KR20120092534A - Transgenic cloned caninds with pepck gene and method for producing thereof - Google Patents

Abstract

PURPOSE: A PEPCK-overexpressing transgenic cloned canidae animal and a method for producing the same are provided to identify genetic cause of type 2 diabetes and to develop a therapeutic agent. CONSTITUTION: A PEPCK coding nucleic acid is placed by regulation of: a promoter of full length naturally existing in PEPCK gene of a dog; a promoter which is removed to -2349th base from the promoter of full-length; a promoter which is removed to -1018th base from the promoter of full length; or a promoter which is removed to -746th base from the promoter of full length. The PEPCK coding nucleic acid is derived from canidae. A method for producing a nuclear-transferred embryo of transgenic canidae comprises: a step of transforming canidae-derived somatic cell line with the PEPCK coding nucleic acid and preparing donor cells; a step of removing nucleus from a mature egg of canidae; and a step of microinjection of the donor cells to the denucleated egg and electrofusion.

Description

Transgenic Cloned Caninds with PEPCK Gene and Method for Producing Thereof {Transgenic Cloned Caninds with PEPCK Gene and Method for Producing Thereof}

The present invention relates to a transgenic cloned canine overexpressing PEPCK (Phosphoenol Pyruvate Carboxykinase) and a production method thereof. More specifically, the present invention overexpresses PEPCK produced by transplanting a canine-derived somatic cell nucleus transformed with a PEPCK gene into an enucleated oocyte, a canine nuclear transfer embryo, a method for producing the same, and transplanting the nuclear transfer egg into the fallopian tube of a surrogate mother. It relates to a transgenic cloned canine animal and a production method thereof.

As the economy develops in Korea, metabolic diseases are constantly increasing due to changes in diet, stress, pollution, and damage to convenience foods. In particular, the incidence of diabetes mellitus and the mortality rate due to diabetes are increasing every year. to be. The prevalence of diabetes varies according to race or ethnic living environment, but the prevalence is increasing worldwide as the economy develops and the lifestyle becomes westernized. In Korea, the prevalence of diabetes, which was estimated to be less than 1% in 1970, is on a gradual increase to about 3% in the late 1980s and 5-8% in the 1990s (Korean Diabetes Association, Diabetes Science, Seoul, Korea Medicine, 1998). . It is reported that Koreans have a lower insulin secretion ability of pancreatic beta cells than Westerners, and are characterized by many obesity types.

Diabetes is the most common metabolic disease, a complex disease involving a number of factors, and about 5 to 8% of the total population suffers from diabetes. Diabetes mellitus is caused by several causes such as genetics, viruses, or harmful compounds. It is a disease caused by an increase in blood sugar due to a problem with insulin, a hormone secreted by pancreatic beta cells and lowering blood sugar. Diabetes is a type 1 diabetes (insulin-dependent diabetes mellitus) caused by the destruction of pancreatic beta cells and an insufficient amount of insulin. It can be classified as type 2 diabetes (noninsulin-dependent diabetes mellitus), which is less efficient, and if it persists for a long time without proper treatment, damage to the eyes (diabetic retinopathy), kidneys (diabetic nephropathy), and nerves (diabetic neuropathy) is caused. It is a disease that causes and eventually leads to death (Harrison, TR Diabetes Mellitus; Principles of Internal Medicine 11th ed. 1778-1797, 1987; Mahler, RJ et al, Type 2 Diabetes Mellitus: Update of diagnosis, pathophysiology, and treatment.J Clin. Endocrinol. Metab. 84(4), 1165-1169, 1999).

Control of glucose production is one of the major aspects of diabetes treatment. In type 2 diabetes, high levels of blood glucose are observed after meals and on an empty stomach (Consoli, A. et al., J. Diabetes 38, 550-7, 1989; Shulman, GI Am. J. Card. 84 (Suppl. 1A)) :3J-10J, 1999). Excessive hepatic glucose production (HGP) is associated with fasting hyperglycemia specifically observed in type 2 diabetic patients (Gastadeli, A. et al., Diabetes 49:1367-1373, 2000). It is believed that glucose synthesis is a major pathway for increasing glucose production (Defronzo. R. A. et al., Diabetes Care 15:318-367, 1992).

Phosphoenolpyruvate carboxykinase (PEPCK) is a major regulatory enzyme in the glucose synthesizing pathway. Because PEPCK is considered a flux control-rate limiting enzyme in this pathway (Cimbala, AL et al., J. Biol. Chem. 257:7629-7636, 1982), inhibition of this enzyme is to improve glucose homeostasis. It will be a new way. Previous attempts to control hepatic glucose production through inhibition of glucose renal synthesis have been limited to biguanads such as metformin, which inhibit HGP (Derfronzo, R.A. et al., Diabetes Review 6:89-131, 1998). However, metformin is known to have side effects such as gastrointestinal disorders and hyperlactic acidosis. Inhibition of PEPCK will provide excellent titers, reduce side effects, and provide a new treatment for type 2 diabetes.

For this, an animal model in which diabetes is induced by overexpressing PEPCK will be needed.

In order to prepare a diabetic animal model, the present inventors prepared a nuclear donor cell by transforming a somatic cell line derived from a canine animal with a PEPCK gene, removing a nucleus from a mature egg of a canine, and the nuclear donor cell in the enucleated egg. After microinjection and electrofusion to prepare a nuclear transfer embryo of a canine transformed with the PEPCK gene, a transgenic clone canine overexpressing the PEPCK gene was produced using the nuclear transfer embryo, and the present invention was completed.

In one aspect, the present invention provides a canine nuclear transfer embryo (KCTC 11360BP) formed by transplanting a canine-derived somatic cell nucleus transformed with a nucleic acid encoding PEPCK (Phosphoenol Pyruvate Carboxykinase) into an enucleated egg.

In another aspect, (a) preparing a nuclear donor cell, including transforming a somatic cell line derived from a canine animal with a PEPCK-encoding nucleic acid; (b) removing the nucleus from the mature egg of the canine animal; (c) It provides a method of producing a nuclear transfer embryo of a canine animal transformed with a PEPCK gene, comprising microinjecting and electrofusion of the donor nuclear progenitor cell of the step (a) into the enucleated oocyte of the step (b).

In another aspect, there is provided a method for producing a transgenic, cloned canine overexpressing PEPCK, comprising the step of transferring the nuclear transfer egg into an oviduct of a surrogate mother to give birth to birth.

As another aspect, it provides a transgenic cloned canine overexpressing PEPCK produced by the above method.

The term'nuclear transplantation' as used in the present invention refers to a genetic engineering technology that artificially binds nuclear DNA of another cell to a cell without a nucleus to have the same traits.

The term'nuclear transplantation egg' as used in the present invention refers to an egg into which a donor nuclear progenitor cell has been introduced or fused.

The term'cloning' as used in the present invention is a genetic engineering technology to create a new individual having the same set of genes as an individual. In particular, in the present invention, cells, embryonic cells, fetal cells and/or animal cells are It refers to having substantially the same nuclear DNA sequence.

* The term'donor nuclear progenitor cell' as used in the present invention refers to a cell or a nucleus of a cell that transfers a nucleus to a recipient ovum, a nuclear receptor.

