and Hypermethylated (Hypo) fragments. The promoter is defined as 2 kb upstream of the annotated transcription start in the RefSeq database. The appearance of other genomes is also defined in the RefSeq database. SINE, short interspersed nuclear element; LINE, long interspersed nuclear element; LTR, long terminal repeat.

이하, 본 발명을 상세히 설명한다.
Hereinafter, the present invention will be described in detail.

본 발명은 하기의 군으로부터 선택되는 어느 하나 이상의 유전자의 핵산 서열 올리고뉴클레오티드 또는 그의 상보가닥 분자가 집적된, 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩을 제공한다:The present invention provides a microarray chip for determining the stage of differentiation from human embryonic stem cells to hepatocytes in which nucleic acid sequence oligonucleotides or complementary strand molecules of any one or more genes selected from the following groups are integrated:

POU5F1(POU class 5 homeobox 1, 유전자 등록 번호(Genbank Accession No.) NM_002701), DPPA2(developmental pluripotency associated 2, 유전자 등록 번호(Genbank Accession No.) NM_138815), DPEP3(dipeptidase 3, 유전자 등록 번호(Genbank Accession No.) NM_022357), SLC15A3(solute carrier family 15, member 3, 유전자 등록 번호(Genbank Accession No.) NM_016582), USP44(ubiquitin specific peptidase 44, 유전자 등록 번호(Genbank Accession No.) NM_032147), SOX2(SRY (sex determining region Y)-box 2, 유전자 등록 번호(Genbank Accession No.) NM_003106), MT1F(metallothionein 1F, 유전자 등록 번호(Genbank Accession No.) NM_005949), CRABP1(cellular retinoic acid binding protein 1, 유전자 등록 번호(Genbank Accession No.) NM_004378), LECT1(leukocyte cell derived chemotaxin 1, 유전자 등록 번호(Genbank Accession No.) NM_007015), VGF(VGF nerve growth factor inducible, 유전자 등록 번호(Genbank Accession No.) NM_007015), SFRP2(secreted frizzled related protein 2, 유전자 등록 번호(Genbank Accession No.) NT_016354), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), 유전자 등록 번호(Genbank Accession No.) NM_005378), UTF1(undifferentiated embryonic cell transcription factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003577), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, 유전자 등록 번호(Genbank Accession No.) NM_005769), PRDM14(PR domain containing 14, 유전자 등록 번호(Genbank Accession No.) NM_024504), MT1G(metallothionein 1G, 유전자 등록 번호(Genbank Accession No.) NM_005950), CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_005454), GATA4(GATA binding protein 4, 유전자 등록 번호(Genbank Accession No.) NT_077531), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_031944), LEFTY1(left-right determination factor 1, 유전자 등록 번호(Genbank Accession No.) NM_020997), VWF(von Willebrand factor, 유전자 등록 번호(Genbank Accession No.) NM_000552), NODAL(nodal homolog (mouse), 유전자 등록 번호(Genbank Accession No.) NM_018055), DLX5(distal-less homeobox 5, 유전자 등록 번호(Genbank Accession No.) NT_007933), FOXC1(forkhead box C1, 유전자 등록 번호(Genbank Accession No.) NM_001453), KCNK12(potassium channel, subfamily K, member 12, 유전자 등록 번호(Genbank Accession No.) NM_022055), SOX17(SRY (sex determining region Y)-box 17, 유전자 등록 번호(Genbank Accession No.) NM_022454), LEFTY2(left-right determination factor 2, 유전자 등록 번호(Genbank Accession No.) NM_003240), SERPINA3(serpin peptidase inhibitor, clade A , member 3, 유전자 등록 번호(Genbank Accession No.) NM_001085), AGT(angiotensinogen, 유전자 등록 번호(Genbank Accession No.) NM_000029), AFP(alpha-fetoprotein, 유전자 등록 번호(Genbank Accession No.) NM_001134), TM4SF4(transmembrane 4 L six family member 4, 유전자 등록 번호(Genbank Accession No.) NM_004617), APOA4(apolipoprotein A-IV, 유전자 등록 번호(Genbank Accession No.) NM_000482), SPINK1(serine peptidase inhibitor, Kazal type 1, 유전자 등록 번호(Genbank Accession No.) NM_003122), KNG1(kininogen 1, 유전자 등록 번호(Genbank Accession No.) NM_000893), CFH(complement factor H, 유전자 등록 번호(Genbank Accession No.) NM_000186), ALDH1A1(aldehyde dehydrogenase 1 family, member A1, 유전자 등록 번호(Genbank Accession No.) NM_000689), C11orf9(chromosome 11 open reading frame 9, 유전자 등록 번호(Genbank Accession No.) NM_013279), SLCO2B1(solute carrier organic anion transporter family, member 2B1, 유전자 등록 번호(Genbank Accession No.) NM_007256), RIN2(Ras and Rab interactor 2, 유전자 등록 번호(Genbank Accession No.) NM_018993), SRPX2(sushi-repeat-containing protein, X-linked 2, 유전자 등록 번호(Genbank Accession No.) NM_014467), FGG(fibrinogen gamma chain, 유전자 등록 번호(Genbank Accession No.) NM_000509), VTN(vitronectin, 유전자 등록 번호(Genbank Accession No.) NM_000638), KLB(klotho beta, 유전자 등록 번호(Genbank Accession No.) NM_175737), TIMP3(TIMP metallopeptidase inhibitor 3, 유전자 등록 번호(Genbank Accession No.) NT_011520), CREB3L3(cAMP responsive element binding protein 3-like 3, 유전자 등록 번호(Genbank Accession No.) NM_032607), DEFB1(defensin, beta 1, 유전자 등록 번호(Genbank Accession No.) NM_005218), CIDEC(cell death-inducing DFFA-like effector c, 유전자 등록 번호(Genbank Accession No.) NM_022094), ANGPTL6(angiopoietin-like 6, 유전자 등록 번호(Genbank Accession No.) NM_031917), KBTBD10(kelch repeat and BTB (POZ) domain containing 10, 유전자 등록 번호(Genbank Accession No.) NM_006063), VCAM1(vascular cell adhesion molecule 1, 유전자 등록 번호(Genbank Accession No.) NM_001078), CSF1R(colony stimulating factor 1 receptor, 유전자 등록 번호(Genbank Accession No.) NM_005211), KYNU(kynureninase (L-kynurenine hydrolase), 유전자 등록 번호(Genbank Accession No.) NM_003937), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1, 유전자 등록 번호(Genbank Accession No.) NM_003167), RAMP1(receptor (G protein-coupled) activity modifying protein 1, 유전자 등록 번호(Genbank Accession No.) NM_005855), TDO2(tryptophan 2,3-dioxygenase, 유전자 등록 번호(Genbank Accession No.) NM_005651), AQP10(aquaporin 10, 유전자 등록 번호(Genbank Accession No.) NM_080429), CTSE(cathepsin E, 유전자 등록 번호(Genbank Accession No.) NM_001910), SLPI(secretory leukocyte peptidase inhibitor, 유전자 등록 번호(Genbank Accession No.) NM_003064), APOC2(apolipoprotein C-II, 유전자 등록 번호(Genbank Accession No.) NM_000483), SEPP1(selenoprotein P, plasma, 1, 유전자 등록 번호(Genbank Accession No.) NM_005410), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila), 유전자 등록 번호(Genbank Accession No.) NM_001343), TFF1(trefoil factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003225), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13, 유전자 등록 번호(Genbank Accession No.) NM_002242), FMO1(flavin containing monooxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_002021), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2, 유전자 등록 번호(Genbank Accession No.) NM_002153), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_000302) 및 HKDC1(hexokinase domain containing 1, 유전자 등록 번호(Genbank Accession No.) NM_025130).POU5F1 (POU class 5 homeobox 1, Genbank Accession No. NM_002701), DPPA2 (developmental pluripotency associated 2), Gene Accession Number (Genbank Accession No.) NM_138815, DPEP3 (dipeptidase 3, Gene Accession Number (Genbank Accession) No.) NM_022357), SLC15A3 (solute carrier family 15, member 3, Gene Accession No. NM_016582), USP44 (ubiquitin specific peptidase 44, Gene Accession No. NM_032147), SOX2 (SRY (sex determining region Y) -box 2, Genbank Accession No. NM_003106, MT1F (metallothionein 1F, Genbank Accession No. NM_005949), CRABP1 (cellular retinoic acid binding protein 1, gene registration No. (Genbank Accession No.) NM_004378), LECT1 (leukocyte cell derived chemotaxin 1, Gene accession number (Genbank Accession No.) NM_007015), VGF (VGF nerve growth factor inducible, Genbank Accession No. NM_007015), SFRP2 (secreted frizzled relat ed protein 2, gene accession number (Genbank Accession No.) NT_016354), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), gene accession number (Genbank Accession No.) NM_005378), UTF1 (undifferentiated embryonic cell transcription factor 1, Genbank Accession No. NM_003577), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, Genebank Accession No. NM_005769), PRDM14 (PR domain containing 14, gene accession number (Genbank Accession No.) NM_024504), MT1G (metallothionein 1G, gene accession number (Genbank Accession No.) NM_005950), CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), gene accession number (Genbank Accession No.) NM_005454), GATA4 (GATA binding protein 4, Genbank Accession No.) NT_077531), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis), Gene Accession No. NM_031944), LEFTY1 (left- right determination factor 1, u Electronic Bank Identification Number (Genbank Accession No.) NM_020997, VWF (von Willebrand factor, Genbank Accession No. NM_000552), NODAL (nodal homolog (mouse), Gene Bank Accession No. NM_018055), DLX5 (distal-less homeobox 5, Genbank Accession No. NT_007933), FOXC1 (forkhead box C1, Genbank Accession No. NM_001453), KCNK12 (potassium channel, subfamily K, member 12, gene Genbank Accession No. (NM_022055), SOX17 (sex determining region Y) -box 17, Genbank Accession No. (NM_022454), LEFTY2 (left-right determination factor 2, gene registration number (Genbank) Accession No.) NM_003240), SERPINA3 (serpin peptidase inhibitor, clade A, member 3, Genbank Accession No. NM_001085), AGT (angiotensinogen, Genbank Accession No.) NM_000029), AFP (alpha) fetoprotein, Genbank Accession No. NM_001134, TM4SF4 (t ransmembrane 4 L six family member 4, gene accession number (Genbank Accession No.) NM_004617), APOA4 (apolipoprotein A-IV, gene accession number (Genbank Accession No.) NM_000482), SPINK1 (serine peptidase inhibitor, Kazal type 1, gene Accession number (Genbank Accession No.) NM_003122), KNG1 (kininogen 1, gene accession number (Genbank Accession No.) NM_000893), CFH (complement factor H, Genbank Accession No.) NM_000186), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1, Genbank Accession No. NM_000689), C11orf9 (chromosome 11 open reading frame 9, Gene Accession No. NM_013279), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 , Genbank Accession No. NM_007256, RIN2 (Ras and Rab interactor 2, Genbank Accession No. NM_018993), SRPX2 (sushi-repeat-containing protein, X-linked 2, gene accession number (Genbank Accession No.) NM_014467), FGG (fi brinogen gamma chain, Genbank Accession No. NM_000509, VTN (vitronectin, Genbank Accession No. NM_000638), KLB (klotho beta, Genbank Accession No. NM_175737), TIMP3 (TIMP metallopeptidase inhibitor 3, Genbank Accession No. NT_011520), CREB3L3 (cAMP responsive element binding protein 3-like 3, Gene accession No. NM_032607), DEFB1 (defensin, beta 1, gene Accession number (Genbank Accession No.) NM_005218), cell death-inducing DFFA-like effector c, gene accession number (Genbank Accession No.) NM_022094), ANGPTL6 (angiopoietin-like 6, gene accession number (Genbank Accession No. ) NM_031917), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10, Genebank Accession No. NM_006063), VCAM1 (vascular cell adhesion molecule 1, Genebank Accession No. NM_001078), CSF1R (colony stimulating factor 1 receptor, gene GenBank Accession No. (NM_005211), kynureninase (L-kynurenine hydrolase), KYNU, Genbank Accession No. (NM_003937), SULT2A1 (sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1, Genbank Accession No. NM_003167), RAMP1 (receptor (G protein-coupled) activity modifying protein 1, Genebank Accession No.) NM_005855), TDO2 (tryptophan 2,3-dioxygenase, gene Accession number (Genbank Accession No.) NM_005651), AQP10 (aquaporin 10, gene accession number (Genbank Accession No.) NM_080429), CTSE (cathepsin E, gene accession number (Genbank Accession No.) NM_001910), secretory leukocyte peptidase inhibitor, gene accession number (Genbank Accession No.) NM_003064), APOC2 (apolipoprotein C-II, gene accession number (Genbank Accession No.) NM_000483), SEPP1 (selenoprotein P, plasma, 1, gene accession number (Genbank Accession No. NM_005410), DAB2 (disabled homolog 2, mitogen-re sponsive phosphoprotein (Drosophila), Genbank Accession No. NM_001343, TFF1 (trefoil factor 1, Genbank Accession No. NM_003225), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13, gene Accession number (Genbank Accession No.) NM_002242), FMO1 (flavin containing monooxygenase 1, gene accession number (Genbank Accession No.) NM_002021), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2, gene accession number (Genbank Accession No.) NM_002153), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, Genbank Accession No. NM_000302) and HKDC1 (hexokinase domain containing 1, Genebank Accession No. NM_025130).

상기 마이크로어레이 칩에 집적된 하기의 군으로부터 선택되는 어느 하나 이상의 유전자는 인간 배아 줄기 세포(embryonic stem cell; ES)-특이적 유전자인 것이 바람직하나, 이에 한정되지 않는다;Any one or more genes selected from the following groups integrated in the microarray chip is preferably, but not limited to, human embryonic stem cell (ES) -specific genes;

POU5F1(POU class 5 homeobox 1), DPPA2(developmental pluripotency associated 2), DPEP3(dipeptidase 3), SLC15A3(solute carrier family 15, member 3), USP44(ubiquitin specific peptidase 44), SOX2(SRY (sex determining region Y)-box 2), MT1F(metallothionein 1F), CRABP1(cellular retinoic acid binding protein 1), LECT1(leukocyte cell derived chemotaxin 1), VGF(VGF nerve growth factor inducible), SFRP2(secreted frizzled related protein 2), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), UTF1(undifferentiated embryonic cell transcription factor 1), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4), PRDM14(PR domain containing 14) 및 MT1G(metallothionein 1G).POU5F1 (POU class 5 homeobox 1), DPPA2 (developmental pluripotency associated 2), DPEP3 (dipeptidase 3), SLC15A3 (solute carrier family 15, member 3), USP44 (ubiquitin specific peptidase 44), SOX2 (SRY (sex determining region Y) ) -box 2), metallothionein 1F (MT1F), cellular retinoic acid binding protein 1 (CRABP1), leukocyte cell derived chemotaxin 1 (LECT1), VGF nerve growth factor inducible (VGF), secreted frizzled related protein 2 (SFRP2), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), undifferentiated embryonic cell transcription factor 1 (UTF1), carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 (CHST4), PRDM14 (PR domain containing 14), and MT1G ( metallothionein 1G).

상기 마이크로어레이 칩에 집적된 하기의 군으로부터 선택되는 어느 하나 이상의 유전자는 내배엽 전구체(endoderm progenitor; EP)-특이적 유전자인 것이 바람직하나, 이에 한정되지 않는다;At least one gene selected from the following group integrated in the microarray chip is preferably an endoderm progenitor (EP) -specific gene, but is not limited thereto;

CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4(GATA binding protein 4), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1(left-right determination factor 1), VWF(von Willebrand factor), NODAL(nodal homolog (mouse)), DLX5(distal-less homeobox 5), FOXC1(forkhead box C1), KCNK12(potassium channel, subfamily K, member 12), SOX17(SRY (sex determining region Y)-box 17) 및 LEFTY2(left-right determination factor 2).CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4 (GATA binding protein 4), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1 (left-right determination factor 1), VWF (von Willebrand factor, NODAL (nodal homolog (mouse)), DLX5 (distal-less homeobox 5), FOXC1 (forkhead box C1), KCNK12 (potassium channel, subfamily K, member 12), SOX17 (SRY (sex determining region Y) -box 17) and LEFTY2 (left-right determination factor 2).

상기 마이크로어레이 칩에 집적된 하기의 군으로부터 선택되는 어느 하나 이상의 유전자는 성숙한 간세포(mature hepatocytes; MH)-특이적 유전자인 것이 바람직하나, 이에 한정되지 않는다;Any one or more genes selected from the following groups integrated in the microarray chip are preferably mature hepatocytes (MH) -specific genes, but are not limited thereto;

SERPINA3(serpin peptidase inhibitor, clade A , member 3), AGT(angiotensinogen), AFP(alpha-fetoprotein), TM4SF4(transmembrane 4 L six family member 4), APOA4(apolipoprotein A-IV), SPINK1(serine peptidase inhibitor, Kazal type 1), KNG1(kininogen 1), CFH(complement factor H), ALDH1A1(aldehyde dehydrogenase 1 family, member A1), C11orf9(chromosome 11 open reading frame 9), SLCO2B1(solute carrier organic anion transporter family, member 2B1), RIN2(Ras and Rab interactor 2), SRPX2(sushi-repeat-containing protein, X-linked 2), FGG(fibrinogen gamma chain), VTN(vitronectin), KLB(klotho beta), TIMP3(TIMP metallopeptidase inhibitor 3), CREB3L3(cAMP responsive element binding protein 3-like 3), DEFB1(defensin, beta 1), CIDEC(cell death-inducing DFFA-like effector c), ANGPTL6(angiopoietin-like 6), KBTBD10(kelch repeat and BTB (POZ) domain containing 10), VCAM1(vascular cell adhesion molecule 1), CSF1R(colony stimulating factor 1 receptor), KYNU(kynureninase (L-kynurenine hydrolase)), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1), RAMP1(receptor (G protein-coupled) activity modifying protein 1), TDO2(tryptophan 2,3-dioxygenase), AQP10(aquaporin 10), CTSE(cathepsin E), SLPI(secretory leukocyte peptidase inhibitor), APOC2(apolipoprotein C-II), SEPP1(selenoprotein P, plasma, 1), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)), TFF1(trefoil factor 1), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13), FMO1(flavin containing monooxygenase 1), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) 및 HKDC1(hexokinase domain containing 1).SERPINA3 (serpin peptidase inhibitor, clade A, member 3), AGT (angiotensinogen), AFP (alpha-fetoprotein), TM4SF4 (transmembrane 4 L six family member 4), APOA4 (apolipoprotein A-IV), SPINK1 (serine peptidase inhibitor, Kazal type 1), KNG1 (kininogen 1), CFH (complement factor H), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), C11orf9 (chromosome 11 open reading frame 9), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 ), RIN2 (Ras and Rab interactor 2), SRPX2 (sushi-repeat-containing protein, X-linked 2), fibrinogen gamma chain (FFG), vitronectin (VTN), klotho beta (KLB), TIMP metallopeptidase inhibitor 3 ), CREB3L3 (cAMP responsive element binding protein 3-like 3), DEFB1 (defensin, beta 1), CIDEC (cell death-inducing DFFA-like effector c), ANGPTL6 (angiopoietin-like 6), KBTBD10 (kelch repeat and BTB) (POZ) domain containing 10), vascular cell adhesion molecule 1 (VCAM1), colony stimulating factor 1 receptor (CSF1R), kynureninase (L-kynurenine hydrolase) (KYNU), SULT2A1 (sulfot) ransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1), RAMP1 (receptor (G protein-coupled) activity modifying protein 1), TDO2 (tryptophan 2,3-dioxygenase), AQP10 (aquaporin 10), CTSE (cathepsin E), secretory leukocyte peptidase inhibitor (SLPI), apolipoprotein C-II (APOC2), selenoprotein P, plasma, 1), DAB2 (disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)), TFF1 (trefoil factor) 1), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13), FMO1 (flavin containing monooxygenase 1), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) and HKDC1 (hexokinase domain containing 1).

상기 마이크로어레이 칩은 유전자의 발현 검출용 또는 DNA 탈메틸화 검출용인 것이 바람직하나, 이에 한정되지 않는다.The microarray chip is preferably for detecting gene expression or detecting DNA demethylation, but is not limited thereto.

본 발명의 구체적인 실시예에서, 배아 줄기 세포(배아 줄기 세포(ES))는 >90%의 효율로 내배엽 전구체(내배엽 전구체(EP))로 분화시키고, 그 후에 내배엽 전구체는 >80%의 효율로 간세포로 분화시켰다(도 1A). In a specific embodiment of the present invention, embryonic stem cells (embryonic stem cells (ES)) differentiate into endoderm precursors (endodermal precursors (EP)) at an efficiency of> 90%, after which endoderm precursors are at an efficiency of> 80%. Differentiation into hepatocytes (FIG. 1A).

본 발명의 구체적인 실시예에서, 배아 줄기 세포(ES), 내배엽 전구체(EP), 및 성숙한 간세포(MH)의 발현 분석은 4회 반복 실험하였다. 표시된 시점에 세포주에서 분리된 RNA를 사용하고, 46,000개 이상의 인간 전사체에 대한 발현 프로파일을 제공하는 인간-6 전체-게놈 발현 비드칩을 사용하여 유전자 발현을 분석하였다. 질을 확인한 총 RNA 300 ng을 사용하여 선형 증폭 키트(linear amplification kit; Ambion, Austin, TX)로 비오틴-표지된 cRNA를 만들었다. 칩 혼성화, 세척, Cy3-스트렙타비딘 염색, 및 스캐닝은 제조자가 제공한 시약 및 프로토콜에 따라 비드어레이 리더(BeadArray Reader; Illumina) 플랫폼에서 수행하였다. 발현을 결정하기 위해 검출 점수를 사용하였다.In specific embodiments of the invention, expression assays of embryonic stem cells (ES), endoderm precursors (EP), and mature hepatocytes (MH) were repeated four times. Gene expression was analyzed using RNA isolated from the cell line at the indicated time points and using a human-6 whole-genomic expression beadchip that provides expression profiles for over 46,000 human transcripts. Biotin-labeled cRNA was made with a linear amplification kit (Ambion, Austin, TX) using 300 ng of confirmed total RNA. Chip hybridization, washing, Cy3-streptavidin staining, and scanning were performed on a BeadArray Reader (Illumination) platform according to the reagents and protocols provided by the manufacturer. Detection scores were used to determine expression.

본 발명의 구체적인 실시예에서, qRT-PCR를 통하여 POU5F1, SOX2, 및 NANOG는 배아 줄기 세포-특이적으로 발현하였고, SOX17, FOXA2, 및 GATA4는 내배엽 전구체(EP)-특이적으로 발현하였으며, ALB, AFP, 및 SERPINA1는 성숙한 간세포(MH)-특이적으로 발현하였음을 확인하였다. 이런 마커들은 분화하는 동안에 극적인 발현 변화를 보인다(도 3A).In a specific embodiment of the invention, POU5F1, SOX2, and NANOG expressed embryonic stem cell-specifically via qRT-PCR, SOX17, FOXA2, and GATA4 expressed endoderm precursor (EP) -specifically, and ALB , AFP, and SERPINA1 were confirmed to express mature hepatocyte (MH) -specifically. These markers show dramatic expression changes during differentiation (FIG. 3A).

본 발명의 구체적인 실시예에서, 배아 줄기 세포(ES), 내배엽 전구체(EP), 및 성숙한 간세포(MH) 단계 동안 특이적으로 발현되는 추가적인 유전자들을 찾기 위하여, 각 단계에서 잘 알려진 마커들과 공동-발현되는 유전자들을 클러스터하였다(도 3B). 클러스터 1은 POU5F1, SOX2, 및 NANOG과 배아 줄기 세포(ES)-특이적 발현을 보이는 67개의 유전자들을 포함한다(표 2). 클러스터 2는 SOX17, FOXA2, 및 GATA4과 내배엽 전구체(EP)-특이적 발현을 보이는 83개의 유전자들을 포함한다(표 3). 클러스터 3은 ALB, AFP, 및 SERPINA1과 성숙한 간세포(MH)-특이적 발현을 보이는 375개의 유전자들을 포함한다(표 4).In a specific embodiment of the present invention, in order to find additional genes specifically expressed during embryonic stem cell (ES), endoderm precursor (EP), and mature hepatocyte (MH) stages, co- The expressed genes were clustered (FIG. 3B). Cluster 1 contains 67 genes that exhibit POU5F1, SOX2, and NANOG and embryonic stem cell (ES) -specific expression (Table 2). Cluster 2 contains 83 genes showing SOX17, FOXA2, and GATA4 and endoderm precursor (EP) -specific expression (Table 3). Cluster 3 contains 375 genes showing mature hepatocyte (MH) -specific expression with ALB, AFP, and SERPINA1 (Table 4).

본 발명의 구체적인 실시예에서, 배아 줄기 세포(배아 줄기 세포(ES)), 내배엽 전구체(내배엽 전구체(EP)), 및 성숙한 간세포(성숙한 간세포(MH))의 메틸화 분석은 3회 반복 실험하였다. 각 시료에서 게놈 DNA(1 ㎍)은 EZ DNA 메틸화 키트(Zymo Research, Orange, CA)를 사용하여 중아황산염(bisulfite)으로 변형시키고, 변형된 DNA 200 ng 을 증폭에 사용하였다. 증폭된 DNA는 인피니엄 인간메틸화27 비드칩(Infinium HumanMethylation27 BeadChip, Illumina)로 혼성화하고, 잘 알려진 14,495 이상의 유전자에서 선별된 27,578 CpG 위치의 메틸화 상태를 분석하였다. 어레이는 비드어레이 리더(BeadArray Reader)를 사용하여 이미지화하고, 일루미나(Illumina) 사의 안내에 따라 이미지 프로세싱 및 인텐시티 데이타(intensity data)의 추출을 수행하였다. 각 메틸화 신호는 β 값으로 계산하고, 이는 0(완전히 메틸화되지 않은 시토신)에서 1(완전히 메틸화된 시토신)의 범위로 DNA 메틸화의 정량적인 값으로 계산되었다(Bibikova M. et al., Genome Res 2006;16:1075-1083).In specific embodiments of the invention, methylation assays of embryonic stem cells (embryonic stem cells (ES)), endoderm precursors (endodermal precursors (EP)), and mature hepatocytes (mature hepatocytes (MH)) were repeated three times. Genomic DNA (1 μg) in each sample was modified with bisulfite using the EZ DNA Methylation Kit (Zymo Research, Orange, Calif.), And 200 ng of the modified DNA was used for amplification. The amplified DNA was hybridized with Infinium HumanMethylation27 BeadChip, Illumina and analyzed for methylation status of 27,578 CpG positions selected from over 14,495 well-known genes. Arrays were imaged using a BeadArray Reader and image processing and extraction of intensity data were performed as directed by Illumina. Each methylation signal is calculated as a β value, which is calculated as a quantitative value of DNA methylation ranging from 0 (not fully methylated cytosine) to 1 (fully methylated cytosine) (Bibikova M. et. al ., Genome Res 2006; 16: 1075-1083).

본 발명의 구체적인 실시예에서, 클러스터 1에서 67개의 유전자의 유전자 온톨로지(ontology) 분석은 이들 유전자가 핵산 대사, 발생, 및 mRNA 전사와 관련되어 있다는 것을 나타낸다(도 2A). 67 개의 유전자들 중에, 마이크로어레이 데이타에서 mRNA 발현과 CpG 메틸화간의 중요한 음성적 상관관계를 보여주는 16개의 배아 줄기 세포(ES) 특이적 마커를 확인하였다(컷오프 R < 0.3, P < 0.05; 표 6). <도 4A>는 분화 과정 동안 16개의 배아 줄기 세포(ES)-특이적 마커의 mRNA 발현 및 CpG 메틸화 패턴을 보여준다. 상세히 살펴보면, 미분화 상태의 유지 및 배아 줄기 세포(ES)의 증식에 기능을 하는(Du J. et al., J Biochem 2010;147;265-271), DPPA2 (developmental pluripotency associated 2); 디펩티다제(dipeptidases)의 족에 속하는 막-결합 단백질인(Habib GM. et al., Faseb J 2003;17:1313-1315), dipeptidases; 양성자 올리고펩티드 공동수송체(a proton oligopeptide cotransporter)(Daniel H. et al., Pflugers Arch 2004;447:610-618)인, SLC15A3 (solute carrier family 15 member 3); 세포 주기를 조절하는 데 핵심적 역할을 하는 탈유비키틴화(deubiquitinating) 효소인(Stegmeier F. et al., Nature 2007;446:876-881), USP44 (ubiquitin specific peptidase 44); 및 자기재생(selfrenewal) 및 만능(pluripotent) 분화에 관련된(Li SS. et al., Stem Cells Dev 2006;15:532-555), LECT1 (leukocyte cell derived chemotaxin 1)을 확인하였다. 각각, qRT-PCR 분석(도 4B) 및 파이로서열분석(도 4C)을 사용하여 배아 줄기 세포(ES), 내배엽 전구체(EP), 및 성숙한 간세포(MH)에서 이 유전자들의 mRNA 발현과 DNA 메틸화 수준을 입증하였고; 이 유전자들의 mRNA 발현과 DNA 메틸화는 마이크로어레이 데이타에 부합된다.In a specific embodiment of the present invention, gene ontology analysis of 67 genes in cluster 1 shows that these genes are involved in nucleic acid metabolism, development, and mRNA transcription (FIG. 2A). Of the 67 genes, 16 embryonic stem cell (ES) specific markers were identified in the microarray data showing a significant negative correlation between mRNA expression and CpG methylation (cutoff R <0.3, P <0.05; Table 6). 4A shows mRNA expression and CpG methylation patterns of 16 embryonic stem cell (ES) -specific markers during the differentiation process. In detail, it functions in maintaining undifferentiated state and proliferating embryonic stem cells (ES) (Du J. et al ., J Biochem 2010; 147; 265-271), DPPA2 (developmental pluripotency associated 2); Dipeptidases, which is a membrane-binding protein belonging to the family of dipeptidases (Habib GM. Et al ., Faseb J 2003; 17: 1313-1315); SLC15A3 (solute carrier family 15 member 3), which is a proton oligopeptide cotransporter (Daniel H. et al ., Pflugers Arch 2004; 447: 610-618); Deubiquitinating enzyme (Stegmeier F. et al ., Nature 2007; 446: 876-881), USP44 (ubiquitin specific peptidase 44), which plays a key role in regulating the cell cycle; And related to selfrenewal and pluripotent differentiation (Li SS. Et al ., Stem Cells Dev 2006; 15: 532-555), LECT1 (leukocyte cell derived chemotaxin 1). MRNA expression and DNA methylation of these genes in embryonic stem cells (ES), endoderm precursors (EP), and mature hepatocytes (MH), respectively, using qRT-PCR analysis (FIG. 4B) and pyrosequencing (FIG. 4C). Proven levels; MRNA expression and DNA methylation of these genes correspond to microarray data.

본 발명의 구체적인 실시예에서, 클러스터 2에서 83개의 유전자의 유전자 온톨로지(ontology) 분석은 이들 유전자가 신호 전달, 발생, 배 발생(embryogenesis), 세포 커뮤니케이션, 및 절편 분화(segment specification)와 관련되어 있다는 것을 나타낸다(도 2B). 83 개의 유전자들 중에, 마이크로어레이 데이타에서 mRNA 발현과 CpG 메틸화간의 중요한 음성적 상관관계를 보여주는 11개의 내배엽 전구체(EP)특이적 메틸화 마커를 확인하였다(컷오프 R < 0.3, P < 0.05; 표 7). 도 5A는 분화 과정 동안 11개의 내배엽 전구체(EP)-특이적 마커의 mRNA 발현 및 CpG 메틸화 패턴을 보여준다. 이 11개의 마커들 중에서, 배아 줄기 세포(ES)의 분화와 관계되는 마디 신호전달 저해제(nodal signaling inhibitor)인(Katoh M. et al., Int J Mol Med 2006;17:795-799), CER1 (cerberus 1); 형태 발생(morphogenesis) 및 내배엽 분화에 중대한 역할을 하는(Hart AH. et al., Development 2002;129:3597-3608), MIXL1 (Mix1 homeobox-like 1); 초기 배 발생에서 좌-우 축 결정에 필요한(Meno C. et al., Cell 1998;94:287-297), LEFTY1 및 LEFTY2 (left-right determination factors 1 및 2); 및 내피하의(subendothelial) 콜라겐 및 혈소판의 결합 부위를 갖는 연쇄되고, 복합기능적인 단백질인(Kim J. et al., Nature 2010;466:992-995), VWF (von Willebrand factor)을 확인하였다. qRT-PCR 분석에 의한 이 유전자들의 mRNA 발현(도 5B) 및 파이로서열분석에 의한 DNA 메틸화 수준(도 5C)를 확인하였다.In a specific embodiment of the invention, gene ontology analysis of 83 genes in cluster 2 indicates that these genes are involved in signal transduction, development, embryoogenesis, cellular communication, and segment specification. (FIG. 2B). Of the 83 genes, 11 endoderm precursor (EP) specific methylation markers were identified in the microarray data showing a significant negative correlation between mRNA expression and CpG methylation (cutoff R <0.3, P <0.05; Table 7). 5A shows mRNA expression and CpG methylation patterns of 11 endoderm precursor (EP) -specific markers during differentiation. Of these 11 markers, CER1, a nodal signaling inhibitor (Katoh M. et al ., Int J Mol Med 2006; 17: 795-799), involved in the differentiation of embryonic stem cells (ES). (cerberus 1); Plays an important role in morphogenesis and endoderm differentiation (Hart AH. Et al ., Development 2002; 129: 3597-3608), MIXL1 (Mix1 homeobox-like 1); Required for left-right axis determination in early embryonic development (Meno C. et al ., Cell 1998; 94: 287-297), LEFTY1 and LEFTY2 (left-right determination factors 1 and 2); And a chain, multifunctional protein (Kim J. et al ., Nature 2010; 466: 992-995), von Willebrand factor (VWF) having a binding site of subendothelial collagen and platelets. . mRNA expression of these genes by qRT-PCR analysis (FIG. 5B) and DNA methylation levels by pyrosequence analysis (FIG. 5C) were confirmed.

