KR20120090968A - Monoclonal antibodies against pbp2-a protein and homologous sequences for the treatment of infections by and immunodiagnostics of bacteria of the firmicutes phylum - Google Patents

Abstract

The invention pathogens mechi ampicillin-resistant Staphylococcus aureus (methicillin-resistant Staphylococcus aureus) -MRSA , tangerine core cyclase-negative staphylococci (coagulase-negative Staphylococcus), Staphylococcus sciuri (Staphylococcus sciuri), enterococci (. Enterococcus spp) and A monoclonal antibody capable of recognizing and binding PBp2a protein and other proteins exhibiting sequences homologous to PBP2a, including PBP2a or other bacteria having sequences homologous to such proteins.
The present invention relates to the use of monoclonal antibodies capable of recognizing and binding PBP2a proteins and other proteins exhibiting sequences homologous to PBP2a in complementary immune diagnostics for the detection of resistance to beta-lactams.

Description

MONOCLONAL ANTIBODIES AGAINST PBP2-A PROTEIN AND HOMOLOGOUS SEQUENCES FOR THE TREATMENT OF INFECTIONS BY AND IMMUNODIAGNOSTICS OF BACTERIA OF THE FIRMICUTES

The invention pathogens mechi cylinder-resistant Staphylococcus aureus (methicillin-resistant Staphylococcus aureus) -MRSA , tangerine core cyclase-negative staphylococci (coagulase-negative Staphylococcus), Staphylococcus sciuri (Staphylococcus sciuri ), Enterococcus spp., and monoclonal antibodies capable of recognizing and binding PBP2a proteins and other proteins showing sequences homologous to PBP2a, including PBP2a or other bacteria having sequences homologous to such proteins. .

The present invention relates to the use of monoclonal antibodies capable of recognizing and binding PBP2a proteins and other proteins exhibiting sequences homologous to PBP2a in complementary immune diagnostics for the detection of resistance to beta-lactams.

Invention ground

Methicillin-resistant Staphylococcus aureus (MRSA) is a major reason of interest for clinicians who directly deal with patients, which shows higher mortality and incidence than infections caused by Methicillin-sensitive Staphylococcus (1). In addition, such infections result in longer hospitalization times and higher costs with antimicrobial agents, resulting in significantly higher costs for the treatment of patients infected by these pathogens 1.

Vancomycin was the first antimicrobial agent to choose for the treatment of infections caused by MRSA. However, with the identification of MRSA strains with moderate resistance to vancomycin in Japan, the United States (5), and Brazil (6), isolation of progressively increasing MRSA strains in the United States and Australia (2, 3, 4) Isolation is making the situation worse. The resistance of MRSA strains to vancomycin in 2004 (7) has caused tremendous concern in the medical-scientific community. Currently, MRSA represents the strongest candidate for pathogens that are resistant to all the drugs now available, namely the horrible “superbugs or superbacteria”.

Typically, the prevalence of MRSA in hospital infections (ratio of Staphylococcus aureus caused by MRSA among all infections) has been increasing gradually over the last few decades. Jarvis et al. , Including 1268 Intensive Care Units (ICUs) at 337 hospitals in the United States . In the study conducted by, the number of infections caused by MRSA in the ICU changed from 660 to 2184 cases, and the prevalence also increased from 35% to 64,4% (8). In Japan, the prevalence of hospital infections (HIs) caused by MRSA represents an alarming figure, namely 60% to 90%. In a study conducted in the United States, the percentile changed from 2% in 1974 to 50% in 1997, and in some US hospitals more than 80% of HIs were caused by MRSA (12). The prevalence rate in the United Kingdom increased from 1.5% to 15.2% between 1989 and 1995, and is now 41.5% (13) in 2004.

In addition to the high prevalence, MRSA is known to be the main pathogen causing pandemic in Brazilian hospitals, especially in educational and large hospitals. In 1986, more than 50% of Staphylococcus aureus strains, isolated from patients at Sao Paulo University Hospital, were resistant to methicillin, and in 1993, the incidence of MRSA in pediatric hospitals at Paulista Medical School was 70%. (15). In a study conducted in Belo Horizonte's hospital, Resende et al . (16) indicated a 71% prevalence of MRSA.

MRSA strains provide penicillin-binding proteins with very low affinity for antimicrobial agents in the beta-lactam class such as PBP2a (17). In the presence of these enzymes encoded by the gene mec A, the bacteria successfully synthesize pepti glycans even in the presence of beta-lactams. This enzyme is also the core tangerine cyclase may be found in bacteria present in the two normal strain-negative Staphylococci and Staphylococcus sciuri. In addition to resistance to beta-lactams, hospital MRSA strains are also resistant to other available antimicrobial classes, with the use of glycopeptides (vancomycin and teicoplanin), which are the first choice for treatment.

Two studies using DNA vaccines against PBP2a showed that these proteins were immunogenic and the obtained immune response could confer defense against MRSA in studies conducted in mouse models. However, in hospital infections, most patients are known to be immunosuppressed. In such cases, the vaccine will not be able to produce protective antibodies in a timely manner to control bacterial infection.