The term "nucleus ova" as used in the present invention refers to an egg that has its original nucleus removed through a denuclearization process and is transferred from a donor nuclear progenitor cell.

The term'mature egg' as used in the present invention refers to an egg that has reached the middle of the second meiosis.

The term'denuclearized egg' as used in the present invention refers to the removal of the nucleus of an egg.

The term'fusion' as used in the present invention refers to the combination of a nuclear donor cell and a lipid membrane portion of a recipient oocyte. For example, the lipid membrane can be a plasma membrane or a nuclear membrane of a cell. Fusion can occur by applying electrical stimulation when the nuclear donor cell and the recipient oocyte are located adjacent to each other, or when the nuclear donor cell is located within the perivitelline space of the recipient oocyte.

The term'activation' as used herein refers to stimulating cells to divide before, during and after the nuclear transfer step. Preferably, in the present invention, it refers to stimulation of cells to divide after the nuclear transfer step.

In the present invention, the'canine animals' may include dogs, wolves, foxes, jackals, coyotes, monks, and raccoons. Preferably it includes a dog or a wolf. The dog is known to have been domesticated by wild wolves. Accordingly, wolves and dogs have the same number of chromosomes and have similar changes in gestation and sex hormones (Seal US et al., Biology Reproduction, 1979, 21:1057- 1066).

Step 1: PEPCK Transformed with a nucleic acid encoding Of nuclear donor cells Produce

(1) Construction of a promoter capable of overexpressing PEPCK (Phosphoenol Pyruvate Carboxykinase)

In the present invention, in order to produce a promoter capable of inducing overexpression of PEPCK, a full-length promoter naturally present in the PEPCK gene (from nucleotides -3180 to +1 = transcription start site; SEQ ID NO: 1) and the full length A promoter in which -3180 to -2349 bases, -3180 to -1018 bases, and -3180 to -746 bases were removed from the promoter was prepared. The full length promoter sequence of SEQ ID NO: 1 is as follows.

-3180 gctagccatg gcttcctttc cactgtttac ctggaaggca

-3140 gctgttccct gcccccactc tcacctgctc acaccttttg agtcttggcc attctagact

-3080 gctgtgcagt ttccatggtg ccttctcagc ttccctgctc cacacaggct ttccagagtc

-3020 ctgctccctc cctcctcgga tcctgaggac agccaggctg cagcttcaac agcaacaaat

-2960 gtgcgtggaa cctcacaagg agaagtgaag acgttaactt tggagttgga aactattttt

-2900 ttctgtgtct actgcctcct tctccttctt tcagcaaaaa caattttgtc tgggttcaac

-2840 tttgtatatg gtattaaaag gaggagcagt cttgcatctt aagccagcct cgagaagtta

-2780 ggaggtcccc atggcattta ttgcagaagt gacaaatgca gcccatactg ggagaccatt

-2720 accattatga tttacacagt ccccgttggg ccctatcaac actgggatag ggacgccggg

-2660 gtggctcagg gcctgccttt ggctcaggtt gttatcctgg ggtccaggat cgagtcccac

-2600 atcgggctcc ctgcgaggag cctgtttctc cctttaccta tgtctctgcc tctctctgtg

-2540 tgtctctcgt gaataagtga ataaataaaa tttttaaaaa acaaaacact gggataagcg

-2480 aactttgtcc atacttctgc cgcgtgtcct caacatcctg gcttctgtct gcatcactct

-2420 tttccaacgg actcagtact ttcaggtaaa tctgcaacct gatgtttgcc ttttcatgtt

-2360 attttgaggg acagttgcaa aggaataatg ccagccttcc ctggggtcag tgtgaataat

-2300 taagcaattg gcggggggca gtggtagcct cctgttccta cattttaatc gagctggcta

-2240 tttctctcca ggaagactcc aaacataaac accttgaatt tatgggtagc atttagaacc

-2180 acaaataagt tctggtttct catttttgtt ttcaatctat gtgctcttcg agggaatgaa

-2120 acctatcaca gttttatcag caaaatggga atctctaccc atttggtgag atggaccgca

-2060 ctggcataaa tgtgtgtgtt gctgtgcatt tgaatggcta atttcactgg tgtcagatgc

-2000 taagacagtg tccctcagca actgaacatt acgtcgtagt tgaatttcga catgacacaa

*-1940 acttatatgg ttggcagcgc cactaagaat gaaatctggg gacctaaatg ggaaataatt

-1880 ttaaactaaa tgaaaacctc agtttatact gaaagattca attggttaaa tacaaatctg

-1820 ggggggatcc ctgggtggct cagaggttta gtgcctgcct tcggcccagg gtgtgatcct

-1760 ggagtcctgg gatcgagtcc cgcgtcgggc tcccagcatg gagcctgctt ctccctctgc

-1700 ctgtgtctct gcctctttct ccctctctct gtgtatctca tgaataaata aaataaaaat

-1640 attaaaaaat acaaatctgg gtaaatgaga cattggaata ggttggcaat tttggtggaa

-1580 gttggtgatg tgtgtatacc taatgtcaca atgggaacca aggcttaagg ggtagtcctt

-1520 cagatattct tggtctgaga ttgccattcc caaagccttg tattcctata gctccttaag

-1460 gacacagtca cagaattatc tctgcacacc ccacgtggga ggcaggcaaa tccctaccca

-1400 ccgtcctcca aagcacaggg tgcccactga ctgcactgtt gggttccctg tgaagagtgg

-1340 gagcctggcc ccaagctcct gacttctcac ccagtgctct caaaatgcca gcaagtagca

*-1280 ccagagttca ctgaattgga ctgaagttct tatggcttgc aaagcgaatt ctttacagct

-1220 ggcataaagg tctcattgct caagtgtaat ctagcaaaac caccaagccc cctcccctcc

-1160 ccagacgctc agactctcaa gggcattgag aagtgtgcag tcatcttttt gtagctgcat

-1100 ccagcccaga actacttgga gaatatatgg aaagttccag aaaagagaat ggcacctcac

-1040 aagggacagc atggtgaggt gctccagatc cccagtggct tatgttccaa tcttccctct

-980 atcactctac aaccaggagt tgggagtagc cacttggcct gcacgcattc agtgcctacc

-920 gtgtgctagg aaccgtacag acaaaaaata acaggacagg cagagattct tgcccttgga

-860 gagtttatat ttggggtggt gggcacacag gggagactca gtaaggttat tagccctccg

-800 ttaggtctgg acttttgcta atgagccaaa tgtttattta catttgggca catccttcct

-740 ataggccttg gctgtgtggt gacacctcac cactgctgtg ttttgtcagc cagcagccat

-680 cggtacacag aatgtgctgc caataaccct tgatgtccgg aaggtgttcc cgccagcctt

-620 gcaggatccc acctgcctgt cagtggaagg acggagtgtt ttacatcagc agtgaactgg

-560 gtcaaagttt agtcaatcac aagttgtgta agaacttgct gtggctggtc taaggacaaa

-500 ggcctcccag cactcattaa caactatctg ttcaatgatt atctccctgg ggcttattgt

-440 ggtgagcccg tccagaagca tgacggacag tggccatgat ccaaagtcct gcccctgacg

-380 tcagagacga gcctccctgg gtgtagccga ggggtggggc ctttctcctc aatgggattt

-320 aagaccagga ggctctgcga cccaacagcg agcacggcct tcccactggg aacgcacggc

-260 tactagcagg aagaaccgcg aaaagaaacc cttggatctc tcatcgaggt catcccaaaa

-200 caagaacagt aggtagagat ttttaattta cgtttctaaa aattacagag gtaacaccaa

-140 cccgtttcct tttctcctta gagcttcggc tgtctcgtga tgtgtcaccc aaagaagcat

-80 gtggagtttc tttgagggtg tctgtcattt tgttcaagga gcctgtgttt tctgtttcag

-20 gaagccttgg tgtcaagctt

Among the thus produced promoters, it was confirmed that the -2349 promoter and the -746 promoter, particularly, the -746 promoter, strongly induce the expression of the coding sequence under their control. Therefore, in the present invention, it is preferable to transform the PEPCK-encoding nucleic acid by operably linking it with the -746 promoter variant.