본 발명의 구체적인 실시예에서, 클러스터 3에서 375개의 유전자의 유전자 온톨로지(ontology) 분석은 이들 유전자가 면역 및 방어, 수송, 단백질 분해(proteolysis), 세포 커뮤니케이션, 지방산 대사, 및 세포 부착(cell adhesion)과 관련되어 있다는 것을 나타낸다(도 2C). 375 개의 유전자들 중에, 마이크로어레이 데이타에서 mRNA 발현과 CpG 메틸화간의 중요한 음성적 상관관계를 보여주는 40개의 성숙한 간세포(MH)특이적 메틸화 마커를 확인하였다(컷오프 R < 0.3, P < 0.05; 표 8). 도 6A는 분화 과정 동안 40개의 성숙한 간세포(MH)-특이적 마커의 mRNA 발현 및 CpG 메틸화 패턴을 보여준다. 상세히 살펴보면, 세린 프로테아제 저해제 유전자 패밀리(serine protease inhibitor gene family) 중의 하나인, SERPINA3 (serpin peptidase inhibitor A3); 지방 대사에 많은 역할을 하는(Tubb MR. et al., J Biol Chem 2007;282:28385-28394), APOA4 (apolipoprotein A4); 혈액 응집(blood coagulation)에 중요한 역할을 하는(Muller-Esterl W. Kininogens, kinins and kinships. Thromb Haemost 1989;61:2-6), KNG1 (kininogen 1); 세포 부착(cell adhesion) 및 퍼짐(spreading)을 촉진하는(Ragno P. et al., Cancer Res 1998;58:1315-1319), VTN (vitronectin); 및 간에서 스테로이드와 담즙 산(bile acids)의 황산화(sulfation)를 촉매하는(Chatterjee B. et al., Methods Enzymol 2005;400:165-191), SULT2A1 (sulfotransferase 2A1)을 확인하였다. qRT-PCR 분석에 의한 이 유전자들의 mRNA 발현(도 6B) 및 파이로서열분석에 의한 DNA 메틸화 수준(도 6C)를 확인하였다.In a specific embodiment of the present invention, gene ontology analysis of 375 genes in cluster 3 shows that these genes are immune and defense, transport, proteolysis, cell communication, fatty acid metabolism, and cell adhesion. It is associated with (Fig. 2C). Of the 375 genes, 40 mature hepatocyte (MH) specific methylation markers were identified in the microarray data showing a significant negative correlation between mRNA expression and CpG methylation (cutoff R <0.3, P <0.05; Table 8). 6A shows mRNA expression and CpG methylation patterns of 40 mature hepatocyte (MH) -specific markers during differentiation. In detail, SERPINA3 (serpin peptidase inhibitor A3), which is one of the serine protease inhibitor gene family; Plays a role in fat metabolism (Tubb MR. Et al ., J Biol Chem 2007; 282: 28385-28394), APOA4 (apolipoprotein A4); Plays an important role in blood coagulation (Muller-Esterl W. Kininogens, kinins and kinships. Thromb Haemost 1989; 61: 2-6), KNG1 (kininogen 1); Promoting cell adhesion and spreading (Ragno P. et al ., Cancer Res 1998; 58: 1315-1319), VTN (vitronectin); And SULT2A1 (sulfotransferase 2A1), which catalyzes the sulfation of steroids and bile acids in the liver (Chatterjee B. et al ., Methods Enzymol 2005; 400: 165-191). mRNA expression of these genes by qRT-PCR analysis (FIG. 6B) and DNA methylation levels by pyro sequencing (FIG. 6C) were confirmed.

본 발명의 구체적인 실시예에서, 배아 줄기 세포(ES)로부터 내배엽 전구체(EP)로의 분화하는 동안, 과메틸화(11.3%)는 저메틸화 (3.4 %)보다 좀더 빈번하였고, 반면에 내배엽 전구체(EP)로부터 성숙한 간세포(MH)로 분화하는 동안, 저메틸화 (10.4 %)가 과메틸화 (4.1 %)보다 좀더 빈번하였다(도 7A). CpG 함량에 기초하여 과- 또는 저메틸화된 절편들의 특징을 조사하였다. 첫째로, UCSC hg18 어셈블리로부터 각 절편의 DNA 서열을 확보하고 모든 CpG 절편을 포함하였다. 그 다음에 전체 인간 게놈의 절편들(총 10,200,091 절편들)을 3개의 카테고리고 균등하게 나누었다: 높은-CpG 절편들(CpG 관찰/예측 비> 0.313), 낮은-CpG 절편들(CpG 관찰/예측 비< 0.180), 및 중간-CpG 절편들(도 7B). 예측된 것처럼, 높은-CpG 절편들이 분화하는 동안 가장 빈번한 메틸화 변화를 보였다(도 7C).
In specific embodiments of the invention, during differentiation from embryonic stem cells (ES) to endoderm precursors (EP), hypermethylation (11.3%) was more frequent than hypomethylation (3.4%), while endoderm precursors (EP) During differentiation from mature hepatocytes (MH) to hypomethylation (10.4%) was more frequent than hypermethylation (4.1%) (FIG. 7A). The characteristics of the over- or hypomethylated sections were investigated based on the CpG content. First, the DNA sequence of each fragment was obtained from the UCSC hg18 assembly and all CpG fragments were included. Sections of the entire human genome (10,200,091 fragments in total) were then divided into three categories and evenly: high-CpG fragments (CpG observation / prediction ratio> 0.313), low-CpG fragments (CpG observation / prediction ratio) <0.180), and mid-CpG fragments (FIG. 7B). As expected, the high-CpG fragments showed the most frequent methylation changes during differentiation (FIG. 7C).

또한 본 발명은 본 발명에 따른 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩을 포함하는 인간 배아 줄기 세포의 간세포(hepatocytes)로의 분화 단계 판별용 키트를 제공한다.The present invention also provides a kit for determining the differentiation stage of human embryonic stem cells into hepatocytes comprising a microarray chip for determining the differentiation stage from human embryonic stem cells to hepatocytes according to the present invention.

상기 마이크로어레이 칩은 유전자의 발현 검출용 또는 DNA 탈메틸화 검출용인 것이 바람직하나, 이에 한정되지 않는다.
The microarray chip is preferably for detecting gene expression or detecting DNA demethylation, but is not limited thereto.

또한 본 발명은 하기의 단계를 포함하는 인간 배아 줄기 세포의 간세포(hepatocytes)로의 분화 단계 판별 방법을 제공한다;The present invention also provides a method for determining the stage of differentiation of human embryonic stem cells into hepatocytes comprising the following steps;

⑴ 인간 배아 줄기 세포로부터 시료를 얻는 단계; 시료 obtaining a sample from human embryonic stem cells;

⑵ 하기로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량 을 측정하는 단계: 측정 measuring the expression level of any one or more genes selected from the group consisting of:

POU5F1(POU class 5 homeobox 1, 유전자 등록 번호(Genbank Accession No.) NM_002701), DPPA2(developmental pluripotency associated 2, 유전자 등록 번호(Genbank Accession No.) NM_138815), DPEP3(dipeptidase 3, 유전자 등록 번호(Genbank Accession No.) NM_022357), SLC15A3(solute carrier family 15, member 3, 유전자 등록 번호(Genbank Accession No.) NM_016582), USP44(ubiquitin specific peptidase 44, 유전자 등록 번호(Genbank Accession No.) NM_032147), SOX2(SRY (sex determining region Y)-box 2, 유전자 등록 번호(Genbank Accession No.) NM_003106), MT1F(metallothionein 1F, 유전자 등록 번호(Genbank Accession No.) NM_005949), CRABP1(cellular retinoic acid binding protein 1, 유전자 등록 번호(Genbank Accession No.) NM_004378), LECT1(leukocyte cell derived chemotaxin 1, 유전자 등록 번호(Genbank Accession No.) NM_007015), VGF(VGF nerve growth factor inducible, 유전자 등록 번호(Genbank Accession No.) NM_007015), SFRP2(secreted frizzled related protein 2, 유전자 등록 번호(Genbank Accession No.) NT_016354), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), 유전자 등록 번호(Genbank Accession No.) NM_005378), UTF1(undifferentiated embryonic cell transcription factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003577), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, 유전자 등록 번호(Genbank Accession No.) NM_005769), PRDM14(PR domain containing 14, 유전자 등록 번호(Genbank Accession No.) NM_024504), MT1G(metallothionein 1G, 유전자 등록 번호(Genbank Accession No.) NM_005950), CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_005454), GATA4(GATA binding protein 4, 유전자 등록 번호(Genbank Accession No.) NT_077531), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_031944), LEFTY1(left-right determination factor 1, 유전자 등록 번호(Genbank Accession No.) NM_020997), VWF(von Willebrand factor, 유전자 등록 번호(Genbank Accession No.) NM_000552), NODAL(nodal homolog (mouse), 유전자 등록 번호(Genbank Accession No.) NM_018055), DLX5(distal-less homeobox 5, 유전자 등록 번호(Genbank Accession No.) NT_007933), FOXC1(forkhead box C1, 유전자 등록 번호(Genbank Accession No.) NM_001453), KCNK12(potassium channel, subfamily K, member 12, 유전자 등록 번호(Genbank Accession No.) NM_022055), SOX17(SRY (sex determining region Y)-box 17, 유전자 등록 번호(Genbank Accession No.) NM_022454), LEFTY2(left-right determination factor 2, 유전자 등록 번호(Genbank Accession No.) NM_003240), SERPINA3(serpin peptidase inhibitor, clade A , member 3, 유전자 등록 번호(Genbank Accession No.) NM_001085), AGT(angiotensinogen, 유전자 등록 번호(Genbank Accession No.) NM_000029), AFP(alpha-fetoprotein, 유전자 등록 번호(Genbank Accession No.) NM_001134), TM4SF4(transmembrane 4 L six family member 4, 유전자 등록 번호(Genbank Accession No.) NM_004617), APOA4(apolipoprotein A-IV, 유전자 등록 번호(Genbank Accession No.) NM_000482), SPINK1(serine peptidase inhibitor, Kazal type 1, 유전자 등록 번호(Genbank Accession No.) NM_003122), KNG1(kininogen 1, 유전자 등록 번호(Genbank Accession No.) NM_000893), CFH(complement factor H, 유전자 등록 번호(Genbank Accession No.) NM_000186), ALDH1A1(aldehyde dehydrogenase 1 family, member A1, 유전자 등록 번호(Genbank Accession No.) NM_000689), C11orf9(chromosome 11 open reading frame 9, 유전자 등록 번호(Genbank Accession No.) NM_013279), SLCO2B1(solute carrier organic anion transporter family, member 2B1, 유전자 등록 번호(Genbank Accession No.) NM_007256), RIN2(Ras and Rab interactor 2, 유전자 등록 번호(Genbank Accession No.) NM_018993), SRPX2(sushi-repeat-containing protein, X-linked 2, 유전자 등록 번호(Genbank Accession No.) NM_014467), FGG(fibrinogen gamma chain, 유전자 등록 번호(Genbank Accession No.) NM_000509), VTN(vitronectin, 유전자 등록 번호(Genbank Accession No.) NM_000638), KLB(klotho beta, 유전자 등록 번호(Genbank Accession No.) NM_175737), TIMP3(TIMP metallopeptidase inhibitor 3, 유전자 등록 번호(Genbank Accession No.) NT_011520), CREB3L3(cAMP responsive element binding protein 3-like 3, 유전자 등록 번호(Genbank Accession No.) NM_032607), DEFB1(defensin, beta 1, 유전자 등록 번호(Genbank Accession No.) NM_005218), CIDEC(cell death-inducing DFFA-like effector c, 유전자 등록 번호(Genbank Accession No.) NM_022094), ANGPTL6(angiopoietin-like 6, 유전자 등록 번호(Genbank Accession No.) NM_031917), KBTBD10(kelch repeat and BTB (POZ) domain containing 10, 유전자 등록 번호(Genbank Accession No.) NM_006063), VCAM1(vascular cell adhesion molecule 1, 유전자 등록 번호(Genbank Accession No.) NM_001078), CSF1R(colony stimulating factor 1 receptor, 유전자 등록 번호(Genbank Accession No.) NM_005211), KYNU(kynureninase (L-kynurenine hydrolase), 유전자 등록 번호(Genbank Accession No.) NM_003937), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1, 유전자 등록 번호(Genbank Accession No.) NM_003167), RAMP1(receptor (G protein-coupled) activity modifying protein 1, 유전자 등록 번호(Genbank Accession No.) NM_005855), TDO2(tryptophan 2,3-dioxygenase, 유전자 등록 번호(Genbank Accession No.) NM_005651), AQP10(aquaporin 10, 유전자 등록 번호(Genbank Accession No.) NM_080429), CTSE(cathepsin E, 유전자 등록 번호(Genbank Accession No.) NM_001910), SLPI(secretory leukocyte peptidase inhibitor, 유전자 등록 번호(Genbank Accession No.) NM_003064), APOC2(apolipoprotein C-II, 유전자 등록 번호(Genbank Accession No.) NM_000483), SEPP1(selenoprotein P, plasma, 1, 유전자 등록 번호(Genbank Accession No.) NM_005410), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila), 유전자 등록 번호(Genbank Accession No.) NM_001343), TFF1(trefoil factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003225), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13, 유전자 등록 번호(Genbank Accession No.) NM_002242), FMO1(flavin containing monooxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_002021), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2, 유전자 등록 번호(Genbank Accession No.) NM_002153), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_000302) 및 HKDC1(hexokinase domain containing 1, 유전자 등록 번호(Genbank Accession No.) NM_025130).; 및POU5F1 (POU class 5 homeobox 1, Genbank Accession No. NM_002701), DPPA2 (developmental pluripotency associated 2), Gene Accession Number (Genbank Accession No.) NM_138815, DPEP3 (dipeptidase 3, Gene Accession Number (Genbank Accession) No.) NM_022357), SLC15A3 (solute carrier family 15, member 3, Gene Accession No. NM_016582), USP44 (ubiquitin specific peptidase 44, Gene Accession No. NM_032147), SOX2 (SRY (sex determining region Y) -box 2, Genbank Accession No. NM_003106, MT1F (metallothionein 1F, Genbank Accession No. NM_005949), CRABP1 (cellular retinoic acid binding protein 1, gene registration No. (Genbank Accession No.) NM_004378), LECT1 (leukocyte cell derived chemotaxin 1, Gene accession number (Genbank Accession No.) NM_007015), VGF (VGF nerve growth factor inducible, Genbank Accession No. NM_007015), SFRP2 (secreted frizzled relat ed protein 2, gene accession number (Genbank Accession No.) NT_016354), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), gene accession number (Genbank Accession No.) NM_005378), UTF1 (undifferentiated embryonic cell transcription factor 1, Genbank Accession No. NM_003577), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, Genebank Accession No. NM_005769), PRDM14 (PR domain containing 14, gene accession number (Genbank Accession No.) NM_024504), MT1G (metallothionein 1G, gene accession number (Genbank Accession No.) NM_005950), CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), gene accession number (Genbank Accession No.) NM_005454), GATA4 (GATA binding protein 4, Genbank Accession No.) NT_077531), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis), Gene Accession No. NM_031944), LEFTY1 (left- right determination factor 1, u Electronic Bank Identification Number (Genbank Accession No.) NM_020997, VWF (von Willebrand factor, Genbank Accession No. NM_000552), NODAL (nodal homolog (mouse), Gene Bank Accession No. NM_018055), DLX5 (distal-less homeobox 5, Genbank Accession No. NT_007933), FOXC1 (forkhead box C1, Genbank Accession No. NM_001453), KCNK12 (potassium channel, subfamily K, member 12, gene Genbank Accession No. (NM_022055), SOX17 (sex determining region Y) -box 17, Genbank Accession No. (NM_022454), LEFTY2 (left-right determination factor 2, gene registration number (Genbank) Accession No.) NM_003240), SERPINA3 (serpin peptidase inhibitor, clade A, member 3, Genbank Accession No. NM_001085), AGT (angiotensinogen, Genbank Accession No.) NM_000029), AFP (alpha) fetoprotein, Genbank Accession No. NM_001134, TM4SF4 (t ransmembrane 4 L six family member 4, gene accession number (Genbank Accession No.) NM_004617), APOA4 (apolipoprotein A-IV, gene accession number (Genbank Accession No.) NM_000482), SPINK1 (serine peptidase inhibitor, Kazal type 1, gene Accession number (Genbank Accession No.) NM_003122), KNG1 (kininogen 1, gene accession number (Genbank Accession No.) NM_000893), CFH (complement factor H, Genbank Accession No.) NM_000186), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1, Genbank Accession No. NM_000689), C11orf9 (chromosome 11 open reading frame 9, Gene Accession No. NM_013279), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 , Genbank Accession No. NM_007256, RIN2 (Ras and Rab interactor 2, Genbank Accession No. NM_018993), SRPX2 (sushi-repeat-containing protein, X-linked 2, gene accession number (Genbank Accession No.) NM_014467), FGG (fi brinogen gamma chain, Genbank Accession No. NM_000509, VTN (vitronectin, Genbank Accession No. NM_000638), KLB (klotho beta, Genbank Accession No. NM_175737), TIMP3 (TIMP metallopeptidase inhibitor 3, Genbank Accession No. NT_011520), CREB3L3 (cAMP responsive element binding protein 3-like 3, Gene accession No. NM_032607), DEFB1 (defensin, beta 1, gene Accession number (Genbank Accession No.) NM_005218), cell death-inducing DFFA-like effector c, gene accession number (Genbank Accession No.) NM_022094), ANGPTL6 (angiopoietin-like 6, gene accession number (Genbank Accession No. ) NM_031917), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10, Genebank Accession No. NM_006063), VCAM1 (vascular cell adhesion molecule 1, Genebank Accession No. NM_001078), CSF1R (colony stimulating factor 1 receptor, gene GenBank Accession No. (NM_005211), kynureninase (L-kynurenine hydrolase), KYNU, Genbank Accession No. (NM_003937), SULT2A1 (sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1, Genbank Accession No. NM_003167), RAMP1 (receptor (G protein-coupled) activity modifying protein 1, Genebank Accession No.) NM_005855), TDO2 (tryptophan 2,3-dioxygenase, gene Accession number (Genbank Accession No.) NM_005651), AQP10 (aquaporin 10, gene accession number (Genbank Accession No.) NM_080429), CTSE (cathepsin E, gene accession number (Genbank Accession No.) NM_001910), secretory leukocyte peptidase inhibitor, gene accession number (Genbank Accession No.) NM_003064), APOC2 (apolipoprotein C-II, gene accession number (Genbank Accession No.) NM_000483), SEPP1 (selenoprotein P, plasma, 1, gene accession number (Genbank Accession No. NM_005410), DAB2 (disabled homolog 2, mitogen-re sponsive phosphoprotein (Drosophila), Genbank Accession No. NM_001343, TFF1 (trefoil factor 1, Genbank Accession No. NM_003225), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13, gene Accession number (Genbank Accession No.) NM_002242), FMO1 (flavin containing monooxygenase 1, gene accession number (Genbank Accession No.) NM_002021), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2, gene accession number (Genbank Accession No.) NM_002153), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, Genbank Accession No. NM_000302) and HKDC1 (hexokinase domain containing 1, Genebank Accession No. NM_025130); And

⑶ 하기 ⒜의 군으로부터 선택되는 어느 하나 이상의 유전자가 배아 줄기 세포-특이적으로 유전자의 발현량이 증가하면 미분화 단계인 것으로 판별하고, 하기 ⒝의 군으로부터 선택되는 어느 하나 이상의 유전자가 내배엽 전구체-특이적으로 유전자의 발현량이 증가하면 분화 중인 단계인 것으로 판별하며, 또는 하기 ⒞의 군으로부터 선택되는 어느 하나 이상의 유전자가 성숙한 간세포-특이적으로 유전자의 발현량이 증가하면 간세포로 분화한 단계인 것으로 판별하는 단계:어느 Any one or more genes selected from the group of ⑶ below are determined to be embryonic stem cell-specifically when the expression level of the gene is increased, and at least one gene selected from the group of ⒝ is endoderm precursor-specific As a result, when the expression level of the gene is increased, it is determined that it is in the stage of differentiation, or when one or more genes selected from the group of 하기 is mature hepatocytes-specifically, the stage of differentiation into the hepatocytes when the expression level of the gene is increased. :

⒜ POU5F1(POU class 5 homeobox 1), DPPA2(developmental pluripotency associated 2), DPEP3(dipeptidase 3), SLC15A3(solute carrier family 15, member 3), USP44(ubiquitin specific peptidase 44), SOX2(SRY (sex determining region Y)-box 2), MT1F(metallothionein 1F), CRABP1(cellular retinoic acid binding protein 1), LECT1(leukocyte cell derived chemotaxin 1), VGF(VGF nerve growth factor inducible), SFRP2(secreted frizzled related protein 2), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), UTF1(undifferentiated embryonic cell transcription factor 1), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4), PRDM14(PR domain containing 14) 및 MT1G(metallothionein 1G),OU POU5F1 (POU class 5 homeobox 1), DPPA2 (developmental pluripotency associated 2), DPEP3 (dipeptidase 3), SLC15A3 (solute carrier family 15, member 3), USP44 (ubiquitin specific peptidase 44), SOX2 (SRY (sex determining region) Y) -box 2), metallothionein 1F (MT1F), cellular retinoic acid binding protein 1 (CRABP1), leukocyte cell derived chemotaxin 1 (LECT1), VGF nerve growth factor inducible (VGF), secreted frizzled related protein 2 (SFRP2), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), undifferentiated embryonic cell transcription factor 1 (UTF1), carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4) (CHST4), PRDM14 (PR domain containing 14), and MT1G (metallothionein 1G),

⒝ CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4(GATA binding protein 4), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1(left-right determination factor 1), VWF(von Willebrand factor), NODAL(nodal homolog (mouse)), DLX5(distal-less homeobox 5), FOXC1(forkhead box C1), KCNK12(potassium channel, subfamily K, member 12), SOX17(SRY (sex determining region Y)-box 17) 및 LEFTY2(left-right determination factor 2),ER CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4 (GATA binding protein 4), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1 (left-right determination factor 1), VWF ( von Willebrand factor, NODAL (nodal homolog (mouse)), DLX5 (distal-less homeobox 5), FOXC1 (forkhead box C1), KCNK12 (potassium channel, subfamily K, member 12), SOX17 (SRY (sex determining region Y) ) -box 17) and LEFTY2 (left-right determination factor 2),

⒞ SERPINA3(serpin peptidase inhibitor, clade A , member 3), AGT(angiotensinogen), AFP(alpha-fetoprotein), TM4SF4(transmembrane 4 L six family member 4), APOA4(apolipoprotein A-IV), SPINK1(serine peptidase inhibitor, Kazal type 1), KNG1(kininogen 1), CFH(complement factor H), ALDH1A1(aldehyde dehydrogenase 1 family, member A1), C11orf9(chromosome 11 open reading frame 9), SLCO2B1(solute carrier organic anion transporter family, member 2B1), RIN2(Ras and Rab interactor 2), SRPX2(sushi-repeat-containing protein, X-linked 2), FGG(fibrinogen gamma chain), VTN(vitronectin), KLB(klotho beta), TIMP3(TIMP metallopeptidase inhibitor 3), CREB3L3(cAMP responsive element binding protein 3-like 3), DEFB1(defensin, beta 1), CIDEC(cell death-inducing DFFA-like effector c), ANGPTL6(angiopoietin-like 6), KBTBD10(kelch repeat and BTB (POZ) domain containing 10), VCAM1(vascular cell adhesion molecule 1), CSF1R(colony stimulating factor 1 receptor), KYNU(kynureninase (L-kynurenine hydrolase)), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1), RAMP1(receptor (G protein-coupled) activity modifying protein 1), TDO2(tryptophan 2,3-dioxygenase), AQP10(aquaporin 10), CTSE(cathepsin E), SLPI(secretory leukocyte peptidase inhibitor), APOC2(apolipoprotein C-II), SEPP1(selenoprotein P, plasma, 1), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)), TFF1(trefoil factor 1), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13), FMO1(flavin containing monooxygenase 1), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) 및 HKDC1(hexokinase domain containing 1).RP SERPINA3 (serpin peptidase inhibitor, clade A, member 3), AGT (angiotensinogen), AFP (alpha-fetoprotein), TM4SF4 (transmembrane 4 L six family member 4), APOA4 (apolipoprotein A-IV), SPINK1 (serine peptidase inhibitor) , Kazal type 1), KNG1 (kininogen 1), CFH (complement factor H), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), C11orf9 (chromosome 11 open reading frame 9), SLCO2B1 (solute carrier organic anion transporter family, member 2B1), RIN2 (Ras and Rab interactor 2), SRPX2 (sushi-repeat-containing protein, X-linked 2), fibrinogen gamma chain (FGG), vitronectin (VTN), klotho beta (KLB), and TIMP metallopeptidase inhibitor 3), CREB3L3 (cAMP responsive element binding protein 3-like 3), DEFB1 (defensin, beta 1), CIDEC (cell death-inducing DFFA-like effector c), ANGPTL6 (angiopoietin-like 6), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10), vascular cell adhesion molecule 1 (VCAM1), colony stimulating factor 1 receptor (CSF1R), kynureninase (L-kynurenine hydrolase) (KYNU), SULT2A1 (su lfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1), receptor (G protein-coupled) activity modifying protein 1), TDO2 (tryptophan 2,3-dioxygenase), AQP10 (aquaporin 10), CTSE (cathepsin E), SLPI (secretory leukocyte peptidase inhibitor), APOC2 (apolipoprotein C-II), SEPP1 (selenoprotein P, plasma, 1), DAB2 (disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)), TFF1 (trefoil factor) 1), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13), FMO1 (flavin containing monooxygenase 1), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) and HKDC1 (hexokinase domain containing 1).

상기 방법에 있어서 단계 ⑴의 시료는 게놈 DNA, mRNA 또는 단백질인 것이 바람직하나, 이에 한정되지 않는다.In the above method, the sample of step VII is preferably genomic DNA, mRNA or protein, but is not limited thereto.

상기 방법에 있어서 단계 ⑵의 유전자의 발현량은 마이크로어레이 또는 정량적 RT-PCR(qRT-PCR)으로 측정하는 것이 바람직하나, 이에 한정되지 않는다.In the method, the expression level of the gene of step VII is preferably measured by microarray or quantitative RT-PCR (qRT-PCR), but is not limited thereto.

상기 방법에 있어서 단계 ⑶의 배아 줄기 세포-특이적으로 유전자의 발현량이 증가한다는 것은 내배엽 전구체 및 성숙한 간세포의 상기 유전자의 발현량보다 증가하는 것을 의미하고, 상기 내배엽 전구체-특이적으로 유전자의 발현량이 증가한다는 것은 배아 줄기 세포 및 성숙한 간세포의 상기 유전자의 발현량보다 증가하는 것을 의미하며, 상기 성숙한 간세포-특이적으로 유전자의 발현량이 증가한다는 것은 배아 줄기 세포 및 내배엽 전구체의 상기 유전자의 발현량보다 증가하는 것을 의미하나, 이에 한정되지 않는다.
In this method, the increase in the expression level of the gene in the embryonic stem cell-specific gene of step VII means that the expression level of the gene of the endoderm precursor and the mature hepatocytes is increased, and the expression level of the gene in the endoderm precursor-specific gene is increased. Increasing means that the expression level of the gene of the embryonic stem cells and mature hepatocytes is increased, while increasing the expression level of the gene of the mature hepatocyte-specific gene is higher than the expression level of the gene of the embryonic stem cells and endoderm precursors It means, but is not limited to.

본 발명은 하기의 단계를 포함하는 인간 배아 줄기 세포의 간세포(hepatocytes)로의 분화 단계 판별 방법을 제공한다;The present invention provides a method for determining the stage of differentiation of human embryonic stem cells into hepatocytes comprising the following steps;

⑴ 인간 배아 줄기 세포로부터 시료를 얻는 단계; 시료 obtaining a sample from human embryonic stem cells;

⑵ 하기로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 DNA 탈메틸화를 측정하는 단계: DNA measuring DNA demethylation of any one or more genes selected from the group consisting of:

