KR20120096917A - Recombinant multiplex polymerase chain reaction primer set detecting diarrhoeal typed toxin and emetic typed toxin simultaneously - Google Patents

Abstract

PURPOSE: A multiplex PCR primer set which is recombined for diarrhea poison and vomitoxin of Bacillus cereus detection is provided to rapidly and accurately detect Bacillus cereus. CONSTITUTION: A multiplex PCR primer set is recombined for detecting diarrhea poison and vomitoxin of Bacillus cereus, and is composed of a reverse primer described in the sequence number 8 and a forward primer described in the sequence number 7(SEQ ID NO:7). G+C rate is 40-60% in order to strongly maintain the coherence between the template DNA and the primer set. The multiplex PCR primer set additionally includes a reverse primer described in the sequence number 2 and a forward primer described in the sequence number 1. The multiplex PCR primer set additionally includes a reverse primer described in the sequence number 4 and a forward primer described in the sequence number 3. The multiplex PCR primer set additionally includes a reverse primer described in the sequence number 10 and a forward primer described in the sequence number 9.

Description

{Recombinant multiplex polymerase chain reaction primer set detecting diarrhoeal typed toxin and emetic typed toxin simultaneously}

The present invention relates to a recombined multiplex polymerase chain reaction primer set to simultaneously detect vomiting toxin and diarrheal toxin of Bacillus cereus.

It may be a recombined multiplex polymerase chain reaction primer set, characterized in that the G+C ratio is 40 to 60% so as to strongly maintain the binding force between the primer and the template DNA.

In addition, the present invention relates to a method for detecting vomiting toxin and diarrheal toxin of Bacillus cerius, characterized in that the recombinant multiplex polymerase chain reaction primer set is used.

And it relates to a test kit for detecting vomiting toxin and diarrheal toxin of Bacillus cerius, characterized in that it comprises the recombined multiplex polymerase chain reaction primer set.

Conventionally, “non-detection” standards have been applied to food poisoning bacteria for instant foods and convenience foods such as salads and kimbap. However, in accordance with the recent improvement in accordance with the reality, it was announced as a new type in the food code, and as the microbial standard was announced in advance, a quantitative standard for Bacillus cerius was newly established for the non-heated ready-to-eat food. In more detail, for ready-to-eat foods and convenience foods, Bacillus cerius stipulated less than 1,000 animals per gram for processed foods for which no separate standard was established.

There are two types of food poisoning caused by Bacillus cerius: the diarrhoeal type, which is caused by enterotoxin, and the emetic type, which is caused by emetic toxin. First of all, in the case of diarrhea, it is caused by various foods such as cooking using spices, soup of meat and vegetables, pudding, vanilla sauce, sausage, and cream. Next, the vomiting type is usually caused by carbohydrate foods such as rice or fried rice, which is a cooking food.

Comparing the two, first of all, diarrheal toxin (enterotoxin) has a molecular weight of 5.5? It is a high molecular protein of 60,000 and is composed of about 17 amino acids. Bacillus cerius is produced by proliferation in the intestinal tract. It is weak against heat and destroyed by heating at 60℃ for 20 minutes, and is sensitive to changes in pH. On the other hand, emetic toxin is a toxin produced in food and is a low-molecular peptide with a molecular weight of 10,000 or less (cerulide). It is not destroyed even when heated to 128℃ for 90 minutes. It is very resistant to proteolytic enzymes. Therefore, it is more often caused by the vomiting toxin of food poisoning.

The symptoms of diarrhea caused by Bacillus cerius are similar to those of Clostridium perfringenes food poisoning, and water-borne diarrhea, dizziness, and abdominal pain occur 6 to 16 hours after food intake. On the other hand, the symptoms of vomiting caused by Bacillus cerius are similar to those of food poisoning caused by Staphylococcus aureus, causing nausea and vomiting in an incubation period of 1 to 5 hours, but sometimes severe abdominal pain and diarrhea. , Symptoms have a characteristic that subsides within 24 hours.

In the case of diarrhea type food poisoning, it is caused by enterotoxin, which is weak in heat resistance, and shows clinical symptoms of diarrhea and abdominal pain, and is reported to occur mainly in Northern Europe such as Norway, Hungary, and Finland. Meanwhile, various genes such as hblA, hblC, hblD, nheA, nheB, nheC, and cytK have been identified as diarrhea-type toxin-generating genes. It's going on.

The prior art related to the present invention is Korean Patent Registration 10-0431586 (Method for detecting toxin-producing micro-cysts), which uses a gene probe capable of specifically detecting toxin-producing micro-cysts to accurately and quickly produce toxins. It relates to a method of detecting. In more detail, the present invention can accurately detect toxin-producing microcysts depending on whether or not toxin is produced even in a sample in which blue-green algae strains are mixed. It is a technology that can be used as a means of environmental monitoring.

In addition, the Korean patent registration 10-0671501 (a primer for detecting food poisoning and a method for detecting bacterial food poisoning using the same) relates to a primer for detecting food poisoning and a method for detecting bacterial food poisoning using the same. In more detail, the present invention is a PCR primer capable of amplifying the specific genes of each of Salmonella sp. strain, Staphylococcus aureus, E. coli O157, Listeria monocytogenes and Vibrio parahemoliticus, detection of food poisoning using the primers It relates to a method and a detection kit. However, these prior art technologies are different from the present invention.

1.Technical aspect

Conventionally, high performance liquid chromatography (HPLC), gas chromatography (GC), mass spectrometry (MS), and the like have been used as methods for detecting diarrhea-type toxins.

Recently, a method of identifying diarrheal toxin genes such as hblA, hblB, hblC, nheA, nheB, nheC, and cytK has been used by using polymerase chain reaction (PCR). Furthermore, commercial kits using ELISA (enzyme linked immunoassay) and RPLA (reversed passive latex agglutination) to identify toxin proteins are being developed.

On the other hand, Bacillus cerius producing vomiting toxins has been relatively inadequate compared to the isolation of diarrhea toxin strains so far in studies on physiological aspects related to strain isolation and identification and toxin generation mechanisms. This is thought to be due to the fact that there were almost no reports of vomiting food poisoning caused by Bacillus cerius in Korea.

Unlike diarrhea-type food poisoning, vomiting-type food poisoning is caused by cyclic dodeca depsipeptide cereulide vomiting toxin, which has low-molecular heat resistance, and has been reported separately in the United Kingdom, the United States, and Japan.

However, based on the scientific fact that the low-molecular cyclic amino acid peptide is not produced in the ribosome because the Cereulide-producing gene has not yet been accurately identified, PCR is performed on the target of the NRPS (Non-ribosomal peptide synthetase) gene. Bacillus cerius strains are being identified. In addition, since the toxin gene is not expressed in ribosomes, commercial kits by antigen-antibody reaction have not been developed.