(2) Construction of recombinant expression vector containing PEPCK-encoding nucleic acid

The PEPCK gene can be prepared by performing PCR using the genomic DNA of a specific individual as a template, referring to the base sequence of the known PEPCK gene of the individual, and using oligonucleotides having a base sequence complementary to both ends thereof as a primer. I can. Alternatively, it may be chemically synthesized by referring to the base sequence of a known specific individual's PEPCK gene, or prepared using a commercially available automatic DNA synthesizer (e.g., one that can be purchased through ^{BioSearch, Applied Biosystem TM, etc.)} have. In the present invention, the PEPCK gene is derived from a canine animal, preferably a dog.

In the present invention, it is suitable to clone a PEPCK-encoding nucleic acid into a vector and transform it into a nuclear donor cell. Since the present invention is to overexpress the PEPCK gene in pancreatic beta cells of canine animals, the vector must be in the form of a recombinant expression vector. The recombinant expression vector is a commercially available base vector (i.e., a backbone vector) with a PEPCK-encoding nucleic acid and a regulatory sequence capable of exerting a function in canine pancreatic beta cells (e.g., promoter, secretion sequence, enhancer, upstream activation sequence, transcription It can be manufactured by operatively connecting to a terminating factor, etc.). In particular, the recombinant expression vector preferably includes a selection marker, and antibiotic resistance genes such as kanamycin resistance gene and neomycin resistance gene, green fluorescent protein, and the like may be used as the selection marker.

In the present invention, as an embodiment, commercially available pGL3-Basic (Promega Co., Madison, WI, US) is used as a basic vector, and the PEPCK-encoding nucleic acid includes a nucleotide sequence derived from hepatocytes of beagle dogs, The promoter includes a promoter removed from the full-length promoter naturally present in the dog's PEPCK gene to -746 bases, and as a selection marker, a recombinant expression vector'pGL3-dPEPCK' containing a neomycin resistance gene and a green fluorescent protein Was prepared (see FIG. 3).

(3) Preparation of nuclear donor cells derived from canine animals

Somatic cells derived from canine animals may be used as the donor nuclear progenitor cells. Specifically, the somatic cells used in the present invention may be obtained from canine embryonic cells, fetus cells, juvenile cells, and adult cells.

Somatic cells that can be used in the present invention include, but are not limited to, cumulus cells, epithelial cells, fibroblasts, nerve cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, red blood cells, macrophages, monocytes, muscle cells. Cells, B lymphocytes, T lymphocytes, embryonic stem cells, embryonic germ cells, fetal cells, placental cells, and embryonic cells.

More preferably, the somatic cell used in the present invention may be an adult, a natural individual, or a re-replicated fetal fibroblast. In the present invention, fibroblasts of ordinary fetuses are more preferable.

Somatic cells provided as donor nuclear progenitor cells may be obtained from a method of preparing a surgical sample or a biopsy sample, and a single cell may be obtained from the sample using a known method. For example, a part of the tissue is aseptically dissected from the subject animal to obtain the surgical sample or the biopsy sample, finely chopped and treated with collagenase, and then cultured in a tissue culture medium. . After 3-4 days incubation in tissue culture medium, confirm that it grows in a petri dish, and when it is fully grown, some of it is frozen for later use and stored in liquid nitrogen, and the rest is continuously cultured for use in nuclear transplantation. Conduct. Cells to be continuously cultured and used for nuclear transplantation are preferably prevented from becoming excessively large on the premise of passage 10 or less. In the above, as a medium for tissue culture, a medium known in the art may be used, for example, TCM-199, DMEM (Dulbecco's modified Eagle's medium), and the like.

(4) Preparation of nuclear donor cell transformed with PEPCK-encoding nucleic acid

The above-described donor nuclear progenitor cells are transformed with a recombinant expression vector containing the previously prepared PEPCK-encoding nucleic acid.

Transformation can be performed according to known methods, for example, calcium phosphate transfection, electrophoresis, transduction, DEAE-dextran mediated transfection. ), microinjection, cationic lipid-transfection, ballistic introduction, and the like.

The recombinant expression vector containing the PEPCK-encoding nucleic acid is introduced into the cell by the above transformation, then introduced into the nucleus, and then inserted into genomic DNA at the time of nuclear fission. The genomic DNA of a canine somatic cell line naturally possesses the PEPCK gene, but according to the present invention, as a foreign PEPCK-encoding nucleic acid is artificially additionally introduced, the PEPCK gene will be overexpressed when compared to the wild-type canine. In particular, according to the present invention, when the foreign PEPCK-encoding nucleic acid is located under the control of a promoter capable of inducing its overexpression (eg, the -746 variant described above), the PEPCK gene will be more overexpressed. In the present invention, "overexpression" means that a large amount is expressed compared to a wild-type canine animal.

Step 2: of the recipient ovum Denuclearization

Canines, unlike other mammals, stay in the fallopian tubes for several hours after ovulation, and the immature eggs become mature eggs. In mammals, the egg is a mature egg, that is, ovulation occurs in the second metaphase II, whereas the canine egg ovulates during the first meiosis and stays in the fallopian tube for 48-120 hours. It is characterized by going through a maturation process. In addition to this characteristic reproductive physiology, studies of many researchers (Lee et al, Reprod. Domest. Anim., 42(6):561-5, 2007; Lee et al, Zygote, 15(4):347-53, 2007) ), despite the in vitro maturation of the egg in canine animals (in The efficiency of in vitro maturation is still low. Therefore, it is most preferable to recover matured eggs in the living body of canine animals and use them as recipient oocytes for somatic cell nuclear transplantation.

The method of determining the time to ovulate in canine animals to recover mature eggs is, for example, but is not limited to, a method of determining the optimal time when it is confirmed that the keratinocytes are 70% or more through vaginal cell smear and There are methods of checking the growth and development status of follicles in real time through ultrasound images, and methods of determining the right time by measuring plasma progesterone.

In the present invention, it is preferable to determine the degree of egg maturation by measuring the concentration of progesterone in the blood of a donor dog providing a recipient egg. Preferably, when the plasma progesterone concentration is 4.0 to 7.5 ng/mL, it is regarded as the day of ovulation and the eggs are recovered. The concentration of plasma progesterone has a characteristic lower than that of plasma progesterone, which is determined to be the day of ovulation at the time of normal egg recovery known so far. In the case of individuals whose plasma progesterone rises rapidly (≥3.6 ng/ml/day) of the egg, it is optimal to recover 70-80 hours from the day of ovulation, and in the case of the individuals who rise slowly (<3.6 ng/ml/day), from the date of ovulation. It is preferable to recover at 80-90 hours. This is because there is a difference in the rate of increase of progesterone for each individual.