POU5F1(POU class 5 homeobox 1, 유전자 등록 번호(Genbank Accession No.) NM_002701), DPPA2(developmental pluripotency associated 2, 유전자 등록 번호(Genbank Accession No.) NM_138815), DPEP3(dipeptidase 3, 유전자 등록 번호(Genbank Accession No.) NM_022357), SLC15A3(solute carrier family 15, member 3, 유전자 등록 번호(Genbank Accession No.) NM_016582), USP44(ubiquitin specific peptidase 44, 유전자 등록 번호(Genbank Accession No.) NM_032147), SOX2(SRY (sex determining region Y)-box 2, 유전자 등록 번호(Genbank Accession No.) NM_003106), MT1F(metallothionein 1F, 유전자 등록 번호(Genbank Accession No.) NM_005949), CRABP1(cellular retinoic acid binding protein 1, 유전자 등록 번호(Genbank Accession No.) NM_004378), LECT1(leukocyte cell derived chemotaxin 1, 유전자 등록 번호(Genbank Accession No.) NM_007015), VGF(VGF nerve growth factor inducible, 유전자 등록 번호(Genbank Accession No.) NM_007015), SFRP2(secreted frizzled related protein 2, 유전자 등록 번호(Genbank Accession No.) NT_016354), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), 유전자 등록 번호(Genbank Accession No.) NM_005378), UTF1(undifferentiated embryonic cell transcription factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003577), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, 유전자 등록 번호(Genbank Accession No.) NM_005769), PRDM14(PR domain containing 14, 유전자 등록 번호(Genbank Accession No.) NM_024504), MT1G(metallothionein 1G, 유전자 등록 번호(Genbank Accession No.) NM_005950), CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_005454), GATA4(GATA binding protein 4, 유전자 등록 번호(Genbank Accession No.) NT_077531), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_031944), LEFTY1(left-right determination factor 1, 유전자 등록 번호(Genbank Accession No.) NM_020997), VWF(von Willebrand factor, 유전자 등록 번호(Genbank Accession No.) NM_000552), NODAL(nodal homolog (mouse), 유전자 등록 번호(Genbank Accession No.) NM_018055), DLX5(distal-less homeobox 5, 유전자 등록 번호(Genbank Accession No.) NT_007933), FOXC1(forkhead box C1, 유전자 등록 번호(Genbank Accession No.) NM_001453), KCNK12(potassium channel, subfamily K, member 12, 유전자 등록 번호(Genbank Accession No.) NM_022055), SOX17(SRY (sex determining region Y)-box 17, 유전자 등록 번호(Genbank Accession No.) NM_022454), LEFTY2(left-right determination factor 2, 유전자 등록 번호(Genbank Accession No.) NM_003240), SERPINA3(serpin peptidase inhibitor, clade A , member 3, 유전자 등록 번호(Genbank Accession No.) NM_001085), AGT(angiotensinogen, 유전자 등록 번호(Genbank Accession No.) NM_000029), AFP(alpha-fetoprotein, 유전자 등록 번호(Genbank Accession No.) NM_001134), TM4SF4(transmembrane 4 L six family member 4, 유전자 등록 번호(Genbank Accession No.) NM_004617), APOA4(apolipoprotein A-IV, 유전자 등록 번호(Genbank Accession No.) NM_000482), SPINK1(serine peptidase inhibitor, Kazal type 1, 유전자 등록 번호(Genbank Accession No.) NM_003122), KNG1(kininogen 1, 유전자 등록 번호(Genbank Accession No.) NM_000893), CFH(complement factor H, 유전자 등록 번호(Genbank Accession No.) NM_000186), ALDH1A1(aldehyde dehydrogenase 1 family, member A1, 유전자 등록 번호(Genbank Accession No.) NM_000689), C11orf9(chromosome 11 open reading frame 9, 유전자 등록 번호(Genbank Accession No.) NM_013279), SLCO2B1(solute carrier organic anion transporter family, member 2B1, 유전자 등록 번호(Genbank Accession No.) NM_007256), RIN2(Ras and Rab interactor 2, 유전자 등록 번호(Genbank Accession No.) NM_018993), SRPX2(sushi-repeat-containing protein, X-linked 2, 유전자 등록 번호(Genbank Accession No.) NM_014467), FGG(fibrinogen gamma chain, 유전자 등록 번호(Genbank Accession No.) NM_000509), VTN(vitronectin, 유전자 등록 번호(Genbank Accession No.) NM_000638), KLB(klotho beta, 유전자 등록 번호(Genbank Accession No.) NM_175737), TIMP3(TIMP metallopeptidase inhibitor 3, 유전자 등록 번호(Genbank Accession No.) NT_011520), CREB3L3(cAMP responsive element binding protein 3-like 3, 유전자 등록 번호(Genbank Accession No.) NM_032607), DEFB1(defensin, beta 1, 유전자 등록 번호(Genbank Accession No.) NM_005218), CIDEC(cell death-inducing DFFA-like effector c, 유전자 등록 번호(Genbank Accession No.) NM_022094), ANGPTL6(angiopoietin-like 6, 유전자 등록 번호(Genbank Accession No.) NM_031917), KBTBD10(kelch repeat and BTB (POZ) domain containing 10, 유전자 등록 번호(Genbank Accession No.) NM_006063), VCAM1(vascular cell adhesion molecule 1, 유전자 등록 번호(Genbank Accession No.) NM_001078), CSF1R(colony stimulating factor 1 receptor, 유전자 등록 번호(Genbank Accession No.) NM_005211), KYNU(kynureninase (L-kynurenine hydrolase), 유전자 등록 번호(Genbank Accession No.) NM_003937), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1, 유전자 등록 번호(Genbank Accession No.) NM_003167), RAMP1(receptor (G protein-coupled) activity modifying protein 1, 유전자 등록 번호(Genbank Accession No.) NM_005855), TDO2(tryptophan 2,3-dioxygenase, 유전자 등록 번호(Genbank Accession No.) NM_005651), AQP10(aquaporin 10, 유전자 등록 번호(Genbank Accession No.) NM_080429), CTSE(cathepsin E, 유전자 등록 번호(Genbank Accession No.) NM_001910), SLPI(secretory leukocyte peptidase inhibitor, 유전자 등록 번호(Genbank Accession No.) NM_003064), APOC2(apolipoprotein C-II, 유전자 등록 번호(Genbank Accession No.) NM_000483), SEPP1(selenoprotein P, plasma, 1, 유전자 등록 번호(Genbank Accession No.) NM_005410), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila), 유전자 등록 번호(Genbank Accession No.) NM_001343), TFF1(trefoil factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003225), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13, 유전자 등록 번호(Genbank Accession No.) NM_002242), FMO1(flavin containing monooxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_002021), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2, 유전자 등록 번호(Genbank Accession No.) NM_002153), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_000302) 및 HKDC1(hexokinase domain containing 1, 유전자 등록 번호(Genbank Accession No.) NM_025130).; 및POU5F1 (POU class 5 homeobox 1, Genbank Accession No. NM_002701), DPPA2 (developmental pluripotency associated 2), Gene Accession Number (Genbank Accession No.) NM_138815, DPEP3 (dipeptidase 3, Gene Accession Number (Genbank Accession) No.) NM_022357), SLC15A3 (solute carrier family 15, member 3, Gene Accession No. NM_016582), USP44 (ubiquitin specific peptidase 44, Gene Accession No. NM_032147), SOX2 (SRY (sex determining region Y) -box 2, Genbank Accession No. NM_003106, MT1F (metallothionein 1F, Genbank Accession No. NM_005949), CRABP1 (cellular retinoic acid binding protein 1, gene registration No. (Genbank Accession No.) NM_004378), LECT1 (leukocyte cell derived chemotaxin 1, Gene accession number (Genbank Accession No.) NM_007015), VGF (VGF nerve growth factor inducible, Genbank Accession No. NM_007015), SFRP2 (secreted frizzled relat ed protein 2, gene accession number (Genbank Accession No.) NT_016354), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), gene accession number (Genbank Accession No.) NM_005378), UTF1 (undifferentiated embryonic cell transcription factor 1, Genbank Accession No. NM_003577), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, Genebank Accession No. NM_005769), PRDM14 (PR domain containing 14, gene accession number (Genbank Accession No.) NM_024504), MT1G (metallothionein 1G, gene accession number (Genbank Accession No.) NM_005950), CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), gene accession number (Genbank Accession No.) NM_005454), GATA4 (GATA binding protein 4, Genbank Accession No.) NT_077531), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis), Gene Accession No. NM_031944), LEFTY1 (left- right determination factor 1, u Electronic Bank Identification Number (Genbank Accession No.) NM_020997, VWF (von Willebrand factor, Genbank Accession No. NM_000552), NODAL (nodal homolog (mouse), Gene Bank Accession No. NM_018055), DLX5 (distal-less homeobox 5, Genbank Accession No. NT_007933), FOXC1 (forkhead box C1, Genbank Accession No. NM_001453), KCNK12 (potassium channel, subfamily K, member 12, gene Genbank Accession No. (NM_022055), SOX17 (sex determining region Y) -box 17, Genbank Accession No. (NM_022454), LEFTY2 (left-right determination factor 2, gene registration number (Genbank) Accession No.) NM_003240), SERPINA3 (serpin peptidase inhibitor, clade A, member 3, Genbank Accession No. NM_001085), AGT (angiotensinogen, Genbank Accession No.) NM_000029), AFP (alpha) fetoprotein, Genbank Accession No. NM_001134, TM4SF4 (t ransmembrane 4 L six family member 4, gene accession number (Genbank Accession No.) NM_004617), APOA4 (apolipoprotein A-IV, gene accession number (Genbank Accession No.) NM_000482), SPINK1 (serine peptidase inhibitor, Kazal type 1, gene Accession number (Genbank Accession No.) NM_003122), KNG1 (kininogen 1, gene accession number (Genbank Accession No.) NM_000893), CFH (complement factor H, Genbank Accession No.) NM_000186), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1, Genbank Accession No. NM_000689), C11orf9 (chromosome 11 open reading frame 9, Gene Accession No. NM_013279), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 , Genbank Accession No. NM_007256, RIN2 (Ras and Rab interactor 2, Genbank Accession No. NM_018993), SRPX2 (sushi-repeat-containing protein, X-linked 2, gene accession number (Genbank Accession No.) NM_014467), FGG (fi brinogen gamma chain, Genbank Accession No. NM_000509, VTN (vitronectin, Genbank Accession No. NM_000638), KLB (klotho beta, Genbank Accession No. NM_175737), TIMP3 (TIMP metallopeptidase inhibitor 3, Genbank Accession No. NT_011520), CREB3L3 (cAMP responsive element binding protein 3-like 3, Gene accession No. NM_032607), DEFB1 (defensin, beta 1, gene Accession number (Genbank Accession No.) NM_005218), cell death-inducing DFFA-like effector c, gene accession number (Genbank Accession No.) NM_022094), ANGPTL6 (angiopoietin-like 6, gene accession number (Genbank Accession No. ) NM_031917), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10, Genebank Accession No. NM_006063), VCAM1 (vascular cell adhesion molecule 1, Genebank Accession No. NM_001078), CSF1R (colony stimulating factor 1 receptor, gene GenBank Accession No. (NM_005211), kynureninase (L-kynurenine hydrolase), KYNU, Genbank Accession No. (NM_003937), SULT2A1 (sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1, Genbank Accession No. NM_003167), RAMP1 (receptor (G protein-coupled) activity modifying protein 1, Genebank Accession No.) NM_005855), TDO2 (tryptophan 2,3-dioxygenase, gene Accession number (Genbank Accession No.) NM_005651), AQP10 (aquaporin 10, gene accession number (Genbank Accession No.) NM_080429), CTSE (cathepsin E, gene accession number (Genbank Accession No.) NM_001910), secretory leukocyte peptidase inhibitor, gene accession number (Genbank Accession No.) NM_003064), APOC2 (apolipoprotein C-II, gene accession number (Genbank Accession No.) NM_000483), SEPP1 (selenoprotein P, plasma, 1, gene accession number (Genbank Accession No. NM_005410), DAB2 (disabled homolog 2, mitogen-re sponsive phosphoprotein (Drosophila), Genbank Accession No. NM_001343, TFF1 (trefoil factor 1, Genbank Accession No. NM_003225), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13, gene Accession number (Genbank Accession No.) NM_002242), FMO1 (flavin containing monooxygenase 1, gene accession number (Genbank Accession No.) NM_002021), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2, gene accession number (Genbank Accession No.) NM_002153), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, Genbank Accession No. NM_000302) and HKDC1 (hexokinase domain containing 1, Genebank Accession No. NM_025130); And

⑶ 하기 ⒜의 군으로부터 선택되는 어느 하나 이상의 유전자가 배아 줄기 세포-특이적으로 DNA 탈메틸화되면 미분화 단계인 것으로 판별하고, 하기 ⒝의 군으로부터 선택되는 어느 하나 이상의 유전자가 내배엽 전구체-특이적으로 DNA 탈메틸화되면 분화 중인 단계인 것으로 판별하며, 또는 하기 ⒞의 군으로부터 선택되는 어느 하나 이상의 유전자가 성숙한 간세포-특이적으로 DNA 탈메틸화되면 간세포로 분화한 단계인 것으로 판별하는 단계:어느 any one or more genes selected from the group of VII are determined to be undifferentiated when embryonic stem cell-specifically DNA demethylated, and at least one gene selected from the group of VII is endoderm precursor-specific DNA Determining that it is in the stage of differentiation upon demethylation, or determining that any one or more genes selected from the group of the following is a stage for differentiation into hepatocytes when mature hepatocyte-specific DNA demethylation:

⒜ POU5F1(POU class 5 homeobox 1), DPPA2(developmental pluripotency associated 2), DPEP3(dipeptidase 3), SLC15A3(solute carrier family 15, member 3), USP44(ubiquitin specific peptidase 44), SOX2(SRY (sex determining region Y)-box 2), MT1F(metallothionein 1F), CRABP1(cellular retinoic acid binding protein 1), LECT1(leukocyte cell derived chemotaxin 1), VGF(VGF nerve growth factor inducible), SFRP2(secreted frizzled related protein 2), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), UTF1(undifferentiated embryonic cell transcription factor 1), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4), PRDM14(PR domain containing 14) 및 MT1G(metallothionein 1G),OU POU5F1 (POU class 5 homeobox 1), DPPA2 (developmental pluripotency associated 2), DPEP3 (dipeptidase 3), SLC15A3 (solute carrier family 15, member 3), USP44 (ubiquitin specific peptidase 44), SOX2 (SRY (sex determining region) Y) -box 2), metallothionein 1F (MT1F), cellular retinoic acid binding protein 1 (CRABP1), leukocyte cell derived chemotaxin 1 (LECT1), VGF nerve growth factor inducible (VGF), secreted frizzled related protein 2 (SFRP2), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), undifferentiated embryonic cell transcription factor 1 (UTF1), carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4) (CHST4), PRDM14 (PR domain containing 14), and MT1G (metallothionein 1G),

⒝ CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4(GATA binding protein 4), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1(left-right determination factor 1), VWF(von Willebrand factor), NODAL(nodal homolog (mouse)), DLX5(distal-less homeobox 5), FOXC1(forkhead box C1), KCNK12(potassium channel, subfamily K, member 12), SOX17(SRY (sex determining region Y)-box 17) 및 LEFTY2(left-right determination factor 2),ER CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4 (GATA binding protein 4), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1 (left-right determination factor 1), VWF ( von Willebrand factor, NODAL (nodal homolog (mouse)), DLX5 (distal-less homeobox 5), FOXC1 (forkhead box C1), KCNK12 (potassium channel, subfamily K, member 12), SOX17 (SRY (sex determining region Y) ) -box 17) and LEFTY2 (left-right determination factor 2),

⒞ SERPINA3(serpin peptidase inhibitor, clade A , member 3), AGT(angiotensinogen), AFP(alpha-fetoprotein), TM4SF4(transmembrane 4 L six family member 4), APOA4(apolipoprotein A-IV), SPINK1(serine peptidase inhibitor, Kazal type 1), KNG1(kininogen 1), CFH(complement factor H), ALDH1A1(aldehyde dehydrogenase 1 family, member A1), C11orf9(chromosome 11 open reading frame 9), SLCO2B1(solute carrier organic anion transporter family, member 2B1), RIN2(Ras and Rab interactor 2), SRPX2(sushi-repeat-containing protein, X-linked 2), FGG(fibrinogen gamma chain), VTN(vitronectin), KLB(klotho beta), TIMP3(TIMP metallopeptidase inhibitor 3), CREB3L3(cAMP responsive element binding protein 3-like 3), DEFB1(defensin, beta 1), CIDEC(cell death-inducing DFFA-like effector c), ANGPTL6(angiopoietin-like 6), KBTBD10(kelch repeat and BTB (POZ) domain containing 10), VCAM1(vascular cell adhesion molecule 1), CSF1R(colony stimulating factor 1 receptor), KYNU(kynureninase (L-kynurenine hydrolase)), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1), RAMP1(receptor (G protein-coupled) activity modifying protein 1), TDO2(tryptophan 2,3-dioxygenase), AQP10(aquaporin 10), CTSE(cathepsin E), SLPI(secretory leukocyte peptidase inhibitor), APOC2(apolipoprotein C-II), SEPP1(selenoprotein P, plasma, 1), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)), TFF1(trefoil factor 1), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13), FMO1(flavin containing monooxygenase 1), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) 및 HKDC1(hexokinase domain containing 1).RP SERPINA3 (serpin peptidase inhibitor, clade A, member 3), AGT (angiotensinogen), AFP (alpha-fetoprotein), TM4SF4 (transmembrane 4 L six family member 4), APOA4 (apolipoprotein A-IV), SPINK1 (serine peptidase inhibitor) , Kazal type 1), KNG1 (kininogen 1), CFH (complement factor H), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), C11orf9 (chromosome 11 open reading frame 9), SLCO2B1 (solute carrier organic anion transporter family, member 2B1), RIN2 (Ras and Rab interactor 2), SRPX2 (sushi-repeat-containing protein, X-linked 2), fibrinogen gamma chain (FGG), vitronectin (VTN), klotho beta (KLB), and TIMP metallopeptidase inhibitor 3), CREB3L3 (cAMP responsive element binding protein 3-like 3), DEFB1 (defensin, beta 1), CIDEC (cell death-inducing DFFA-like effector c), ANGPTL6 (angiopoietin-like 6), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10), vascular cell adhesion molecule 1 (VCAM1), colony stimulating factor 1 receptor (CSF1R), kynureninase (L-kynurenine hydrolase) (KYNU), SULT2A1 (su lfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1), receptor (G protein-coupled) activity modifying protein 1), TDO2 (tryptophan 2,3-dioxygenase), AQP10 (aquaporin 10), CTSE (cathepsin E), SLPI (secretory leukocyte peptidase inhibitor), APOC2 (apolipoprotein C-II), SEPP1 (selenoprotein P, plasma, 1), DAB2 (disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)), TFF1 (trefoil factor) 1), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13), FMO1 (flavin containing monooxygenase 1), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) and HKDC1 (hexokinase domain containing 1).

상기 방법에 있어서 단계 ⑴의 시료는 게놈 DNA, mRNA 또는 단백질인 것이 바람직하나, 이에 한정되지 않는다.In the above method, the sample of step VII is preferably genomic DNA, mRNA or protein, but is not limited thereto.

상기 방법에 있어서 단계 ⑵의 DNA 탈메틸화는 마이크로어레이 또는 파이로시퀀싱(pyrosequencing)으로 측정하는 것이 바람직하나, 이에 한정되지 않는다.In the method, DNA demethylation of step VII is preferably measured by microarray or pyrosequencing, but is not limited thereto.

상기 방법에 있어서 단계 ⑶의 배아 줄기 세포-특이적으로 DNA 탈메틸화한다는 것은 유전자의 CpG 메틸레이션 수준이 내배엽 전구체 및 성숙한 간세포의 상기 유전자의 CpG 메틸레이션 수준보다 감소하는 것을 의미하고, 상기 내배엽 전구체-특이적으로 DNA 탈메틸화한다는 것은 유전자의 CpG 메틸레이션 수준이 배아 줄기 세포 및 성숙한 간세포의 상기 유전자의 CpG 메틸레이션 수준 보다 감소하는 것을 의미하며, 상기 성숙한 간세포-특이적으로 DNA 탈메틸화한다는 것은 유전자의 CpG 메틸레이션 수준이 배아 줄기 세포 및 내배엽 전구체의 상기 유전자의 CpG 메틸레이션 수준 보다 감소하는 것을 의미하나, 이에 한정되지 않는다.
Embryonic stem cell-specific DNA demethylation of step VII in this method means that the CpG methylation level of the gene decreases below the CpG methylation level of the gene of endoderm precursors and mature hepatocytes, and the endoderm precursor- Specific DNA demethylation means that the CpG methylation level of the gene is lower than the CpG methylation level of the gene of embryonic stem cells and mature hepatocytes, and that DNA demethylation of the mature hepatocyte-specific It means, but is not limited to, that CpG methylation levels are lower than CpG methylation levels of these genes of embryonic stem cells and endoderm precursors.

또한 본 발명은 본 발명에 따른 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩을 사용하여 인간 줄기 세포로부터 간세포로의 분화를 촉진하는 물질을 스크리닝하는 방법을 제공한다.The present invention also provides a method for screening a substance that promotes differentiation from human stem cells to hepatocytes using a microarray chip for determining the differentiation stage from human embryonic stem cells to hepatocytes according to the present invention.

구체적으로 본 발명은 하기 단계를 포함하는 방법으로 수행되는 것이 바람직하나, 이에 한정되지 않는다;Specifically, the present invention is preferably performed by a method including the following steps, but is not limited thereto;

⑴ 본 발명에 따른 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩에 피검 화합물 또는 조성물을 처리하는 단계;피 treating a test compound or composition on a microarray chip for determining the differentiation stage from human embryonic stem cells to hepatocytes according to the present invention;

⑵ 상기 마이크로어레이 칩에 집적된 유전자의 발현량 또는 DNA 탈메틸화를 측정하는 단계; 및Measuring DNA expression or DNA demethylation of the gene integrated in the microarray chip; And

⑶ 단계 ⑵의 내배엽 전구체-특이적 유전자 또는 성숙한 간세포-특이적 유전자의 발현량을 증가시키거나, 또는 내배엽 전구체-특이적 유전자 또는 성숙한 간세포-특이적 유전자를 DNA 탈메틸화시키는 피검 화합물 또는 조성물을 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화를 촉진하는 후보 물질로 판정하는 단계.A test compound or composition which increases the expression level of the endoderm precursor-specific gene or mature hepatocyte-specific gene of step VII or DNA demethylates the endoderm precursor-specific gene or mature hepatocyte-specific gene. Determining as a candidate to promote differentiation from embryonic stem cells to hepatocytes.

상기 방법에 있어서 단계 ⑵의 유전자의 발현량은 마이크로어레이 또는 정량적 RT-PCR(qRT-PCR)으로 측정하는 것이 바람직하나, 이에 한정되지 않는다.In the method, the expression level of the gene of step VII is preferably measured by microarray or quantitative RT-PCR (qRT-PCR), but is not limited thereto.

상기 방법에 있어서 단계 ⑵의 DNA 탈메틸화는 마이크로어레이 또는 파이로시퀀싱(pyrosequencing)으로 측정하는 것이 바람직하나, 이에 한정되지 않는다.In the method, DNA demethylation of step VII is preferably measured by microarray or pyrosequencing, but is not limited thereto.

상기 방법에 있어서 단계 ⑶의 내배엽 전구체 또는 성숙한 간세포-특이적 유전자의 발현량을 증가시킨다는 것은 배아 줄기 세포의 상기 유전자의 발현량보다 증가하는 것을 의미하나, 이에 한정되지 않는다.Increasing the expression level of the endoderm precursor or mature hepatocyte-specific gene of step VII in the method means, but is not limited to, the expression level of the gene of embryonic stem cells.

상기 방법에 있어서 단계 ⑶의 성숙한 간세포-특이적 유전자를 DNA 탈메틸화시킨다는 것은 유전자의 CpG 메틸레이션 수준이 배아 줄기 세포에 있어서 상기 유전자의 CpG 메틸레이션 수준보다 감소하는 것을 의미하나, 이에 한정되지 않는다.DNA demethylation of the mature hepatocyte-specific gene of step VII in this method means, but not limited to, that the CpG methylation level of the gene is lower than the CpG methylation level of the gene in embryonic stem cells.

상기 방법에 있어서 단계 ⑶의 상기 인간 줄기 세포로부터 간세포로의 분화를 촉진하는 후보 물질은 배아 줄기 세포를 내배엽 전구체로 분화시키는 것을 촉진시키거나, 내배엽 전구체를 성숙한 간세포로 분화시키는 것을 촉진시키거나, 또는 배아 줄기 세포를 성숙한 간세포로 분화시키는 것을 촉진시키는 후보 물질인 것이 바람직하나, 이에 한정되지 않는다.In the method, the candidate substance which promotes differentiation from human stem cells to hepatocytes in step VII promotes differentiation of embryonic stem cells into endoderm precursors, or promotes differentiation of endoderm precursors into mature hepatocytes, or It is preferably a candidate substance that promotes differentiation of embryonic stem cells into mature hepatocytes, but is not limited thereto.

상기 스크리닝 방법으로 스크리닝된 후보 물질을 이용하여 배아 줄기 세포 또는 내배엽 전구체로부터 간세포로의 분화를 촉진시킬 수 있다.
Candidates screened by the screening method can be used to promote differentiation from embryonic stem cells or endoderm precursors to hepatocytes.

이하 실시예를 통해 본 발명의 내용을 보다 상세히 설명한다. Hereinafter, the contents of the present invention will be described in more detail with reference to the following examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

배아 줄기 세포의 간세포(Liver cells of embryonic stem cells hepatocyteshepatocytes )로의 분화Eruption

인간 배아 줄기 세포 (CHA-hES4) 는 한국, 성남, 포천 차 대학교, 의과대학에서 제공받았다. Cai et al.(Cai J, Zhao Y, Liu Y, Ye F, Song Z, Qin H, et al. Directed differentiation of human embryonic stem cells into functional hepatic cells. Hepatology 2007;45:1229-1239)의 3-단계 방법을 사용하여 배아 줄기 세포에서 간세포로 분화시켰다(도 1A). Human embryonic stem cells (CHA-hES4) were provided by Korea, Seongnam, Pocheoncha University, and College of Medicine. 3- of Cai et al. (Cai J, Zhao Y, Liu Y, Ye F, Song Z, Qin H, et al. Directed differentiation of human embryonic stem cells into functional hepatic cells.Hepatology 2007; 45: 1229-1239). The step method was used to differentiate from embryonic stem cells to hepatocytes (FIG. 1A).

간단히 설명하면, 배아 줄기 세포는 3일 동안 새로운 배지를 첨가하지 않는 시스템(feeder-free system)에서 조절된 배지에 완전히 자라게 배양하였다. 그 후, 배아 줄기 세포는 0.5 ㎎/㎖ 알부민 분획 V(Sigma-Aldrich, St. Louis, MO) 및 50 ng/㎖ 액티빈 A(activin A)(Peprotech, Rocky Hill, NJ)을 포함하는 RPMI-1640 (HyClone, Logan, UT)에서 1일 동안 배양하고 추가로 1 % 인슐린-트랜스페린-셀레늄(insulin-transferrin-selenium, ITS; Sigma-Aldrich)를 보충한 상기와 동일한 RPMI 배지에서 4일 동안 배양하였다. 액티빈 A로 처리한 후, 배아 줄기 세포를 수확하였다. 추가적인 분화를 위해, 배아 줄기 세포를 30 ng/㎖ FGF4(Peprotech) 및 20 ng/㎖ BMP2(Peprotech)을 포함하는 간세포 배양 배지(HCM; Lonza,Baltimore, MD)에서 5일 동안 배양하고 추가로 20 ng/㎖ 간세포 성장 인자(Peprotech)를 보충한 HCM에서 5일 동안 배양하였다. 10 ng/㎖ 온코스타틴 M(oncostatin M; R&D Systems, Minneapolis, MN) 및 0.1 μM 덱사메타손(dexamethasone; Sigma-Aldrich)을 보충한 HCM에서 5일 동안 배양하여 배아 줄기 세포-유래 간세포의 성숙을 유도하였다. 성숙한 간세포를 수확하였다. 배지는 매일 갈아주었다.Briefly, embryonic stem cells were cultured in full growth in conditioned medium in a feeder-free system for 3 days without adding fresh medium. Embryonic stem cells were then RPMI- containing 0.5 mg / ml albumin fraction V (Sigma-Aldrich, St. Louis, Mo.) and 50 ng / ml activin A (Peprotech, Rocky Hill, NJ). Incubated for 1 day at 1640 (HyClone, Logan, UT) and incubated for 4 days in the same RPMI medium supplemented with an additional 1% insulin-transferrin-selenium (ITS; Sigma-Aldrich). . After treatment with activin A, embryonic stem cells were harvested. For further differentiation, embryonic stem cells were incubated for 5 days in hepatocyte culture medium (HCM; Lonza, Baltimore, MD) containing 30 ng / ml FGF4 (Peprotech) and 20 ng / ml BMP2 (Peprotech) and further 20 Cultured for 5 days in HCM supplemented with ng / ml hepatocyte growth factor (Peprotech). Maturation of embryonic stem cell-derived hepatocytes was induced by incubation for 5 days in HCM supplemented with 10 ng / ml oncostatin M (R & D Systems, Minneapolis, MN) and 0.1 μM dexamethasone (Sigma-Aldrich). . Mature hepatocytes were harvested. The badge was changed daily.

배아 줄기 세포(배아 줄기 세포(ES))는 >90 %의 효율로 내배엽 전구체(내배엽 전구체(EP))로 분화시키고, 그 후에 내배엽 전구체는 >80 %의 효율로 간세포로 분화시켰다(도 1A).
Embryonic stem cells (embryonic stem cells (ES)) differentiated to endoderm precursors (endodermal precursors (EP)) with an efficiency of> 90%, and then endoderm precursors differentiated to hepatocytes with an efficiency of> 80% (FIG. 1A). .

배아 줄기 세포에서 간세포로 분화하는 동안 유전자 발현의 프로파일링Profiling of Gene Expression During Differentiation from Embryonic Stem Cells to Hepatocytes

3 분화 단계(배아 줄기 세포(ES), 내배엽 전구체(EP), 및 성숙한 간세포(MH))의 유전자 발현은 일루미나 비드칩(Illumina BeadChip) 분석으로 프로파일하였다.
Gene expression of the three differentiation steps (embryonic stem cells (ES), endoderm precursors (EP), and mature hepatocytes (MH)) was profiled by Illumina BeadChip analysis.

<2-1> 인간-6 전체-게놈 발현 비드칩(<2-1> human-6 full-genomic expression bead chip ( HumanHuman -6 -6 WholeWhole -- GenomeGenome ExpressionExpression BeadChipBeadChip )으로 발현 분석Expression analysis

배아 줄기 세포(ES), 내배엽 전구체(EP), 및 성숙한 간세포(MH)의 발현 분석은 4회 반복 실험하였다. 표시된 시점에 세포주에서 분리된 RNA를 사용하고, 46,000개 이상의 인간 전사체에 대한 발현 프로파일을 제공하는 인간-6 전체-게놈 발현 비드칩을 사용하여 유전자 발현을 분석하였다. 질을 확인한 총 RNA 300 ng을 사용하여 선형 증폭 키트(linear amplification kit; Ambion, Austin, TX)로 비오틴-표지된 cRNA를 만들었다. 칩 혼성화, 세척, Cy3-스트렙타비딘 염색, 및 스캐닝은 제조자가 제공한 시약 및 프로토콜에 따라 비드어레이 리더(BeadArray Reader; Illumina) 플랫폼에서 수행하였다. 발현을 결정하기 위해 검출 점수를 사용하였다.
Expression analysis of embryonic stem cells (ES), endoderm precursors (EP), and mature hepatocytes (MH) were repeated four times. Gene expression was analyzed using RNA isolated from the cell line at the indicated time points and using a human-6 whole-genomic expression beadchip that provides expression profiles for over 46,000 human transcripts. Biotin-labeled cRNA was made with a linear amplification kit (Ambion, Austin, TX) using 300 ng of confirmed total RNA. Chip hybridization, washing, Cy3-streptavidin staining, and scanning were performed on a BeadArray Reader (Illumination) platform according to the reagents and protocols provided by the manufacturer. Detection scores were used to determine expression.

<2-2> 정량적 역 전사(<2-2> quantitative reverse transcription ( QuantitativeQuantitative ReverseReverse TranscriptionPCRTranscriptionPCR , , qRTqRT -- PCRPCR ).).

각 분화 단계의 잘 알려진 마커들의 qRT-PCR을 수행하였다. 배아 줄기 세포(ES)의 마커는 POU5F1, SOX2, 및 NANOG이다. 내배엽 전구체(EP)의 마커는 SOX17, FOXA2, 및 GATA4이다. 성숙한 간세포(MH)의 마커는 ALB, AFP, 및 SERPINA1이다.QRT-PCR of well known markers of each differentiation step was performed. Markers of embryonic stem cells (ES) are POU5F1, SOX2, and NANOG. Markers of endoderm precursors (EP) are SOX17, FOXA2, and GATA4. Markers of mature hepatocytes (MH) are ALB, AFP, and SERPINA1.

qRT-PCR는 (Kim M. et al ., Cancer Res 2008;68:7147-7155)에서 설명한 바와 같이 수행하였다. PCR 프라이머 서열은 <표 1>에 기재하였다. 총 RNA는 RNeasy 키트(Qiagen, Hilden, Germany)를 사용하여 제조하였고; DNase-처리된 RNA (5 ㎍)은 Superscript II 역 전사효소(reverse transcriptase) (Invitrogen, Carlsbad, CA)로 역-전사시켰다. 실시간 PCR은 C1000 Thermal Cycler (Bio-Rad, Hercules, CA)에서 수행하였다. β-액틴을 암호화하는 유전자를 대조군으로 증폭시켰다. 표적 mRNA의 상대적 정량은 comparative threshold cycle (CT) 방법(Johnson MR., et al., Anal Biochem 2000;278:175-184)으로 분석하였다.
qRT-PCR (Kim M. et. al . , Cancer Res 2008; 68: 7147-7155). PCR primer sequences are listed in Table 1. Total RNA was prepared using the RNeasy kit (Qiagen, Hilden, Germany); DNase-treated RNA (5 μg) was reverse-transcribed with Superscript II reverse transcriptase (Invitrogen, Carlsbad, Calif.). Real time PCR was performed in C1000 Thermal Cycler (Bio-Rad, Hercules, CA). The gene encoding β-actin was amplified as a control. Relative quantification of target mRNA was analyzed by comparative threshold cycle (CT) method (Johnson MR., Et al. , Anal Biochem 2000; 278: 175-184).

qRT-PCR를 위한 프라이머 서열Primer Sequence for qRT-PCR 번호number 유전자gene 정방향 프라이머(5'-3')Forward primer (5'-3 ') 역방향 프라이머(5'-3')Reverse primer (5'-3 ') 1One POU5F1POU5F1 GAAGGATGTGGTCCGAGTGT (서열번호: 1)GAAGGATGTGGTCCGAGTGT (SEQ ID NO .: 1) GTGAAGTGAGGGCTCCCATA (서열번호: 2)GTGAAGTGAGGGCTCCCATA (SEQ ID NO .: 2) 22 SOX2SOX2 AACCCCAAGATGCACAACTC (서열번호: 3)AACCCCAAGATGCACAACTC (SEQ ID NO .: 3) CGGGGCCGGTATTTATAATC (서열번호: 4)CGGGGCCGGTATTTATAATC (SEQ ID NO .: 4) 33 NANOGNANOG CAAAGGCAAACAACCCACTT (서열번호: 5)CAAAGGCAAACAACCCACTT (SEQ ID NO .: 5) TCTGGAACCAGGTCTTCACC (서열번호: 6)TCTGGAACCAGGTCTTCACC (SEQ ID NO .: 6) 44 SOX17SOX17 CAGAATCCAGACCTGCACAA (서열번호: 7)CAGAATCCAGACCTGCACAA (SEQ ID NO .: 7) GCGGCCGGTACTTGTAGTT (서열번호: 8)GCGGCCGGTACTTGTAGTT (SEQ ID NO .: 8) 55 FOXA2FOXA2 CTACGCCAACATGAACTCCA (서열번호: 9)CTACGCCAACATGAACTCCA (SEQ ID NO .: 9) CGGTAGAAGGGGAAGAGGTC (서열번호: 10)CGGTAGAAGGGGAAGAGGTC (SEQ ID NO .: 10) 66 GATA4GATA4 TCCAAACCAGAAAACGGAAG (서열번호: 11)TCCAAACCAGAAAACGGAAG (SEQ ID NO .: 11) CTGTGCCCGTAGTGAGATGA (서열번호: 12)CTGTGCCCGTAGTGAGATGA (SEQ ID NO .: 12) 77 ALBALB CCAGAGATTTCCCAAAGCTG (서열번호: 13)CCAGAGATTTCCCAAAGCTG (SEQ ID NO .: 13) TGGGATTTTTCCAACAGAGG (서열번호: 14)TGGGATTTTTCCAACAGAGG (SEQ ID NO .: 14) 88 AFPAFP GTAGCGCTGCAAACAATGAA (서열번호: 15)GTAGCGCTGCAAACAATGAA (SEQ ID NO .: 15) CCCTCTTCAGCAAAGCAGAC (서열번호: 16)CCCTCTTCAGCAAAGCAGAC (SEQ ID NO .: 16) 99 SERPINA1SERPINA1 AGGGCCTGAAGCTAGTGGAT (서열번호: 17)AGGGCCTGAAGCTAGTGGAT (SEQ ID NO .: 17) TCCTCGGTGTCCTTGACTTC (서열번호: 18)TCCTCGGTGTCCTTGACTTC (SEQ ID NO .: 18) 1010 DPPA2DPPA2 CCAAGAGAGCAAGGCTTCAG (서열번호: 19)CCAAGAGAGCAAGGCTTCAG (SEQ ID NO .: 19) GTCTGCCGAGAGAAGTCTGC (서열번호: 20)GTCTGCCGAGAGAAGTCTGC (SEQ ID NO .: 20) 1111 DPEP3DPEP3 CCTGGACAGGCTTAGAGACG (서열번호: 21)CCTGGACAGGCTTAGAGACG (SEQ ID NO .: 21) AGTGAGTGACCACCCTCCAC (서열번호: 22)AGTGAGTGACCACCCTCCAC (SEQ ID NO .: 22) 1212 SLC15A3SLC15A3 CCACATCCCAAACATTTTCC (서열번호: 23)CCACATCCCAAACATTTTCC (SEQ ID NO .: 23) GATCAAGCGGTCCTTCAGAG (서열번호: 24)GATCAAGCGGTCCTTCAGAG (SEQ ID NO .: 24) 1313 USP44USP44 GATTTGGCTCAGGGCACTAC (서열번호: 25)GATTTGGCTCAGGGCACTAC (SEQ ID NO .: 25) AGCGTCTTCATTGGGATGTT (서열번호: 26)AGCGTCTTCATTGGGATGTT (SEQ ID NO .: 26) 1414 LECT1LECT1 AGGCGCTGGAAGACTGAATA (서열번호: 27)AGGCGCTGGAAGACTGAATA (SEQ ID NO .: 27) GATCTTCTGGCAGTGGGTGT (서열번호: 28)GATCTTCTGGCAGTGGGTGT (SEQ ID NO .: 28) 1515 CER1CER1 TCTGGCACCACTTCATGTTC (서열번호: 29)TCTGGCACCACTTCATGTTC (SEQ ID NO .: 29) AATGAACAGACCCGCATTTC (서열번호: 30)AATGAACAGACCCGCATTTC (SEQ ID NO .: 30) 1616 MIXL1MIXL1 AAGCGCACGTCTTTCAGC (서열번호: 31)AAGCGCACGTCTTTCAGC (SEQ ID NO .: 31) TGGAAGGATTTCCCACTCTG (서열번호: 32)TGGAAGGATTTCCCACTCTG (SEQ ID NO .: 32) 1717 LEFTY1LEFTY1 CGCCAGGAGATGTACATTGA (서열번호: 33)CGCCAGGAGATGTACATTGA (SEQ ID NO .: 33) CTTGATGCTGACGATCATGG (서열번호: 34)CTTGATGCTGACGATCATGG (SEQ ID NO .: 34) 1818 VWFVWF TGCTGACACCAGAAAAGTGC (서열번호: 35)TGCTGACACCAGAAAAGTGC (SEQ ID NO .: 35) AGTCCCCAATGGACTCACAG (서열번호: 36)AGTCCCCAATGGACTCACAG (SEQ ID NO .: 36) 1919 LEFTY2LEFTY2 CAGGGACTATGGAGCTCAGG (서열번호: 37)CAGGGACTATGGAGCTCAGG (SEQ ID NO .: 37) CACACACTCGTAAGCCAGGA (서열번호: 38)CACACACTCGTAAGCCAGGA (SEQ ID NO .: 38) 2020 SERPINA3SERPINA3 GGTGAGCTCTACCTGCCAAA (서열번호: 39)GGTGAGCTCTACCTGCCAAA (SEQ ID NO .: 39) CACAGCCTTATGGACCACCT (서열번호: 40)CACAGCCTTATGGACCACCT (SEQ ID NO .: 40) 2121 APOA4APOA4 TGAACTCACCCAGCAACTCA (서열번호: 41)TGAACTCACCCAGCAACTCA (SEQ ID NO .: 41) CCTTCCCAATCTCCTCCTTC (서열번호: 42)CCTTCCCAATCTCCTCCTTC (SEQ ID NO .: 42) 2222 KNG1KNG1 GTGGTGGCTGGATTGAACTT (서열번호: 43)GTGGTGGCTGGATTGAACTT (SEQ ID NO .: 43) CGCAAATCTTGGTAGGTGGT (서열번호: 44)CGCAAATCTTGGTAGGTGGT (SEQ ID NO .: 44) 2323 VTNVTN GGGAGCGGGTCTACTTCTTC (서열번호: 45)GGGAGCGGGTCTACTTCTTC (SEQ ID NO .: 45) GCTAATGAACTGGGGCTGTC (서열번호: 46)GCTAATGAACTGGGGCTGTC (SEQ ID NO .: 46) 2424 SULT2A1SULT2A1 TGGTTTGACCACATTCATGG (서열번호: 47)TGGTTTGACCACATTCATGG (SEQ ID NO .: 47) TCATGCTCTGAAAGGAGCTG (서열번호: 48)TCATGCTCTGAAAGGAGCTG (SEQ ID NO .: 48)

qRT-PCR를 통하여 POU5F1, SOX2, 및 NANOG는 배아 줄기 세포-특이적으로 발현하였고, SOX17, FOXA2, 및 GATA4는 내배엽 전구체(EP)-특이적으로 발현하였으며, ALB, AFP, 및 SERPINA1는 성숙한 간세포(MH)-특이적으로 발현하였음을 확인하였다. 이런 마커들은 분화하는 동안에 극적인 발현 변화를 보인다(도 3A).
Through qRT-PCR, POU5F1, SOX2, and NANOG expressed embryonic stem cell-specifically, SOX17, FOXA2, and GATA4 expressed endoderm precursors (EP) -specifically, while ALB, AFP, and SERPINA1 expressed mature hepatocytes. It was confirmed that (MH) -specific expression. These markers show dramatic expression changes during differentiation (FIG. 3A).