In other words, studies on the physiological aspects related to the isolation and identification of the strain and the mechanism of toxin production for the vomiting toxin-producing Bacillus cerius are relatively inadequate compared to the isolation of the diarrhea-type toxin strain so far, and there are no related studies in Korea.

Currently, it is difficult to accurately identify the vomiting toxin-producing Bacillus cerius strain by searching for genes related to vomiting toxin production using PCR, so the cereulide vomiting toxin produced by the Bacillus cerius strain as a method of confirming the toxin production was tested by sperm assay or A quantitative analysis method using HPLC-MS is used as a standard substance using valinomycin, which is qualitative by cell culture or has a chemical structure and molecular weight very similar to that of cereulide. However, in Korea, the above methods for analyzing vomiting toxins are not yet established. Therefore, the following technology development is required.

First, in Japan, which has similar food culture to Korea, vomiting-type food poisoning is reported to be 10 times higher than that of diarrhea. It is judged that the possibility of vomiting-type food poisoning caused by domestic Bacillus cerius is very high. It is expected that the development of PCR primers that can detect reus quickly and accurately is very necessary.

Second, it is reported that Bacillus cerius produces vomiting toxin and diarrhea type toxin at the same time according to the results of previous experiments in this study and foreign studies. Therefore, it is necessary to develop a technology to screen and identify Bacillus cerius bacteria producing diarrhea and vomiting toxins by developing a multiplex PCR primer kit that can simultaneously detect diarrhea-type toxins and vomiting-type toxins.

2. Economic aspect

Currently, in Korea, a system for food hygiene and food poisoning control measures has been established and improvement measures are being implemented, but the number of food poisoning caused by pathogenic microorganisms is still showing a mass and grouping trend both at home and abroad.

In addition, looking at the current status of food poisoning by food poisoning in Korea, complex cooked foods are reported as the main cause of food poisoning, and countless food poisonings occur every year. The specific gravity that the bacteria are in contact with is very large.

* On the other hand, Bacillus cerius has not many cases of food poisoning itself, but in the case of 2007, as if 50 patients occurred in one accident, it is gradually increasing in size, so group catering or thorough hygiene management of large-scale food establishments is required.

The annual number of food poisoning patients in Korea is about 11.85 million, the total number of hospitalized patients is 154,000, accounting for about 0.3% of the total population, and the cost of socioeconomic losses due to such food poisoning patients is estimated to be KRW 1.31 trillion. This corresponds to 0.28% of Korea's GNP in 2000 and 1.16% of the government budget in 2002 (Park, 2001).

In the United States, there was a loss of US$ 6.6 to 37.1 billion in medical costs and productivity losses due to food poisoning (Buzby, 1997), and in the United Kingdom, the economic effect of the reduction in medical costs and production lines caused by five kinds of pathogenic bacteria was ~ It was estimated to be 700 million (Roberts, 1989), and Australia also reported that 11,500 food poisoning accidents per year resulted in an economic loss of A$ 2.6 billion per year (ANZFA, 1999), and Canada also reported economic losses due to food poisoning by US$ 1.3. It was evaluated in billions (Todd, 1989).

Therefore, in order to identify microbiological hazards of domestically distributed foods including imported foods, a PCR method was established to prevent and post-treat food poisoning accidents that may be caused by related products more quickly and efficiently. There is a need to minimize all loss costs.

3. Social and cultural aspects

As the recent industrial civilization is highly developed, the consumption of processed foods is rapidly increasing as our lifestyles and habits of eating habits change rapidly, and accordingly, the intake of processed foods is increasing rapidly, which is caused by pathogenic microorganisms up to the production, processing, storage and distribution stages of products. Food poisoning-related food safety issues have emerged seriously and can lead to major social problems.

Social issues caused by Bacillus cerius in domestic ready-to-eat foods have recently been pointed out by media reports, especially for kimbap (Korea Consumer Protection Agency, 2007) sold at a specialty kimbap store, fish cake, and tteokbokki sold on the street. , Tempura, Kimbap, Sundae, etc., poor hygiene of street food (Korea Health Industry Development Institute, 2007), kimbap sold at highway rest areas, hamburgers (Chosun Ilbo, 2008), and sold at national bus terminals, train stations, and beach food cooking establishments. The detection rate of Bacillus cerius was found to be high in processed foods with high content of grains or starch, such as kimbap and sandwich (Chosun Ilbo, 2008).

Therefore, according to the rapid increase in the occurrence of food poisoning accidents caused by various food poisoning microorganisms including Bacillus cerius, accident prevention and rapid response by a rapid and accurate detection method are required. Furthermore, it will be said that the presence or absence of a rapid, accurate and standardized detection method for harmful substances in food is a prerequisite for the prevention, diagnosis, and accurate epidemiological investigation of food poisoning accidents.

In order to solve the above problems, the present invention provides a recombined multiplex polymerase chain reaction primer set to simultaneously detect vomiting toxins and diarrheal toxins of Bacillus cereus.

It may be a recombined multiplex polymerase chain reaction primer set, characterized in that the G+C ratio is 40 to 60% so as to strongly maintain the binding force between the primer and the template DNA.

In addition, it provides a method for detecting vomiting toxins and diarrheal toxins of Bacillus cerius, and a test kit for detecting vomiting toxins and diarrheal toxins of Bacillus cerius, characterized by using the recombined multiplex polymerase chain reaction primer set.

1. Technical aspects

Through the PCR Primer of the present invention, it is possible to quickly and accurately detect the vomiting toxin-producing Bacillus cerius. As in Japan, there is a very high possibility of vomiting food poisoning caused by Bacillus cerius in Korea in the future. In addition, according to recent research results, there is a report that B. cereus produces both vomiting toxin and diarrheal toxin. Therefore, the present invention has an advantageous effect of rapidly and accurately detecting the vomiting toxin-producing Bacillus cerius by providing a PCR Primer. Furthermore, in the present invention, a multiplex PCR was developed to simultaneously rapidly and rapidly generate a diarrhea-type toxin gene and a vomiting-type toxin gene. There is an advantageous effect that can be detected properly.

2. Economic aspect

The inspection of hazardous food substances is increasing exponentially due to increasing public health and food safety concerns and desires, strengthening regulations on food safety, enhancing competitiveness through improvement of producers and quality, and safety management of imported food. .

Therefore, in order to ensure the safety of food from B. cereus bacteria, an accurate diagnosis is required for the diagnosis of microorganisms that cause food poisoning. Therefore, as a new technology for securing food safety, the development of a PCR primer kit that develops a rapid detection technique for B. cereus that produces diarrhea and vomiting toxins is more important than ever.