PBP2a  Immunogenicity

PBP2a is a class II multimodal enzyme according to the Goffin and Ghuysen classification. This 76-kilodalton enzyme consists of a membrane-binding site, a non-transpeptidase region and a transpeptidase region, which contains a 4-amino acid active core (STQK), which is responsible for the bacterial peptide transfer reaction. (20 bis Ryfell, 1990).

Previous studies with DNA vaccines against PBP2a have shown that bacterial reduction results (height quantification) in immunized animals in environments challenged by systematic infection are reported by Ohwada et al. al . In the study of 3 to 4 times, Senna et al . In the study was 1000 times. The authors used the entire sequence of the gene mecA (except for the membrane anchoring region) and the inner fragment of the transpeptidase region, respectively.

However, according to the above, the vaccine cannot produce protective antibodies in a timely manner to control bacterial infection. Thus, when infections of MRSA occur, administering anti-PBP2a monoclonal antibodies is the most appropriate treatment for treating such infections.

The main object of the present invention includes pathogen methicillin resistant Staphylococcus aureus-MRSA, coagulase-negative Staphylococcus aureus, Staphylococcus sciuri , Enterococcus spp. And PBP2a or other bacteria having sequences homologous to such proteins. Thus, the present invention provides a monoclonal antibody capable of recognizing and binding a PBp2a protein (SEQ ID NO.:1) and another protein exhibiting a sequence homologous to PBP2a.

Another object of the present invention is to use a monoclonal antibody capable of recognizing and binding a PBP2a protein and another protein showing a sequence homologous to PBP2a in a complementary immunodiagnosis for detection of resistance to beta-lactams. .

The monoclonal antibodies of the invention comprise the sequences SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 9, SEQ ID NO .: 10, SEQ ID NO .: 11, SEQ ID NO .: 12, SEQ ID NO .: 13, SEQ ID NO .: 14, SEQ ID NO .: 15, SEQ ID NO .: 16, and SEQ ID NO .: 17.

1 shows immunoenzyme tests on animal serum immunized to produce anti-PBP2a antibodies.
2 shows the polyacrylamide gel results of raw samples and post-purification samples.
Figure 3 depicts immunotaxine testing of MRSA and MSSA lysates on supernatants containing anti-PBP2a monoclonal antibodies.
4 shows the results according to representative flow cytometry of MRSA (CEB) and MSSA bacteria, incubated with anti-PBP2a monoclonal antibody and labeled with phycoerythrin (PE).
5 depicts the in vitro defense test (MIC-minimal inhibitory concentration) conferred by monoclonal antibodies and vancomycin purified against inoculations of different MRSA strains.
FIG. 6A shows kidney quantitative results of treatment of animals with and without treatment with anti-PBP2a monoclonal antibodies in a sub-lethal dose of the MRSA CEB strain.
FIG. 6B shows kidney quantitative results of treatment of animals with and without treatment with anti-PBP2a monoclonal antibodies in a sub-lethal dose of MRSA Iberian strain (European pandemic).
FIG. 6C shows kidney quantitative results of treatment of animals with and without treatment with anti-PBP2a monoclonal antibody in a sub-lethal dose of WB79 CA-MRSA strain (Brazil regional strain).
FIG. 7A shows survival curves of treated (defense) and untreated animals (control) after infection with lethal bacterial mass (MRSA CEB).
FIG. 7B shows survival curves of treated animals (defense) and untreated animals (control) after infection with lethal bacterial mass (Iberian MRSA).
7A shows survival curves of treated (defense) and untreated animals (modulation) after infection with lethal bacterial load (WB79 CA-MRSA).
FIG. 8A shows intracellular renal quantification of untreated animals after infection with bacteria (MRSA CEB) and animals treated with anti-PBP2a monoclonal antibody, vancomycin and antibody + vancomycin associations.
8B shows quantification of bacterial in kidneys of animals treated with anti-PBP2a monoclonal antibody.
9 depicts the interaction between PBP2a (antigen) and recombination of monoclonal antibody clones 38 (FIG. 9A) and clone 10 (FIG. 9B).
10 is a second analysis of MRSA samples by flow cytometry in the presence of FITC-labeled anti-PBP2a antibody.
FIG. 11 shows the results for in vitro defenses conferred by antibodies against VRE enterococcus strains.
12 shows LD ₅₀ and lethal dose for intraperitoneal infection determination.
FIG. 13 shows the efficacy results of in vivo defense of anti-PBP2a and PBP5 monoclonal antibodies from enterococci against systemic infection.

Detailed invention

Cases of infections caused by bacteria that are multidrug resistant to antimicrobial agents have emerged, and have increased gradually to alarm. The prevalence of hospital infections caused by MRSA has increased mortality or incidence rates worldwide, which has resulted in very high costs due to more intensive use of antimicrobial agents and further lengthens the length of hospitalization of patients ( 24). Chemotherapy-based therapies have shown signs of exhaustion because very few new and effective drugs appear on the market (25).