<2-3> 배아 줄기 세포(<2-3> embryonic stem cells ( ESES )-, 내배엽 전구체(), Endoderm precursor ( EPEP )-, 및 성숙한 간세포(), And mature hepatocytes ( MHMH )-특이적으로 발현된 유전자들의 클러스터링.Clustering of specifically-expressed genes.

모든 유전자들이 시험관 내(in vitro)에서 간세포로의 분화 과정 동안 세 단계의 잘 알려진 마커와 유사한 유전자 발현 변화를 보이는 지 유전자들의 세 클러스터를 확인하는 실험을 하였다. 유전자 발현 마이크로어레이 데이타는 TIGR MultiExperiment Viewer로 보내고(Saeed AI. et al ., Biotechniques 2003;34:374-378), K-방법 클러스터링(K-means clustering)을 수행하였다. 데이타의 필터링과 편집(compilations)은 마이크로소프트 엑셀을 사용하여 수행하였다.Three clusters of genes were tested to determine whether all genes exhibited similar gene expression changes to three well-known markers during differentiation into hepatocytes in vitro. Gene expression microarray data is sent to TIGR MultiExperiment Viewer (Saeed AI. Et al . , Biotechniques 2003; 34: 374-378), K-means clustering was performed. Data filtering and compilations were performed using Microsoft Excel.

배아 줄기 세포(ES), 내배엽 전구체(EP), 및 성숙한 간세포(MH) 단계 동안 특이적으로 발현되는 추가적인 유전자들을 찾기 위하여, 각 단계에서 잘 알려진 마커들과 공동-발현되는 유전자들을 클러스터하였다(도 3B). 클러스터 1은 POU5F1, SOX2, 및 NANOG과 배아 줄기 세포(ES)-특이적 발현을 보이는 67개의 유전자들을 포함한다(표 2). 클러스터 2는 SOX17, FOXA2, 및 GATA4과 내배엽 전구체(EP)-특이적 발현을 보이는 83개의 유전자들을 포함한다(표 3). 클러스터 3은 ALB, AFP, 및 SERPINA1과 성숙한 간세포(MH)-특이적 발현을 보이는 375개의 유전자들을 포함한다(표 4).
To find additional genes specifically expressed during embryonic stem cell (ES), endoderm precursor (EP), and mature hepatocyte (MH) stages, genes co-expressed with well-known markers at each stage were clustered (FIG. 3B). Cluster 1 contains 67 genes that exhibit POU5F1, SOX2, and NANOG and embryonic stem cell (ES) -specific expression (Table 2). Cluster 2 contains 83 genes showing SOX17, FOXA2, and GATA4 and endoderm precursor (EP) -specific expression (Table 3). Cluster 3 contains 375 genes showing mature hepatocyte (MH) -specific expression with ALB, AFP, and SERPINA1 (Table 4).

시험관 내 간세포 발생 동안 클러스터 1에서 유전자들의 mRNA 발현 수준MRNA expression levels of genes in cluster 1 during in vitro hepatocyte development 유전자gene ESES EPEP MHMH AASSAASS 15511551 172172 106.4106.4 APOBEC3HAPOBEC3H 446.8446.8 71.171.1 65.265.2 CAMKVCAMKV 2776.82776.8 161.7161.7 69.769.7 CDCA7LCDCA7L 1769.31769.3 126.1126.1 76.276.2 CHST4CHST4 1015.11015.1 103.7103.7 69.869.8 CKMT1ACKMT1A 879.1879.1 97.297.2 82.782.7 CRABP1CRABP1 3575.43575.4 356.1356.1 60.560.5 CXXC6CXXC6 1002.61002.6 170.4170.4 96.896.8 CYP2S1CYP2S1 2213.42213.4 277.2277.2 165.6165.6 DCLK1DCLK1 20452045 179.4179.4 113.9113.9 DNMT3BDNMT3B 4362.24362.2 1098.91098.9 110.4110.4 DPEP3DPEP3 791.8791.8 84.784.7 79.779.7 DPPA2DPPA2 10091009 138.5138.5 66.866.8 DPPA4DPPA4 11517.311517.3 2035.42035.4 671.6671.6 DPPA5DPPA5 706.4706.4 57.357.3 53.553.5 FLJ25404FLJ25404 3656.43656.4 445.4445.4 77.677.6 GPM6BGPM6B 872.3872.3 131.6131.6 76.576.5 HEY2HEY2 24862486 188.6188.6 152.2152.2 HLA-DOAHLA-DOA 470.1470.1 75.875.8 63.463.4 HS.148659HS.148659 2122.12122.1 73.973.9 63.463.4 HS.270778HS.270778 503.6503.6 83.583.5 60.260.2 HS.540043HS.540043 2113.42113.4 196.1196.1 69.469.4 HS.561216HS.561216 2054.32054.3 297.1297.1 6161 HS.574590HS.574590 4512.14512.1 395.7395.7 6666 HS.575696HS.575696 4443.54443.5 329.7329.7 6868 IRX2IRX2 1056.31056.3 148.7148.7 79.879.8 LECT1LECT1 3634.93634.9 84.584.5 75.575.5 LOC440132LOC440132 2133.92133.9 78.478.4 75.175.1 LOC642559LOC642559 17043.917043.9 1445.91445.9 100.7100.7 LOC643272LOC643272 11129.811129.8 1492.71492.7 84.784.7 LOC645682LOC645682 6932.26932.2 229.1229.1 63.663.6 LOC649970LOC649970 1910.31910.3 170.3170.3 100.4100.4 MIATMIAT 2649.32649.3 87.487.4 67.567.5 MT1FMT1F 1762.51762.5 195.1195.1 135135 MT1GMT1G 5806.65806.6 98.598.5 75.875.8 MT1HMT1H 2045.12045.1 73.973.9 65.965.9 MYCNMYCN 32313231 557.3557.3 148148 NANOGNANOG 767.4767.4 126.9126.9 59.959.9 PHC1PHC1 2244.42244.4 362.4362.4 221221 PHF17PHF17 21992199 301.3301.3 193.6193.6 POU5F1POU5F1 3957.23957.2 160.6160.6 68.268.2 POU5F1P1POU5F1P1 8281.58281.5 541.5541.5 67.967.9 PPFIA4PPFIA4 1201.91201.9 173.4173.4 127.8127.8 PRDM14PRDM14 1277.91277.9 82.182.1 64.264.2 PRIM1PRIM1 1447.21447.2 214.2214.2 95.695.6 PTPRZ1PTPRZ1 964.2964.2 78.378.3 68.668.6 RHBDL3RHBDL3 591.4591.4 74.174.1 72.572.5 SALL2SALL2 7238.17238.1 687.6687.6 651.2651.2 SCG5SCG5 1030.91030.9 161.1161.1 122.5122.5 SEPHS1SEPHS1 7154.77154.7 1134.41134.4 410.2410.2 SFRP2SFRP2 881.5881.5 80.180.1 7777 SILVSILV 1088.91088.9 157.1157.1 154.5154.5 SLC15A3SLC15A3 605.3605.3 88.388.3 87.587.5 SOX2SOX2 29672967 96.496.4 99.999.9 SOX3SOX3 992.6992.6 6666 63.363.3 SPP1SPP1 41324132 101.3101.3 101.3101.3 SYT4SYT4 15181518 196.7196.7 191.9191.9 TCEAL2TCEAL2 1881.71881.7 306.6306.6 213.1213.1 TERF1TERF1 1536.11536.1 189.8189.8 178.3178.3 TMEM145TMEM145 1305.51305.5 113.7113.7 86.886.8 TMEM158TMEM158 7695.27695.2 862.2862.2 715.4715.4 UPK1AUPK1A 965965 8080 7676 USP44USP44 837.2837.2 63.663.6 61.761.7 UTF1UTF1 446.7446.7 64.564.5 55.655.6 VASH2VASH2 4140.74140.7 454.8454.8 115.8115.8 VGFVGF 2282.52282.5 185.3185.3 102102 WDR54WDR54 4731.54731.5 790.4790.4 343.4343.4

시험관 내 간세포 발생 동안 클러스터 2에서 유전자들의 mRNA 발현 수준MRNA expression levels of genes in cluster 2 during hepatocyte development in vitro 유전자gene ESES EPEP MHMH ABCD1ABCD1 76.876.8 657.2657.2 250.5250.5 ACE2ACE2 63.563.5 515.5515.5 142.5142.5 ACOX3ACOX3 256.3256.3 3535.73535.7 403.7403.7 AMOTAMOT 147.7147.7 1598.21598.2 405405 ANGPT2ANGPT2 73.973.9 1686.71686.7 122.1122.1 ARL4DARL4D 78.578.5 704.3704.3 133.5133.5 BHLHB5BHLHB5 59.159.1 2838.82838.8 57.357.3 BMP2BMP2 133.7133.7 5705.75705.7 1804.41804.4 C21ORF129C21ORF129 65.765.7 1230.71230.7 359.9359.9 C6ORF60C6ORF60 308.3308.3 4297.54297.5 249.1249.1 C8ORF13C8ORF13 96.196.1 796.4796.4 67.767.7 C8ORF31C8ORF31 7575 695.1695.1 91.791.7 C9ORF19C9ORF19 754.1754.1 8513.58513.5 784.8784.8 CCDC81CCDC81 8080 5484.55484.5 85.285.2 CCKBRCCKBR 94.694.6 4545.24545.2 123.1123.1 CER1CER1 69.869.8 9835.59835.5 66.466.4 CFLARCFLAR 140.3140.3 21422142 708.5708.5 COL9A2COL9A2 113.3113.3 4835.64835.6 123.5123.5 CRIP1CRIP1 132.2132.2 2949.42949.4 86.886.8 CST1CST1 73.773.7 22497.922497.9 419419 CXCR4CXCR4 111.5111.5 2623.42623.4 146.6146.6 CXCR7CXCR7 163.9163.9 4267.94267.9 470.8470.8 DACT2DACT2 147.9147.9 2622.22622.2 208.3208.3 DLX5DLX5 64.264.2 1047.81047.8 74.974.9 ELOVL2ELOVL2 70.670.6 569.4569.4 225.3225.3 EOMESEOMES 66.966.9 13642.313642.3 62.562.5 FGF17FGF17 71.871.8 15514.615514.6 71.171.1 FGF8FGF8 64.964.9 1108.71108.7 63.263.2 FHOD1FHOD1 575.9575.9 4630.74630.7 465.5465.5 FOXA2FOXA2 62.962.9 4049.54049.5 1190.31190.3 FOXC1FOXC1 92.392.3 945.7945.7 116.9116.9 FOXQ1FOXQ1 62.262.2 9562.89562.8 204.8204.8 FREM1FREM1 8383 4230.94230.9 610.2610.2 FSTFST 563.1563.1 8779.58779.5 1425.41425.4 FZD5FZD5 273.8273.8 3871.63871.6 1222.91222.9 GADD45AGADD45A 451451 1780.11780.1 817.5817.5 GATA4GATA4 62.162.1 564.9564.9 183.4183.4 GRPGRP 68.268.2 762.4762.4 63.463.4 GSCGSC 75.575.5 2748.52748.5 74.974.9 HS.241559HS.241559 63.563.5 854.8854.8 129.6129.6 HS.475733HS.475733 72.572.5 705.6705.6 114.7114.7 HS.502887HS.502887 63.163.1 641.2641.2 65.765.7 HS.543452HS.543452 70.870.8 1202.51202.5 71.171.1 HS.572444HS.572444 75.675.6 3600.43600.4 164.8164.8 IER3IER3 750.9750.9 7241.87241.8 1106.31106.3 IGFBP5IGFBP5 212.2212.2 9968.39968.3 2568.72568.7 IGFBP6IGFBP6 257.1257.1 3144.73144.7 287.6287.6 KCNF1KCNF1 113.1113.1 1001.41001.4 195.1195.1 KCNK12KCNK12 1117.21117.2 14422.114422.1 1039.11039.1 LEFTY1LEFTY1 304.1304.1 15090.915090.9 59.159.1 LEFTY2LEFTY2 339.5339.5 24852.624852.6 93.793.7 LHX1LHX1 80.780.7 1876.81876.8 83.783.7 LOC642299LOC642299 194194 19351935 192.1192.1 LOC646100LOC646100 8181 1003.11003.1 77.377.3 LOC653158LOC653158 75.675.6 846846 130.2130.2 LOC728473LOC728473 60.460.4 4253.64253.6 1197.31197.3 LOC730273LOC730273 161.8161.8 1381.71381.7 211.9211.9 MBD4MBD4 12161216 2850.12850.1 1046.51046.5 MIXL1MIXL1 7979 1987.91987.9 67.467.4 MXRA5MXRA5 162.2162.2 3141.43141.4 844.4844.4 MYL4MYL4 61.461.4 10101010 283.4283.4 MYL7MYL7 84.184.1 5496.25496.2 299.2299.2 NBL1NBL1 307.7307.7 5485.15485.1 1990.21990.2 NFKBIANFKBIA 1418.81418.8 12133.712133.7 2762.62762.6 NODALNODAL 242242 4890.64890.6 109.4109.4 NTN1NTN1 96.596.5 790.1790.1 255.7255.7 OXTROXTR 122.7122.7 2002.42002.4 204.6204.6 PLCE1PLCE1 64.264.2 736.4736.4 283.9283.9 PLXNA2PLXNA2 75.975.9 697.7697.7 157.2157.2 RAGERAGE 109.3109.3 1273.21273.2 162162 RHOBTB3RHOBTB3 203.6203.6 14780.714780.7 3684.53684.5 ROR2ROR2 271.3271.3 4193.74193.7 388.7388.7 SLC5A9SLC5A9 60.760.7 1142.31142.3 83.883.8 SLCO2A1SLCO2A1 114.4114.4 30373037 235.6235.6 SOX17SOX17 61.461.4 3116.63116.6 77.477.4 STMN2STMN2 243243 58885888 1793.11793.1 TDRD7TDRD7 133.2133.2 2861.72861.7 903.7903.7 TMEM63ATMEM63A 159.1159.1 1473.71473.7 564.4564.4 TMOD1TMOD1 100.6100.6 1520.81520.8 67.567.5 TNNC1TNNC1 232.9232.9 4102.24102.2 161.1161.1 VWFVWF 84.784.7 17971797 73.173.1 WNT3WNT3 102.5102.5 1324.51324.5 178.6178.6 ZBTB40ZBTB40 162.4162.4 1619.11619.1 319.4319.4

시험관 내 간세포 발생 동안 클러스터 3에서 유전자들의 mRNA 발현 수준MRNA expression levels of genes in cluster 3 during in vitro hepatocyte development 유전자gene ESES EPEP MHMH A1CFA1CF 65.265.2 66.566.5 723.3723.3 A2MA2M 5050 51.351.3 2383.42383.4 ABCA1ABCA1 1176.41176.4 3080.93080.9 8525.68525.6 ACAA1ACAA1 385.2385.2 633.8633.8 4583.64583.6 ACTA1ACTA1 815.2815.2 2295.32295.3 4813.74813.7 ACTA2ACTA2 234234 239.7239.7 8626.38626.3 AFMAFM 58.458.4 61.961.9 484.2484.2 AFPAFP 192.8192.8 6464 24254.124254.1 AGTAGT 58.758.7 59.559.5 3038.93038.9 AHSGAHSG 97.997.9 8686 6849.96849.9 AKR1B10AKR1B10 59.659.6 6666 455.1455.1 ALBALB 65.365.3 69.269.2 17272.617272.6 ALDH1A1ALDH1A1 89.189.1 73.473.4 1940.11940.1 ANGANG 645.8645.8 758.6758.6 5522.25522.2 ANGPTL2ANGPTL2 113.9113.9 291.5291.5 915.3915.3 ANGPTL3ANGPTL3 60.860.8 6262 2939.52939.5 ANGPTL6ANGPTL6 75.875.8 65.665.6 1655.51655.5 ANPEPANPEP 8383 113.5113.5 2005.72005.7 ANTXR2ANTXR2 202.2202.2 189189 1232.81232.8 ANXA8ANXA8 69.569.5 74.174.1 451.4451.4 APCDD1APCDD1 76.776.7 195.3195.3 1747.51747.5 APH1BAPH1B 170.9170.9 211211 1118.31118.3 APOA4APOA4 56.556.5 80.880.8 24397.424397.4 APOBAPOB 79.879.8 114114 11768.711768.7 APOC2APOC2 73.773.7 77.477.4 6121.86121.8 APOC3APOC3 60.260.2 63.463.4 22059.222059.2 APOHAPOH 57.857.8 56.556.5 922.6922.6 APOMAPOM 163.7163.7 75.675.6 1489.11489.1 AQP10AQP10 64.364.3 64.364.3 522.7522.7 ARHGDIBARHGDIB 103.2103.2 110.4110.4 878.8878.8 ARHGEF3ARHGEF3 361.8361.8 925.4925.4 2776.22776.2 ARID5BARID5B 102.6102.6 74.574.5 2209.22209.2 ARL2BPARL2BP 585.8585.8 895.1895.1 3851.13851.1 ASGR2ASGR2 61.561.5 61.761.7 1867.41867.4 ATP6AP1ATP6AP1 1720.71720.7 6239.86239.8 11147.911147.9 ATP7BATP7B 115.8115.8 163.7163.7 852.3852.3 ATP9AATP9A 197.1197.1 466.4466.4 1241.61241.6 BEX5BEX5 274.2274.2 432.8432.8 2006.32006.3 BGNBGN 225.7225.7 117.7117.7 1376.61376.6 BMPR2BMPR2 96.496.4 302.3302.3 633.1633.1 C11ORF9C11ORF9 103.2103.2 111.1111.1 704.2704.2 C19ORF15C19ORF15 72.572.5 100.9100.9 1116.21116.2 C1ORF116C1ORF116 123.8123.8 121.4121.4 1672.51672.5 C1SC1S 99.299.2 71.671.6 656.3656.3 C4ORF18C4ORF18 62.162.1 77.277.2 414.8414.8 C6C6 6060 75.775.7 673.9673.9 C6ORF32C6ORF32 424.5424.5 294.3294.3 3069.63069.6 CAMK2N1CAMK2N1 531.6531.6 261261 61396139 CD248CD248 142.7142.7 69.869.8 5589.95589.9 CD3DCD3D 64.964.9 60.260.2 2124.72124.7 CD44CD44 127.3127.3 201.6201.6 1141.81141.8 CDH11CDH11 90.990.9 105.8105.8 1528.91528.9 CDH17CDH17 58.758.7 56.856.8 2399.22399.2 CDH6CDH6 86.586.5 7171 1399.41399.4 CDKN1ACDKN1A 1152.21152.2 2641.42641.4 6572.26572.2 CDKN1CCDKN1C 327.8327.8 437437 4580.14580.1 CDX2CDX2 75.675.6 90.290.2 1036.91036.9 CEACAM6CEACAM6 53.653.6 56.556.5 327.8327.8 CEBPACEBPA 161.5161.5 80.680.6 2073.22073.2 CEBPDCEBPD 270.3270.3 367367 6744.76744.7 CFBCFB 5959 61.561.5 2112.82112.8 CFHCFH 66.466.4 69.269.2 460.8460.8 CFICFI 65.265.2 62.262.2 521.9521.9 CIDECCIDEC 68.968.9 69.869.8 434.5434.5 CILPCILP 74.774.7 77.477.4 3580.63580.6 CKAP4CKAP4 1550.31550.3 3000.73000.7 9155.79155.7 CLDN1CLDN1 395395 447.6447.6 3901.43901.4 CLDN18CLDN18 7979 304.6304.6 2661.42661.4 CLDN2CLDN2 67.767.7 66.566.5 864.2864.2 CLIC6CLIC6 209209 279.7279.7 4335.24335.2 COBLL1COBLL1 254.4254.4 528.4528.4 3553.73553.7 COL11A1COL11A1 168.2168.2 8080 1252.31252.3 COL15A1COL15A1 60.860.8 62.462.4 1660.21660.2 COL1A1COL1A1 2039.12039.1 577.7577.7 25566.625566.6 COL1A2COL1A2 1092.61092.6 352352 15685.215685.2 COL3A1COL3A1 56.956.9 60.460.4 25691.825691.8 COL4A2COL4A2 352.5352.5 1303.81303.8 2507.22507.2 COL4A5COL4A5 572.2572.2 1505.11505.1 4457.54457.5 COL6A3COL6A3 181.3181.3 68.168.1 3860.73860.7 COLEC11COLEC11 70.570.5 64.964.9 1191.11191.1 CPA2CPA2 69.969.9 76.176.1 2689.72689.7 CREB3L3CREB3L3 67.967.9 58.458.4 887.4887.4 CRISPLD2CRISPLD2 285.6285.6 302.8302.8 7391.17391.1 CSF1RCSF1R 62.962.9 7373 910.8910.8 CST3CST3 2065.72065.7 6366.66366.6 17035.817035.8 CTHRC1CTHRC1 183.8183.8 78.678.6 1610.21610.2 CTSACTSA 292.5292.5 784.8784.8 4304.74304.7 CTSBCTSB 409.4409.4 1547.51547.5 5208.35208.3 CTSECTSE 86.386.3 9595 566.6566.6 CTSHCTSH 370.4370.4 508.4508.4 2448.72448.7 CTSKCTSK 128.4128.4 395.9395.9 891.5891.5 CXCL14CXCL14 98.998.9 106.4106.4 1776.51776.5 CXCL16CXCL16 215.2215.2 97.897.8 1867.81867.8 CYB5R1CYB5R1 261.7261.7 767.6767.6 3041.53041.5 DAB2DAB2 159.5159.5 487.1487.1 2328.22328.2 DCNDCN 65.665.6 66.566.5 6482.36482.3 DDCDDC 67.667.6 7373 636.5636.5 DEFB1DEFB1 64.164.1 65.765.7 849849 DHRS7DHRS7 581.9581.9 602.4602.4 5754.45754.4 DIO1DIO1 57.357.3 59.159.1 853.3853.3 DKFZP564O0823DKFZP564O0823 316.6316.6 97.997.9 2465.82465.8 DLK1DLK1 140.9140.9 375.1375.1 2491224912 DNAH2DNAH2 73.173.1 116116 413.7413.7 DPP4DPP4 6464 85.485.4 418.5418.5 DPP7DPP7 155.8155.8 144.2144.2 1539.41539.4 DUOX1DUOX1 73.273.2 67.367.3 431.9431.9 DUOXA1DUOXA1 63.763.7 58.958.9 465.4465.4 DUOXA2DUOXA2 67.967.9 60.360.3 591.5591.5 ECGF1ECGF1 109.3109.3 320.1320.1 1182.61182.6 ECHDC2ECHDC2 660.1660.1 1349.41349.4 4262.94262.9 EFEMP2EFEMP2 268.8268.8 757.9757.9 1747.21747.2 EGFL6EGFL6 8787 66.966.9 1444.11444.1 EGFLAMEGFLAM 80.680.6 128.1128.1 1633.41633.4 ENDOD1ENDOD1 87.887.8 70.770.7 670.5670.5 EPAS1EPAS1 114.2114.2 117.9117.9 2830.62830.6 ERP27ERP27 58.658.6 59.859.8 611.6611.6 ESAMESAM 71.571.5 66.566.5 661.5661.5 EVI1EVI1 73.673.6 123123 14941494 F10F10 67.167.1 247.6247.6 881.1881.1 F2RL1F2RL1 655.3655.3 222.3222.3 3988.93988.9 F3F3 85.385.3 115.6115.6 781.4781.4 FAM107BFAM107B 404.1404.1 788.7788.7 3009.63009.6 FAM38BFAM38B 8787 183.8183.8 820.7820.7 FAM46AFAM46A 546.6546.6 1228.61228.6 7652.17652.1 FAM46CFAM46C 129.1129.1 151151 1596.51596.5 FAPFAP 64.764.7 67.467.4 458.6458.6 FBLN5FBLN5 85.485.4 139.2139.2 2994.52994.5 FBXO6FBXO6 79.679.6 146.4146.4 690.8690.8 FCGRTFCGRT 461.1461.1 500.4500.4 3048.93048.9 FGAFGA 95.495.4 150150 13381.413381.4 FGBFGB 67.567.5 73.173.1 14237.514237.5 FGGFGG 63.263.2 62.262.2 92529252 FGL1FGL1 69.769.7 75.475.4 1480.71480.7 FILIP1LFILIP1L 74.974.9 83.583.5 2563.32563.3 FLJ13236FLJ13236 67.267.2 144.6144.6 881.1881.1 FLJ21986FLJ21986 63.763.7 59.559.5 365.1365.1 FLJ35258FLJ35258 100.9100.9 80.580.5 592592 FMO1FMO1 61.161.1 65.765.7 1654.51654.5 FMODFMOD 68.168.1 76.576.5 761761 FNDC4FNDC4 120.4120.4 248.5248.5 745.6745.6 FOXF1FOXF1 76.176.1 81.781.7 489.4489.4 FSTL3FSTL3 195.7195.7 233.3233.3 14931493 GABRB1GABRB1 54.754.7 59.659.6 340.8340.8 GAMTGAMT 322.3322.3 457.7457.7 1938.61938.6 GATA5GATA5 109.2109.2 135.7135.7 658658 GBP2GBP2 83.183.1 92.692.6 478.1478.1 GCGRGCGR 107.3107.3 67.867.8 685.1685.1 GCNT3GCNT3 60.260.2 84.284.2 977.9977.9 GDF15GDF15 672.2672.2 855855 4204.84204.8 GHRGHR 58.858.8 86.686.6 538.6538.6 GJB1GJB1 80.280.2 74.874.8 564.3564.3 GLIPR1GLIPR1 71.571.5 60.560.5 10171017 GLTPD2GLTPD2 62.762.7 69.769.7 681.7681.7 GNG11GNG11 135.7135.7 120.6120.6 877.5877.5 GNSGNS 1905.71905.7 4069.74069.7 15042.515042.5 GPBAR1GPBAR1 87.687.6 73.573.5 957.6957.6 GPC3GPC3 534.1534.1 200.6200.6 8285.68285.6 GPR126GPR126 87.787.7 82.182.1 548.4548.4 GPRC5CGPRC5C 368.1368.1 296.6296.6 2569.82569.8 GSTA1GSTA1 64.264.2 80.580.5 5830.35830.3 GSTA2GSTA2 63.463.4 71.171.1 11214.211214.2 GSTK1GSTK1 1003.61003.6 1345.41345.4 5731.85731.8 GSTM3GSTM3 71.371.3 76.276.2 512.1512.1 GUCY1A3GUCY1A3 60.560.5 78.178.1 800.1800.1 H19H19 221.8221.8 267.4267.4 28890.628890.6 HABP2HABP2 56.656.6 61.261.2 963.5963.5 HBE1HBE1 55.555.5 88.588.5 4610.54610.5 HBG1HBG1 71.271.2 94.694.6 2883.22883.2 HBG2HBG2 66.866.8 89.389.3 3623.13623.1 HBZHBZ 79.679.6 69.669.6 2459.82459.8 HES4HES4 776.8776.8 28492849 5214.15214.1 HGDHGD 75.275.2 7272 688.9688.9 HIST1H1CHIST1H1C 162.7162.7 141.8141.8 1735.81735.8 HIST1H2BDHIST1H2BD 279.1279.1 93.593.5 2168.42168.4 HIST1H2BKHIST1H2BK 301.6301.6 770.3770.3 6525.96525.9 HIST1H4HHIST1H4H 113.8113.8 82.582.5 1359.51359.5 HIST2H2AA3HIST2H2AA3 204.4204.4 185.9185.9 6189.16189.1 HIST2H2ACHIST2H2AC 369.1369.1 412.3412.3 5725.65725.6 HIST2H2BEHIST2H2BE 138.9138.9 92.592.5 1743.61743.6 HKDC1HKDC1 70.370.3 64.864.8 4116.64116.6 HMGCS2HMGCS2 61.261.2 65.665.6 7418.57418.5 HOXB2HOXB2 7070 128.2128.2 514.2514.2 HOXB5HOXB5 71.471.4 119119 1188.41188.4 HOXB7HOXB7 57.457.4 88.888.8 801.9801.9 HOXB8HOXB8 56.856.8 87.287.2 1216.71216.7 HOXC8HOXC8 5858 67.267.2 1035.21035.2 HPGDHPGD 103103 87.887.8 1407.91407.9 HPXHPX 63.163.1 199.6199.6 24679.824679.8 HS.100261HS.100261 79.479.4 61.561.5 545.5545.5 HS.202577HS.202577 84.684.6 102.7102.7 688.2688.2 HS.25318HS.25318 90.690.6 67.567.5 2696.32696.3 HS.368984HS.368984 68.268.2 7373 418.4418.4 HS.563390HS.563390 63.463.4 60.760.7 365.8365.8 HS.566332HS.566332 67.967.9 78.778.7 551.7551.7 HS.570988HS.570988 137.8137.8 504.5504.5 3796.83796.8 HSD17B14HSD17B14 259.3259.3 941.2941.2 1793.11793.1 HSD17B2HSD17B2 53.853.8 60.560.5 1338.41338.4 HSPB6HSPB6 75.875.8 80.680.6 1296.41296.4 HTRA1HTRA1 262.8262.8 138.5138.5 4324.94324.9 IFI6IFI6 190.9190.9 98.798.7 1406.31406.3 IFNAR1IFNAR1 94.394.3 116.6116.6 712.8712.8 IGF2IGF2 68.468.4 76.576.5 757.6757.6 IGFBP3IGFBP3 163.3163.3 165.7165.7 1246312463 IGFBP7IGFBP7 114.2114.2 73.573.5 21562156 IL13RA1IL13RA1 278.8278.8 1076.41076.4 31043104 IL18R1IL18R1 58.658.6 93.693.6 845.6845.6 INPP1INPP1 160160 163.5163.5 994.5994.5 ITGA11ITGA11 6262 75.575.5 559.9559.9 ITPKAITPKA 92.692.6 73.473.4 1822.71822.7 KBTBD10KBTBD10 72.772.7 58.758.7 561.3561.3 KCNJ13KCNJ13 60.660.6 122.8122.8 389.9389.9 KCNJ16KCNJ16 93.993.9 151151 911.6911.6 KCNJ8KCNJ8 103.4103.4 94.194.1 1287.81287.8 KDELR3KDELR3 230230 157157 1949.91949.9 KLBKLB 82.482.4 83.283.2 540.1540.1 KNG1KNG1 65.765.7 60.860.8 1363.91363.9 KYNUKYNU 69.669.6 82.582.5 1133.21133.2 LAMA1LAMA1 377.5377.5 10551055 2168.82168.8 LAMB2LAMB2 173173 534.9534.9 1355.71355.7 LAMC3LAMC3 139.8139.8 135.5135.5 1562.61562.6 LCP1LCP1 177.7177.7 123.1123.1 9264.89264.8 LEPROTLEPROT 673.4673.4 1131.41131.4 5987.45987.4 LOC388588LOC388588 224224 216.9216.9 12921292 LOC389286LOC389286 86.586.5 8383 722.9722.9 LOC647169LOC647169 65.665.6 78.778.7 4954.24954.2 LOC653110LOC653110 66.566.5 139.6139.6 403.9403.9 LOC653610LOC653610 68.168.1 64.664.6 477.3477.3 LOC728811LOC728811 62.562.5 61.761.7 3296.63296.6 LOXLOX 264.6264.6 109.8109.8 5149.45149.4 LRMPLRMP 58.858.8 63.163.1 417.1417.1 LRP10LRP10 202.1202.1 574.8574.8 1333.91333.9 LRRC32LRRC32 82.782.7 72.572.5 2435.92435.9 LRRN2LRRN2 91.291.2 155.5155.5 708.4708.4 LUMLUM 66.366.3 99.799.7 8958.68958.6 MAN2B2MAN2B2 95.895.8 228.3228.3 600.1600.1 MAOAMAOA 300.5300.5 123123 1967.41967.4 MEP1AMEP1A 83.383.3 8585 1498.51498.5 METTL7BMETTL7B 133.1133.1 128.3128.3 925.6925.6 MFAP4MFAP4 219219 286.3286.3 7673.87673.8 MGC16121MGC16121 115.3115.3 85.185.1 10401040 MGPMGP 6262 68.368.3 1517.51517.5 MST1MST1 557557 937937 36653665 MTTPMTTP 58.558.5 58.758.7 583.9583.9 MUM1L1MUM1L1 88.488.4 64.364.3 693.5693.5 MVPMVP 127127 98.198.1 1218.51218.5 NEK6NEK6 96.996.9 345.4345.4 878.3878.3 NEU1NEU1 567.9567.9 1309.61309.6 8035.28035.2 NOPENOPE 159.9159.9 238238 1067.71067.7 NPC1L1NPC1L1 65.565.5 9898 1162.61162.6 NPYNPY 130.6130.6 73.373.3 864864 NR2F2NR2F2 86.786.7 95.395.3 584.6584.6 OAFOAF 118.4118.4 110110 15071507 ODC1ODC1 1594.61594.6 2484.32484.3 15057.615057.6 OLR1OLR1 68.268.2 265.8265.8 1804.41804.4 ORM1ORM1 62.462.4 63.463.4 492.2492.2 PCDH7PCDH7 80.880.8 277.7277.7 808.7808.7 PCSK5PCSK5 322322 158.5158.5 19221922 PDGFRAPDGFRA 120.2120.2 257.7257.7 1420.21420.2 PDGFRBPDGFRB 162.8162.8 133.7133.7 2305.92305.9 PGCPPGCP 83.483.4 80.380.3 1292.31292.3 PID1PID1 139.3139.3 81.481.4 848.4848.4 PLA1APLA1A 59.159.1 57.857.8 442442 PLA2G12BPLA2G12B 83.883.8 128.6128.6 14231423 PLA2G1BPLA2G1B 59.959.9 60.660.6 2828.52828.5 PLA2G2APLA2G2A 79.679.6 65.765.7 1016.71016.7 PLATPLAT 8383 73.373.3 1690.41690.4 PLEK2PLEK2 8888 97.697.6 605.8605.8 PLOD1PLOD1 1132.71132.7 3910.13910.1 7808.37808.3 PMP22PMP22 96.696.6 293.7293.7 656.7656.7 PPICPPIC 748.2748.2 419.2419.2 5414.35414.3 PROK1PROK1 62.562.5 60.660.6 445.4445.4 PROS1PROS1 146.1146.1 434434 5435.85435.8 PRSS12PRSS12 160.6160.6 103.2103.2 1485.71485.7 PRSS3PRSS3 79.879.8 80.480.4 714714 PTGDSPTGDS 104.9104.9 144.8144.8 5027.75027.7 RAB7BRAB7B 72.972.9 56.256.2 422.6422.6 RAMP1RAMP1 65.765.7 66.366.3 2519.62519.6 RASD1RASD1 227.3227.3 130130 3124.33124.3 RBP2RBP2 75.275.2 80.480.4 514.7514.7 RBP4RBP4 64.164.1 61.461.4 5875.95875.9 RDH5RDH5 114114 99.199.1 780.5780.5 REEP1REEP1 137.3137.3 78.278.2 3738.53738.5 REEP6REEP6 420.6420.6 738738 4868.44868.4 RFTN1RFTN1 188.7188.7 105.9105.9 1421.21421.2 RGL1RGL1 109.5109.5 105.5105.5 2128.92128.9 RIN2RIN2 71.371.3 111.6111.6 455.8455.8 RNASE4RNASE4 217.3217.3 250.7250.7 2194.52194.5 RNF103RNF103 275.1275.1 440.5440.5 2143.42143.4 RSPO3RSPO3 135.6135.6 235.6235.6 1487.71487.7 S100A14S100A14 78.678.6 85.185.1 540.5540.5 S100A6S100A6 546.8546.8 777.9777.9 8768.88768.8 SAMD5SAMD5 58.158.1 146.1146.1 491.5491.5 SAT1SAT1 2022.92022.9 913.2913.2 15235.915235.9 SC5DLSC5DL 960960 1043.71043.7 8306.28306.2 SCG2SCG2 64.564.5 58.258.2 1269.81269.8 SCGB2A1SCGB2A1 57.357.3 66.666.6 738.9738.9 SEPP1SEPP1 135.1135.1 80.980.9 2816.82816.8 SERPINA1SERPINA1 67.467.4 67.667.6 1128911289 SERPINA3SERPINA3 59.359.3 58.258.2 13404.713404.7 SERPINA5SERPINA5 96.396.3 85.785.7 1719.31719.3 SERPINA7SERPINA7 62.562.5 61.361.3 64906490 SERPINC1SERPINC1 58.858.8 86.786.7 1367.11367.1 SERPIND1SERPIND1 63.963.9 59.159.1 1061.91061.9 SERPINF1SERPINF1 112.6112.6 85.985.9 18191819 SERPINF2SERPINF2 93.693.6 72.672.6 2397.52397.5 SFTPDSFTPD 177.9177.9 253.9253.9 2498.52498.5 SGKSGK 593.2593.2 199.5199.5 4714.74714.7 SHBGSHBG 86.886.8 9898 653.5653.5 SIL1SIL1 153.6153.6 517.2517.2 1598.11598.1 SLC10A1SLC10A1 56.256.2 59.759.7 735.1735.1 SLC1A3SLC1A3 241.2241.2 340340 1416.81416.8 SLC22A18SLC22A18 179.3179.3 296.9296.9 1086.61086.6 SLC31A2SLC31A2 94.594.5 175.2175.2 771.6771.6 SLC3A1SLC3A1 66.666.6 67.667.6 719.3719.3 SLC40A1SLC40A1 67.667.6 259.5259.5 1358.61358.6 SLC44A3SLC44A3 145.2145.2 98.198.1 970.9970.9 SLC46A1SLC46A1 75.175.1 83.583.5 561.8561.8 SLC7A4SLC7A4 76.376.3 7373 1372.41372.4 SLCO2B1SLCO2B1 71.471.4 82.182.1 2962.32962.3 SLIT2SLIT2 163.2163.2 142142 1625.81625.8 SLIT3SLIT3 60.360.3 129.8129.8 971.6971.6 SLNSLN 68.268.2 72.272.2 900.7900.7 SLPISLPI 63.963.9 67.267.2 1680.41680.4 SMPDL3ASMPDL3A 99.299.2 96.196.1 731.4731.4 SNAI2SNAI2 80.280.2 72.572.5 1369.31369.3 SPARCSPARC 950.5950.5 1345.51345.5 9076.89076.8 SPINK1SPINK1 125.2125.2 108.3108.3 2565525655 SPON2SPON2 70.770.7 82.682.6 2035.72035.7 SPSB1SPSB1 160.8160.8 409.2409.2 2026.82026.8 SRPX2SRPX2 76.476.4 80.880.8 1454.71454.7 STARD10STARD10 312.9312.9 884.8884.8 2536.52536.5 SULT2A1SULT2A1 57.657.6 68.468.4 831.8831.8 SUSD1SUSD1 214.1214.1 366.2366.2 1263.61263.6 SVEP1SVEP1 103103 149.8149.8 4034.14034.1 TACSTD2TACSTD2 178.4178.4 162.4162.4 3159.43159.4 TDO2TDO2 56.656.6 60.660.6 1018.41018.4 TEKTEK 134.9134.9 113.8113.8 2872.82872.8 TFTF 71.971.9 62.862.8 23565.923565.9 TFF1TFF1 60.960.9 140.7140.7 1959.41959.4 TFF3TFF3 87.187.1 132.1132.1 1359.11359.1 TFPITFPI 277.7277.7 129.2129.2 2129.32129.3 TGFBITGFBI 389.3389.3 174.8174.8 14969.514969.5 TGFBR2TGFBR2 164.7164.7 180.6180.6 935.8935.8 TGFBR3TGFBR3 149.8149.8 211.9211.9 3353.93353.9 TICAM1TICAM1 88.188.1 102.4102.4 630.4630.4 TIMP1TIMP1 2397.62397.6 3631.93631.9 28393.528393.5 TIMP3TIMP3 72.772.7 196.8196.8 430.8430.8 TM4SF1TM4SF1 100100 101.6101.6 12424.512424.5 TM4SF4TM4SF4 56.356.3 58.158.1 985.9985.9 TM4SF5TM4SF5 59.559.5 84.184.1 1328.11328.1 TMBIM1TMBIM1 140.5140.5 503.7503.7 1035.21035.2 TMEM119TMEM119 59.359.3 6565 3545.13545.1 TMEM140TMEM140 95.995.9 99.699.6 570570 TMEM62TMEM62 121121 304.7304.7 1193.31193.3 TMPRSS6TMPRSS6 58.758.7 6060 419.3419.3 TPP1TPP1 619.3619.3 914.4914.4 3925.23925.2 TRPV6TRPV6 64.864.8 9191 401.5401.5 TSC22D3TSC22D3 163.3163.3 9090 971.9971.9 TTC13TTC13 150.7150.7 279.1279.1 905.4905.4 TTRTTR 82.682.6 93.593.5 35003.235003.2 UBDUBD 70.870.8 62.162.1 2103.62103.6 UGT2B10UGT2B10 56.256.2 61.761.7 549.8549.8 UGT2B11UGT2B11 65.965.9 68.168.1 8998.88998.8 UGT2B28UGT2B28 60.660.6 65.365.3 2560.82560.8 UGT2B7UGT2B7 63.863.8 61.161.1 10834.610834.6 UGT3A1UGT3A1 100.5100.5 107.7107.7 705.6705.6 VCAM1VCAM1 65.865.8 65.865.8 1462.61462.6 VIL1VIL1 94.694.6 312.7312.7 820.4820.4 VSIG2VSIG2 7878 69.969.9 1016.91016.9 VTNVTN 61.761.7 225.5225.5 2493024930 ZBTB16ZBTB16 62.462.4 64.464.4 406.3406.3 ZBTB20ZBTB20 85.185.1 78.278.2 496.4496.4 ZFHX3ZFHX3 128.6128.6 426.6426.6 834.9834.9 ZG16ZG16 63.463.4 60.860.8 759.1759.1 ZNF702ZNF702 105.3105.3 409.9409.9 849.8849.8