Due to the exponential growth of the food testing market and the development of biotechnology, a diagnostic kit for harmful substances in food equipped with advanced technology is continuously being developed. Therefore, a PCR primer kit that simultaneously detects commercially available diarrhea and vomiting toxins If it is developed wisely after verification, it will be possible to obtain advantageous effects in economic terms such as cost and time and labor savings.

3. Socio-cultural aspect

The present invention is a new technology for securing food safety as an accurate diagnosis of the microorganism causing food poisoning is required in order to secure the safety of food from B. cereus bacteria, and the diarrhea-type toxin gene and the vomiting-type toxin gene are simultaneously and rapidly It contributes to the prevention of food poisoning accidents by developing a detection multiplex PCR system to accurately and efficiently detect toxin generation by B. cereus bacteria and increase the detection rate, and to operate HACCP (Hazard Analysis Critical Control Point) of food companies. By providing a standardized test method, the occurrence of food poisoning can be prevented and food safety can be secured. This can be said to have an advantageous effect of contributing to the improvement of the quality of life in the socio-cultural aspect.

1 is a gel electrophoresis result for the PCR product amplified with multiplex primer of the present invention. Line 1 represents Marker, Line 2 represents B. cereus JNHE 36 (emetic strain), Line 3 represents B. cereus KFDA 213 (entrotoxic strain), and Line 4 represents B. cereus KNIH 28 (emetic strain). And Line 5 represents B. cereus ATCC 12480 (entrotoxic reference strain), and Line 6 represents B. cereus F4810/72 (emetic reference strain).
2 is a gel electrophoresis result for the PCR product amplified with multiplex primer of the present invention. Line 1 represents Marker, Line 2 represents B. cereus JNHE 36 (multiplex), Line 3 represents B. cereus JNHE 36 (cyt K), and Line 4 represents B. cereus JNHE 36 (nhe A) , Line 5 represents B. cereus JNHE 36 (ces), Line 6 represents B. cereus JNHE 36 (CER), Line 7 represents B. cereus JNHE 36 (hblC), and Line 8 represents B. cereus JNHE 36 (hblC) 36 (enrFM), Line 9 represents B. cereus ATCC 12480 (entrotoxic reference strain), Line 10 represents B. cereus F4810/72 (emetic reference strain), and Line 11 represents negative.
3 is a gel electrophoresis result for the PCR product amplified with multiplex primer of the present invention. Line 1 represents Marker, Line 2 represents B. cereus F4810/72 (emetic reference strain), Line 3 represents B. cereus ATCC 12480 (entrotoxic reference strain), and Line 4 represents E. coli KCCM 32396 , Line 5 represents Staphylococcus aureus ATCC 27729, Line 6 represents Salmonella typhimurium ATCC 14028, Line 7 represents Listeria monocytogenes ATCC 19119, Line 8 represents Bacillus subtilis KCCM 11316, Line 9 represents Escherichia coli O157:H7ATCC 43895 And Line 10 indicates Marker.

The present invention relates to a recombined multiplex polymerase chain reaction primer set to simultaneously detect vomiting toxin and diarrheal toxin of Bacillus cereus.

The primers were prepared based on the experimental results obtained by isolating and identifying Bacillus cerius derived from humans, food and environment, and confirming the gene sequence of the isolated and identified Bacillus cerius.

It may be a recombined multiplex polymerase chain reaction primer set, characterized in that the G+C ratio is 40 to 60% so as to strongly maintain the binding force between the primer and the template DNA.

The multiplex PCR primer set includes a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2, a forward primer of SEQ ID NO: 3, a reverse primer of SEQ ID NO: 4, and a forward primer of SEQ ID NO: 5 Consisting of a reverse primer of SEQ ID NO: 6, a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8, a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10, a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12 It may be a recombinant multiplex polymerase chain reaction primer set, characterized in that any one selected from the group.

And the present invention relates to a method for detecting vomiting toxins and diarrheal toxins of Bacillus cerius, characterized in that the recombined multiplex polymerase chain reaction primer set is used.

It also relates to a test kit for detecting vomiting toxin and diarrheal toxin of Bacillus cerius.

Hereinafter, it will be described in detail based on Examples. However, this is to illustrate the present invention and is not intended to limit the scope of the present invention.

<Example 1> Selection of test materials and test strains

1. Selection of experimental materials

From March 2009 to May 2009, 52 samples of rice cake and 56 samples of kimbap were purchased at retail stores and traditional markets in Chuncheon, Gangwon-do, and used as experimental materials.

2. Selection of experimental strains

As for the B. cereus strain used in this experiment, 81 human isolates, 65 grains and 14 foods isolate, were selected as shown in Table 1 below. B. cereus F4810/72 reported to produce vomiting toxin was used as a standard strain.

The strains used in the experiment were 23 weeks from the Jeollabuk-do Health and Environment Research Institute, 13 weeks from the Centers for Disease Control and Prevention, 6 weeks from the Seoul Institute for Health and Environment, and 9 weeks from the Incheon Institute of Health and Environment, including 4 weeks isolated from rice cake and kimbap. 103 weeks in storage and a total of 160 weeks were selected.

These strains were used while being stored in a low temperature freezer at -70°C using a TSB (Trypticase soy btoth) medium (Oxoid, England) containing 20% glycerol.

Selected B. cereus test strain Origin Total Clinical strains (total 81) - Feces 77 Vomit 4 Grain strains (total 65) - Brown rice 14 Glutinous rice 22 Barely 12 Job’s tear 17 Food strains (total 14) - Sunshik 5 Gimbab 3 Meat 2 Korean rice cake 2 Unknown 2 Total 160

<Example 2> Isolation and identification of B. cereus

Separation and identification of B. cereus was performed by aseptically taking 25 g of each sample according to the food code, adding 225 mL of buffer diluent (Oxoid, England), and homogenizing with a homogenizer (Bagmixer 400 Stomacher, Interscience, France) for 15 minutes. Thereafter, the homogenized sample solution was plated on MYP (Mannitol egg Yolk Polymyxin agar) agar medium (Difo, Fetroit, Mich) and incubated for 24 hours at 37°C.

Among the cultured colonies, bright red typical colonies were selected and spread on TSA medium (Oxoid, England), cultured at 37°C for 24 hours, and then gram-stained to confirm motility as gram-positive, long-formed bacillus with spores. Was confirmed to be B. cereus using API 50CHB (bioMerieix Inc. Durham, NC) and API 20E (bioMerieix Inc. Durham, NC) biochemical identification kit. The final confirmed B. cereus was stored at -70°C and used in the experiment.

<Example 3> Analysis of diarrheal toxin gene of B. cereus

1. Isolation of DNA

Emetic toxin-producing isolates were cultured in TSB (Trypticase soy btoth) medium (Oxoid, England) for 12 hours at 35°C, taken 1 ml in an Eppendorf Tube, and centrifuged to remove the supernatant, leaving only the cells. Then, the mixture was allowed to stand in boiling water for 10 minutes, and then allowed to stand on ice for 2 hours using a DNA extraction kit, followed by centrifugation, and the supernatant was used.