As a method of recovering mature oocytes in vivo, a surgical method including anesthetizing the target animal and then laparotomy may be used.

More specifically, for the recovery of mature oocytes in vivo, a fallopian tube resection method, which is a method known in the art, may be used. The fallopian tube resection method is a method of obtaining a perfusate by perfusing an embryo collection medium inside the fallopian tube after surgically cutting the fallopian tube, and recovering an egg from the perfusate.

In addition, mature oocytes in vivo can be recovered by attaching a catheter to the fallopian tube and injecting perfusate into the fallopian tube-uterine junction using an injection needle. Since this method does not damage the fallopian tubes, there is an advantage that the animal donating the egg can be used for the next estrus.

Therefore, preferably, the recovery of mature oocytes in vivo is performed using a catheter that does not damage the fallopian tubes.

More preferably, in the method of recovering eggs using a catheter, the front part of the needle developed by the present inventors is rounded, and thus the egg may be recovered using a 16 gauge Sonde, which is easy to install at the entrance of the fallopian tube. In this method, an egg recovery needle with a rounded front part is inserted-ligated into the fallopian tube, and then the egg recovery medium is perfused at the fallopian tube-uterine junction to allow the perfusate to flow into the egg recovery needle, and use the perfusate under a microscope. This is a method of obtaining mature eggs by speculum.

After the mature egg is recovered, the haploid nucleus of the egg is removed. Denuclearization of an egg can be performed using a method known in the art (US Patent No. 494384, US Patent No. 5057420, US Patent No. 5945577, European Patent Publication No. 0930009A1, Korean Patent No. 342437, Kanda et al, J. Vet. Med. Sci., 57(4):641-646, 1995; Willadsen, Nature, 320:63-65, 1986, Nagashima et al., Mol. Reprod. Dev. 48:339- 343 1997; Nagashima et al., J. Reprod Dev 38:37-78, 1992; Prather et al., Biol. Reprod 41:414-418, 1989, Prather et al., J. Exp. Zool. 255:355 -358, 1990; Saito et al., Assis Reprod Tech Andro, 259:257-266, 1992; Terlouw et al., Theriogenology 37:309, 1992).

Preferably, enucleation of the recipient oocyte can be carried out using two methods. One method is to remove the cumulus cells of the mature recipient egg, and then use a fine needle to incise a part of the translucency of the recipient egg to form an incision, through which the first pole body, the nucleus and cytoplasm of the egg Sheep).

Another method is to remove the egg cell of the recipient, and then stain the egg and remove the first pole body and the nucleus of the egg using a fine aspiration pipet.

More preferably, enucleation is performed by means of enucleation (Squeezing method) in which an incision must be formed in the egg. This is performed by fixing the recipient ovum with a holding micropipette, and then removing the first pole body, the ovum nucleus, and some cytoplasm.

A more specific method is as follows. For example, after rotating an incision egg to position the incision window vertically, place a fixing pipette at the bottom of the egg to support it so that the egg cannot move downward, and then press the incision pipette on the top of the egg to include the first pole body. Denuclearization of 10-30% of the cytoplasm is performed. Alternatively, after rotating the incision window of the egg vertically at 3 o'clock, press the fixing pipette and the incision pipette from top to bottom to perform denucleation of 10 to 30% of the cytoplasm including the first pole body. The oocytes of the denuclearized group 1 are washed with TCM-W and left in TCM 199 (B-①) for IVM until nuclear transplantation. Since oocytes after enucleation are very fragile, use a mouse pipette with an inner diameter of at least 300 μm, so that the cytoplasm of the oocyte does not escape through the incision after operation.

Step 3: Of nuclear donor cells Microinjection and fusion/activation

Microinjection of the nuclear donor cell into the enucleated oocyte can be performed by injecting the nuclear donor cell between the cytoplasm and the translucency of the enucleated oocyte using a pipette for transplantation.

The enucleated oocyte, on which the microinjection of the nuclear donor nuclear progenitor cells is completed, is electrically fused with the nuclear donor progenitor cell using a cell manipulator. In electrical fusion, the current may be alternating current or direct current, and may be performed under a voltage of 1.5 to 4.0 kV/cm.

Preferably the DC voltage is 1.9 to 2.2 kv/cm, more preferably 2.1 kv/cm, the time is 15 to 45 µs, more preferably for 30 µs, the number of times is 1 to 3 times, more preferably Can be performed twice.

Fusion by electrical stimulation of nuclear donor cells and eggs may be performed in a fusion medium. As the fusion medium, a medium in which mannitol, Mg ₂ SO ₄ , HEPES, and BSA are mixed may be used. Preferably, 0.2 to 0.3 M mannitol solution, 0.4 to 0.6 mM HEPES (0.01 to 0.2 mM CaCl ₂ and 0.01 to 0.2 mM MgSO ₄ are added) to 0.05 to 0.1% (w/v) BSA to be carried out in a mixed medium. I can. More preferably, 0.26M mannitol solution, 0.5mM HEPES (0.1mM CaCl ₂ and _{0.1mM MgSO 4} added) 0.05 ~ 0.1% (w / v) BSA may be carried out in a mixed medium.

Stage 4: fused nuclei Transplanted egg Activation

Activation of the fused nuclear transfer egg refers to the process of resuming the cell cycle, which has stopped in the middle of the second meiosis in the in vitro maturation stage. To this end, the high activity of MPF, CSF, etc., which are substances that stop the cell cycle, must be lowered, and the low activity of APC, which promotes the metastasis from the middle to late second meiosis, must be increased.

In general, in order to activate nuclear transfer embryos, it is necessary ^{to induce chromosomal condensation and embryo development by increasing the concentration of Ca 2 +} ions in cells, and for this, a physical method, a chemical method, or an electrical method is used. Physical methods include mechanical stimulation, heat, and direct current. Chemical methods include ethanol, inositol triphosphate, Ca ^{2 +} or Sr ^{2 +} , cytocalacin B, calcium ionophore, 6-dimethylaminopurine, cycloheximide, and phobol 12-myristate 13-acetate. There is a way to treat it with a substance. As the chemical method, preferably, a method of treating an egg fused with DMAP (6-dimethylaminopurine) for 2-4 hours may be used. As an electrical activation method, it can be performed 1-3 times for 30-60 µs under a DC voltage of 1.5 to 2.5 kV/cm.

In the present invention, it is preferable to omit the activation step.

As noted above, many diabetes treatments known in the art cause serious side effects. Since diabetes is a chronic disease, treatments for diabetes should be free from side effects, considering that treatments must also be taken for a long time.

The cloned canine animal overexpressing PEPCK obtainable according to the present invention can be used as a diabetic animal model for clinical trials of new diabetes treatments, and is expected to contribute to the development of diabetes treatments without side effects as well as diabetes treatment effects.