배아 줄기 세포에서 간세포로 분화하는 동안 During differentiation from embryonic stem cells to hepatocytes DNADNA 메틸화의 프로파일링 Profiling of methylation

각 단계에서 DNA 메틸화 마커 후보를 찾기 위하여, 폭넓게 사용되는 중아황산염(bisulfite)-기초 비드 어레이인, 인피니엄 어레이에서 27,578 CpG 위치들의 메틸화 상태를 분석하였다(Bibikova M. et al., Genome Res 2006;16:1075-1083).
To find candidate DNA methylation markers at each step, the methylation status of 27,578 CpG positions in the Infinium array, a widely used bisulfite-based bead array, was analyzed (Bibikova M. et. al ., Genome Res 2006; 16: 1075-1083).

<3-1> <3-1> 인피니엄Infinium 인간메틸화27Human Methylation27 비드칩( Bead Chips InfiniumInfinium HumanMethylation27HumanMethylation27 BeadChipBeadChip )으로 메틸화 분석Methylation analysis

배아 줄기 세포(배아 줄기 세포(ES)), 내배엽 전구체(내배엽 전구체(EP)), 및 성숙한 간세포(성숙한 간세포(MH))의 메틸화 분석은 3회 반복 실험하였다. 각 시료에서 게놈 DNA(1 ㎍)은 EZ DNA 메틸화 키트(Zymo Research, Orange, CA)를 사용하여 중아황산염(bisulfite)으로 변형시키고, 변형된 DNA 200 ng 을 증폭에 사용하였다. 증폭된 DNA는 인피니엄 인간메틸화27 비드칩(Infinium HumanMethylation27 BeadChip, Illumina)를 혼성화하고, 잘 알려진 14,495 이상의 유전자에서 선별된 27,578 CpG 위치의 메틸화 상태를 분석하였다. 어레이는 비드어레이 리더(BeadArray Reader)를 사용하여 이미지화하고, 일루미나(Illumina) 사의 안내에 따라 이미지 프로세싱 및 인텐시티 데이타(intensity data)의 추출을 수행하였다. 각 메틸화 신호는 β 값으로 계산하고, 이는 0(완전히 메틸화되지 않은 시토신)에서 1(완전히 메틸화된 시토신)의 범위로 DNA 메틸화의 정량적인 값으로 계산되었다(Bibikova M. et al., Genome Res 2006;16:1075-1083).
Methylation analysis of embryonic stem cells (embryonic stem cells (ES)), endoderm precursors (endodermal precursors (EP)), and mature hepatocytes (mature hepatocytes (MH)) was repeated three times. Genomic DNA (1 μg) in each sample was modified with bisulfite using the EZ DNA Methylation Kit (Zymo Research, Orange, Calif.), And 200 ng of the modified DNA was used for amplification. The amplified DNA hybridized Infinium HumanMethylation27 BeadChip, Illumina and analyzed the methylation status of 27,578 CpG positions selected from 14,495 or more well-known genes. Arrays were imaged using a BeadArray Reader and image processing and extraction of intensity data were performed as directed by Illumina. Each methylation signal is calculated as a β value, which is calculated as a quantitative value of DNA methylation ranging from 0 (not fully methylated cytosine) to 1 (fully methylated cytosine) (Bibikova M. et. al ., Genome Res 2006; 16: 1075-1083).

<3-2> <3-2> 파이로시퀀싱Pyrosequencing 분석( analysis( PyrosequencingPyrosequencing AnalysisAnalysis ).).

파이로시퀀싱은 Kim M. et al., Cancer Res 2008;68:7147-7155에서 설명한 바와 같이 수행하였다. 프라이머들은 PSQ 분석 디자인(Biotage AB, Kungsgatan, Sweden; 표 1)으로 고안하였다.Pyro sequencing was performed as described in Kim M. et al., Cancer Res 2008; 68: 7147-7155. Primers were designed with the PSQ assay design (Biotage AB, Kungsgatan, Sweden; Table 1).

중아황산염(bisulfite)-변형된 DNA (EZ DNA methylation kit; Zymo Research)를 프라이머 세트와 f-Taq 중합효소(Solgent, Daejeon, Korea)를 포함하여 총량 25-μL로 증폭시켰다. 파이로시퀀싱 반응은 PSQ HS 96A 시스템 (Biotage AB)으로 수행하였다.
Bisulfite-modified DNA (EZ DNA methylation kit; Zymo Research) was amplified in a total amount of 25-μL including primer set and f-Taq polymerase (Solgent, Daejeon, Korea). Pyro sequencing reactions were performed with the PSQ HS 96A system (Biotage AB).

파이로시퀀싱을 위한 프라이머Primers for Pyro Sequencing 번호number 유전자gene 정방향 프라이머(5'-3')Forward primer (5'-3 ') 역방향 프라이머(5'-3')Reverse primer (5'-3 ') 시퀀싱 프라이머(5'-3')Sequencing Primer (5'-3 ') 1One POU5F1POU5F1 GGAAGGTATAAGGGAGTA (서열번호: 49)GGAAGGTATAAGGGAGTA (SEQ ID NO .: 49) Biotin-CACACCTCCATATTCTTC
(서열번호: 50)
Biotin-CACACCTCCATATTCTTC
(SEQ ID NO: 50)
TGTTGATGTATTGAGGGAT
(서열번호: 51)
TGTTGATGTATTGAGGGAT
(SEQ ID NO: 51)
22 DPPA2DPPA2 Biotin-TTTAAAGTATTAGGGGTTATAT
(서열번호: 52)
Biotin-TTTAAAGTATTAGGGGTTATAT
(SEQ ID NO: 52)
CTAAATACAACCCTCTAAAAT
(서열번호: 53)
CTAAATACAACCCTCTAAAAT
(SEQ ID NO: 53)
AATACAACCAAAAAAACACT
(서열번호: 54)
AATACAACCAAAAAAACACT
(SEQ ID NO: 54)
33 DPEP3DPEP3 GTTTAGGAGTTGGGTATAAGT
(서열번호: 55)
GTTTAGGAGTTGGGTATAAGT
(SEQ ID NO: 55)
Biotin-CCAAAAATCTTCCTAATC
(서열번호: 56)
Biotin-CCAAAAATCTTCCTAATC
(SEQ ID NO: 56)
TTTAGGAGTTGGGTATAAGT
(서열번호: 57)
TTTAGGAGTTGGGTATAAGT
(SEQ ID NO: 57)
44 SLC15A3SLC15A3 Biotin-AATGGTTGAGTGTGATTAAA
(서열번호: 58)
Biotin-AATGGTTGAGTGTGATTAAA
(SEQ ID NO: 58)
CCAAAATTCCACTTTTAC
(서열번호: 59)
CCAAAATTCCACTTTTAC
(SEQ ID NO: 59)
TCTTCCAATCAAACTCC
(서열번호: 60)
TCTTCCAATCAAACTCC
(SEQ ID NO: 60)
55 USP44USP44 GTATAGAAAGGGAGTAAGTGT
(서열번호: 61)
GTATAGAAAGGGAGTAAGTGT
(SEQ ID NO: 61)
Biotin-CCCCAACAATACATTATTA
(서열번호: 62)
Biotin-CCCCAACAATACATTATTA
(SEQ ID NO: 62)
AGGGAGTAAGTGTATAGTTT
(서열번호: 63)
AGGGAGTAAGTGTATAGTTT
(SEQ ID NO: 63)
66 LECT1LECT1 AATGGTTTTTAGTTAGTTGT
(서열번호: 64)
AATGGTTTTTAGTTAGTTGT
(SEQ ID NO: 64)
Biotin-CCAAAAAAATACTCAAATAC
(서열번호: 65)
Biotin-CCAAAAAAATACTCAAATAC
(SEQ ID NO: 65)
AGTTAGTTGTTATAGTAGAG
(서열번호: 66)
AGTTAGTTGTTATAGTAGAG
(SEQ ID NO: 66)
77 GATA4GATA4 GGTTAAGGAAAAGAGAGAA
(서열번호: 67)
GGTTAAGGAAAAGAGAGAA
(SEQ ID NO: 67)
Biotin-CCAAAAACTCCTAACCTTATA
(서열번호: 68)
Biotin-CCAAAAACTCCTAACCTTATA
(SEQ ID NO: 68)
TATATTTAGTAGTGTAAAAA
(서열번호: 69)
TATATTTAGTAGTGTAAAAA
(SEQ ID NO: 69)
88 CER1CER1 TTTGTTTGGTTATTGATTAT
(서열번호: 70)
TTTGTTTGGTTATTGATTAT
(SEQ ID NO: 70)
Biotin-AAACCCAAACTTCTTTTATA
(서열번호: 71)
Biotin-AAACCCAAACTTCTTTTATA
(SEQ ID NO: 71)
TTGATTATTTGTTTTTTTAT
(서열번호: 72)
TTGATTATTTGTTTTTTTAT
(SEQ ID NO: 72)
99 MIXL1MIXL1 AGTTTTGATGAGGATAGA
(서열번호: 73)
AGTTTTGATGAGGATAGA
(SEQ ID NO: 73)
Biotin-CCACAAAACTCTCTTCTC
(서열번호: 74)
Biotin-CCACAAAACTCTCTTCTC
(SEQ ID NO: 74)
TATAGGTTAGGTAAGGTGTT
(서열번호: 75)
TATAGGTTAGGTAAGGTGTT
(SEQ ID NO: 75)
1010 LEFTY1LEFTY1 TGGGGTATAATTATGTTTTG
(서열번호: 76)
TGGGGTATAATTATGTTTTG
(SEQ ID NO: 76)
Biotin-CCCCTAACAACCAAATAT
(서열번호: 77)
Biotin-CCCCTAACAACCAAATAT
(SEQ ID NO: 77)
TGAGTTATTGTAAATAGAAG
(서열번호: 78)
TGAGTTATTGTAAATAGAAG
(SEQ ID NO: 78)
1111 VWFVWF TAGTAGTGGGGATTTTATAG
(서열번호: 79)
TAGTAGTGGGGATTTTATAG
(SEQ ID NO: 79)
Biotin-TACCTTCCCCTACAAATA
(서열번호: 80)
Biotin-TACCTTCCCCTACAAATA
(SEQ ID NO: 80)
ATGGTTTAGGGTGGG
(서열번호: 81)
ATGGTTTAGGGTGGG
(SEQ ID NO: 81)
1212 LEFTY2LEFTY2 Biotin-GTGATTGTAAAGGTATTTG
(서열번호: 82)
Biotin-GTGATTGTAAAGGTATTTG
(SEQ ID NO: 82)
AACCTACACTCCTTACAC
(서열번호: 83)
AACCTACACTCCTTACAC
(SEQ ID NO: 83)
CAAAAATCCCTCAAAATTAT
(서열번호: 84)
CAAAAATCCCTCAAAATTAT
(SEQ ID NO: 84)
1313 AFPAFP TTTTGTAGTTTGAGGAGAATAT
(서열번호: 85)
TTTTGTAGTTTGAGGAGAATAT
(SEQ ID NO: 85)
Biotin-TTTACCAATAATTAACAACAT
(서열번호: 86)
Biotin-TTTACCAATAATTAACAACAT
(SEQ ID NO: 86)
TTTGAATATAAAATATAAAT
(서열번호: 87)
TTTGAATATAAAATATAAAT
(SEQ ID NO: 87)
1414 SERPINA3SERPINA3 Biotin-TATTTGAGTAGGTTTAATAAGTT
(서열번호: 88)
Biotin-TATTTGAGTAGGTTTAATAAGTT
(SEQ ID NO: 88)
CAAAACAACCAAATATTCTA
(서열번호: 89)
CAAAACAACCAAATATTCTA
(SEQ ID NO: 89)
CAACCAAATATTCTATTCTC
(서열번호: 90)
CAACCAAATATTCTATTCTC
(SEQ ID NO: 90)
1515 APOA4APOA4 Biotin-TAGGGTTATAAAAGTTTAAGA
(서열번호: 91)
Biotin-TAGGGTTATAAAAGTTTAAGA
(SEQ ID NO: 91)
TCCTCCTTCCTCAATATA
(서열번호: 92)
TCCTCCTTCCTCAATATA
(SEQ ID NO: 92)
CCTTCCTCAATATAACTCC
(서열번호: 93)
CCTTCCTCAATATAACTCC
(SEQ ID NO: 93)
1616 KNG1KNG1 Biotin-TGGTTTTGTAAAAGTTATAG
(서열번호: 94)
Biotin-TGGTTTTGTAAAAGTTATAG
(SEQ ID NO: 94)
CCAAAAATTAAATAACTCT
(서열번호: 95)
CCAAAAATTAAATAACTCT
(SEQ ID NO: 95)
CATTTACATTTAAAAATCAC
(서열번호: 96)
CATTTACATTTAAAAATCAC
(SEQ ID NO: 96)
1717 VTNVTN Biotin-AGGTTGAGTAAATAGAGTAGT
(서열번호: 97)
Biotin-AGGTTGAGTAAATAGAGTAGT
(SEQ ID NO: 97)
AACTCTAATCTCCCTAAAA
(서열번호: 98)
AACTCTAATCTCCCTAAAA
(SEQ ID NO: 98)
CTCTAATCTCCCTAAAATCT
(서열번호: 99)
CTCTAATCTCCCTAAAATCT
(SEQ ID NO: 99)
1818 SULT2A1SULT2A1 Biotin-TGTTGGGATAAGGTTAAA
(서열번호: 100)
Biotin-TGTTGGGATAAGGTTAAA
(SEQ ID NO: 100)
TCCCTTATCACAAACTCA
(서열번호: 101)
TCCCTTATCACAAACTCA
(SEQ ID NO: 101)
CCTTCAAACCATAAAAAATC
(서열번호: 102)
CCTTCAAACCATAAAAAATC
(SEQ ID NO: 102)

배아 줄기 세포(Embryonic stem cells ( ESES )-, 내배엽 전구체(), Endoderm precursor ( EPEP )-, 및 성숙한 간세포(), And mature hepatocytes ( MHMH )-특이적으로 발현되고 ) -Specifically expressed 탈메틸화Demethylation 유전자 gene

<4-1> 배아 줄기 세포(ES)-특이적으로 발현되고 탈메틸화 유전자<4-1> Embryonic Stem Cell (ES) -Specifically Expressed and Demethylated Gene

클러스터 1에서 67개의 유전자의 유전자 온톨로지(ontology) 분석은 이들 유전자가 핵산 대사, 발생, 및 mRNA 전사와 관련되어 있다는 것을 나타낸다(도 2A). 67 개의 유전자들 중에, 마이크로어레이 데이타에서 mRNA 발현과 CpG 메틸화간의 중요한 음성적 상관관계를 보여주는 16개의 배아 줄기 세포(ES) 특이적 마커를 확인하였다(컷오프 R < 0.3, P < 0.05; 표 6).
Gene ontology analysis of 67 genes in cluster 1 shows that these genes are involved in nucleic acid metabolism, development, and mRNA transcription (FIG. 2A). Of the 67 genes, 16 embryonic stem cell (ES) specific markers were identified in the microarray data showing a significant negative correlation between mRNA expression and CpG methylation (cutoff R <0.3, P <0.05; Table 6).

ES 마커들의 mRNA 발현과 CpG 메틸화 간의 상관관계Correlation Between mRNA Expression and CpG Methylation of ES Markers 유전
자명
heredity
cipher

설명

Explanation
mRNA 발현mRNA expression CpG 메틸화CpG methylation
R

R

P

P

CpG ID

CpG ID
염색체
위치
chromosome
location
ESES EPEP MHMH ESES EPEP MHMH POU5F1POU5F1 POU class 5 homeobox 1POU class 5 homeobox 1 3957.23957.2 160.6160.6 68.268.2 0.335490.33549 0.736750.73675 0.877320.87732 -0.96265-0.96265 5.12E-225.12E-22 cg13083810cg13083810 chr6:31247135chr6: 31247135 DPPA2DPPA2 developmental pluripotency associated 2developmental pluripotency associated 2 10091009 138.5138.5 66.866.8 0.174640.17464 0.426810.42681 0.61390.6139 -0.81367-0.81367 5.29E-105.29E-10 cg11759378cg11759378 chr3:110518159chr3: 110518159 DPEP3DPEP3 dipeptidase 3dipeptidase 3 791.8791.8 84.784.7 79.779.7 0.287140.28714 0.521140.52114 0.680320.68032 -0.75527-0.75527 4.25E-084.25E-08 cg21695020cg21695020 chr16:66572127chr16: 66572127 SLC15A3SLC15A3 solute carrier family 15, member 3solute carrier family 15, member 3 605.3605.3 88.388.3 87.587.5 0.344920.34492 0.562890.56289 0.635290.63529 -0.7225-0.7225 3.03E-073.03E-07 cg26980692cg26980692 chr11:60476523chr11: 60476523 USP44USP44 ubiquitin specific peptidase 44ubiquitin specific peptidase 44 837.2837.2 63.663.6 61.761.7 0.02090.0209 0.317810.31781 0.573370.57337 -0.70251-0.70251 8.81E-078.81E-07 cg04488758cg04488758 chr12:94469497chr12: 94469497 SOX2SOX2 SRY (sex determining region Y)-box 2SRY (sex determining region Y) -box 2 29672967 96.496.4 99.999.9 0.10250.1025 0.137440.13744 0.195870.19587 -0.51823-0.51823 0.000860.00086 cg15105987cg15105987 chr3:182913011chr3: 182913011 MT1FMT1F metallothionein 1Fmetallothionein 1F 1762.51762.5 195.1195.1 135135 0.209390.20939 0.230360.23036 0.24840.2484 -0.51188-0.51188 0.001020.00102 cg00728317cg00728317 chr16:55249534chr16: 55249534 CRABP1CRABP1 cellular retinoic acid binding protein 1cellular retinoic acid binding protein 1 3575.43575.4 356.1356.1 60.560.5 0.064060.06406 0.08260.0826 0.108660.10866 -0.41881-0.41881 0.008870.00887 cg20550118cg20550118 chr15:76420717chr15: 76420717 LECT1LECT1 leukocyte cell derived chemotaxin 1leukocyte cell derived chemotaxin 1 3634.93634.9 84.584.5 75.575.5 0.281220.28122 0.422890.42289 0.515760.51576 -0.41691-0.41691 0.0092160.009216 cg22398616cg22398616 chr13:52212204chr13: 52212204 VGFVGF VGF nerve growth factor inducibleVGF nerve growth factor inducible 2282.52282.5 185.3185.3 102102 0.045530.04553 0.056810.05681 0.079230.07923 -0.41143-0.41143 0.010280.01028 cg04084157cg04084157 chr7:100595769chr7: 100595769 SFRP2SFRP2 secreted frizzled related protein 2secreted frizzled related protein 2 881.5881.5 80.180.1 7777 0.018370.01837 0.037330.03733 0.031540.03154 -0.36316-0.36316 0.0250250.025025 cg23910835cg23910835 chr4:154930350chr4: 154930350 MYCNMYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 32313231 557.3557.3 148148 0.03060.0306 0.031660.03166 0.032990.03299 -0.3392-0.3392 0.0372220.037222 cg02204046cg02204046 chr2:15998211chr2: 15998211 UTF1UTF1 undifferentiated embryonic cell transcription factor 1undifferentiated embryonic cell transcription factor 1 446.7446.7 64.564.5 55.655.6 0.027210.02721 0.02440.0244 0.028490.02849 -0.33842-0.33842 0.0376870.037687 cg09053680cg09053680 chr10:134894104chr10: 134894104 CHST4CHST4 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4carbohydrate (N-acetylglucosamine 6- O ) sulfotransferase 4 1015.11015.1 103.7103.7 69.869.8 0.052390.05239 0.061470.06147 0.049310.04931 -0.33092-0.33092 0.0424220.042422 cg00840403cg00840403 chr16:70117706chr16: 70117706 PRDM14PRDM14 PR domain containing 14PR domain containing 14 1277.91277.9 82.182.1 64.264.2 0.03610.0361 0.043730.04373 0.056230.05623 -0.32901-0.32901 0.0437040.043704 cg10457247cg10457247 chr8:71145633chr8: 71145633 MT1GMT1G metallothionein 1Gmetallothionein 1G 5806.65806.6 98.598.5 75.875.8 0.071380.07138 0.142670.14267 0.198870.19887 -0.31793-0.31793 0.0379810.037981 cg09985279cg09985279 chr16:55259635chr16: 55259635

<도 4A>는 분화 과정 동안 16개의 배아 줄기 세포(ES)-특이적 마커의 mRNA 발현 및 CpG 메틸화 패턴을 보여준다. 상세히 살펴보면, 미분화 상태의 유지 및 배아 줄기 세포(ES)의 증식에 기능을 하는(Du J. et al., J Biochem 2010;147;265-271), DPPA2 (developmental pluripotency associated 2); 디펩티다제(dipeptidases)의 족에 속하는 막-결합 단백질인(Habib GM. et al., Faseb J 2003;17:1313-1315), dipeptidases; 양성자 올리고펩티드 공동수송체(a proton oligopeptide cotransporter)(Daniel H. et al., Pflugers Arch 2004;447:610-618)인, SLC15A3 (solute carrier family 15 member 3); 세포 주기를 조절하는 데 핵심적 역할을 하는 탈유비키틴화(deubiquitinating) 효소인(Stegmeier F. et al., Nature 2007;446:876-881), USP44 (ubiquitin specific peptidase 44); 및 자기재생(selfrenewal) 및 만능(pluripotent) 분화에 관련된(Li SS. et al., Stem Cells Dev 2006;15:532-555), LECT1 (leukocyte cell derived chemotaxin 1)을 확인하였다. 각각, qRT-PCR 분석(도 4B) 및 파이로서열분석(도 4C)을 사용하여 배아 줄기 세포(ES), 내배엽 전구체(EP), 및 성숙한 간세포(MH)에서 이 유전자들의 mRNA 발현과 DNA 메틸화 수준을 입증하였고; 이 유전자들의 mRNA 발현과 DNA 메틸화는 마이크로어레이 데이타에 부합된다.
4A shows mRNA expression and CpG methylation patterns of 16 embryonic stem cell (ES) -specific markers during the differentiation process. In detail, it functions to maintain undifferentiated state and to proliferate embryonic stem cells (ES) (Du J. et. al ., J Biochem 2010; 147; 265-271), developmental pluripotency associated 2); Habib GM. Et , a membrane-binding protein belonging to the family of dipeptides al ., Faseb J 2003; 17: 1313-1315), dipeptidases; Proton oligopeptide cotransporter (Daniel H. et al ., SLC15A3 (solute carrier family 15 member 3), Pflugers Arch 2004; 447: 610-618; A deubiquitinating enzyme that plays a key role in regulating the cell cycle (Stegmeier F. et al ., Nature 2007; 446: 876-881), USP44 (ubiquitin specific peptidase 44); And related to selfrenewal and pluripotent differentiation (Li SS. Et . al ., Stem Cells Dev 2006; 15: 532-555), LECT1 (leukocyte cell derived chemotaxin 1) was identified. MRNA expression and DNA methylation of these genes in embryonic stem cells (ES), endoderm precursors (EP), and mature hepatocytes (MH), respectively, using qRT-PCR analysis (FIG. 4B) and pyrosequencing (FIG. 4C). Proven levels; MRNA expression and DNA methylation of these genes correspond to microarray data.