The diarrheal toxin-producing strain is cultured in TSB medium at 35°C for 12 hours, then 1 ml of the sample solution obtained is taken into an eppendorf tube, and the supernatant is removed by centrifugation (14,000 rpm, 3 minutes), and the remaining cells are suspended in 500 sterilized distilled water. And, the washing process was repeated twice. DNA extract (Celex 100) 100 was added to the cells and homogenized to suspend the cells, fully heated at 95° C. for 20 minutes to completely destroy the cells, and then centrifuged (14,000 rpm, 10 minutes) to use the supernatant as a DNA template. .

2. Diarrhea gene detection

The composition of the reaction solution was prepared to contain 10 mM Tris-HCl, 1.5 mM MgCl2, 40 mM KCl, 0.001% gelatin, 250 μM dNTP, 30 pM primer, 1 U Taq polymerase, and then the primers shown in Table 2 were used. Thus, the DNA amplified under each reaction condition, and the amplified DNA was electrophoresed for 50 minutes at 100 volt using a TBE buffer on a 1.5% agarose gel, and then the PCR results were confirmed using an imege analysis system.

Sequences of primers and PCR reaction conditions used in this study Amplification target Primer Sequence (5'-3') Reaction condition Amplicon size (bp) nheA NHA F GTTAGGATCACAATCACCGC 94℃ 2min →(94℃ 60 sec→56℃ 60 sec
→72℃ 120 sec) 35 cycle →2℃ 5 min 755 NHA R ACGAATGTAATTTGAGTCGC nheB NHB F TTTAGTAGTGGATCTGTACGC 94℃ 2min →(94℃ 60 sec→54℃ 60 sec
→72℃ 120 sec) 35 cycle →2℃ 5 min 743 NHB R TTAATGTTCGTTAATCCTGC nheC NHC F TGGATTCCAAGATGTAACG 94℃ 2min →(94℃ 60 sec→54℃ 60 sec
→72℃ 120 sec) 35 cycle →2℃ 5 min 683 NHC R ATTACGACTTCTGCTTGTGC hblC HBC F GATACTCAATGTGGCAACTGC 94℃ 2min→(94℃ 60 sec→58℃ 60 sec
→72℃ 120 sec) 35 cycle →2℃ 5 min 740 HBC R TTGAGACTGCTCGTCTAGTTG hblD HBD F ACCGGTAACACTATTCATGC 94℃ 2min→(94℃ 60 sec→58℃ 60 sec
→72℃ 120 sec) 35 cycle →2℃, 5 min 829 HBD R GAGTCCATATGCTTAGATGC hblA HBA F AAGCAATGGAATACAATGGG 94℃, 2min → (94℃, 60 sec→56℃, 60 sec
→72℃, 120 sec) 35 cycle →72℃, 5 min 1,154 HBA R AGAATCTAAATCATGCCACTGC entFM ENT F AAAGAAATTAATGGACAAACTCAAACTCA 95℃ 3min →(95℃ 30 sec→60℃ 30 sec
→72℃ 60 sec) 35 cycle →2℃ 5min 596 ENT R GTATGTAGCTGGGCCTGTACGT cytK CYK F GTAACTTTCATTGATGATCC 95℃ 1min→(95℃ 60 sec→48℃ 60 sec
→72℃ 60 sec) 30 cycle →2℃ 7 min 505 CYK R GAATACTAAATAATTGGTTTCC

<Example 4> Gene sequencing analysis

A universal primer that can amplify the vomiting toxin-related gene by securing the gene sequence related to the vomiting toxin of B. cereus registered in the Gene Bank (NCBI, National Center for Biotechnology Information) was prepared. , PCR was performed using the above primers, and the nucleotide sequence was determined (sequencing) for the amplified DNA fragment.

<Example 5> Analysis of sensitivity, specificity and accuracy of PCR primers for vomiting toxin detection

In order to measure the sensitivity, specificity, and accuracy of the previously reported emetic toxin gene detection PCR primer, PCR was performed under the conditions as shown in Table 3 below. Sensitivity, specificity and accuracy were calculated according to Greenhalgh (1997).

PCR primers and cycling conditions for the detection of emetic toxin producing B. cereus Primer name Primer sequence (5'-3') PCR cycling conditions Amplicon size (bp) CER ATCATAAAGGTGCGAACAAGAAAGATCAACCGAATGCAACTG 95℃ 10min→(94℃ 60sec→52℃ 60sec
→72℃ 60sec) 35 cycle →2℃ 5min 188 EM1 GACAAGAGAAATTTCTACGAGCAAGTACAATGCAGCCTTCCAATTACTCCTTCTGCCACAGT 95℃ 15min→(95℃ 30sec→60℃ 30sec
→72℃ 60sec) 30 cycle →2℃ 5min 635 RE234 AACGTCGGTATGATTTTAGGCTCTTCTGCTCTCTATTTATGTC 95℃ 1min →(95℃ 5sec→54℃ 10sec
→72℃ 20sec) 35 cycle →2℃ 5min 234 CES GGTGACACATTATCATATAAGGTGGTAAGCGAACCTGTCTGTAACAACA 95℃ 15min →(95℃ 60sec→53℃ 75sec→
72℃ 50sec) 5 cycle →(95℃ 60sec→58℃ 75sec
→72℃ 50sec) 25 cycle →72℃ 5min 1,271 Ces3R
CESR2 TTGTTGGAATTGTCGCAGAGGTAAGCGAACCTGTCTGTAACAACA 95℃ 3min →(95℃ 30sec→60℃, 30sec
→72℃ 60sec) 35 cycle →2℃ 5min 405

<Example 6> Development of PCR primer kit for simultaneous detection of B. cereus

1. PCR primer design

In order to identify the toxin gene of B. cereus, the toxin gene sequence was searched through the Gene bank, and the sequence of the toxin gene already published through NCBI (National Center for Biological Information) was obtained. Oligonucleotides corresponding to nucleotide sequences of about 20 bp at both ends of the obtained toxin gene fragment were synthesized.

The G+C ratio was designed to be about 50% so that the binding force between the primer and the template DNA could be maintained strongly, and the annealing temperature of each primer was matched so that each toxin gene could be detected at the same time. In addition, it was designed so that complementary base bonding does not occur between each primer.

2. Sensitivity and specificity test of PCR primer kit

Sensitivity and specificity tests were carried out in food, environment, and B. cereus isolated from humans, the strains in which the vomiting toxin was confirmed through HPLC/MS, the strains in which the vomiting toxin was not confirmed, E. coli, Staphylococcus, etc. PCR was performed using a primer kit for simultaneous detection of a toxin gene developed for food poisoning strains such as Staphylococcus aureus.