1 shows the activity of the canine PEPCK promoter in H41IIE cells.
Figure 2 shows the activity of the canine PEPCK promoter in H41IIE cells by Western blot analysis.
Figure 3 shows a schematic diagram of the recombinant expression vector pGL3_dPEPCK according to the present invention.
Figure 4 shows the results of PCR analysis of the genomic DNA of the transgenic donor nuclear progenitor cells and the transformed cloned dog.
5 shows the results of confirming the presence or absence of EGFP expression under normal light (a) and fluorescence (b) (left dog: normal cloned dog Boston Taylor, right dog: transgenic cloned dog beagle).
Figure 6 shows the microsatellite analysis results of the donor nuclear source, cloned dog and surrogate mother, the donor nuclear source and DMP-108. It can be seen that the peak value of DMP110 is the same, and through this, it was revealed that the donor nucleus and the replicator are genetically identical.

Hereinafter, a specific method of the present invention will be described in detail with examples, but the scope of the present invention is not limited to these examples.

Example One. PEPCK Of a promoter capable of inducing overexpression of

Example 1-1. Cell culture

The rat hepatocyte cell line (H4IIE), which was sold in the US ATCC laboratory, was maintained at 37° C. in DMEM (50 U/ml penicillin and 50/ml streptomycin) added with 10% FBS.

Example 1-2. Construction of a promoter and a recombinant expression vector containing the same

To induce overexpression of PEPCK, a full-length promoter naturally present in the PEPCK gene (from nucleotides -3180 to +1 = transcription start site; SEQ ID NO: 1) and from -3180 to -2349 nt from the full-length promoter, From -3180 to -1018 nt, and from -3180 to -746 nt, respectively, removed promoter variants were constructed. For each promoter amplification,

-3180 to +1 nt forward primer 5'-cccgctagccatggcttcctttccact-3' (SEQ ID NO: 2) and reverse primer 5'-cccaagcttgacaccaaggcttcctga-3' (SEQ ID NO: 3), -2349 to +1 nt forward primer 5'-cccgctagcgacagttgcaaaggaataa-3' (SEQ ID NO: 4) and reverse primer 5'-cccaagcttgacaccaaggcttcctga-3' (SEQ ID NO: 5), -1018 to +1 nt forward primer 5'-cccgctagcaagggcattgagaagtgt-3' (SEQ ID NO: 6) and reverse Primer 5'-cccaagcttgacaccaaggcttcctga-3' (SEQ ID NO: 7), -746 to +1 nt forward primer 5'-cccgctagctcctataggccttggctg-3' (SEQ ID NO: 8) and reverse primer 5'-cccaagcttgacaccaaggcttcctga-3' (SEQ ID NO: 9 ) And the genomic DNA of fibroblasts of beagle dogs. Several sites of the PEPCK promoter were constructed from genomic DNA of beagle dog fibroblasts, including NheI at the 5'end and NcoI at the 3'end. The amplified fragment was cut with NheI and NcoI restriction enzymes, and transferred to a pGL3-basic vector without a promoter (Promega Co., Madison, WI, USA) to prepare a “recombinant pGL3_PEPCK promoter plasmid”.

Example 1-3. temporary Transfection Department reporter gene assay

Transient transfection was performed using ^{lipofectamin™ 2000.} In order to control the transfection efficiency of the recombinant pGL3_PEPCK promoter plasmid (or'luciferase construct'), H4IIE cells were transfected with Rous sarcoma virus (RSV)-lacZ plasmid together with the luciferase construct. Briefly, during the day before transfection, 3 X 10 ⁵ cells were cultured in a 6 well tissue culture dish, and 0.5 µg of RSV-lacZ plasmid and 4 µg of luciferase construct were transferred to the cells in serum-free conditions. Specified. After 4 hours transfection, the culture medium was replaced with a treatment medium (including 1 mM dexamethasone in the existing culture medium), and cells were cultured for an additional 48 hours. Cell lysates were prepared through 150 µl of reporter lysis buffer (Promega, Co.), and luciferase activity was measured through a luciferase assay system (Promega, Co.). β-galactosidase activity was measured through the β-galactosidase enzyme assay system (Promega, Co.), and promoter activity was measured by calculating the relative luciferase value (%) to β-galactosidase activity.

As shown in FIG. 1, the promoter variants, which were removed from the full-length promoter naturally present in the PEPCK gene to -2349 nt and -746 nt, increased the luciferase activity by 110 and 130 times, respectively. However, the promoter variants removed from the PEPCK promoter to -3180 nt and -1018 nt did not induce a significant increase in luciferase activity. As a result, luciferase activity was the strongest in the promoter mutants removed from the full-length PEPCK promoter to -2349 nt and -746 nt.

Example 1-4. Western Blotting

H4IIE rat liver tumor cell lines were obtained and washed through a cold sterile solution of 0.9% NaCl, and proteins were isolated through Pro-prep (InTron. Inc., Seoul, Korea). 30 μg of cytoplasmic protein per lane was electrophoresed on a 10% SDS-poly acrylamide gel electrophoresis (PAGE) gel, and polyvinylidene fluoride (PVDF) transfer membrane (Perkin Elmer Co.) through TransBlot Cell (TE-22, Hoefer co.) ., Wellesley, MA). The transferred blot was blocked in TBS-T containing 5% fat-free milk for 120 minutes and reacted with PEPCK (diluted 1:500, CAYMAN) or GAPDH (diluted 1:2000, Assay Design Inc.) primary antibody. After washing the blot membrane using a buffer, it was reacted with a quantitative horseradish peroxidase-conjugated secondary antibody (diluted 1:2500, Santa Cruz, CA, USA) for 1 hour at room temperature. The blot membrane was washed again, reacted in ECL chemiluminescent reagent (Amersham Biosciences), and developed on a Biomax™ Light film (Kodak) for 1-5 minutes.

In Example 1-3, it was confirmed that the promoter variants removed from the full-length PEPCK promoter to -2349 nt and -746 nt showed the strongest activity. Accordingly, in Example 1-4, it was examined whether the -2349 nt and -746 nt variants in the PEPCK expression induced by the PEPCK promoter are related to the expression of the PEPCK induced by Dex (dexamethasone). When H4IIE cells were treated with 1mM Dex for 24 hours, when compared to cells in the absence of Dex, the level of PEPCK expression was increased. Additionally, it was confirmed that PEPCK expression was specifically overexpressed in transfected cells. A significant increase in PEPCK expression was observed in the presence of Dex in transfected cells. In the presence of Dex, the PEPCK expression level was higher in the -746 nt mutant than in the -2349 nt mutant in the PEPCK promoter (Fig. 2). This result is consistent with that in Example 1-3, the -746 nt mutant had the highest luciferase activity.