<4-2> 내배엽 전구체(EP)-특이적으로 발현되고 탈메틸화 유전자<4-2> Endoderm Precursor (EP) -Specifically Expressed and Demethylated Genes

클러스터 2에서 83개의 유전자의 유전자 온톨로지(ontology) 분석은 이들 유전자가 신호 전달, 발생, 배 발생(embryogenesis), 세포 커뮤니케이션, 및 절편 분화(segment specification)와 관련되어 있다는 것을 나타낸다(도 2B). 83 개의 유전자들 중에, 마이크로어레이 데이타에서 mRNA 발현과 CpG 메틸화간의 중요한 음성적 상관관계를 보여주는 11개의 내배엽 전구체(EP)특이적 메틸화 마커를 확인하였다(컷오프 R < 0.3, P < 0.05; 표 7).
Genetic ontology analysis of 83 genes in cluster 2 indicates that these genes are involved in signal transduction, development, embryoogenesis, cellular communication, and segment specification (FIG. 2B). Of the 83 genes, 11 endoderm precursor (EP) specific methylation markers were identified in the microarray data showing a significant negative correlation between mRNA expression and CpG methylation (cutoff R <0.3, P <0.05; Table 7).

EP 마커들의 mRNA 발현과 CpG 메틸화 간의 상관관계Correlation Between mRNA Expression and CpG Methylation of EP Markers 유전
자명
heredity
cipher

설명

Explanation
mRNA 발현mRNA expression CpG 메틸화CpG methylation
R

R

P

P

CpG ID

CpG ID
염색체
위치
chromosome
location
ESES EPEP MHMH ESES EPEP MHMH CER1CER1 cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) 69.869.8 9835.59835.5 66.466.4 0.334590.33459 0.117520.11752 0.458960.45896 -0.64268-0.64268 1.36E-051.36E-05 cg07926025cg07926025 chr9:14712864chr9: 14712864 GATA4GATA4 GATA binding protein 4GATA binding protein 4 62.162.1 564.9564.9 183.4183.4 0.48840.4884 0.333690.33369 0.846750.84675 -0.59-0.59 9.68E-059.68E-05 cg26020513cg26020513 chr8:11605765chr8: 11605765 MIXL1MIXL1 Mix1 homeobox-like 1 (Xenopus laevis)Mix1 homeobox-like 1 (Xenopus laevis) 7979 1987.91987.9 67.467.4 0.245660.24566 0.085980.08598 0.264480.26448 -0.58249-0.58249 0.0001250.000125 cg18354264cg18354264 chr1:224477631chr1: 224477631 LEFTY1LEFTY1 left-right determination factor 1left-right determination factor 1 304.1304.1 15090.915090.9 59.159.1 0.661510.66151 0.47890.4789 0.758570.75857 -0.55541-0.55541 0.0002950.000295 cg10774440cg10774440 chr1:224142776chr1: 224142776 VWFVWF von Willebrand factorvon Willebrand factor 84.784.7 17971797 73.173.1 0.732910.73291 0.45990.4599 0.72660.7266 -0.53763-0.53763 0.00050.0005 cg27347104cg27347104 chr12:6103918chr12: 6103918 NODALNODAL nodal homolog (mouse)nodal homolog (mouse) 242242 4890.64890.6 109.4109.4 0.080490.08049 0.08250.0825 0.157310.15731 -0.45385-0.45385 0.004210.00421 cg04377282cg04377282 chr10:71871423chr10: 71871423 DLX5DLX5 distal-less homeobox 5distal-less homeobox 5 64.264.2 1047.81047.8 74.974.9 0.102870.10287 0.086410.08641 0.127750.12775 -0.43668-0.43668 0.0061240.006124 cg06537230cg06537230 chr7:96491119chr7: 96491119 FOXC1FOXC1 forkhead box C1forkhead box C1 92.392.3 945.7945.7 116.9116.9 0.017940.01794 0.018980.01898 0.020430.02043 -0.40482-0.40482 0.0116990.011699 cg23867624cg23867624 chr6:1555196chr6: 1555196 KCNK12KCNK12 potassium channel, subfamily K, member 12potassium channel, subfamily K, member 12 1117.21117.2 14422.114422.1 1039.11039.1 0.020250.02025 0.024670.02467 0.021550.02155 -0.39211-0.39211 0.0149010.014901 cg27320127cg27320127 chr2:47651900chr2: 47651900 SOX17SOX17 SRY (sex determining region Y)-box 17SRY (sex determining region Y) -box 17 61.461.4 3116.63116.6 77.477.4 0.040240.04024 0.030650.03065 0.039590.03959 -0.36914-0.36914 0.0225650.022565 cg02919422cg02919422 chr8:55533097chr8: 55533097 LEFTY2LEFTY2 left-right determination factor 2left-right determination factor 2 339.5339.5 24852.624852.6 93.793.7 0.846230.84623 0.480960.48096 0.616150.61615 -0.36657-0.36657 0.0235950.023595 cg22462235cg22462235 chr1:224196104chr1: 224196104

도 5A는 분화 과정 동안 11개의 내배엽 전구체(EP)-특이적 마커의 mRNA 발현 및 CpG 메틸화 패턴을 보여준다. 이 11개의 마커들 중에서, 배아 줄기 세포(ES)의 분화와 관계되는 마디 신호전달 저해제(nodal signaling inhibitor)인(Katoh M. et al., Int J Mol Med 2006;17:795-799), CER1 (cerberus 1); 형태 발생(morphogenesis) 및 내배엽 분화에 중대한 역할을 하는(Hart AH. et al., Development 2002;129:3597-3608), MIXL1 (Mix1 homeobox-like 1); 초기 배 발생에서 좌-우 축 결정에 필요한(Meno C. et al., Cell 1998;94:287-297), LEFTY1 및 LEFTY2 (left-right determination factors 1 및 2); 및 내피하의(subendothelial) 콜라겐 및 혈소판의 결합 부위를 갖는 연쇄되고, 복합기능적인 단백질인(Kim J. et al., Nature 2010;466:992-995), VWF (von Willebrand factor)을 확인하였다. qRT-PCR 분석에 의한 이 유전자들의 mRNA 발현(도 5B) 및 파이로서열분석에 의한 DNA 메틸화 수준(도 5C)를 확인하였다.
 5A shows mRNA expression and CpG methylation patterns of 11 endoderm precursor (EP) -specific markers during differentiation. Of these eleven markers, the nodal signaling inhibitors involved in the differentiation of embryonic stem cells (ES) (Katoh M.meat get, Int J Mol Med 2006; 17: 795-799), CER1 (cerberus 1); Plays a critical role in morphogenesis and endoderm differentiation (Hart AH.meat get, Development 2002; 129: 3597-3608), MIXL1 (Mix1 homeobox-like 1); Required for Left-Right Axis Determination in Early Embryogenesis (Meno C.meat get, Cell 1998; 94: 287-297), LEFTY1 and LEFTY2 (left-right determination factors 1 and 2); And a chain, multifunctional protein having a binding site of subendothelial collagen and platelets (Kim J.meat get, Nature 2010; 466: 992-995), and VWF (von Willebrand factor). mRNA expression of these genes by qRT-PCR analysis (FIG. 5B) and DNA methylation levels by pyrosequence analysis (FIG. 5C) were confirmed.

<4-3> 성숙한 간세포(<4-3> mature liver cells ( MHMH )-특이적으로 발현되고 ) -Specifically expressed 탈메틸화Demethylation 유전자 gene

클러스터 3에서 375개의 유전자의 유전자 온톨로지(ontology) 분석은 이들 유전자가 면역 및 방어, 수송, 단백질 분해(proteolysis), 세포 커뮤니케이션, 지방산 대사, 및 세포 부착(cell adhesion)과 관련되어 있다는 것을 나타낸다(도 2C). 375 개의 유전자들 중에, 마이크로어레이 데이타에서 mRNA 발현과 CpG 메틸화간의 중요한 음성적 상관관계를 보여주는 40개의 성숙한 간세포(MH)특이적 메틸화 마커를 확인하였다(컷오프 R < 0.3, P < 0.05; 표 8).
Gene ontology analysis of 375 genes in cluster 3 shows that these genes are involved in immunity and defense, transport, proteolysis, cell communication, fatty acid metabolism, and cell adhesion (FIG. 2C). Of the 375 genes, 40 mature hepatocyte (MH) specific methylation markers were identified in the microarray data showing a significant negative correlation between mRNA expression and CpG methylation (cutoff R <0.3, P <0.05; Table 8).

Figure pat00001
Figure pat00001

Figure pat00002
Figure pat00002

Figure pat00003
Figure pat00003

Figure pat00004
Figure pat00004

Figure pat00005
Figure pat00005

도 6A는 분화 과정 동안 40개의 성숙한 간세포(MH)-특이적 마커의 mRNA 발현 및 CpG 메틸화 패턴을 보여준다. 상세히 살펴보면, 세린 프로테아제 저해제 유전자 패밀리(serine protease inhibitor gene family) 중의 하나인, SERPINA3 (serpin peptidase inhibitor A3); 지방 대사에 많은 역할을 하는(Tubb MR. et al., J Biol Chem 2007;282:28385-28394), APOA4 (apolipoprotein A4); 혈액 응집(blood coagulation)에 중요한 역할을 하는(Muller-Esterl W. Kininogens, kinins and kinships. Thromb Haemost 1989;61:2-6), KNG1 (kininogen 1); 세포 부착(cell adhesion) 및 퍼짐(spreading)을 촉진하는(Ragno P. et al., Cancer Res 1998;58:1315-1319), VTN (vitronectin); 및 간에서 스테로이드와 담즙 산(bile acids)의 황산화(sulfation)를 촉매하는(Chatterjee B. et al., Methods Enzymol 2005;400:165-191), SULT2A1 (sulfotransferase 2A1)을 확인하였다. qRT-PCR 분석에 의한 이 유전자들의 mRNA 발현(도 6B) 및 파이로서열분석에 의한 DNA 메틸화 수준(도 6C)를 확인하였다.
6A shows mRNA expression and CpG methylation patterns of 40 mature hepatocyte (MH) -specific markers during differentiation. In detail, SERPINA3 (serpin peptidase inhibitor A3), which is one of the serine protease inhibitor gene family; Plays a role in fat metabolism (Tubb MR. Et al ., J Biol Chem 2007; 282: 28385-28394), APOA4 (apolipoprotein A4); Plays an important role in blood coagulation (Muller-Esterl W. Kininogens, kinins and kinships. Thromb Haemost 1989; 61: 2-6), KNG1 (kininogen 1); Promote cell adhesion and spreading (Ragno P. et. al ., Cancer Res 1998; 58: 1315-1319), VTN (vitronectin); And catalyzes the sulfation of steroids and bile acids in the liver (Chatterjee B. et. al ., Methods Enzymol 2005; 400: 165-191), SULT2A1 (sulfotransferase 2A1). mRNA expression of these genes by qRT-PCR analysis (FIG. 6B) and DNA methylation levels by pyro sequencing (FIG. 6C) were confirmed.

배아 줄기 세포에서 간세포로 분화하는 동안 유전자 사이 부위의 역동적인 Dynamics of sites between genes during differentiation from embryonic stem cells to hepatocytes DNADNA 메틸화 변화 Methylation changes

또한 시험관 내(in vitro) 간세포 분화 과정 동안 전-게놈 DNA 메틸화 변화를 분석하기 위하여, 메틸화된 이중-가닥 DNA 단편들을 강화하는 MBD2 단백질의 메틸-CpG 결합 도메인을 사용하는 서열분석-기초 기술인, MBD-서열분석을 수행하였다(도 1B) (Harris RA. et al., Nat Biotechnol 2010).
MBD, a sequencing-based technique that also uses the methyl-CpG binding domain of the MBD2 protein to enhance methylated double-stranded DNA fragments, to analyze progenomic DNA methylation changes during in vitro hepatocyte differentiation Sequence analysis was performed (FIG. 1B) (Harris RA. Et al ., Nat Biotechnol 2010).

<5-1> <5-1> MBDMBD -서열 분석Sequence analysis

게놈 DNA는 네뷸라이저(nebulizer)(Illumina)로 1분 동안 가스 44 psi로 100-500 bp의 단편으로 만들고 그 후에 MethylMiner methylated DNA enrichment kit(Invitrogen) 를 사용하여 메틸화된 DNA를 농축시켰다. 간단하게 설명하면, 메틸화된 DNA는 1 ㎍ 분절된 게놈 DNA에서 마그네틱 다이나비드(magnetic Dynabeads)에 결합된 인간 MBD2 단백질의 메틸-CpG 결합 도메인에 결합시켜 침강시켰다. 그 후에 메틸화된 단편들을 고염 용출 완충액(Invitrogen)으로 용출시키고 Qiagen miniElute PCR 정제 키트로 정제하였다. 메틸화된 DNA 단편들을 일루미나 게놈 분석기(Illumina Genome Analyzer)로 서열을 분석하기 위해 어탭터에 라이게이션하였다. 라이게이션 산물은 2 % 아가로스 겔에서 전기영동하여 200300 bp 크기의 단편을 얻었고 PCR로 18 사이클로 증폭되었다. 클러스터 생산 및 72 사이클의 단일 해독 서열분석(single-read sequencing)을 하였다. 서열들은 일루미나 게놈 분석기 데이타 분석 파이프라인(Illumina Genome Analyzer data analysis pipeline)을 사용하여 인간 게놈에 위치를 파악하였다. 총 게놈을 200-bp 절편으로 나누고, 해독의 번호를 각 절편에 매겼다. 해독의 수는 총 해독 수에 대해 표준화되었다.Genomic DNA was made into fragments of 100-500 bp in gas 44 psi for 1 minute with nebulizer (Illumina) and then methylated DNA was concentrated using MethylMiner methylated DNA enrichment kit (Invitrogen). In brief, methylated DNA was precipitated by binding to the methyl-CpG binding domain of human MBD2 protein bound to magnetic Dynabeads in 1 μg segmented genomic DNA. Methylated fragments were then eluted with high salt elution buffer (Invitrogen) and purified with Qiagen miniElute PCR purification kit. Methylated DNA fragments were ligated to the adapter for sequence analysis with an Illumina Genome Analyzer. Ligation products were electrophoresed on 2% agarose gel to obtain 200300 bp sized fragments and amplified 18 cycles by PCR. Cluster production and 72 cycles of single read sequencing were performed. Sequences were located in the human genome using the Illumina Genome Analyzer data analysis pipeline. The total genome was divided into 200-bp fragments and the number of translations was numbered for each fragment. The number of detoxifications was normalized to the total number of detoxifications.

인피니엄 어레이(Infinium arrays)는 14,000개 이상의 유전자에 대한 고도로 재생할 수 있는 CpG 메틸화 데이타를 제공함에도 불구하고, 유전자 당 단지 하나 또는 몇개의 CpG 위치의 메틸화 상태를 보여준다. 배아 줄기 세포(ES), 내배엽 전구체(EP), 및 성숙한 간세포(MH)에서 전-게놈 DNA 메틸화를 프로파일하기 위하여, MBD-서열분석을 수행하였다. 전체 게놈을 200-bp 절편들(총 15,399,219 절편들)로 나누고 각 절편들간에 위치를 파악된 번역의 수를 세었다. 비드칩(BeadChip) 데이타로부터 CpG 메틸화 수준 및 매치된 절편에서 세어진 서열분석 번역의 비교는 좋은 상관관계를 보였다(배아 줄기 세포(ES)에서 R = 0.5223, P < 2.2E16; 내배엽 전구체(EP)에서 R = 0.4993, P < 2.2E16; 성숙한 간세포(MH)에서 R = 0.5331, P < 2.2E16). 과메틸화(hypermethylation) 및 저메틸화(hypomethylation)는 각각, 메틸화에서 2-배 증가 및 감소로 정의하였다. 배아 줄기 세포(ES)로부터 내배엽 전구체(EP)로의 분화하는 동안, 과메틸화(11.3%)는 저메틸화 (3.4 %)보다 좀더 빈번하였고, 반면에 내배엽 전구체(EP)로부터 성숙한 간세포(MH)로 분화하는 동안, 저메틸화 (10.4 %)가 과메틸화 (4.1 %)보다 좀더 빈번하였다(도 7A).Infinium arrays show methylation status of only one or several CpG positions per gene, despite providing highly reproducible CpG methylation data for more than 14,000 genes. To profile pre-genomic DNA methylation in embryonic stem cells (ES), endoderm precursors (EP), and mature hepatocytes (MH), MBD-sequencing was performed. The entire genome was divided into 200-bp fragments (15,399,219 fragments in total) and the number of translations located between each fragment was counted. The comparison of CpG methylation levels and sequencing translations counted in matched sections from the BeadChip data showed a good correlation (R = 0.5223, P <2.2E16 in embryonic stem cells (ES); endoderm precursor (EP)). R = 0.4993, P <2.2E16; in mature hepatocytes (MH) R = 0.5331, P <2.2E16). Hypermethylation and hypomethylation were defined as 2-fold increases and decreases in methylation, respectively. During differentiation from embryonic stem cells (ES) to endoderm precursors (EP), hypermethylation (11.3%) was more frequent than hypomethylation (3.4%), while differentiation from endoderm precursors (EP) to mature hepatocytes (MH) During this time, hypomethylation (10.4%) was more frequent than hypermethylation (4.1%) (FIG. 7A).

CpG 함량에 기초하여 과- 또는 저메틸화된 절편들의 특징을 조사하였다. 첫째로, UCSC hg18 어셈블리로부터 각 절편의 DNA 서열을 확보하고 모든 CpG 절편을 포함하였다. 그 다음에 전체 인간 게놈의 절편들(총 10,200,091 절편들)을 3개의 카테고리고 균등하게 나누었다: 높은-CpG 절편들(CpG 관찰/예측 비> 0.313), 낮은-CpG 절편들(CpG 관찰/예측 비< 0.180), 및 중간-CpG 절편들(도 7B). 예측된 것처럼, 높은-CpG 절편들이 분화하는 동안 가장 빈번한 메틸화 변화를 보였다(도 7C). 그러나 적어도 부분적으로는 그것들의 낮은 CpG 함량 때문에, 낮은-CpG 절편들이 불충분하게 표시된 것으로 생각된다.The characteristics of the over- or hypomethylated sections were investigated based on the CpG content. First, the DNA sequence of each fragment was obtained from the UCSC hg18 assembly and all CpG fragments were included. Sections of the entire human genome (10,200,091 fragments in total) were then divided into three categories and evenly: high-CpG fragments (CpG observation / prediction ratio> 0.313), low-CpG fragments (CpG observation / prediction ratio) <0.180), and mid-CpG fragments (FIG. 7B). As expected, the high-CpG fragments showed the most frequent methylation changes during differentiation (FIG. 7C). However, at least in part due to their low CpG content, it is believed that low-CpG fragments are insufficiently represented.

또한 과- 또는 저메틸화된 절편들이 게놈의 모습과 관련되는 지를 조사하였다. 프로모터 영역들은 전사 시작점의 2 kb 상류로 정의하였다. 메틸화 변화가 있는 대부분의 절편들은 유전자 사이의 영역(intergenic regions), 인트론, 및 SINE (short interspersed nuclear elements)이었다(도 7D).We also examined whether hyper- or hypomethylated fragments correlate with the appearance of the genome. Promoter regions were defined 2 kb upstream of the transcription start point. Most fragments with methylation changes were intergenic regions, introns, and short interspersed nuclear elements (SINE) (FIG. 7D).

유전자 사이의 영역이 인간 게놈의 약 7.3%임에도 불구하고, 과- 또는 저메틸화된 절편들의 3233%가 유전자 사이의 영역에 있고(반복 서열은 제외), 이는 유전자 사이의 영역에서 메틸화 변화가 배아 줄기 세포(ES)의 분화에 중요하다는 것을 제안한다.Although the region between genes is about 7.3% of the human genome, 3233% of hyper- or hypomethylated fragments are in the region between genes (except for repetitive sequences), which indicates that the methylation changes in the region between genes are embryonic stems. It is suggested to be important for the differentiation of cells (ES).

<110> Korea Research Institute of Bioscience and Biotechnology <120> DNA methylation markers for detecting hepatogenesis and a method for detecting using the same <130> 10p-11-57 <160> 102 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 1 gaaggatgtg gtccgagtgt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 2 gtgaagtgag ggctcccata 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 3 aaccccaaga tgcacaactc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 4 cggggccggt atttataatc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 5 caaaggcaaa caacccactt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 6 tctggaacca ggtcttcacc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 7 cagaatccag acctgcacaa 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 8 gcggccggta cttgtagtt 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 9 ctacgccaac atgaactcca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 10 cggtagaagg ggaagaggtc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 11 tccaaaccag aaaacggaag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 12 ctgtgcccgt agtgagatga 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 13 ccagagattt cccaaagctg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 14 tgggattttt ccaacagagg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 15 gtagcgctgc aaacaatgaa 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 16 ccctcttcag caaagcagac 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 17 agggcctgaa gctagtggat 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 18 tcctcggtgt ccttgacttc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 19 ccaagagagc aaggcttcag 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 20 gtctgccgag agaagtctgc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 21 cctggacagg cttagagacg 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 22 agtgagtgac caccctccac 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 23 ccacatccca aacattttcc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 24 gatcaagcgg tccttcagag 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 25 gatttggctc agggcactac 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 26 agcgtcttca ttgggatgtt 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 27 aggcgctgga agactgaata 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 28 gatcttctgg cagtgggtgt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 29 tctggcacca cttcatgttc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 30 aatgaacaga cccgcatttc 20 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 31 aagcgcacgt ctttcagc 18 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 32 tggaaggatt tcccactctg 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 33 cgccaggaga tgtacattga 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 34 cttgatgctg acgatcatgg 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 35 tgctgacacc agaaaagtgc 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 36 agtccccaat ggactcacag 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 37 cagggactat ggagctcagg 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 38 cacacactcg taagccagga 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 39 ggtgagctct acctgccaaa 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 40 cacagcctta tggaccacct 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 41 tgaactcacc cagcaactca 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 42 ccttcccaat ctcctccttc 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 43 gtggtggctg gattgaactt 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 44 cgcaaatctt ggtaggtggt 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 45 gggagcgggt ctacttcttc 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 46 gctaatgaac tggggctgtc 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 47 tggtttgacc acattcatgg 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 48 tcatgctctg aaaggagctg 20 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 49 ggaaggtata agggagta 18 <210> 50 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 50 ncacacctcc atattcttc 19 <210> 51 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 51 tgttgatgta ttgagggat 19 <210> 52 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 52 ntttaaagta ttaggggtta tat 23 <210> 53 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 53 ctaaatacaa ccctctaaaa t 21 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 54 aatacaacca aaaaaacact 20 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 55 gtttaggagt tgggtataag t 21 <210> 56 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 56 nccaaaaatc ttcctaatc 19 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 57 tttaggagtt gggtataagt 20 <210> 58 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 58 naatggttga gtgtgattaa a 21 <210> 59 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 59 ccaaaattcc acttttac 18 <210> 60 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 60 tcttccaatc aaactcc 17 <210> 61 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 61 gtatagaaag ggagtaagtg t 21 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 62 nccccaacaa tacattatta 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 63 agggagtaag tgtatagttt 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 64 aatggttttt agttagttgt 20 <210> 65 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 65 nccaaaaaaa tactcaaata c 21 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 66 agttagttgt tatagtagag 20 <210> 67 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 67 ggttaaggaa aagagagaa 19 <210> 68 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 68 nccaaaaact cctaacctta ta 22 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 69 tatatttagt agtgtaaaaa 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 70 tttgtttggt tattgattat 20 <210> 71 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 71 naaacccaaa cttcttttat a 21 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 72 ttgattattt gtttttttat 20 <210> 73 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 73 agttttgatg aggataga 18 <210> 74 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 74 nccacaaaac tctcttctc 19 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 75 tataggttag gtaaggtgtt 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 76 tggggtataa ttatgttttg 20 <210> 77 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 77 ncccctaaca accaaatat 19 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 78 tgagttattg taaatagaag 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 79 tagtagtggg gattttatag 20 <210> 80 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 80 ntaccttccc ctacaaata 19 <210> 81 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 81 atggtttagg gtggg 15 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 82 ngtgattgta aaggtatttg 20 <210> 83 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 83 aacctacact ccttacac 18 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 84 caaaaatccc tcaaaattat 20 <210> 85 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 85 ttttgtagtt tgaggagaat at 22 <210> 86 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 86 ntttaccaat aattaacaac at 22 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 87 tttgaatata aaatataaat 20 <210> 88 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 88 ntatttgagt aggtttaata agtt 24 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 89 caaaacaacc aaatattcta 20 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 90 caaccaaata ttctattctc 20 <210> 91 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 91 ntagggttat aaaagtttaa ga 22 <210> 92 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 92 tcctccttcc tcaatata 18 <210> 93 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 93 ccttcctcaa tataactcc 19 <210> 94 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 94 ntggttttgt aaaagttata g 21 <210> 95 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 95 ccaaaaatta aataactct 19 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 96 catttacatt taaaaatcac 20 <210> 97 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 97 naggttgagt aaatagagta gt 22 <210> 98 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 98 aactctaatc tccctaaaa 19 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 99 ctctaatctc cctaaaatct 20 <210> 100 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 100 ntgttgggat aaggttaaa 19 <210> 101 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 101 tcccttatca caaactca 18 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 102 ccttcaaacc ataaaaaatc 20 <110> Korea Research Institute of Bioscience and Biotechnology <120> DNA methylation markers for detecting hepatogenesis and a method          for detecting using the same <130> 10p-11-57 <160> 102 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 1 gaaggatgtg gtccgagtgt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 2 gtgaagtgag ggctcccata 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 3 aaccccaaga tgcacaactc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 4 cggggccggt atttataatc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 5 caaaggcaaa caacccactt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 6 tctggaacca ggtcttcacc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 7 cagaatccag acctgcacaa 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 8 gcggccggta cttgtagtt 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 9 ctacgccaac atgaactcca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 10 cggtagaagg ggaagaggtc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 11 tccaaaccag aaaacggaag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 12 ctgtgcccgt agtgagatga 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 13 ccagagattt cccaaagctg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 14 tgggattttt ccaacagagg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 15 gtagcgctgc aaacaatgaa 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 16 ccctcttcag caaagcagac 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 17 agggcctgaa gctagtggat 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 18 tcctcggtgt ccttgacttc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 19 ccaagagagc aaggcttcag 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 20 gtctgccgag agaagtctgc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 21 cctggacagg cttagagacg 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 22 agtgagtgac caccctccac 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 23 ccacatccca aacattttcc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 24 gatcaagcgg tccttcagag 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 25 gatttggctc agggcactac 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 26 agcgtcttca ttgggatgtt 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 27 aggcgctgga agactgaata 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 28 gatcttctgg cagtgggtgt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 29 tctggcacca cttcatgttc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 30 aatgaacaga cccgcatttc 20 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 31 aagcgcacgt ctttcagc 18 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 32 tggaaggatt tcccactctg 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 33 cgccaggaga tgtacattga 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 34 cttgatgctg acgatcatgg 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 35 tgctgacacc agaaaagtgc 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 36 agtccccaat ggactcacag 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 37 cagggactat ggagctcagg 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 38 cacacactcg taagccagga 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 39 ggtgagctct acctgccaaa 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 40 cacagcctta tggaccacct 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 41 tgaactcacc cagcaactca 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 42 ccttcccaat ctcctccttc 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 43 gtggtggctg gattgaactt 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 44 cgcaaatctt ggtaggtggt 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 45 gggagcgggt ctacttcttc 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 46 gctaatgaac tggggctgtc 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 47 tggtttgacc acattcatgg 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for qRT-PCR <400> 48 tcatgctctg aaaggagctg 20 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 49 ggaaggtata agggagta 18 <210> 50 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 50 ncacacctcc atattcttc 19 <210> 51 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 51 tgttgatgta ttgagggat 19 <210> 52 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 52 ntttaaagta ttaggggtta tat 23 <210> 53 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 53 ctaaatacaa ccctctaaaa t 21 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 54 aatacaacca aaaaaacact 20 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 55 gtttaggagt tgggtataag t 21 <210> 56 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 56 nccaaaaatc ttcctaatc 19 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 57 tttaggagtt gggtataagt 20 <210> 58 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 58 naatggttga gtgtgattaa a 21 <210> 59 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 59 ccaaaattcc acttttac 18 <210> 60 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 60 tcttccaatc aaactcc 17 <210> 61 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 61 gtatagaaag ggagtaagtg t 21 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 62 nccccaacaa tacattatta 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 63 agggagtaag tgtatagttt 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 64 aatggttttt agttagttgt 20 <210> 65 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 65 nccaaaaaaa tactcaaata c 21 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 66 agttagttgt tatagtagag 20 <210> 67 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 67 ggttaaggaa aagagagaa 19 <210> 68 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 68 nccaaaaact cctaacctta ta 22 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 69 tatatttagt agtgtaaaaa 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 70 tttgtttggt tattgattat 20 <210> 71 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 71 naaacccaaa cttcttttat a 21 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 72 ttgattattt gtttttttat 20 <210> 73 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 73 agttttgatg aggataga 18 <210> 74 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 74 nccacaaaac tctcttctc 19 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 75 tataggttag gtaaggtgtt 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 76 tggggtataa ttatgttttg 20 <210> 77 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 77 ncccctaaca accaaatat 19 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 78 tgagttattg taaatagaag 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 79 tagtagtggg gattttatag 20 <210> 80 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 80 ntaccttccc ctacaaata 19 <210> 81 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 81 atggtttagg gtggg 15 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 82 ngtgattgta aaggtatttg 20 <210> 83 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 83 aacctacact ccttacac 18 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 84 caaaaatccc tcaaaattat 20 <210> 85 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 85 ttttgtagtt tgaggagaat at 22 <210> 86 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 86 ntttaccaat aattaacaac at 22 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 87 tttgaatata aaatataaat 20 <210> 88 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 88 ntatttgagt aggtttaata agtt 24 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 89 caaaacaacc aaatattcta 20 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 90 caaccaaata ttctattctc 20 <210> 91 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 91 ntagggttat aaaagtttaa ga 22 <210> 92 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 92 tcctccttcc tcaatata 18 <210> 93 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 93 ccttcctcaa tataactcc 19 <210> 94 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 94 ntggttttgt aaaagttata g 21 <210> 95 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 95 ccaaaaatta aataactct 19 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 96 catttacatt taaaaatcac 20 <210> 97 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 97 naggttgagt aaatagagta gt 22 <210> 98 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 98 aactctaatc tccctaaaa 19 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 99 ctctaatctc cctaaaatct 20 <210> 100 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <220> <221> variation <222> (1) <223> N is Biotin <400> 100 ntgttgggat aaggttaaa 19 <210> 101 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 101 tcccttatca caaactca 18 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer sequence for pyrosequencing <400> 102 ccttcaaacc ataaaaaatc 20

Claims (15)