3. Search for the minimum detection limit of PCR primer kit

After inoculating B. cereus in TSB medium, incubating overnight, diluting with TSB so that the number of bacteria becomes 105 101 CFU/ml, and then extracting DNA using a DNA extraction kit (Wizatd Genomic DNA purification kit, Promega, USA) and performing PCR I did. To investigate the detection limit of B. cereus for food, dilute 25 ml of skim milk with 225 ml of sterile phosphate buffer, inoculate B. cereus to a concentration of 105 CFU/ml, put it in a filter bag, and shake for 1 minute in a pulsifier. I did. 1 ml of the homogenized filtrate was taken and diluted 10-fold stepwise, and the number of bacteria in each dilution was measured, while DNA extraction PCR was performed using a DNA extraction kit.

<Example 7> Isolation and identification of B. cereus in food

From March 2009 to April 2009, 52 rice cakes and 56 kimbap sold in large marts and traditional markets in Gangwon-do and Gyeonggi-do were collected, and the distribution status of B. cereus was investigated. The results are as follows [Table 4] Shown in. B. cereus was detected in 1 rice cake (1.1%) and 3 kimbap (5.4%), showing a detection rate of 3.7% in 4 of 108 rice cakes and kimbap. Tegifeel et al. from raw rice 40? It was said that 100% detection was found, but the low detection rate in kimbap and rice cake as a result of this study is judged to show a low detection rate due to the death of B. cereus during the washing and heating processes during the manufacturing process. In addition, it is judged that the higher detection rate of gimbap compared to rice cake is because more manual labor is performed in the manufacturing process of gimbap compared to rice cake.

Bacillus cersus isolates from Korean rice cakes and Kimbab Sample No. of samples No. of detection samples Detection rate (%) Korean rice cake 52 One 1.9 Kimbab 56 3 5.4 Total 108 4 3.7

<Example 8> Diarrheal toxin production B. cereus toxin gene analysis

The major diarrheal toxins of B. cereus are reported as haemolysin BL, non-haemolytic enterotoxin, cytotoxin K, and enterotoxin FM. It is known that diarrhea-type toxins are sensitive to heat and are inactivated by heat treatment at 56°C for 5 minutes.

Hemolysin BL, which has enterotoxin activity, is composed of three proteins: B, L₁ and L₂, and is the first enterotoxin whose properties have been revealed among B. cereus toxins. Hemolysin BL having the enterotoxin activity has been reported as a major toxicity factor for B. cereus diarrhea, and it has been reported that all three components are required to express enterotoxin activity.

Lund and Granum (1996) reported the first non-hemolitic enterotoxin, and the three components of the non-hemolitic enterotoxin were isolated and purified from B. cereus isolated after a large-scale food poisoning accident in Norway in 1995. Granum et al. reported that most of the B. cereus strains produced non-hemolitic enterotoxins and about 50% produced HBL.

In order to identify the major diarrheal toxins of B. cereus food poisoning in Korea, the major diarrheal toxin genes of 120 strains of B. cereus, which were not confirmed to produce vomiting toxins, were analyzed through HPLC/MS analysis among 160 strains of B. cereus that were isolated and collected.

The analyzed toxin genes were nheA, nheB, nheC, hblC, hblD, hblA, entFM and cytK toxin genes, which are the diarrhea genes of B. cereus, and the analysis results are shown in Table 5 below.

Distribution of toxin genes among 120 enterotoxic Bacillus cereus isolated from varios sources in Korea Toxin gene No. (%) ofclinical strains (n=45) No. (%) of grain strains (n=64) No. (%) offood strains (n=11) Total(n=120) nheABC 44 (97.8%) 59 (92.2%) 10 (90.9%) 113 (94.2%) hblCDA 40 (90.9%) 59 (92.2%) 8 (66.7%) 107 (89.2%) entFM 34 (75.6%) 39 (60.9%) 6 (54.5%) 79 (65.8%) cytK 20 (44.5%) 36 (56.3%) 7 (63.6%) 63 (52.5%)

As shown in [Table 5], nheABC was identified in 113 weeks (94.2%) of B. cereus among 120 B. cereus, and nheABC was confirmed at 107 weeks (89.2%) in the case of hblCDA, and entFM and cytK were respectively 79 weeks (79 weeks). 65.8%) and 63 weeks (52.5%) were detected.

In addition, the results of analyzing the diarrheal toxin gene pattern of 120 strains of B. cereus are shown in Table 6 below. B. cereus (pattern I) having nheABC, hblCDA, entFM and cytK diarrhea toxin genes was 47 out of 120 strains. B. cereus (pattern II), which has nheABC, hblCDA, and entFM diarrhea toxin genes, showed the highest ratio by strain (39.2%), and B. cereus (pattern VI) was analyzed at 24 weeks (20%).

These results are consistent with the report that 92-100% of B. cereus strains contain NHE diarrheal toxin (Buchanan and Schultz, 1994; Day et al., 1994). As a result of the analysis, the representative diarrhea toxins of the diarrhea-type B. cereus strain isolated in Korea were nheABC and hblCDA, and the B. cereus strain used in this experiment was confirmed to contain one or more diarrheal toxin genes. Therefore, it is considered that the domestic isolates of B. cereus are highly likely to induce food poisoning.

Different toxin gene profilies of 120 enterotoxic Bacillus cereus strains Pattern nheABC hblCDA entFM cytK No. (%) of B. cereus strains Ⅰ + + + + 47 (39.2%) Ⅱ + + + - 24 (20.0%) Ⅲ + + - + 9 (7.5%) Ⅳ + - + + 3 (2.5%) Ⅴ - + + + 2 (1.7%) Ⅵ + + - - 24 (20.0%) Ⅶ + - + - 3 (2.5%) Ⅷ + - - + 1 (0.8%) Ⅸ - + - + 1 (0.8%) Ⅹ + - - - 2 (1.7%) ⅩⅠ - + - - 3 (2.5%) ⅩⅡ - - - + 1 (0.8%)

<Example 9> Emetic toxin production B. cereus toxin gene analysis

Major bioactive peptides such as beta-lactam antibiotic and cyclosporin are known to be synthesized through non-ribosomal peptide synthetases (NRPS) (Chong et al., 1998 ; Weber and Marahiel, 2001).

The vomiting toxin of B. cereus, named as cereulide, consists of a ring in which four amino groups and oxy acids are repeated three times. The cyclic structure of [DO-Leu-D-Ala-LO-Val-L-Val]₃ is a low-molecular peptide with a molecular weight of 1.2 kDa that passes through an extra-circular filtration membrane, and is chemically combined with potassium ionophore valinomycin. It is very similar, and it has been reported that cereulide, an emetic toxin, is also synthesized through NRPS (Agata et al., 1995).