Example 2. PEPCK Overexpression transformation Clone dog production

Example 2-1. dog PEPCK Preparation of Recombinant Expression Vector Containing Gene

In order to overexpress the canine PEPCK gene in pancreatic beta cells, the promoter variant prepared in Example 1, removed from the full-length PEPCK promoter to -746 nt, was transferred to a pGL3-basic vector without a promoter. The PEPCK expression cassette plasmid was constructed in several steps. PEPCK cDNA was produced from hepatocytes of beagle dogs as a template, and the primer was 5'-cccccatggcgaggtcatcccaaaacaag-3' (SEQ ID NO: 10) and the reverse primer 5'-ccctctagagggtctgatcacatggct- It was amplified using 3'(SEQ ID NO: 11). The amplified fragment was cut with NcoI and XbaI restriction enzymes, and transferred to a recombinant pGL3_PEPCK promoter plasmid. EGFP was made of pIRES2_EGFP (BD Biosciences Clontech, USA) as a template, and the 5'end of the primer is EcoRV, the 3'end is the forward primer including BamHI 5'-gatatccacaaccatggtgagcaagggcga-3' (SEQ ID NO: 12) and the reverse primer 5' Amplified using -cggatccttacttgtacagctcgtccatgcc-3' (SEQ ID NO: 13). The amplified fragment was cut with EcoRV, BamHI restriction enzymes, and transferred to pIRES Neo vector (BD Biosciences Clontech, USA). The selection cassette was amplified using the recombinant pIRES EGFP Neo plasmid. The primers were amplified using a 5'-ggacgcgttgacattgattattgact-3' (SEQ ID NO: 14) and a reverse primer 5'-gcgctagctagaggtcgacggtatac-3' (SEQ ID NO: 15), including a 5'end of MulI and a 3'end of NheI. The amplified fragment was cut with MulI and NheI restriction enzymes, and transferred to the recombinant pGL3_PEPCK promoter PEPEK cDNA plasmid. Each sequence base was confirmed by nucleotide sequencing (Genotech Co. Ltd., Daejeon, Korea).

Example 2-2. doggy Donor nuclear source Fibroblast establishment

* The establishment of nuclear donor cells was established as reported by Hossein et al. (Animal reproduction science, 2009, 114(4), 404-414). Briefly, fetal fibroblasts were recovered from fetuses isolated through cesarean section from pregnant 30-day-old mother dogs through artificial insemination and cloned egg transplantation, and adult cells were biopsied from the abdominal skin tissue of adult dogs. In the establishment of recloned fetal fibroblasts, pregnancy is confirmed through ultrasound of a mother dog at 30 days of age after pregnancy through transplantation of cloned eggs. When pregnancy is confirmed, fibroblasts are established from fetuses isolated by cesarean section from the mother. The obtained cells were chemically and physically parsed, incubated in Dulbecco's Modified Eagles' Medium (DMEM) until 90% or more filled in a culture dish, and then frozen in liquid nitrogen.

Example 2-3. dog PEPCK Genetic To donor nuclear progenitor cells Transformation

The overexpression construct of the PEPCK gene prepared in Example 2-1 was linearized by treatment with MulI restriction enzyme. The linearized fragment was sorted and transfected into the donor nuclear progenitor cells established in Example 2-1. One day before the transfection, the donor nuclear progenitor cells were cultured in a culture dish, and the growth rate was cultured to cover 70-80% of the surface area of the culture dish. In this cell culture solution, the PEPCK gene overexpression product and Lipofactamine 2000 were mixed in a ratio of 1 µg:5 µl, left to stand at room temperature for 20 minutes, and then dispensed. After transfection, the culture medium was replaced with DMEM supplemented with 350 μg/ml of G-418, and among these cells, neomysin-resistant cells were cultured for 4 weeks to sort out. Among the surviving cell colonies, only cells with EGFP fluorescence were sorted through a fluorescence microscope. After subculturing the cells several times, cell lines continuously expressing EGFP fluorescence were selected, and screening of these cell lines was performed through PCR.

Example 2-4. Management of experimental animals

Donor dogs to provide mature eggs and female breeding dogs that are 1-7 years old and 20-25 kg in weight were used as breeding dogs for transplantation of cloned eggs, and the experimental dogs used were fed freely with general breeding feed one at a time from indoor dogs. And was reared and managed. All of these dogs were managed in accordance with the Suam Biotechnology Research Institute's Code of Ethics for Experimental Animals.

Example 2-5. Canine cloning

This example was carried out according to the procedure disclosed in Korean Patent Application No. 10-2009-0038315 filed by the applicant of the present invention.

After checking the estrus cycle of the female every week, when the time of ovulation approached, 2 ml of blood was drawn every day to separate the serum. The separated serum was checked for the concentration of progesterone in the blood using ECLIEA of Cobas E411 (Roche Diagnostics,). When the concentration of progesterone in the blood reached 4.5 ng/ml, mature eggs were recovered with TCM199 medium through a surgical method. As described in Hossein et al. (Animal reproduction science, 2009, 114(4), 404-414), cumulus cells from the recovered canine in vitro mature eggs were isolated suitable for somatic cell nuclear transplantation. The oocyte was treated with 5 μg/ml bisbenzimide to stain the oocyte nucleus, followed by somatic cell nuclear transplantation. After micro-manipulation of the donor nucleus source into the enucleated oocyte through micromanipulation, a 0.26M mannitol solution 0.5mM HEPES, 0.1mM CaCl ₂ and _{0.1mM MgSO 4} were added) through electrical stimulation. Electrical activation and fusion were performed. Electric fusion was performed using a BTX Electro-Cell Manipulator 2001 with two DC voltages of 1.9, 2.0, 2.1, or 2.2kV/cm with electric stimulation at 30 µs.

In accordance with the provisions of the Budapest Treaty on the international approval of microbial deposits in the patent procedure, the nuclear transfer eggs obtained through this process were registered with the KCTC (Korean Collection for Type Cultures, Korea Research Institute of Bioscience and Biotechnology) as of July 6, 2008 with the accession number KCTC11360BP. Deposited with.

Example 2-6. Surrogate mother The duplicate column Surgically implanted

After the surrogate mother was opened surgically, the side with many corpus luteum in both ovaries was identified. After exposing the identified ovarian fallopian tubes with fine forceps, a cloned egg loaded in a Tomcat catheter (Severeign, Sherwood, USA) was implanted at the distal end of the fallopian tube. The surrogate mother implanted in this way was confirmed by ultrasound at 30 days of age.

Example 2-7. Microsatellite analysis

The cells of the born baby were compared with those of surrogate mother cells, donor nuclear progenitor cells, and egg donor dogs. GDNA was extracted from each sample, and parental discrimination was performed through 10 markers (PEZ1, PEZ 3, PEZ 5, PEZ 6, PEZ 8, PEZ 12, PEZ 20, FHC 2010, FHC 2054, and FHC 2079). .

Example 2-8. dielectric DNA Extraction department polymerase chain reaction ( PCR )

The genomic DNA of the cells and the umbilical cord of the transgenic puppy were isolated using the G-DEX™ IIc genomic DNA extraction kit (Intron Biotechnology, Suwon, Korea). 1 μg of genomic DNA was amplified through a 20 μl PCR reaction containing 1 unit of Ex-Taq polymerase (TaKaRa, Japan.), 2 mM dNTP, and 10 pmol of a specific primer. The PCR reaction proceeded by separating the double strands at 95° C. for 30 seconds, binding the primers to a single strand at 62° C. for 30 seconds, and continuing the base at 72° C. for 1 or 3 minutes. Primers for the selection cassette are forward primer 5'- catgaagcagcacgacttct -3' (a primer, SEQ ID NO: 16) and reverse primer 5'-cctaggaatgctcgtcaaga-3' (b primer, SEQ ID NO: 17), and for the PEPCK expression cassette Primers are forward primer 5'- tcctataggccttggctg-3' (c primer, SEQ ID NO: 18) and reverse primer 5'-gggtctgatcacatctggct-3' (d primer, SEQ ID NO: 19). The PCR result (8 μl) was electrophoresed on a 0.7% agarose gel, stained with ethidium bromide, and photographed under UV-illumination. Photos were scanned through Gel Doc EQ (Bio-rad Laboratories, Inc.).