하기의 군으로부터 선택되는 어느 하나 이상의 유전자의 핵산 서열 올리고뉴클레오티드 또는 그의 상보가닥 분자가 집적된, 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 마이크로어레이 칩:
POU5F1(POU class 5 homeobox 1, 유전자 등록 번호(Genbank Accession No.) NM_002701), DPPA2(developmental pluripotency associated 2, 유전자 등록 번호(Genbank Accession No.) NM_138815), DPEP3(dipeptidase 3, 유전자 등록 번호(Genbank Accession No.) NM_022357), SLC15A3(solute carrier family 15, member 3, 유전자 등록 번호(Genbank Accession No.) NM_016582), USP44(ubiquitin specific peptidase 44, 유전자 등록 번호(Genbank Accession No.) NM_032147), SOX2(SRY (sex determining region Y)-box 2, 유전자 등록 번호(Genbank Accession No.) NM_003106), MT1F(metallothionein 1F, 유전자 등록 번호(Genbank Accession No.) NM_005949), CRABP1(cellular retinoic acid binding protein 1, 유전자 등록 번호(Genbank Accession No.) NM_004378), LECT1(leukocyte cell derived chemotaxin 1, 유전자 등록 번호(Genbank Accession No.) NM_007015), VGF(VGF nerve growth factor inducible, 유전자 등록 번호(Genbank Accession No.) NM_007015), SFRP2(secreted frizzled related protein 2, 유전자 등록 번호(Genbank Accession No.) NT_016354), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), 유전자 등록 번호(Genbank Accession No.) NM_005378), UTF1(undifferentiated embryonic cell transcription factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003577), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, 유전자 등록 번호(Genbank Accession No.) NM_005769), PRDM14(PR domain containing 14, 유전자 등록 번호(Genbank Accession No.) NM_024504), MT1G(metallothionein 1G, 유전자 등록 번호(Genbank Accession No.) NM_005950), CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_005454), GATA4(GATA binding protein 4, 유전자 등록 번호(Genbank Accession No.) NT_077531), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_031944), LEFTY1(left-right determination factor 1, 유전자 등록 번호(Genbank Accession No.) NM_020997), VWF(von Willebrand factor, 유전자 등록 번호(Genbank Accession No.) NM_000552), NODAL(nodal homolog (mouse), 유전자 등록 번호(Genbank Accession No.) NM_018055), DLX5(distal-less homeobox 5, 유전자 등록 번호(Genbank Accession No.) NT_007933), FOXC1(forkhead box C1, 유전자 등록 번호(Genbank Accession No.) NM_001453), KCNK12(potassium channel, subfamily K, member 12, 유전자 등록 번호(Genbank Accession No.) NM_022055), SOX17(SRY (sex determining region Y)-box 17, 유전자 등록 번호(Genbank Accession No.) NM_022454), LEFTY2(left-right determination factor 2, 유전자 등록 번호(Genbank Accession No.) NM_003240), SERPINA3(serpin peptidase inhibitor, clade A , member 3, 유전자 등록 번호(Genbank Accession No.) NM_001085), AGT(angiotensinogen, 유전자 등록 번호(Genbank Accession No.) NM_000029), AFP(alpha-fetoprotein, 유전자 등록 번호(Genbank Accession No.) NM_001134), TM4SF4(transmembrane 4 L six family member 4, 유전자 등록 번호(Genbank Accession No.) NM_004617), APOA4(apolipoprotein A-IV, 유전자 등록 번호(Genbank Accession No.) NM_000482), SPINK1(serine peptidase inhibitor, Kazal type 1, 유전자 등록 번호(Genbank Accession No.) NM_003122), KNG1(kininogen 1, 유전자 등록 번호(Genbank Accession No.) NM_000893), CFH(complement factor H, 유전자 등록 번호(Genbank Accession No.) NM_000186), ALDH1A1(aldehyde dehydrogenase 1 family, member A1, 유전자 등록 번호(Genbank Accession No.) NM_000689), C11orf9(chromosome 11 open reading frame 9, 유전자 등록 번호(Genbank Accession No.) NM_013279), SLCO2B1(solute carrier organic anion transporter family, member 2B1, 유전자 등록 번호(Genbank Accession No.) NM_007256), RIN2(Ras and Rab interactor 2, 유전자 등록 번호(Genbank Accession No.) NM_018993), SRPX2(sushi-repeat-containing protein, X-linked 2, 유전자 등록 번호(Genbank Accession No.) NM_014467), FGG(fibrinogen gamma chain, 유전자 등록 번호(Genbank Accession No.) NM_000509), VTN(vitronectin, 유전자 등록 번호(Genbank Accession No.) NM_000638), KLB(klotho beta, 유전자 등록 번호(Genbank Accession No.) NM_175737), TIMP3(TIMP metallopeptidase inhibitor 3, 유전자 등록 번호(Genbank Accession No.) NT_011520), CREB3L3(cAMP responsive element binding protein 3-like 3, 유전자 등록 번호(Genbank Accession No.) NM_032607), DEFB1(defensin, beta 1, 유전자 등록 번호(Genbank Accession No.) NM_005218), CIDEC(cell death-inducing DFFA-like effector c, 유전자 등록 번호(Genbank Accession No.) NM_022094), ANGPTL6(angiopoietin-like 6, 유전자 등록 번호(Genbank Accession No.) NM_031917), KBTBD10(kelch repeat and BTB (POZ) domain containing 10, 유전자 등록 번호(Genbank Accession No.) NM_006063), VCAM1(vascular cell adhesion molecule 1, 유전자 등록 번호(Genbank Accession No.) NM_001078), CSF1R(colony stimulating factor 1 receptor, 유전자 등록 번호(Genbank Accession No.) NM_005211), KYNU(kynureninase (L-kynurenine hydrolase), 유전자 등록 번호(Genbank Accession No.) NM_003937), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1, 유전자 등록 번호(Genbank Accession No.) NM_003167), RAMP1(receptor (G protein-coupled) activity modifying protein 1, 유전자 등록 번호(Genbank Accession No.) NM_005855), TDO2(tryptophan 2,3-dioxygenase, 유전자 등록 번호(Genbank Accession No.) NM_005651), AQP10(aquaporin 10, 유전자 등록 번호(Genbank Accession No.) NM_080429), CTSE(cathepsin E, 유전자 등록 번호(Genbank Accession No.) NM_001910), SLPI(secretory leukocyte peptidase inhibitor, 유전자 등록 번호(Genbank Accession No.) NM_003064), APOC2(apolipoprotein C-II, 유전자 등록 번호(Genbank Accession No.) NM_000483), SEPP1(selenoprotein P, plasma, 1, 유전자 등록 번호(Genbank Accession No.) NM_005410), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila), 유전자 등록 번호(Genbank Accession No.) NM_001343), TFF1(trefoil factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003225), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13, 유전자 등록 번호(Genbank Accession No.) NM_002242), FMO1(flavin containing monooxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_002021), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2, 유전자 등록 번호(Genbank Accession No.) NM_002153), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_000302) 및 HKDC1(hexokinase domain containing 1, 유전자 등록 번호(Genbank Accession No.) NM_025130).
A microarray chip for determining the stage of differentiation from human embryonic stem cells to hepatocytes in which nucleic acid sequence oligonucleotides or complementary strand molecules of any one or more genes selected from the following groups are integrated:
POU5F1 (POU class 5 homeobox 1, Genbank Accession No. NM_002701), DPPA2 (developmental pluripotency associated 2), Gene Accession Number (Genbank Accession No.) NM_138815, DPEP3 (dipeptidase 3, Gene Accession Number (Genbank Accession) No.) NM_022357), SLC15A3 (solute carrier family 15, member 3, Gene Accession No. NM_016582), USP44 (ubiquitin specific peptidase 44, Gene Accession No. NM_032147), SOX2 (SRY (sex determining region Y) -box 2, Genbank Accession No. NM_003106, MT1F (metallothionein 1F, Genbank Accession No. NM_005949), CRABP1 (cellular retinoic acid binding protein 1, gene registration Number (Genbank Accession No.) NM_004378), LECT1 (leukocyte cell derived chemotaxin 1, gene accession number (Genbank Accession No.) NM_007015), VGF (VGF nerve growth factor inducible, gene accession number (Genbank Accession No.) NM_007015), SFRP2 (secreted frizzled relat ed protein 2, gene accession number (Genbank Accession No.) NT_016354), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), gene accession number (Genbank Accession No.) NM_005378), UTF1 (undifferentiated embryonic cell transcription factor 1, Genbank Accession No. NM_003577), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, Genebank Accession No. NM_005769), PRDM14 (PR domain containing 14, gene accession number (Genbank Accession No.) NM_024504), MT1G (metallothionein 1G, gene accession number (Genbank Accession No.) NM_005950), CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), gene accession number (Genbank Accession No.) NM_005454), GATA4 (GATA binding protein 4, Genbank Accession No.) NT_077531), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis), Gene Accession No. NM_031944), LEFTY1 (left- right determination factor 1, u Electronic Bank Identification Number (Genbank Accession No.) NM_020997, VWF (von Willebrand factor, Genbank Accession No. NM_000552), NODAL (nodal homolog (mouse), Gene Bank Accession No. NM_018055), DLX5 (distal-less homeobox 5, Genbank Accession No. NT_007933), FOXC1 (forkhead box C1, Genbank Accession No. NM_001453), KCNK12 (potassium channel, subfamily K, member 12, gene Genbank Accession No. (NM_022055), SOX17 (sex determining region Y) -box 17, Genbank Accession No. (NM_022454), LEFTY2 (left-right determination factor 2, gene registration number (Genbank) Accession No.) NM_003240), SERPINA3 (serpin peptidase inhibitor, clade A, member 3, Genbank Accession No. NM_001085), AGT (angiotensinogen, Genbank Accession No.) NM_000029), AFP (alpha) fetoprotein, Genbank Accession No. NM_001134, TM4SF4 (t ransmembrane 4 L six family member 4, gene accession number (Genbank Accession No.) NM_004617), APOA4 (apolipoprotein A-IV, gene accession number (Genbank Accession No.) NM_000482), SPINK1 (serine peptidase inhibitor, Kazal type 1, gene Accession number (Genbank Accession No.) NM_003122), KNG1 (kininogen 1, gene accession number (Genbank Accession No.) NM_000893), CFH (complement factor H, Genbank Accession No.) NM_000186), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1, Genbank Accession No. NM_000689), C11orf9 (chromosome 11 open reading frame 9, Gene Accession No. NM_013279), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 , Genbank Accession No. NM_007256, RIN2 (Ras and Rab interactor 2, Genbank Accession No. NM_018993), SRPX2 (sushi-repeat-containing protein, X-linked 2, gene accession number (Genbank Accession No.) NM_014467), FGG (fi brinogen gamma chain, Genbank Accession No. NM_000509, VTN (vitronectin, Genbank Accession No. NM_000638), KLB (klotho beta, Genbank Accession No. NM_175737), TIMP3 (TIMP metallopeptidase inhibitor 3, Genbank Accession No. NT_011520), CREB3L3 (cAMP responsive element binding protein 3-like 3, Gene accession No. NM_032607), DEFB1 (defensin, beta 1, gene Accession number (Genbank Accession No.) NM_005218), cell death-inducing DFFA-like effector c, gene accession number (Genbank Accession No.) NM_022094), ANGPTL6 (angiopoietin-like 6, gene accession number (Genbank Accession No. ) NM_031917), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10, Genebank Accession No. NM_006063), VCAM1 (vascular cell adhesion molecule 1, Genebank Accession No. NM_001078), CSF1R (colony stimulating factor 1 receptor, gene GenBank Accession No. NM_005211, kynureninase (KYNU) (L-kynurenine hydrolase), Genbank Accession No. NM_003937, SULT2A1 (sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1, Genbank Accession No. NM_003167), RAMP1 (receptor (G protein-coupled) activity modifying protein 1, Genebank Accession No.) NM_005855), TDO2 (tryptophan 2,3-dioxygenase, gene Accession number (Genbank Accession No.) NM_005651), AQP10 (aquaporin 10, gene accession number (Genbank Accession No.) NM_080429), CTSE (cathepsin E, gene accession number (Genbank Accession No.) NM_001910), secretory leukocyte peptidase inhibitor, gene accession number (Genbank Accession No.) NM_003064), APOC2 (apolipoprotein C-II, gene accession number (Genbank Accession No.) NM_000483), SEPP1 (selenoprotein P, plasma, 1, gene accession number (Genbank Accession No. NM_005410), DAB2 (disabled homolog 2, mitogen-re sponsive phosphoprotein (Drosophila), Genbank Accession No. NM_001343, TFF1 (trefoil factor 1, Genbank Accession No. NM_003225), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13, gene Accession number (Genbank Accession No.) NM_002242), FMO1 (flavin containing monooxygenase 1, gene accession number (Genbank Accession No.) NM_002021), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2, gene accession number (Genbank Accession No.) NM_002153), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, Genbank Accession No. NM_000302) and HKDC1 (hexokinase domain containing 1, Genebank Accession No. NM_025130).
제 1항에 있어서, 하기의 군으로부터 선택되는 어느 하나 이상의 유전자는 인간 배아 줄기 세포(embryonic stem cell; ES)-특이적 유전자인 것을 특징으로 하는 마이크로어레이 칩;
POU5F1(POU class 5 homeobox 1), DPPA2(developmental pluripotency associated 2), DPEP3(dipeptidase 3), SLC15A3(solute carrier family 15, member 3), USP44(ubiquitin specific peptidase 44), SOX2(SRY (sex determining region Y)-box 2), MT1F(metallothionein 1F), CRABP1(cellular retinoic acid binding protein 1), LECT1(leukocyte cell derived chemotaxin 1), VGF(VGF nerve growth factor inducible), SFRP2(secreted frizzled related protein 2), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), UTF1(undifferentiated embryonic cell transcription factor 1), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4), PRDM14(PR domain containing 14) 및 MT1G(metallothionein 1G).
The microarray chip of claim 1, wherein any one or more genes selected from the following group is a human embryonic stem cell (ES) -specific gene;
POU5F1 (POU class 5 homeobox 1), DPPA2 (developmental pluripotency associated 2), DPEP3 (dipeptidase 3), SLC15A3 (solute carrier family 15, member 3), USP44 (ubiquitin specific peptidase 44), SOX2 (SRY (sex determining region Y) ) -box 2), metallothionein 1F (MT1F), cellular retinoic acid binding protein 1 (CRABP1), leukocyte cell derived chemotaxin 1 (LECT1), VGF nerve growth factor inducible (VGF), secreted frizzled related protein 2 (SFRP2), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), undifferentiated embryonic cell transcription factor 1 (UTF1), carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 (CHST4), PRDM14 (PR domain containing 14), and MT1G ( metallothionein 1G).
제 1항에 있어서, 하기의 군으로부터 선택되는 어느 하나 이상의 유전자는 내배엽 전구체(endoderm progenitor; EP)-특이적 유전자인 것을 특징으로 하는 마이크로어레이 칩;
CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4(GATA binding protein 4), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1(left-right determination factor 1), VWF(von Willebrand factor), NODAL(nodal homolog (mouse)), DLX5(distal-less homeobox 5), FOXC1(forkhead box C1), KCNK12(potassium channel, subfamily K, member 12), SOX17(SRY (sex determining region Y)-box 17) 및 LEFTY2(left-right determination factor 2).
The microarray chip of claim 1, wherein any one or more genes selected from the following group are endoderm progenitor (EP) -specific genes;
CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4 (GATA binding protein 4), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1 (left-right determination factor 1), VWF (von Willebrand factor, NODAL (nodal homolog (mouse)), DLX5 (distal-less homeobox 5), FOXC1 (forkhead box C1), KCNK12 (potassium channel, subfamily K, member 12), SOX17 (SRY (sex determining region Y) -box 17) and LEFTY2 (left-right determination factor 2).
제 1항에 있어서, 하기의 군으로부터 선택되는 어느 하나 이상의 유전자는 성숙한 간세포(mature hepatocytes; MH)-특이적 유전자인 것을 특징으로 하는 마이크로어레이 칩;
SERPINA3(serpin peptidase inhibitor, clade A , member 3), AGT(angiotensinogen), AFP(alpha-fetoprotein), TM4SF4(transmembrane 4 L six family member 4), APOA4(apolipoprotein A-IV), SPINK1(serine peptidase inhibitor, Kazal type 1), KNG1(kininogen 1), CFH(complement factor H), ALDH1A1(aldehyde dehydrogenase 1 family, member A1), C11orf9(chromosome 11 open reading frame 9), SLCO2B1(solute carrier organic anion transporter family, member 2B1), RIN2(Ras and Rab interactor 2), SRPX2(sushi-repeat-containing protein, X-linked 2), FGG(fibrinogen gamma chain), VTN(vitronectin), KLB(klotho beta), TIMP3(TIMP metallopeptidase inhibitor 3), CREB3L3(cAMP responsive element binding protein 3-like 3), DEFB1(defensin, beta 1), CIDEC(cell death-inducing DFFA-like effector c), ANGPTL6(angiopoietin-like 6), KBTBD10(kelch repeat and BTB (POZ) domain containing 10), VCAM1(vascular cell adhesion molecule 1), CSF1R(colony stimulating factor 1 receptor), KYNU(kynureninase (L-kynurenine hydrolase)), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1), RAMP1(receptor (G protein-coupled) activity modifying protein 1), TDO2(tryptophan 2,3-dioxygenase), AQP10(aquaporin 10), CTSE(cathepsin E), SLPI(secretory leukocyte peptidase inhibitor), APOC2(apolipoprotein C-II), SEPP1(selenoprotein P, plasma, 1), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)), TFF1(trefoil factor 1), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13), FMO1(flavin containing monooxygenase 1), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) 및 HKDC1(hexokinase domain containing 1).
The microarray chip of claim 1, wherein any one or more genes selected from the following group are mature hepatocytes (MH) -specific genes;
SERPINA3 (serpin peptidase inhibitor, clade A, member 3), AGT (angiotensinogen), AFP (alpha-fetoprotein), TM4SF4 (transmembrane 4 L six family member 4), APOA4 (apolipoprotein A-IV), SPINK1 (serine peptidase inhibitor, Kazal type 1), KNG1 (kininogen 1), CFH (complement factor H), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), C11orf9 (chromosome 11 open reading frame 9), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 ), RIN2 (Ras and Rab interactor 2), SRPX2 (sushi-repeat-containing protein, X-linked 2), fibrinogen gamma chain (FFG), vitronectin (VTN), klotho beta (KLB), TIMP metallopeptidase inhibitor 3 ), CREB3L3 (cAMP responsive element binding protein 3-like 3), DEFB1 (defensin, beta 1), CIDEC (cell death-inducing DFFA-like effector c), ANGPTL6 (angiopoietin-like 6), KBTBD10 (kelch repeat and BTB) (POZ) domain containing 10), vascular cell adhesion molecule 1 (VCAM1), colony stimulating factor 1 receptor (CSF1R), kynureninase (L-kynurenine hydrolase) (KYNU), SULT2A1 (sulfot) ransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1), RAMP1 (receptor (G protein-coupled) activity modifying protein 1), TDO2 (tryptophan 2,3-dioxygenase), AQP10 (aquaporin 10), CTSE (cathepsin E), secretory leukocyte peptidase inhibitor (SLPI), apolipoprotein C-II (APOC2), selenoprotein P, plasma, 1), DAB2 (disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)), TFF1 (trefoil factor) 1), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13), FMO1 (flavin containing monooxygenase 1), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) and HKDC1 (hexokinase domain containing 1).
제 1항에 있어서, 유전자의 발현 검출용 또는 DNA 탈메틸화 검출용인 것을 특징으로 하는 마이크로어레이 칩.
The microarray chip according to claim 1, which is used for detecting gene expression or detecting DNA demethylation.
제 1항의 마이크로어레이 칩을 포함하는 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별용 키트.
A kit for differentiation stage determination from human embryonic stem cells comprising hepatocytes of claim 1 into hepatocytes.
제 6항에 있어서, 유전자의 발현 검출용 또는 DNA 탈메틸화 검출용인 것을 특징으로 하는 키트.
The kit according to claim 6, which is used for detecting gene expression or detecting DNA demethylation.
하기의 단계를 포함하는 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별 방법;
⑴ 인간 배아 줄기 세포로부터 시료를 얻는 단계;
⑵ 하기로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량 을 측정하는 단계:
POU5F1(POU class 5 homeobox 1, 유전자 등록 번호(Genbank Accession No.) NM_002701), DPPA2(developmental pluripotency associated 2, 유전자 등록 번호(Genbank Accession No.) NM_138815), DPEP3(dipeptidase 3, 유전자 등록 번호(Genbank Accession No.) NM_022357), SLC15A3(solute carrier family 15, member 3, 유전자 등록 번호(Genbank Accession No.) NM_016582), USP44(ubiquitin specific peptidase 44, 유전자 등록 번호(Genbank Accession No.) NM_032147), SOX2(SRY (sex determining region Y)-box 2, 유전자 등록 번호(Genbank Accession No.) NM_003106), MT1F(metallothionein 1F, 유전자 등록 번호(Genbank Accession No.) NM_005949), CRABP1(cellular retinoic acid binding protein 1, 유전자 등록 번호(Genbank Accession No.) NM_004378), LECT1(leukocyte cell derived chemotaxin 1, 유전자 등록 번호(Genbank Accession No.) NM_007015), VGF(VGF nerve growth factor inducible, 유전자 등록 번호(Genbank Accession No.) NM_007015), SFRP2(secreted frizzled related protein 2, 유전자 등록 번호(Genbank Accession No.) NT_016354), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), 유전자 등록 번호(Genbank Accession No.) NM_005378), UTF1(undifferentiated embryonic cell transcription factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003577), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, 유전자 등록 번호(Genbank Accession No.) NM_005769), PRDM14(PR domain containing 14, 유전자 등록 번호(Genbank Accession No.) NM_024504), MT1G(metallothionein 1G, 유전자 등록 번호(Genbank Accession No.) NM_005950), CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_005454), GATA4(GATA binding protein 4, 유전자 등록 번호(Genbank Accession No.) NT_077531), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_031944), LEFTY1(left-right determination factor 1, 유전자 등록 번호(Genbank Accession No.) NM_020997), VWF(von Willebrand factor, 유전자 등록 번호(Genbank Accession No.) NM_000552), NODAL(nodal homolog (mouse), 유전자 등록 번호(Genbank Accession No.) NM_018055), DLX5(distal-less homeobox 5, 유전자 등록 번호(Genbank Accession No.) NT_007933), FOXC1(forkhead box C1, 유전자 등록 번호(Genbank Accession No.) NM_001453), KCNK12(potassium channel, subfamily K, member 12, 유전자 등록 번호(Genbank Accession No.) NM_022055), SOX17(SRY (sex determining region Y)-box 17, 유전자 등록 번호(Genbank Accession No.) NM_022454), LEFTY2(left-right determination factor 2, 유전자 등록 번호(Genbank Accession No.) NM_003240), SERPINA3(serpin peptidase inhibitor, clade A , member 3, 유전자 등록 번호(Genbank Accession No.) NM_001085), AGT(angiotensinogen, 유전자 등록 번호(Genbank Accession No.) NM_000029), AFP(alpha-fetoprotein, 유전자 등록 번호(Genbank Accession No.) NM_001134), TM4SF4(transmembrane 4 L six family member 4, 유전자 등록 번호(Genbank Accession No.) NM_004617), APOA4(apolipoprotein A-IV, 유전자 등록 번호(Genbank Accession No.) NM_000482), SPINK1(serine peptidase inhibitor, Kazal type 1, 유전자 등록 번호(Genbank Accession No.) NM_003122), KNG1(kininogen 1, 유전자 등록 번호(Genbank Accession No.) NM_000893), CFH(complement factor H, 유전자 등록 번호(Genbank Accession No.) NM_000186), ALDH1A1(aldehyde dehydrogenase 1 family, member A1, 유전자 등록 번호(Genbank Accession No.) NM_000689), C11orf9(chromosome 11 open reading frame 9, 유전자 등록 번호(Genbank Accession No.) NM_013279), SLCO2B1(solute carrier organic anion transporter family, member 2B1, 유전자 등록 번호(Genbank Accession No.) NM_007256), RIN2(Ras and Rab interactor 2, 유전자 등록 번호(Genbank Accession No.) NM_018993), SRPX2(sushi-repeat-containing protein, X-linked 2, 유전자 등록 번호(Genbank Accession No.) NM_014467), FGG(fibrinogen gamma chain, 유전자 등록 번호(Genbank Accession No.) NM_000509), VTN(vitronectin, 유전자 등록 번호(Genbank Accession No.) NM_000638), KLB(klotho beta, 유전자 등록 번호(Genbank Accession No.) NM_175737), TIMP3(TIMP metallopeptidase inhibitor 3, 유전자 등록 번호(Genbank Accession No.) NT_011520), CREB3L3(cAMP responsive element binding protein 3-like 3, 유전자 등록 번호(Genbank Accession No.) NM_032607), DEFB1(defensin, beta 1, 유전자 등록 번호(Genbank Accession No.) NM_005218), CIDEC(cell death-inducing DFFA-like effector c, 유전자 등록 번호(Genbank Accession No.) NM_022094), ANGPTL6(angiopoietin-like 6, 유전자 등록 번호(Genbank Accession No.) NM_031917), KBTBD10(kelch repeat and BTB (POZ) domain containing 10, 유전자 등록 번호(Genbank Accession No.) NM_006063), VCAM1(vascular cell adhesion molecule 1, 유전자 등록 번호(Genbank Accession No.) NM_001078), CSF1R(colony stimulating factor 1 receptor, 유전자 등록 번호(Genbank Accession No.) NM_005211), KYNU(kynureninase (L-kynurenine hydrolase), 유전자 등록 번호(Genbank Accession No.) NM_003937), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1, 유전자 등록 번호(Genbank Accession No.) NM_003167), RAMP1(receptor (G protein-coupled) activity modifying protein 1, 유전자 등록 번호(Genbank Accession No.) NM_005855), TDO2(tryptophan 2,3-dioxygenase, 유전자 등록 번호(Genbank Accession No.) NM_005651), AQP10(aquaporin 10, 유전자 등록 번호(Genbank Accession No.) NM_080429), CTSE(cathepsin E, 유전자 등록 번호(Genbank Accession No.) NM_001910), SLPI(secretory leukocyte peptidase inhibitor, 유전자 등록 번호(Genbank Accession No.) NM_003064), APOC2(apolipoprotein C-II, 유전자 등록 번호(Genbank Accession No.) NM_000483), SEPP1(selenoprotein P, plasma, 1, 유전자 등록 번호(Genbank Accession No.) NM_005410), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila), 유전자 등록 번호(Genbank Accession No.) NM_001343), TFF1(trefoil factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003225), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13, 유전자 등록 번호(Genbank Accession No.) NM_002242), FMO1(flavin containing monooxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_002021), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2, 유전자 등록 번호(Genbank Accession No.) NM_002153), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_000302) 및 HKDC1(hexokinase domain containing 1, 유전자 등록 번호(Genbank Accession No.) NM_025130).; 및
⑶ 하기 ⒜의 군으로부터 선택되는 어느 하나 이상의 유전자가 배아 줄기 세포-특이적으로 유전자의 발현량이 증가하면 미분화 단계인 것으로 판별하고, 하기 ⒝의 군으로부터 선택되는 어느 하나 이상의 유전자가 내배엽 전구체-특이적으로 유전자의 발현량이 증가하면 분화 중인 단계인 것으로 판별하며, 또는 하기 ⒞의 군으로부터 선택되는 어느 하나 이상의 유전자가 성숙한 간세포-특이적으로 유전자의 발현량이 증가하면 간세포로 분화한 단계인 것으로 판별하는 단계:
⒜ POU5F1(POU class 5 homeobox 1), DPPA2(developmental pluripotency associated 2), DPEP3(dipeptidase 3), SLC15A3(solute carrier family 15, member 3), USP44(ubiquitin specific peptidase 44), SOX2(SRY (sex determining region Y)-box 2), MT1F(metallothionein 1F), CRABP1(cellular retinoic acid binding protein 1), LECT1(leukocyte cell derived chemotaxin 1), VGF(VGF nerve growth factor inducible), SFRP2(secreted frizzled related protein 2), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), UTF1(undifferentiated embryonic cell transcription factor 1), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4), PRDM14(PR domain containing 14) 및 MT1G(metallothionein 1G),
⒝ CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4(GATA binding protein 4), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1(left-right determination factor 1), VWF(von Willebrand factor), NODAL(nodal homolog (mouse)), DLX5(distal-less homeobox 5), FOXC1(forkhead box C1), KCNK12(potassium channel, subfamily K, member 12), SOX17(SRY (sex determining region Y)-box 17) 및 LEFTY2(left-right determination factor 2),
⒞ SERPINA3(serpin peptidase inhibitor, clade A , member 3), AGT(angiotensinogen), AFP(alpha-fetoprotein), TM4SF4(transmembrane 4 L six family member 4), APOA4(apolipoprotein A-IV), SPINK1(serine peptidase inhibitor, Kazal type 1), KNG1(kininogen 1), CFH(complement factor H), ALDH1A1(aldehyde dehydrogenase 1 family, member A1), C11orf9(chromosome 11 open reading frame 9), SLCO2B1(solute carrier organic anion transporter family, member 2B1), RIN2(Ras and Rab interactor 2), SRPX2(sushi-repeat-containing protein, X-linked 2), FGG(fibrinogen gamma chain), VTN(vitronectin), KLB(klotho beta), TIMP3(TIMP metallopeptidase inhibitor 3), CREB3L3(cAMP responsive element binding protein 3-like 3), DEFB1(defensin, beta 1), CIDEC(cell death-inducing DFFA-like effector c), ANGPTL6(angiopoietin-like 6), KBTBD10(kelch repeat and BTB (POZ) domain containing 10), VCAM1(vascular cell adhesion molecule 1), CSF1R(colony stimulating factor 1 receptor), KYNU(kynureninase (L-kynurenine hydrolase)), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1), RAMP1(receptor (G protein-coupled) activity modifying protein 1), TDO2(tryptophan 2,3-dioxygenase), AQP10(aquaporin 10), CTSE(cathepsin E), SLPI(secretory leukocyte peptidase inhibitor), APOC2(apolipoprotein C-II), SEPP1(selenoprotein P, plasma, 1), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)), TFF1(trefoil factor 1), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13), FMO1(flavin containing monooxygenase 1), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) 및 HKDC1(hexokinase domain containing 1).
Differentiation stage determination method from human embryonic stem cells to hepatocytes comprising the following steps;
시료 obtaining a sample from human embryonic stem cells;
측정 measuring the expression level of any one or more genes selected from the group consisting of:
POU5F1 (POU class 5 homeobox 1, Genbank Accession No. NM_002701), DPPA2 (developmental pluripotency associated 2), Gene Accession Number (Genbank Accession No.) NM_138815, DPEP3 (dipeptidase 3, Gene Accession Number (Genbank Accession) No.) NM_022357), SLC15A3 (solute carrier family 15, member 3, Gene Accession No. NM_016582), USP44 (ubiquitin specific peptidase 44, Gene Accession No. NM_032147), SOX2 (SRY (sex determining region Y) -box 2, Genbank Accession No. NM_003106, MT1F (metallothionein 1F, Genbank Accession No. NM_005949), CRABP1 (cellular retinoic acid binding protein 1, gene registration Number (Genbank Accession No.) NM_004378), LECT1 (leukocyte cell derived chemotaxin 1, gene accession number (Genbank Accession No.) NM_007015), VGF (VGF nerve growth factor inducible, gene accession number (Genbank Accession No.) NM_007015), SFRP2 (secreted frizzled relat ed protein 2, gene accession number (Genbank Accession No.) NT_016354), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), gene accession number (Genbank Accession No.) NM_005378), UTF1 (undifferentiated embryonic cell transcription factor 1, Genbank Accession No. NM_003577), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, Genebank Accession No. NM_005769), PRDM14 (PR domain containing 14, gene accession number (Genbank Accession No.) NM_024504), MT1G (metallothionein 1G, gene accession number (Genbank Accession No.) NM_005950), CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), gene accession number (Genbank Accession No.) NM_005454), GATA4 (GATA binding protein 4, Genbank Accession No.) NT_077531), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis), Gene Accession No. NM_031944), LEFTY1 (left- right determination factor 1, u Electronic Bank Identification Number (Genbank Accession No.) NM_020997, VWF (von Willebrand factor, Genbank Accession No. NM_000552), NODAL (nodal homolog (mouse), Gene Bank Accession No. NM_018055), DLX5 (distal-less homeobox 5, Genbank Accession No. NT_007933), FOXC1 (forkhead box C1, Genbank Accession No. NM_001453), KCNK12 (potassium channel, subfamily K, member 12, gene Genbank Accession No. (NM_022055), SOX17 (sex determining region Y) -box 17, Genbank Accession No. (NM_022454), LEFTY2 (left-right determination factor 2, gene registration number (Genbank) Accession No.) NM_003240), SERPINA3 (serpin peptidase inhibitor, clade A, member 3, Genbank Accession No. NM_001085), AGT (angiotensinogen, Genbank Accession No.) NM_000029), AFP (alpha) fetoprotein, Genbank Accession No. NM_001134, TM4SF4 (t ransmembrane 4 L six family member 4, gene accession number (Genbank Accession No.) NM_004617), APOA4 (apolipoprotein A-IV, gene accession number (Genbank Accession No.) NM_000482), SPINK1 (serine peptidase inhibitor, Kazal type 1, gene Accession number (Genbank Accession No.) NM_003122), KNG1 (kininogen 1, gene accession number (Genbank Accession No.) NM_000893), CFH (complement factor H, Genbank Accession No.) NM_000186), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1, Genbank Accession No. NM_000689), C11orf9 (chromosome 11 open reading frame 9, Gene Accession No. NM_013279), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 , Genbank Accession No. NM_007256, RIN2 (Ras and Rab interactor 2, Genbank Accession No. NM_018993), SRPX2 (sushi-repeat-containing protein, X-linked 2, gene accession number (Genbank Accession No.) NM_014467), FGG (fi brinogen gamma chain, Genbank Accession No. NM_000509, VTN (vitronectin, Genbank Accession No. NM_000638), KLB (klotho beta, Genbank Accession No. NM_175737), TIMP3 (TIMP metallopeptidase inhibitor 3, Genbank Accession No. NT_011520), CREB3L3 (cAMP responsive element binding protein 3-like 3, Gene accession No. NM_032607), DEFB1 (defensin, beta 1, gene Accession number (Genbank Accession No.) NM_005218), cell death-inducing DFFA-like effector c, gene accession number (Genbank Accession No.) NM_022094), ANGPTL6 (angiopoietin-like 6, gene accession number (Genbank Accession No. ) NM_031917), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10, Genebank Accession No. NM_006063), VCAM1 (vascular cell adhesion molecule 1, Genebank Accession No. NM_001078), CSF1R (colony stimulating factor 1 receptor, gene GenBank Accession No. NM_005211, kynureninase (KYNU) (L-kynurenine hydrolase), Genbank Accession No. NM_003937, SULT2A1 (sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1, Genbank Accession No. NM_003167), RAMP1 (receptor (G protein-coupled) activity modifying protein 1, Genebank Accession No.) NM_005855), TDO2 (tryptophan 2,3-dioxygenase, gene Accession number (Genbank Accession No.) NM_005651), AQP10 (aquaporin 10, gene accession number (Genbank Accession No.) NM_080429), CTSE (cathepsin E, gene accession number (Genbank Accession No.) NM_001910), secretory leukocyte peptidase inhibitor, gene accession number (Genbank Accession No.) NM_003064), APOC2 (apolipoprotein C-II, gene accession number (Genbank Accession No.) NM_000483), SEPP1 (selenoprotein P, plasma, 1, gene accession number (Genbank Accession No. NM_005410), DAB2 (disabled homolog 2, mitogen-re sponsive phosphoprotein (Drosophila), Genbank Accession No. NM_001343, TFF1 (trefoil factor 1, Genbank Accession No. NM_003225), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13, gene Accession number (Genbank Accession No.) NM_002242), FMO1 (flavin containing monooxygenase 1, gene accession number (Genbank Accession No.) NM_002021), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2, gene accession number (Genbank Accession No.) NM_002153), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, Genbank Accession No. NM_000302) and HKDC1 (hexokinase domain containing 1, Genebank Accession No. NM_025130); And
어느 Any one or more genes selected from the group of ⑶ below are determined to be embryonic stem cell-specifically when the expression level of the gene is increased, and at least one gene selected from the group of ⒝ is endoderm precursor-specific As a result, when the expression level of the gene is increased, it is determined that it is in the stage of differentiation, or when one or more genes selected from the group of 하기 is mature hepatocytes-specifically, the stage of differentiation into the hepatocytes when the expression level of the gene is increased. :
OU POU5F1 (POU class 5 homeobox 1), DPPA2 (developmental pluripotency associated 2), DPEP3 (dipeptidase 3), SLC15A3 (solute carrier family 15, member 3), USP44 (ubiquitin specific peptidase 44), SOX2 (SRY (sex determining region) Y) -box 2), metallothionein 1F (MT1F), cellular retinoic acid binding protein 1 (CRABP1), leukocyte cell derived chemotaxin 1 (LECT1), VGF nerve growth factor inducible (VGF), secreted frizzled related protein 2 (SFRP2), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), undifferentiated embryonic cell transcription factor 1 (UTF1), carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4) (CHST4), PRDM14 (PR domain containing 14), and MT1G (metallothionein 1G),
ER CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4 (GATA binding protein 4), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1 (left-right determination factor 1), VWF ( von Willebrand factor, NODAL (nodal homolog (mouse)), DLX5 (distal-less homeobox 5), FOXC1 (forkhead box C1), KCNK12 (potassium channel, subfamily K, member 12), SOX17 (SRY (sex determining region Y) ) -box 17) and LEFTY2 (left-right determination factor 2),
RP SERPINA3 (serpin peptidase inhibitor, clade A, member 3), AGT (angiotensinogen), AFP (alpha-fetoprotein), TM4SF4 (transmembrane 4 L six family member 4), APOA4 (apolipoprotein A-IV), SPINK1 (serine peptidase inhibitor) , Kazal type 1), KNG1 (kininogen 1), CFH (complement factor H), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), C11orf9 (chromosome 11 open reading frame 9), SLCO2B1 (solute carrier organic anion transporter family, member 2B1), RIN2 (Ras and Rab interactor 2), SRPX2 (sushi-repeat-containing protein, X-linked 2), fibrinogen gamma chain (FGG), vitronectin (VTN), klotho beta (KLB), and TIMP metallopeptidase inhibitor 3), CREB3L3 (cAMP responsive element binding protein 3-like 3), DEFB1 (defensin, beta 1), CIDEC (cell death-inducing DFFA-like effector c), ANGPTL6 (angiopoietin-like 6), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10), vascular cell adhesion molecule 1 (VCAM1), colony stimulating factor 1 receptor (CSF1R), kynureninase (L-kynurenine hydrolase) (KYNU), SULT2A1 (su lfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1), receptor (G protein-coupled) activity modifying protein 1), TDO2 (tryptophan 2,3-dioxygenase), AQP10 (aquaporin 10), CTSE (cathepsin E), SLPI (secretory leukocyte peptidase inhibitor), APOC2 (apolipoprotein C-II), SEPP1 (selenoprotein P, plasma, 1), DAB2 (disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)), TFF1 (trefoil factor) 1), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13), FMO1 (flavin containing monooxygenase 1), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1) and HKDC1 (hexokinase domain containing 1).
하기의 단계를 포함하는 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화 단계 판별 방법;
⑴ 인간 배아 줄기 세포로부터 시료를 얻는 단계;
⑵ 하기로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 DNA 탈메틸화를 측정하는 단계:
POU5F1(POU class 5 homeobox 1, 유전자 등록 번호(Genbank Accession No.) NM_002701), DPPA2(developmental pluripotency associated 2, 유전자 등록 번호(Genbank Accession No.) NM_138815), DPEP3(dipeptidase 3, 유전자 등록 번호(Genbank Accession No.) NM_022357), SLC15A3(solute carrier family 15, member 3, 유전자 등록 번호(Genbank Accession No.) NM_016582), USP44(ubiquitin specific peptidase 44, 유전자 등록 번호(Genbank Accession No.) NM_032147), SOX2(SRY (sex determining region Y)-box 2, 유전자 등록 번호(Genbank Accession No.) NM_003106), MT1F(metallothionein 1F, 유전자 등록 번호(Genbank Accession No.) NM_005949), CRABP1(cellular retinoic acid binding protein 1, 유전자 등록 번호(Genbank Accession No.) NM_004378), LECT1(leukocyte cell derived chemotaxin 1, 유전자 등록 번호(Genbank Accession No.) NM_007015), VGF(VGF nerve growth factor inducible, 유전자 등록 번호(Genbank Accession No.) NM_007015), SFRP2(secreted frizzled related protein 2, 유전자 등록 번호(Genbank Accession No.) NT_016354), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), 유전자 등록 번호(Genbank Accession No.) NM_005378), UTF1(undifferentiated embryonic cell transcription factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003577), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, 유전자 등록 번호(Genbank Accession No.) NM_005769), PRDM14(PR domain containing 14, 유전자 등록 번호(Genbank Accession No.) NM_024504), MT1G(metallothionein 1G, 유전자 등록 번호(Genbank Accession No.) NM_005950), CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_005454), GATA4(GATA binding protein 4, 유전자 등록 번호(Genbank Accession No.) NT_077531), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis), 유전자 등록 번호(Genbank Accession No.) NM_031944), LEFTY1(left-right determination factor 1, 유전자 등록 번호(Genbank Accession No.) NM_020997), VWF(von Willebrand factor, 유전자 등록 번호(Genbank Accession No.) NM_000552), NODAL(nodal homolog (mouse), 유전자 등록 번호(Genbank Accession No.) NM_018055), DLX5(distal-less homeobox 5, 유전자 등록 번호(Genbank Accession No.) NT_007933), FOXC1(forkhead box C1, 유전자 등록 번호(Genbank Accession No.) NM_001453), KCNK12(potassium channel, subfamily K, member 12, 유전자 등록 번호(Genbank Accession No.) NM_022055), SOX17(SRY (sex determining region Y)-box 17, 유전자 등록 번호(Genbank Accession No.) NM_022454), LEFTY2(left-right determination factor 2, 유전자 등록 번호(Genbank Accession No.) NM_003240), SERPINA3(serpin peptidase inhibitor, clade A , member 3, 유전자 등록 번호(Genbank Accession No.) NM_001085), AGT(angiotensinogen, 유전자 등록 번호(Genbank Accession No.) NM_000029), AFP(alpha-fetoprotein, 유전자 등록 번호(Genbank Accession No.) NM_001134), TM4SF4(transmembrane 4 L six family member 4, 유전자 등록 번호(Genbank Accession No.) NM_004617), APOA4(apolipoprotein A-IV, 유전자 등록 번호(Genbank Accession No.) NM_000482), SPINK1(serine peptidase inhibitor, Kazal type 1, 유전자 등록 번호(Genbank Accession No.) NM_003122), KNG1(kininogen 1, 유전자 등록 번호(Genbank Accession No.) NM_000893), CFH(complement factor H, 유전자 등록 번호(Genbank Accession No.) NM_000186), ALDH1A1(aldehyde dehydrogenase 1 family, member A1, 유전자 등록 번호(Genbank Accession No.) NM_000689), C11orf9(chromosome 11 open reading frame 9, 유전자 등록 번호(Genbank Accession No.) NM_013279), SLCO2B1(solute carrier organic anion transporter family, member 2B1, 유전자 등록 번호(Genbank Accession No.) NM_007256), RIN2(Ras and Rab interactor 2, 유전자 등록 번호(Genbank Accession No.) NM_018993), SRPX2(sushi-repeat-containing protein, X-linked 2, 유전자 등록 번호(Genbank Accession No.) NM_014467), FGG(fibrinogen gamma chain, 유전자 등록 번호(Genbank Accession No.) NM_000509), VTN(vitronectin, 유전자 등록 번호(Genbank Accession No.) NM_000638), KLB(klotho beta, 유전자 등록 번호(Genbank Accession No.) NM_175737), TIMP3(TIMP metallopeptidase inhibitor 3, 유전자 등록 번호(Genbank Accession No.) NT_011520), CREB3L3(cAMP responsive element binding protein 3-like 3, 유전자 등록 번호(Genbank Accession No.) NM_032607), DEFB1(defensin, beta 1, 유전자 등록 번호(Genbank Accession No.) NM_005218), CIDEC(cell death-inducing DFFA-like effector c, 유전자 등록 번호(Genbank Accession No.) NM_022094), ANGPTL6(angiopoietin-like 6, 유전자 등록 번호(Genbank Accession No.) NM_031917), KBTBD10(kelch repeat and BTB (POZ) domain containing 10, 유전자 등록 번호(Genbank Accession No.) NM_006063), VCAM1(vascular cell adhesion molecule 1, 유전자 등록 번호(Genbank Accession No.) NM_001078), CSF1R(colony stimulating factor 1 receptor, 유전자 등록 번호(Genbank Accession No.) NM_005211), KYNU(kynureninase (L-kynurenine hydrolase), 유전자 등록 번호(Genbank Accession No.) NM_003937), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1, 유전자 등록 번호(Genbank Accession No.) NM_003167), RAMP1(receptor (G protein-coupled) activity modifying protein 1, 유전자 등록 번호(Genbank Accession No.) NM_005855), TDO2(tryptophan 2,3-dioxygenase, 유전자 등록 번호(Genbank Accession No.) NM_005651), AQP10(aquaporin 10, 유전자 등록 번호(Genbank Accession No.) NM_080429), CTSE(cathepsin E, 유전자 등록 번호(Genbank Accession No.) NM_001910), SLPI(secretory leukocyte peptidase inhibitor, 유전자 등록 번호(Genbank Accession No.) NM_003064), APOC2(apolipoprotein C-II, 유전자 등록 번호(Genbank Accession No.) NM_000483), SEPP1(selenoprotein P, plasma, 1, 유전자 등록 번호(Genbank Accession No.) NM_005410), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila), 유전자 등록 번호(Genbank Accession No.) NM_001343), TFF1(trefoil factor 1, 유전자 등록 번호(Genbank Accession No.) NM_003225), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13, 유전자 등록 번호(Genbank Accession No.) NM_002242), FMO1(flavin containing monooxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_002021), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2, 유전자 등록 번호(Genbank Accession No.) NM_002153), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, 유전자 등록 번호(Genbank Accession No.) NM_000302) 및 HKDC1(hexokinase domain containing 1, 유전자 등록 번호(Genbank Accession No.) NM_025130).; 및
⑶ 하기 ⒜의 군으로부터 선택되는 어느 하나 이상의 유전자가 배아 줄기 세포-특이적으로 DNA 탈메틸화되면 미분화 단계인 것으로 판별하고, 하기 ⒝의 군으로부터 선택되는 어느 하나 이상의 유전자가 내배엽 전구체-특이적으로 DNA 탈메틸화되면 분화 중인 단계인 것으로 판별하며, 또는 하기 ⒞의 군으로부터 선택되는 어느 하나 이상의 유전자가 성숙한 간세포-특이적으로 DNA 탈메틸화되면 간세포로 분화한 단계인 것으로 판별하는 단계:
⒜ POU5F1(POU class 5 homeobox 1), DPPA2(developmental pluripotency associated 2), DPEP3(dipeptidase 3), SLC15A3(solute carrier family 15, member 3), USP44(ubiquitin specific peptidase 44), SOX2(SRY (sex determining region Y)-box 2), MT1F(metallothionein 1F), CRABP1(cellular retinoic acid binding protein 1), LECT1(leukocyte cell derived chemotaxin 1), VGF(VGF nerve growth factor inducible), SFRP2(secreted frizzled related protein 2), MYCN(-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), UTF1(undifferentiated embryonic cell transcription factor 1), CHST4(carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4), PRDM14(PR domain containing 14), MT1G(metallothionein 1G),
⒝ CER1(cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4(GATA binding protein 4), MIXL1(Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1(left-right determination factor 1), VWF(von Willebrand factor), NODAL(nodal homolog (mouse)), DLX5(distal-less homeobox 5), FOXC1(forkhead box C1), KCNK12(potassium channel, subfamily K, member 12), SOX17(SRY (sex determining region Y)-box 17), LEFTY2(left-right determination factor 2),
⒞ SERPINA3(serpin peptidase inhibitor, clade A , member 3), AGT(angiotensinogen), AFP(alpha-fetoprotein), TM4SF4(transmembrane 4 L six family member 4), APOA4(apolipoprotein A-IV), SPINK1(serine peptidase inhibitor, Kazal type 1), KNG1(kininogen 1), CFH(complement factor H), ALDH1A1(aldehyde dehydrogenase 1 family, member A1), C11orf9(chromosome 11 open reading frame 9), SLCO2B1(solute carrier organic anion transporter family, member 2B1), RIN2(Ras and Rab interactor 2), SRPX2(sushi-repeat-containing protein, X-linked 2), FGG(fibrinogen gamma chain), VTN(vitronectin), KLB(klotho beta), TIMP3(TIMP metallopeptidase inhibitor 3), CREB3L3(cAMP responsive element binding protein 3-like 3), DEFB1(defensin, beta 1), CIDEC(cell death-inducing DFFA-like effector c), ANGPTL6(angiopoietin-like 6), KBTBD10(kelch repeat and BTB (POZ) domain containing 10), VCAM1(vascular cell adhesion molecule 1), CSF1R(colony stimulating factor 1 receptor), KYNU(kynureninase (L-kynurenine hydrolase)), SULT2A1(sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1), RAMP1(receptor (G protein-coupled) activity modifying protein 1), TDO2(tryptophan 2,3-dioxygenase), AQP10(aquaporin 10), CTSE(cathepsin E), SLPI(secretory leukocyte peptidase inhibitor), APOC2(apolipoprotein C-II), SEPP1(selenoprotein P, plasma, 1), DAB2(disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)), TFF1(trefoil factor 1), KCNJ13(potassium inwardly rectifying channel, subfamily J, member 13), FMO1(flavin containing monooxygenase 1), HSD17B2(hydroxysteroid (17-beta) dehydrogenase 2), PLOD1(procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1), HKDC1(hexokinase domain containing 1).
Differentiation stage determination method from human embryonic stem cells to hepatocytes comprising the following steps;
시료 obtaining a sample from human embryonic stem cells;
DNA measuring DNA demethylation of any one or more genes selected from the group consisting of:
POU5F1 (POU class 5 homeobox 1, Genbank Accession No. NM_002701), DPPA2 (developmental pluripotency associated 2), Gene Accession Number (Genbank Accession No.) NM_138815, DPEP3 (dipeptidase 3, Gene Accession Number (Genbank Accession) No.) NM_022357), SLC15A3 (solute carrier family 15, member 3, Gene Accession No. NM_016582), USP44 (ubiquitin specific peptidase 44, Gene Accession No. NM_032147), SOX2 (SRY (sex determining region Y) -box 2, Genbank Accession No. NM_003106, MT1F (metallothionein 1F, Genbank Accession No. NM_005949), CRABP1 (cellular retinoic acid binding protein 1, gene registration Number (Genbank Accession No.) NM_004378), LECT1 (leukocyte cell derived chemotaxin 1, gene accession number (Genbank Accession No.) NM_007015), VGF (VGF nerve growth factor inducible, gene accession number (Genbank Accession No.) NM_007015), SFRP2 (secreted frizzled relat ed protein 2, gene accession number (Genbank Accession No.) NT_016354), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), gene accession number (Genbank Accession No.) NM_005378), UTF1 (undifferentiated embryonic cell transcription factor 1, Genbank Accession No. NM_003577), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, Genebank Accession No. NM_005769), PRDM14 (PR domain containing 14, gene accession number (Genbank Accession No.) NM_024504), MT1G (metallothionein 1G, gene accession number (Genbank Accession No.) NM_005950), CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis), gene accession number (Genbank Accession No.) NM_005454), GATA4 (GATA binding protein 4, Genbank Accession No.) NT_077531), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis), Gene Accession No. NM_031944), LEFTY1 (left- right determination factor 1, u Electronic Bank Identification Number (Genbank Accession No.) NM_020997, VWF (von Willebrand factor, Genbank Accession No. NM_000552), NODAL (nodal homolog (mouse), Gene Bank Accession No. NM_018055), DLX5 (distal-less homeobox 5, Genbank Accession No. NT_007933), FOXC1 (forkhead box C1, Genbank Accession No. NM_001453), KCNK12 (potassium channel, subfamily K, member 12, gene Genbank Accession No. (NM_022055), SOX17 (sex determining region Y) -box 17, Genbank Accession No. (NM_022454), LEFTY2 (left-right determination factor 2, gene registration number (Genbank) Accession No.) NM_003240), SERPINA3 (serpin peptidase inhibitor, clade A, member 3, Genbank Accession No. NM_001085), AGT (angiotensinogen, Genbank Accession No.) NM_000029), AFP (alpha) fetoprotein, Genbank Accession No. NM_001134, TM4SF4 (t ransmembrane 4 L six family member 4, gene accession number (Genbank Accession No.) NM_004617), APOA4 (apolipoprotein A-IV, gene accession number (Genbank Accession No.) NM_000482), SPINK1 (serine peptidase inhibitor, Kazal type 1, gene Accession number (Genbank Accession No.) NM_003122), KNG1 (kininogen 1, gene accession number (Genbank Accession No.) NM_000893), CFH (complement factor H, Genbank Accession No.) NM_000186), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1, Genbank Accession No. NM_000689), C11orf9 (chromosome 11 open reading frame 9, Gene Accession No. NM_013279), SLCO2B1 (solute carrier organic anion transporter family, member 2B1 , Genbank Accession No. NM_007256, RIN2 (Ras and Rab interactor 2, Genbank Accession No. NM_018993), SRPX2 (sushi-repeat-containing protein, X-linked 2, gene accession number (Genbank Accession No.) NM_014467), FGG (fi brinogen gamma chain, Genbank Accession No. NM_000509, VTN (vitronectin, Genbank Accession No. NM_000638), KLB (klotho beta, Genbank Accession No. NM_175737), TIMP3 (TIMP metallopeptidase inhibitor 3, Genbank Accession No. NT_011520), CREB3L3 (cAMP responsive element binding protein 3-like 3, Gene accession No. NM_032607), DEFB1 (defensin, beta 1, gene Accession number (Genbank Accession No.) NM_005218), cell death-inducing DFFA-like effector c, gene accession number (Genbank Accession No.) NM_022094), ANGPTL6 (angiopoietin-like 6, gene accession number (Genbank Accession No. ) NM_031917), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10, Genebank Accession No. NM_006063), VCAM1 (vascular cell adhesion molecule 1, Genebank Accession No. NM_001078), CSF1R (colony stimulating factor 1 receptor, gene GenBank Accession No. NM_005211, kynureninase (KYNU) (L-kynurenine hydrolase), Genbank Accession No. NM_003937, SULT2A1 (sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1, Genbank Accession No. NM_003167), RAMP1 (receptor (G protein-coupled) activity modifying protein 1, Genebank Accession No.) NM_005855), TDO2 (tryptophan 2,3-dioxygenase, gene Accession number (Genbank Accession No.) NM_005651), AQP10 (aquaporin 10, gene accession number (Genbank Accession No.) NM_080429), CTSE (cathepsin E, gene accession number (Genbank Accession No.) NM_001910), secretory leukocyte peptidase inhibitor, gene accession number (Genbank Accession No.) NM_003064), APOC2 (apolipoprotein C-II, gene accession number (Genbank Accession No.) NM_000483), SEPP1 (selenoprotein P, plasma, 1, gene accession number (Genbank Accession No. NM_005410), DAB2 (disabled homolog 2, mitogen-re sponsive phosphoprotein (Drosophila), Genbank Accession No. NM_001343, TFF1 (trefoil factor 1, Genbank Accession No. NM_003225), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13, gene Accession number (Genbank Accession No.) NM_002242), FMO1 (flavin containing monooxygenase 1, gene accession number (Genbank Accession No.) NM_002021), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2, gene accession number (Genbank Accession No.) NM_002153), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1, Genbank Accession No. NM_000302) and HKDC1 (hexokinase domain containing 1, Genebank Accession No. NM_025130); And
어느 any one or more genes selected from the group of VII are determined to be undifferentiated when embryonic stem cell-specifically DNA demethylated, and at least one gene selected from the group of VII is endoderm precursor-specific DNA Determining that it is in the stage of differentiation upon demethylation, or determining that any one or more genes selected from the group of the following is a stage for differentiation into hepatocytes when mature hepatocyte-specific DNA demethylation:
OU POU5F1 (POU class 5 homeobox 1), DPPA2 (developmental pluripotency associated 2), DPEP3 (dipeptidase 3), SLC15A3 (solute carrier family 15, member 3), USP44 (ubiquitin specific peptidase 44), SOX2 (SRY (sex determining region) Y) -box 2), metallothionein 1F (MT1F), cellular retinoic acid binding protein 1 (CRABP1), leukocyte cell derived chemotaxin 1 (LECT1), VGF nerve growth factor inducible (VGF), secreted frizzled related protein 2 (SFRP2), MYCN (-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)), UTF1 (undifferentiated embryonic cell transcription factor 1), CHST4 (carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4), PRDM14 (PR domain containing 14), MT1G (metallothionein 1G),
ER CER1 (cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)), GATA4 (GATA binding protein 4), MIXL1 (Mix1 homeobox-like 1 (Xenopus laevis)), LEFTY1 (left-right determination factor 1), VWF ( von Willebrand factor, NODAL (nodal homolog (mouse)), DLX5 (distal-less homeobox 5), FOXC1 (forkhead box C1), KCNK12 (potassium channel, subfamily K, member 12), SOX17 (SRY (sex determining region Y) ) -box 17), LEFTY2 (left-right determination factor 2),
RP SERPINA3 (serpin peptidase inhibitor, clade A, member 3), AGT (angiotensinogen), AFP (alpha-fetoprotein), TM4SF4 (transmembrane 4 L six family member 4), APOA4 (apolipoprotein A-IV), SPINK1 (serine peptidase inhibitor) , Kazal type 1), KNG1 (kininogen 1), CFH (complement factor H), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), C11orf9 (chromosome 11 open reading frame 9), SLCO2B1 (solute carrier organic anion transporter family, member 2B1), RIN2 (Ras and Rab interactor 2), SRPX2 (sushi-repeat-containing protein, X-linked 2), fibrinogen gamma chain (FGG), vitronectin (VTN), klotho beta (KLB), and TIMP metallopeptidase inhibitor 3), CREB3L3 (cAMP responsive element binding protein 3-like 3), DEFB1 (defensin, beta 1), CIDEC (cell death-inducing DFFA-like effector c), ANGPTL6 (angiopoietin-like 6), KBTBD10 (kelch repeat and BTB (POZ) domain containing 10), vascular cell adhesion molecule 1 (VCAM1), colony stimulating factor 1 receptor (CSF1R), kynureninase (L-kynurenine hydrolase) (KYNU), SULT2A1 (su lfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1), receptor (G protein-coupled) activity modifying protein 1), TDO2 (tryptophan 2,3-dioxygenase), AQP10 (aquaporin 10), CTSE (cathepsin E), secretory leukocyte peptidase inhibitor (SLPI), apolipoprotein C-II (APOC2), selenoprotein P, plasma, 1), DAB2 (disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)), TFF1 (trefoil factor) 1), KCNJ13 (potassium inwardly rectifying channel, subfamily J, member 13), FMO1 (flavin containing monooxygenase 1), HSD17B2 (hydroxysteroid (17-beta) dehydrogenase 2), PLOD1 (procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1), HKDC1 (hexokinase domain containing 1).
제 8항 또는 제 9항 중 어느 한 항에 있어서, 상기 시료는 게놈 DNA, mRNA 또는 단백질인 것을 특징으로 하는 방법.
10. The method of any one of claims 8 or 9, wherein said sample is genomic DNA, mRNA or protein.
제 8항에 있어서, 상기 유전자의 발현량은 마이크로어레이 또는 정량적 RT-PCR(qRT-PCR)으로 측정하는 것을 특징으로 하는 방법.
The method of claim 8, wherein the expression level of the gene is measured by microarray or quantitative RT-PCR (qRT-PCR).
제 9항에 있어서, 상기 DNA 탈메틸화는 마이크로어레이 또는 파이로시퀀싱(pyrosequencing)으로 측정하는 것을 특징으로 하는 방법.
10. The method of claim 9, wherein said DNA demethylation is determined by microarray or pyrosequencing.
하기의 단계를 포함하는 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화를 촉진하는 후보 물질을 스크리닝하는 방법;
⑴ 제 1항의 마이크로어레이 칩에 피검 화합물 또는 조성물을 처리하는 단계;
⑵ 상기 마이크로어레이 칩에 집적된 유전자의 발현량 또는 DNA 탈메틸화를 측정하는 단계; 및
⑶ 단계 ⑵의 내배엽 전구체-특이적 유전자 또는 성숙한 간세포-특이적 유전자의 발현량을 증가시키거나, 또는 내배엽 전구체-특이적 유전자 또는 성숙한 간세포-특이적 유전자를 DNA 탈메틸화시키는 피검 화합물 또는 조성물을 인간 배아 줄기 세포로부터 간세포(hepatocytes)로의 분화를 촉진하는 후보 물질로 판정하는 단계.
A method for screening candidate substances for promoting differentiation from human embryonic stem cells into hepatocytes, comprising the following steps;
(B) treating the test compound or composition to the microarray chip of claim 1;
Measuring DNA expression or DNA demethylation of the gene integrated in the microarray chip; And
A test compound or composition which increases the expression level of the endoderm precursor-specific gene or mature hepatocyte-specific gene of step VII or DNA demethylates the endoderm precursor-specific gene or mature hepatocyte-specific gene. Determining as a candidate to promote differentiation from embryonic stem cells to hepatocytes.
제 13항에 있어서, 상기 유전자의 발현량은 마이크로어레이 또는 정량적 RT-PCR(qRT-PCR)으로 측정하는 것을 특징으로 하는 방법.
The method of claim 13, wherein the expression level of the gene is measured by microarray or quantitative RT-PCR (qRT-PCR).
제 13항에 있어서, 상기 DNA 탈메틸화는 마이크로어레이 또는 파이로시퀀싱(pyrosequencing)으로 측정하는 것을 특징으로 하는 방법.
The method of claim 13, wherein said DNA demethylation is determined by microarray or pyrosequencing.
KR1020110031848A 2011-04-06 2011-04-06 DNA methylation markers for detecting hepatogenesis and a method for detecting using the same KR101381319B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110031848A KR101381319B1 (en) 2011-04-06 2011-04-06 DNA methylation markers for detecting hepatogenesis and a method for detecting using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110031848A KR101381319B1 (en) 2011-04-06 2011-04-06 DNA methylation markers for detecting hepatogenesis and a method for detecting using the same