Emetic toxin has heat resistance that is not destroyed even when heated at 126°C for 90 minutes, has resistance to acids, alkalis, and proteolytic enzymes, and does not form antibodies. For this reason, the toxin causing vomiting causes disease more easily, but the biosynthetic pathway and mechanism of action of the vomiting toxin have not been accurately identified. Emetic toxin production was confirmed by HPLC/MS analysis of B. cereus in 160 strains. To identify major diarrheal toxin genes in B. cereus 40 strains, nheA, nheB, nheC, hblC, hblD, hblA, entFM, cytK and The NRPS gene gene was analyzed.

Distribution of enterotoxin toxin genes in 40 emetic type of Bacillus cereus isolated in Korea Toxin gene No. (%) offeces strains (n=33) No. (%) of vomit strains (n=3) No. (%) offood strains (n=4) Total(n=40) nheABC 26 (78.8%) 3 (100%) 4 (100%) 33 (82.5%) hblCDA 3 (9.1%) 0 (0%) 0 (0%) 3 (7.5%) entFM 15 (45.5%) 3 (100%) 2 (5.0%) 20 (50.0%) cytK 11 (33.3%) 0 (0%) 0 (0%) 11 (27.5%)

As shown in the analysis result of [Table 7], the NRPS gene was identified in all 40 strains of B. cereus producing vomiting toxin, and nheABC was identified in 33 weeks (82.5%) of B. cereus in 40 weeks, and entFM at 20 weeks (50%). This was confirmed.

In addition, as a result of analyzing the diarrheal toxin gene pattern of B. cereus producing vomiting toxin, out of 40 B. cereus, B. cereus (pattern III), which has both nheABC and entFM diarrheal toxin genes, was found to be 13 weeks (32.5%). B. cereus (Pattern V) carrying the nheABC diarrheal toxin gene was identified as 9 weeks (22.5%). As a result of analysis, representative diarrheal toxins of B. cereus strains that produce vomiting toxins isolated in Korea were nheABC and entFM. In the case of the vomiting type, the hblCDA toxin gene was detected very low in contrast to the diarrhea type. Most of the symptoms are thought to be due to the NHE toxin.

These results are consistent with the reports that most of the B. cereus strains isolated from various isolates have NHE toxin and that the case of the vomiting toxin-producing B. cereus has both vomiting toxins and NHE toxins (Anderson et al. ., 2001; Guinebretiere et al., 2002; Kim et al., 2009).

As a result of analyzing the toxin gene pattern of the vomiting toxin-producing B. cereus strain as shown in [Table 8], it was confirmed that the 85% of the vomiting toxin-producing B. cereus strain used in this experiment contained one or more diarrheal toxins.

Different toxin gene profilies in emetic type of Bacillus cereus strains used in this study Pattern NRPS
gene nheABC hblCDA entFM cytK No. (%) Of B. cereus strains Ⅰ + + + + + 3 (7.5%) Ⅱ + + - + + 3 (7.5%) Ⅲ + + - + - 13 (32.5%) Ⅳ + + - - + 5 (12.5%) Ⅴ + + - - - 9 (22.5%) Ⅵ + - - + - 1 (2.5%) Ⅶ + - - - - 6 (15.0%)

These results suggest that most of the isolated vomiting toxin-producing B. cereus in Korea can produce both vomiting toxins and diarrheal toxins, and the vomiting toxin-producing B. cereus can cause diarrhea-type food poisoning at the same time. Therefore, in order to accurately identify diarrhea-type and vomiting-type B cereus, it is judged that both vomiting toxin and diarrheal toxin should be analyzed at the same time, and a multiplex-PCR kit that can simultaneously detect diarrheal toxin and vomiting toxin genes is urgently needed.

<Example 10> Existing emetic toxin production B. cereus detection PCR primer verification

Major bioactive peptides such as beta-lactam antibiotic and cyclosporin are known to be synthesized through non-ribosomal peptide synthetases (NRPS) (Chong et al., 1998; Weber and Marahiel, 2001). The heterocyclic structure of B. cereus emetic toxin and the presence of D-amino acid of the peptide suggest a relationship between the NRPS gene and the generation of emetic toxin (Horwood et al., 2004; Toh et al., 2004), PCR analysis for the detection of the emetic toxin gene in B. cereus has been developed based on the NRPS gene, which has been identified as the cause of the production of emetic toxin (Ehling-Schulz et al., 2004a 2005a Horwood et al. ., 2004; Seong et al., 2008).

In this experiment, in order to analyze the sensitivity, specificity, and accuracy of the previously reported emetic toxin-producing B. cereus PCR primers, a total of 160 strains were tested for emetic toxin production confirmed by HPLC/MS and 120 non-producing strains. PCR was performed with the strain.

As shown in the analysis results of [Table 9] below, genes related to vomiting toxins were found in 40 strains of B. cereus producing vomiting toxins (Group Ⅰ), and genes related to vomiting toxins in 4 strains of B. cereus non-emetics producing (Group Ⅱ) were found. Was searched. In 116 strains of B. cereus that were not producing other emetic toxins (Group III), genes related to emetic toxins were not detected.

The results of measuring the sensitivity, specificity, and accuracy for the isolated vomiting-type B. cereus strain in Korea using the previously reported vomiting-type B. cereus detection PCR primer are shown in Table 10 below. The CER primer (Horwood et al., 2004) designed as a target for the NRPS gene, which is known to be closely related to the generation of cereulide, the vomiting toxin, showed the highest sensitivity (100%) among the primers used in the experiment, and EM1 primer (Ehling -Schulz etal., 2004a) showed a sensitivity of 85%.

However, the CER primer and EM1 primer designed based on the NRPS gene showed a PCR band was detected even at 6 weeks of diarrhea B. cereus, which did not produce vomiting toxin, and the specificity was slightly lower than the sensitivity. In the case of the RE234 primer pair, a primer designed by separating and sequencing specific amplification bands of B. cereus, which produces vomiting toxin as a result of RAPD (random amplified polymorphic DNA) PCR (Nakano et al., 2004), produces vomiting toxin B. cereus With respect to, the RE234 primer showed a sensitivity of 90.0%.

However, in the case of RE234 primer, a PCR band was shown in 4 weeks of diarrhea-type B. cereus, which did not produce vomiting toxin. CES and Ces3R/CESR2 primers showed 57.5% and 35% sensitivity lower than those of other primers. The CES primer was designed based on valine modules among the NRPS genes of B. cereus producing vomiting toxin, and the Ces3R/CESR2 primer was redesigned based on the CES primer (Seong et al., 2008).