Example 3. Example Results for 2

3-1. PCR Screen results

In the overexpression construct of the PEPCK gene prepared in Example 2-1, the structures of the PEPCK expression cassette construct and the selection cassette construct can be seen in FIG. 3(A). Selectable cassette constructs include CMV, EGFP, and Neo. And the PEPCK expression cassette construct contains -749 nt of the PEPCK promoter, the PEPCK cDNA gene, and the SV40 poly A signal. Screening of transfected cell lines was performed via PCR. A ~1kb fragment containing the Neo site and EGFP was amplified using primers a and b (Fig. 3(B)). Using the c primer and d primer, the ~2.7kb and 5.2kb fragments were amplified (Fig. 3(C)). The 5.2 kb fragment contains the endogenous PEPCK site and the 2.7 kb fragment contains the PEPCK expression cassette site. ^{The identified cell colonies were expanded and frozen at a concentration of 0.6 x 10 6} cells through secondary confirmation and quantitative confirmation, and were used for nuclear replacement. Candidate genomic DNA was isolated from the umbilical cords of candidate transgenic puppies. As a result, of the three animals, two positive animals (No. 1, No. 3) were confirmed (FIG. 3).

3-2. According to the applied voltage Cloned In the body Growth rate

Comparison of in vivo growth rate of cloned eggs in dogs according to applied voltage SDT ^a
No. of oocytes transferred No. of recipients No. of pregnancy (%) No. of puppies born (%) 1.9-30-2 66 6 1 (16.7) 1 (1.5) 2.0-30-2 94 9 3 (33.3) 3 (3.2) 2.1-30-2 51 5 3 (60.0) 3 (5.9) 2.2-30-2 32 2 1 (50.0) 1 (3.2)

^a SDT=S; Voltage (kV), D; Energization time (usec), T; Number of energization

^b Cumulative from 3 independent trials that yielded similar findings

The above results are obtained by transplanting cloned eggs into 22 surrogate mothers. At 2.1kV/cm voltage, fusion and egg activation showed significantly higher litter rate.

3-3. By Donor Nuclear Source Aspects of pregnancy

Pregnancy Patterns by Nuclear Donor Source Cell type No. and (%) of oocytes No. of recipients Pregnancy status (%) of recipients No. of puppies born Used for NT Successfully fused Day 30 pregnancy Full term Adult fibroblasts 152 147 (96.7) 9 1 (11.1) 1 (11.1) One Recloned fetal fibroblasts 118 115 (97.5) 10 3 (30.0) 2 (20.0) 2 Common fetal fibroblasts 66 51 (77.3) 4 2(50.0) 2 (50.0) 2

336 dog cloned eggs were prepared and transplanted into 23 surrogate mothers. Adult fibroblasts, recloned fetal fibroblasts, and general fetal fibroblasts were used as donor nuclear sources, respectively, and their nuclear fusion rates were 96.7%, 97.5%, and 77.3%. The birth rate of each cell was 11.1%, 30%, and 50%. When using normal fetal fibroblasts, the efficiency of litteral replication was significantly higher. When general fetal fibroblasts were used as the donor nuclear source, healthy cloned beagle dogs weighing 380g and 360g were produced at each birth, and it was confirmed that they were cloned dogs consistent with the donor nuclear source through paternity discrimination.

Example 3-4. Produced replica Self-doubt Aspect

Patterns of produced cloned dogs Offspring identification Karyoplast passage no. Gestation length Birth weight (g) Delivery method GFP expression ^c DFN59 5 44 N/A ^a Natural - DFN60 5 65 380 ^b Cesarean section - DFN64 5 63 340 Cesarean section - DMP108 6 62 380 Cesarean section + DMP110 6 63 360 Cesarean section +