Publications (2)

Publication Number Publication Date
KR20120114084A true KR20120114084A (en) 2012-10-16
KR101381319B1 KR101381319B1 (en) 2014-04-04

Family

ID=47283438

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110031848A KR101381319B1 (en) 2011-04-06 2011-04-06 DNA methylation markers for detecting hepatogenesis and a method for detecting using the same

Country Status (1)

Country Link
KR (1) KR101381319B1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106104273A (en) * 2013-12-12 2016-11-09 施特姆森特克斯股份有限公司 Novel anti-DPEP3 antibody and using method
WO2019240247A1 (en) * 2018-06-15 2019-12-19 公立大学法人横浜市立大学 Undifferentiated cell detection method
CN114651069A (en) * 2019-11-15 2022-06-21 公立大学法人横滨市立大学 Undifferentiated cell assay

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106104273A (en) * 2013-12-12 2016-11-09 施特姆森特克斯股份有限公司 Novel anti-DPEP3 antibody and using method
WO2019240247A1 (en) * 2018-06-15 2019-12-19 公立大学法人横浜市立大学 Undifferentiated cell detection method
CN112262217A (en) * 2018-06-15 2021-01-22 公立大学法人横滨市立大学 Undifferentiated cell assay
JPWO2019240247A1 (en) * 2018-06-15 2021-07-08 公立大学法人横浜市立大学 Undifferentiated cell detection method
EP3808856A4 (en) * 2018-06-15 2022-03-09 Public University Corporation Yokohama City University Undifferentiated cell detection method
JP2022118061A (en) * 2018-06-15 2022-08-12 公立大学法人横浜市立大学 Method for detecting undifferentiated cells
CN114651069A (en) * 2019-11-15 2022-06-21 公立大学法人横滨市立大学 Undifferentiated cell assay
EP4059960A4 (en) * 2019-11-15 2023-12-27 Public University Corporation Yokohama City University Method for detecting undifferentiated cells

Also Published As

Publication number Publication date
KR101381319B1 (en) 2014-04-04

Similar Documents

Publication Publication Date Title
CA2812194C (en) Functional genomics assay for characterizing pluripotent stem cell utility and safety
Sharova et al. Global gene expression profiling reveals similarities and differences among mouse pluripotent stem cells of different origins and strains
KR101287600B1 (en) Prognostic Genes for Early Breast Cancer and Prognostic Model for Early Breast Cancer Patients
US20100166713A1 (en) Early mesoderm cells, a stable population of mesendoderm cells that has utility for generation of endoderm and mesoderm lineages and multipotent migratory cells (mmc)
Cuna et al. Alterations in gene expression and DNA methylation during murine and human lung alveolar septation
WO2016103269A1 (en) Populations of neural progenitor cells and methods of producing and using same
Kim et al. Profiling of differentially expressed genes in human stem cells by cDNA microarray
Sun et al. Global comparison of gene expression between subcutaneous and intramuscular adipose tissue of mature Erhualian pig
KR20090121842A (en) Biomarker for identification of exposure to chrysene and the method of identification using thereof
US20220081685A1 (en) Cell-free rna library preparations
KR101381319B1 (en) DNA methylation markers for detecting hepatogenesis and a method for detecting using the same
Adlat et al. Global transcriptome study of Dip2B-deficient mouse embryonic lung fibroblast reveals its important roles in cell proliferation and development
Gallagher et al. Use of microarrays for investigating the subtoxic effects of snake venoms: insights into venom-induced apoptosis in human umbilical vein endothelial cells
EP2460876B1 (en) Method for identifying senescent mesenchymal stem cells
Iglesias-Ussel et al. Isolation of microarray-quality RNA from primary human cells after intracellular immunostaining and fluorescence-activated cell sorting
WO2011046635A1 (en) Differentially methylated regions of reprogrammed induced pluripotent stem cells, method and compositions thereof
Kim et al. Identification of DNA methylation markers for lineage commitment of in vitro hepatogenesis
KR101725985B1 (en) Prognostic Genes for Early Breast Cancer and Prognostic Model for Early Breast Cancer Patients
Wang et al. Rapid and dynamic alterations of gene expression profiles of adult porcine bone marrow-derived stem cell in response to hypoxia
Carinci et al. P‐15 cell‐binding domain derived from collagen: Analysis of MG63 osteoblastic‐cell response by means of a microarray technology
US10294527B2 (en) Epigenetic marker for the identification of natural killer cells
Sainz et al. Genome-wide gene expression analysis in mouse embryonic stem cells
KR101735762B1 (en) Prediction method for swine fecundity using gene expression profile
US20200032249A1 (en) Labeling, isolation, &amp; analysis of rna from rare cell populations
EP3218478B1 (en) Predicting productivity in early cell line development

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20170328

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180205

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20190207

Year of fee payment: 6