The CES primer showed 100% specificity, and the CER primer showed 96.7% specificity as PCR bands were identified in JNHE 38, KNIH 29, KUGH 143 and 13 KUGH strains that did not produce vomiting toxin. EM1 and Ces3R/CESR2 primers showed 99.2% specificity as a PCR band was confirmed in KUGH 143, a diarrhea type B. cereus. The RE234 primer showed a specificity of 98.3% as PCR bands were identified in KUGH 143 and KUGH 139, which do not produce vomiting toxins. According to a study by Nakano (2004) et al. PCR analysis using RE234 primer revealed PCR bands in all of the vomiting B. cereus used in the experiment, but PCR also in the diarrheal B. cereus (ATCC 7004), which does not produce vomiting toxins. It has been reported that the band was confirmed.

As a result of analyzing the accuracy of each primer, it was confirmed that the accuracy of CER was 97.5%, EM1 95.6%, RE234 96.3%, CES 89.4%, and Ces3R/CESR2 83.1%. The difference in sensitivity, specificity, and accuracy between each primer is thought to be due to the fact that each primer was designed to target a different site of a gene related to emetic toxin production. As a result of this experiment, it was confirmed that the CER primer showed the highest sensitivity and accuracy, and the CES primer showed the highest specificity. Therefore, in this study, the genes underlying the development of CER and CES primers were used for the development of the Multi-PCR primer kit.

1) HPLC/MS with ion trap detector was performed to detect emetic toxin.

2) Clinical strains contained GIHE 5609, 5616, 5618, 5619, 5625, 5629, 5633, 5674~ 5677, 5679~5689, 6011, 6013, ICHE 0901~0909, SEHE 4153, 4154, 4158, 4165, 4300, 4303, JNHE 63, 66.

3) Grain strains contained GIHE 5603, 5605, 5610~5615, 5620, 5621, 5623, 5624, 5626~5628, 5630, 5632, 5634~5668, 5670~5673, 5691~5698.

4) Food strains contained GIHE 5617, 6007, 6008, 5602, 5607, 5601, 4605, 4616, 4618, 4628, 4629.

Evaluation of PCR assays compared with emetic toxin producing Bacillus cereus strains confirmed from HPLC/MS analysis PCR primers Emetic toxin producing strains
(n=40) Enterotoxin producing strains
(n=120) Sensitivity ^{1 )}
(%) Specificity ^{2 )}
(%) Accuracy ^{3 )}
(%) Detection of emetic toxin related
gene amplicon (a) Non-detection of emetic toxin related
gene amplicon (b) Detection of emetic toxin related
gene amplicon (c) Non-detection of emetic toxin related
gene amplicon (d) CER 40 0 4 116 100.0 96.7 97.5 EM1 34 6 One 119 85.0 99.2 95.6 RE234 36 4 2 118 90.0 98.3 96.3 CES 23 17 0 120 57.5 100.0 89.4 Ces3R/CESR2 14 26 One 119 35.0 99.2 83.1

1) Sensitivity was calculated by the number of true positive (a) divided by the sum of true positive (a) plus false negative (b).

2)Specificity was calculated by the number of true negative (d) divided by the sum of false positive (c) plus true negative (d).

3) Accuracy was calculated by the sum of true positive (a) plus true negative (d) divided by the number of total strains tested.

<Example 11> PCR primer design

As a result of this study, it was confirmed that 34 (85%) of the 40 strains of isolated vomiting type B. cereus in Korea contained one or more diarrheal toxin genes, and were tested by the BDE-VIA (NHE) and BCET-RPLA (HBL) kits. As a result of measuring the diarrheal toxin production ability, the production of diarrheal toxin was confirmed in all of the vomiting type B. cereus containing the diarrhea toxin gene.

These results indicate that vomiting-type B. cereus can also produce NHE diarrheal toxin (Ehling-Schulz et al., 2005b 2006), and Yang et al. (2005) vomiting-type B. cereus have both vomiting-type food poisoning and diarrhea-type food poisoning. This result is consistent with reports that it may cause a problem.

As a result of this study, it is judged that it is desperately necessary to develop multiplex PCR primers that can simultaneously search for vomiting and diarrheal toxin genes. Among the diarrheal toxin genes, the detection frequency of nheA, hblC, entFM, cytK genes and previously reported vomiting toxin genes are detected. CER and CES genes, which showed the highest sensitivity and specificity among primers, were designed as targets for multiplex PCR primers. In addition, in order to secure the gene sequence of the vomiting-type B. cereus strain, PCR was performed using CES primers, and then the gene sequence was confirmed. As a result, it was found that the gene sequence of the vomiting-type B. cereus isolated in Korea is very similar.

Primer design was designed based on the nucleotide sequences registered in NCBI by searching for each toxin gene in NCBI, and oligonucleotides corresponding to nucleotide sequences of about 20 bp were synthesized at both ends of the obtained toxin gene fragment. The primer design program was designed using Genefisher (http://www.genefisher.de/), and designed with a G+C ratio of 40-60% to maintain strong binding between the primer and the template DNA. .

The annealing temperature of each primer was set to a constant temperature so that each toxin gene could be detected at the same time, and it was designed so that complementary base bonding between each primer does not occur. Primer's reaction conditions were initial denaturation at 95℃ for 10 minutes. In addition, 35 cycles were given at 94°C for denaturation step, 60 seconds at 54°C for annealing step, and 60 seconds at 72°C for extension step. And Final Extension was set to 5 minutes at 72℃.

The Product length and Design source of Primer sequences such as [SEQ ID NO. 1] to [SEQ ID NO. 12] designed for detection of vomiting and diarrheal toxin genes of B. cereus are shown in Table 11 below.

Sequence of multiplex PCR primer (New Design) target gene sequence Product
length Design
source ^{1 )} cytK Forward multiplex PCR primer TGCTAGTAGTGCTGTAACTC 881 DQ019311 Reverse multiplex PCR primer CGTTGTTTCCAACCCAGT nheA Forward multiplex PCR primer GGAGGGGCAAACAGAAGTGAA 750 DQ019312 Reverse multiplex PCR primer CGAAGAGCTGCTTCTCTCGT ces Forward multiplex PCR primer TTCCGCTCTCAATAAATGGG 634 AY691650 Reverse multiplex PCR primer TCACAGCACATTCCAAATGC CER Forward multiplex PCR primer GCGTACCAAATCACCCGTTC 546 AY576054 Reverse multiplex PCR primer TGCAGGTGGCACACTTGTTA hblC Forward multiplex PCR primer CGCAACGACAAATCAATGAA 421 AY786407 Reverse multiplex PCR primer ATTGCTTCACGAGCTGCTTT entFM Forward multiplex PCR primer AGGCCCAGCTACATACAACG 327 AY789084 Reverse multiplex PCR primer CCACTGCAGTCAAAACCAGC

1) NCBI Accession number.