N/A, not applied

^a miscarriage at 44 days of pregnancy

^b Dies at the age of 1 day after delivery

^c Whether or not fluorescence is expressed in B-filter

Korea Research Institute of Bioscience and Biotechnology KCTC11360BP 20080706

<110> HWANG, WOO SUK <120> Transgenic Cloned Caninds with PEPCK Gene and Method for Producing Thereof <160> 19 <170> KopatentIn 1.71 <210> 1 <211> 3180 <212> DNA <213> canine <400> 1 gctagccatg gcttcctttc cactgtttac ctggaaggca gctgttccct gcccccactc 60 tcacctgctc acaccttttg agtcttggcc attctagact gctgtgcagt ttccatggtg 120 ccttctcagc ttccctgctc cacacaggct ttccagagtc ctgctccctc cctcctcgga 180 tcctgaggac agccaggctg cagcttcaac agcaacaaat gtgcgtggaa cctcacaagg 240 agaagtgaag acgttaactt tggagttgga aactattttt ttctgtgtct actgcctcct 300 tctccttctt tcagcaaaaa caattttgtc tgggttcaac tttgtatatg gtattaaaag 360 gaggagcagt cttgcatctt aagccagcct cgagaagtta ggaggtcccc atggcattta 420 ttgcagaagt gacaaatgca gcccatactg ggagaccatt accattatga tttacacagt 480 ccccgttggg ccctatcaac actgggatag ggacgccggg gtggctcagg gcctgccttt 540 ggctcaggtt gttatcctgg ggtccaggat cgagtcccac atcgggctcc ctgcgaggag 600 cctgtttctc cctttaccta tgtctctgcc tctctctgtg tgtctctcgt gaataagtga 660 ataaataaaa tttttaaaaa acaaaacact gggataagcg aactttgtcc atacttctgc 720 cgcgtgtcct caacatcctg gcttctgtct gcatcactct tttccaacgg actcagtact 780 ttcaggtaaa tctgcaacct gatgtttgcc ttttcatgtt attttgaggg acagttgcaa 840 aggaataatg ccagccttcc ctggggtcag tgtgaataat taagcaattg gcggggggca 900 gtggtagcct cctgttccta cattttaatc gagctggcta tttctctcca ggaagactcc 960 aaacataaac accttgaatt tatgggtagc atttagaacc acaaataagt tctggtttct 1020 catttttgtt ttcaatctat gtgctcttcg agggaatgaa acctatcaca gttttatcag 1080 caaaatggga atctctaccc atttggtgag atggaccgca ctggcataaa tgtgtgtgtt 1140 gctgtgcatt tgaatggcta atttcactgg tgtcagatgc taagacagtg tccctcagca 1200 actgaacatt acgtcgtagt tgaatttcga catgacacaa acttatatgg ttggcagcgc 1260 cactaagaat gaaatctggg gacctaaatg ggaaataatt ttaaactaaa tgaaaacctc 1320 agtttatact gaaagattca attggttaaa tacaaatctg ggggggatcc ctgggtggct 1380 cagaggttta gtgcctgcct tcggcccagg gtgtgatcct ggagtcctgg gatcgagtcc 1440 cgcgtcgggc tcccagcatg gagcctgctt ctccctctgc ctgtgtctct gcctctttct 1500 ccctctctct gtgtatctca tgaataaata aaataaaaat attaaaaaat acaaatctgg 1560 gtaaatgaga cattggaata ggttggcaat tttggtggaa gttggtgatg tgtgtatacc 1620 taatgtcaca atgggaacca aggcttaagg ggtagtcctt cagatattct tggtctgaga 1680 ttgccattcc caaagccttg tattcctata gctccttaag gacacagtca cagaattatc 1740 tctgcacacc ccacgtggga ggcaggcaaa tccctaccca ccgtcctcca aagcacaggg 1800 tgcccactga ctgcactgtt gggttccctg tgaagagtgg gagcctggcc ccaagctcct 1860 gacttctcac ccagtgctct caaaatgcca gcaagtagca ccagagttca ctgaattgga 1920 ctgaagttct tatggcttgc aaagcgaatt ctttacagct ggcataaagg tctcattgct 1980 caagtgtaat ctagcaaaac caccaagccc cctcccctcc ccagacgctc agactctcaa 2040 gggcattgag aagtgtgcag tcatcttttt gtagctgcat ccagcccaga actacttgga 2100 gaatatatgg aaagttccag aaaagagaat ggcacctcac aagggacagc atggtgaggt 2160 gctccagatc cccagtggct tatgttccaa tcttccctct atcactctac aaccaggagt 2220 tgggagtagc cacttggcct gcacgcattc agtgcctacc gtgtgctagg aaccgtacag 2280 acaaaaaata acaggacagg cagagattct tgcccttgga gagtttatat ttggggtggt 2340 gggcacacag gggagactca gtaaggttat tagccctccg ttaggtctgg acttttgcta 2400 atgagccaaa tgtttattta catttgggca catccttcct ataggccttg gctgtgtggt 2460 gacacctcac cactgctgtg ttttgtcagc cagcagccat cggtacacag aatgtgctgc 2520 caataaccct tgatgtccgg aaggtgttcc cgccagcctt gcaggatccc acctgcctgt 2580 cagtggaagg acggagtgtt ttacatcagc agtgaactgg gtcaaagttt agtcaatcac 2640 aagttgtgta agaacttgct gtggctggtc taaggacaaa ggcctcccag cactcattaa 2700 caactatctg ttcaatgatt atctccctgg ggcttattgt ggtgagcccg tccagaagca 2760 tgacggacag tggccatgat ccaaagtcct gcccctgacg tcagagacga gcctccctgg 2820 gtgtagccga ggggtggggc ctttctcctc aatgggattt aagaccagga ggctctgcga 2880 cccaacagcg agcacggcct tcccactggg aacgcacggc tactagcagg aagaaccgcg 2940 aaaagaaacc cttggatctc tcatcgaggt catcccaaaa caagaacagt aggtagagat 3000 ttttaattta cgtttctaaa aattacagag gtaacaccaa cccgtttcct tttctcctta 3060 gagcttcggc tgtctcgtga tgtgtcaccc aaagaagcat gtggagtttc tttgagggtg 3120 tctgtcattt tgttcaagga gcctgtgttt tctgtttcag gaagccttgg tgtcaagctt 3180 3180 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PEPCK promoter (from -3180 to +1 nt) <400> 2 cccgctagcc atggcttcct ttccact 27 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PEPCK promoter (from -3180 to +1 nt) <400> 3 cccaagcttg acaccaaggc ttcctga 27 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PEPCK promoter (from -2349 to +1 nt) <400> 4 cccgctagcg acagttgcaa aggaataa 28 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PEPCK promoter (from -2349 to +1 nt) <400> 5 cccaagcttg acaccaaggc ttcctga 27 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PEPCK promoter (from -1018 to +1 nt) <400> 6 cccgctagca agggcattga gaagtgt 27 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PEPCK promoter (from -1018 to +1 nt) <400> 7 cccaagcttg acaccaaggc ttcctga 27 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PEPCK promoter (from -746 to +1 nt) <400> 8 cccgctagct cctataggcc ttggctg 27 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PEPCK promoter (from -746 to + 1 nt) <400> 9 cccaagcttg acaccaaggc ttcctga 27 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PEPCK cDNA <400> 10 cccccatggc gaggtcatcc caaaacaag 29 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PEPCK cDNA <400> 11 ccctctagag ggtctgatca catctggct 29 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for EGFP cDNA <400> 12 gatatccaca accatggtga gcaagggcga 30 <210> 13 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for EGFP cDNA <400> 13 cggatcctta cttgtacagc tcgtccatgc c 31 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> forward primer for selection cassette <400> 14 ggacgcgttg acattgatta ttgact 26 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for selection cassette <400> 15 gcgctagcta gaggtcgacg gtatac 26 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for selection cassette <400> 16 catgaagcag cacgacttct 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for selection cassette <400> 17 cctaggaatg ctcgtcaaga 20 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PEPCK expression cassette <400> 18 tcctataggc cttggctg 18 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PEPCK expression cassette <400> 19 gggtctgatc acatctggct 20

Claims (13)

A nuclear transfer embryo in a canine formed by transplanting a canine-derived somatic nucleus transformed with a nucleic acid encoding a PEPCK (Phosphoenol Pyruvate Carboxykinase) into a denuclearized egg. The nuclear transfer embryo according to claim 1, wherein the nuclear transfer embryo has been deposited with Accession No. KCTC11360BP. The method of claim 1, wherein the PEPCK encoding nucleic acid is (1) a full-length promoter naturally present in the PEPCK gene, (2) a promoter removed to -2349 base from the full-length promoter, (3) the full-length promoter And (4) a nuclear transfer embryo, characterized in that it is placed under the control of a promoter selected from the group consisting of a promoter removed from the full-length promoter to -746 base. The nuclear transfer embryo of claim 1, wherein the PEPCK encoding nucleic acid is derived from a canine animal. The nuclear transfer embryo according to claim 1, wherein the canine somatic cells are fetal fibroblasts. The nuclear transfer egg of claim 1, wherein the canine is a dog. (a) preparing a donor nucleated cell comprising transforming a somatic cell line derived from a canine animal with a PEPCK encoding nucleic acid; (b) removing nuclei from mature eggs of canine animals; (c) a method of producing a nuclear transfer embryo of a canine animal transformed with a PEPCK gene, comprising microinjecting and electrofusion of the donor nucleated cells of step (a) into the denuclear egg of step (b). 8. The production method according to claim 7, wherein the nuclear transfer egg has been deposited under accession No. KCTC11360BP. 8. The production method according to claim 7, wherein the mature egg of the canine in step (b) is recovered at 70 to 90 hours from the date of ovulation of the canine. [8] The production method according to claim 7, wherein in step (c), the electric fusion is performed at a DC voltage of 1.9 to 2.2 kV / cm, for a time of 15 to 45 kW, and recovery is performed one to three times. A method for producing a transgenic cloned canine that overexpresses PEPCK, comprising the step of implanting a nuclear transfer egg according to claim 1 into a fallopian tube of a surrogate mother to give birth to a litter. The production method according to claim 11, wherein the nuclear transfer egg has been deposited under accession No. KCTC11360BP. A transgenic cloned canine animal which overexpresses PEPCK produced by the method according to claim 11.

Images