<Example 12> Analysis of sensitivity and specificity of PCR primer kit

To evaluate the sensitivity, specificity, and accuracy of multiplex PCR primers designed to search for vomiting and diarrheal toxin genes, 160 strains of Bacillus cereus and E. coli isolated from food, human body, and environment. , Staphylococcus aureus (Staphylococcus aureus), etc. for food poisoning strains and Bacillus cerius ATCC 14579 and F4810 / 72 strains were developed for the simultaneous detection of the toxin gene by using a primer kit.

The detection of the diarrheal toxins nheA, hblC, entFM, and cytK genes resulted in the same results as those of the previously reported PCR primers for 160 Bacillus cerius strains, and the band was not identified in other food poisoning strains such as E. coli. It was confirmed that the sensitivity, specificity and accuracy of the newly designed diarrheal toxin PCR primer were very outstanding. In addition, the primer designed for the emetic toxin gene CER showed excellent sensitivity by confirming the target band (546 bp) in all 40 strains of vomiting B. cereus, but showing a specific band in 2 weeks out of 120 strains of diarrhea B. cereus. The degree was somewhat lower than the sensitivity.

However, as a result of the existing CER primer experiment, it was confirmed that the newly designed PCR primer has superior specificity compared to the existing primer compared to the band showing at 4 weeks out of 120 weeks of diarrhea (see FIGS. 1, 2 and 3).

<Example 13> Analysis of the minimum detection limit of PCR primer kit

In order to set the minimum detection limit of the multiplex PCR primer designed as described above, the minimum detection limit in pure culture and food (skim milk) was measured. Two strains (JNHE36, KUGH11) of the F4810/72 strain and the collected vomiting type B. cereus were selected as a reference strain for producing emetic toxin, and the minimum detection limit of the multiplex PCR was measured.

As shown in [Table 12], F4810/72 and JNHE36 were ^{identified as 4.3X10 2} and 7.2X10 ² , respectively, and KUGH11 was identified as ces, entFM was ^{identified as 8.8X10 2} , and CER and nheA were also detectable at ^{8.8X10 1 level.} Appeared. However, in skim milk, the minimum detection levels of F4810/72, JNHE36 and KUGH11 increased to ^{4.3X10 3} , 7.2X103 and 8.8X10 ^{3, respectively.}

It is believed that the increase in the minimum detection limit in skim milk is generally due to PCR inhibitors such as high concentrations of cations, proteases, nucleases, and fatty acids present in milk. This is because these PCR inhibitors surround DNA polymerase or template DNA to inhibit the PCR reaction. As in the studies of Alarcon (2005), this result is consistent with the report that the minimum detection limit is increased when PCR analysis is performed after inoculation of cells in food.

Detection limits of multiplex PCR assay Strain No. CFU/
tube Pure culture Artificially inoculated milk ^{1 )} ces CER nheA hblC entFM cytK ces CER nheA hblC entFM cytK F4810/72 4.3X10 ⁰ - - - - - - - - - - - - 4.3X10 ¹ - - - - - - - - - - - - 4.3X10 ² + + + - - - - - - - - - 4.3X10 ³ + + + - + - + + + - + - 4.3X10 ⁴ + + + - + - + + + - + - JNHE36 7.2X10 ⁰ - - - - - - - - - - - - 7.2X10 ¹ - - - - - - - - - - - - 7.2X10 ² + + + + + + - - - - - - 7.2X10 ³ + + + + + + + + + + + + 7.2X10 ⁴ + + + + + + + + + + + + KUGH11 8.8X10 ⁰ - - - - - - - - - - - - 8.8X10 ¹ - + + - - - - - - - - - 8.8X10 ² + + + - + - - - - - - - 8.8X10 ³ + + + - + - + + + - + - 8.8X10 ⁴ + + + - + - + + + - + -

1) DNA isolated from 1 mL aliquots of artificially inoculated milk without enrichment was used as template.

Due to the growing interest in public health and food safety, reinforcing regulations on food safety, enhancing competitiveness by improving producers and quality, and increasing the need for food safety management due to the increase in imported food, the inspection of hazardous substances in food is geometric. It is increasing exponentially.

In relation to food poisoning by Bacillus cerius, conventional HPLC, GC, MS, etc. have been used as diarrhea-type toxin detection methods. Recently, polymerase chain reaction, ELISA (enzyme linked immunoassay) and RPLA (reversed passive latex agglutination) have been developed. have. However, there are no studies related to the method of detecting vomiting toxins.

Accordingly, the present invention provides a set of recombined multiplex polymerase chain reaction primers capable of rapidly and accurately detecting Bacillus cerius producing vomiting toxins, and further simultaneously detecting vomiting toxins and diarrheal toxins, thereby causing food poisoning. It has excellent industrial applicability because it can be prevented in advance.

Furthermore, the present invention can be used in a standardized test method for food safety evaluation, so that the safety of food can be secured and ultimately, economic or socio-cultural loss due to food poisoning can be prevented, so industrial applicability is very excellent. will be.

<110> Kangwon University Educational-Industrial Complex <120> Recombinant mutiplex PCR primer detecting diarrhoeal typed toxin and emetic typed toxin simultaneously <160> 12 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward multiplex PCR primer of cytK <400> 1 tgctagtagt gctgtaactc 20 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse multiplex PCR primer of cytK <400> 2 cgttgtttcc aacccagt 18 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward multiplex PCR primer of nheA <400> 3 ggaggggcaa acagaagtga a 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse multiplex PCR primer of nheA <400> 4 cgaagagctg cttctctcgt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward multiplex PCR primer of ces <400> 5 ttccgctctc aataaatggg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse multiplex PCR primer of ces <400> 6 tcacagcaca ttccaaatgc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward multiplex PCR primer of CER <400> 7 gcgtaccaaa tcacccgttc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse multiplex PCR primer of CER <400> 8 tgcaggtggc acacttgtta 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward multiplex PCR primer of hblC <400> 9 cgcaacgaca aatcaatgaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse multiplex PCR primer of hblC <400> 10 attgcttcac gagctgcttt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward multiplex PCR primer of entFM <400> 11 aggcccagct acatacaacg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse multiplex PCR primer of entFM <400> 12 ccactgcagt caaaaccagc 20

Claims (6)

Recombinant to detect the vomiting toxin and diarrhea toxin of Bacillus cereus at the same time, multi-characteristics consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8 Multiplex PCR primer set. According to claim 1, Recombinant multiplex polymerase chain reaction primer set, characterized in that the G + C ratio is 40 ~ 60% to maintain a strong binding force between the primer set and the template DNA. The multiplex polymerase chain primer set according to claim 1, wherein the multiplex PCR primer set further comprises a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2. The multiplex polymerase chain primer set of claim 1, wherein the multiplex PCR primer set further comprises a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4. The multiplex polymerase chain primer set according to claim 1, wherein the multiplex PCR primer set further comprises a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10. The multiplex polymerase chain primer set of claim 1, wherein the multiplex PCR primer set further comprises a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12.

Images