In this regard, passive immunotherapy has emerged as a promising alternative, which has a wide range of advantages over conventional chemotherapy. Among such advantages are lower toxicity, higher plasma half-life (which facilitates treatment through reduced dose, which results in lower treatment costs), and especially in the case of the product provided herein, Paul Ehrlich (where the drug is mentioned above Selectively remove the pathogens present) (25a). The last mentioned advantage is very useful in preventing the so-called selection pressure acting by a wide range of antimicrobials, which provide for the emergence of multidrug resistant bacteria 26.

To develop this product, the inventors targeted PBP2a based on preliminary studies related to DNA vaccines and immunostructural molecular analysis in mouse models. PBP2a had its own structure as revealed in 2002 (29) and was left to the Protein Data Bank (PDB).

As another approach, the inventors studied the site inside the molecule with 76 amino acids, which are arranged flanking the enzyme active core (SxxK) in the transpeptidase region. Epitope identification assays were performed on different molecules of the class II CHM Allele (Tepitope program) and on the molecule, which was subsequently performed to confirm their position in the molecule (SPDB-Viewer program). This approach allows us to assess the antibody access efflux rate to these targets in naturally occurring molecules.

This calculated analysis showed the presence of epitopes in close proximity to the enzyme active core, which have an excellent recognition rate by class II CHM alleles located on the PBP2a surface (data not shown).

Previews in this computer virtual environment were confirmed by target recognition tests performed (immunoassay and flow cytometry), and showed that antibodies that bind to the PBP2a site can confer high protection, which was performed in vivo. And the results obtained in in vitro tests. Antibodies produced by 76-amino acid fragments were shown to carry higher defenses than antibodies produced by immunization with total PBP2a, which was confirmed from the results obtained by the inventors as previously known in Ohwada and Senna studies.

Epidemiology of infections caused by MRSA shows that there is a potent clone type responsible for outbreaks and epidemics in hospitals around the world. Such clones provide higher colonization and pathogenesis as compared to the non-infectious MRSA strain 30.

As a method for validating the results obtained, it was intended to study different MRSA clones (infectious clones), which are representative of most of the infections caused by MRSA (particularly hospital infections).

The CEB strain (an infectious clone of Brazil) is responsible for most of the infections caused by MRSA in Brazilian hospitals (31), which are also found in other countries such as South Africa (32, 33), Portugal and Czechoslovakia (34). same. European infectious clones (Iberian-MRSA) have been found in European countries and the United States (35).

One of these strains (WB79 CA-MRSA), isolated from Brazil, was included in this trial due to the increase in the number of local infections caused by MRSA. This test, along with a higher onset (with Panton-Valentine leukocidin) and a profile that is resistant to different antimicrobials than one of the pathogenic MRSA strains (36), exhibits differentiating features from those found in hospitals. Recently, the incidence of infection by CA-MRSA in male residents having sex with other men has been identified in the United States (37). From this point on, infections caused by MRSA are believed to have STD (disease transmitted by sexual contact) characteristics.

The protective results accompanying the administration of anti-PBP2a antibodies have shown efficacy against all other test clones, which allows us to trust its applicability against infections (local or hospital) caused by all MRSA types. have.

Some important features for the product of the present invention may be mentioned as follows.

(i) In vitro results lead to the belief that the mechanism of action involved—blocking sites close to the molecular active core—is sufficient to inhibit bacterial growth and replication. Similar to one of the beta-lactam antibiotics, this mechanism is time-dependent and needs to be in the proliferation stage to allow bacteria to expose their target to drug action.

(ii) This feature is supported by the pharmacokinetic properties of the antibody, which provides a long plasma half-life 38. Compared to antibiotic treatment, this means less doses of drug administration, and consequently will not only provide a treatment facility for the patient, but probably also require a lower final cost. This idea was actually confirmed in a comparative analysis of defenses with vancomycin.

(iii) Inhibition of bacterial proliferation in vitro means that the antibody does not require traditional adjuvant antigen-antibody response mechanisms such as opsonization and complement activation. Considering that most hospital infections occur in patients with immunocompromised conditions, this product property is of great significance.

(iv) Staphylococcus aureus ) provides protein A on its surface. This characteristic molecule binds itself to the Fc region of the immunoglobulin antibody and interferes with the opsonization action of the immune system 38. Due to the results obtained in the test, the administered antibody concentration can saturate Protein A present on the bacterial surface, which prevents blocking of the PBP2a block by the administered antibody.

Systemic infection caused by MRSA has been treated with the use of glycopeptides, in particular vancomycin. However, these drugs have a wide range of side effects such as immunotoxicity (42), dystoxicity, kidney renal toxicity, transient neutropenia (43), require long-term drug administration and further increase the cost of treatment. Will result.

By using the mouse infection model, it was possible to compare the treatments performed with the vancomycin versus monoclonal antibody and a mixture of the two drugs. The results obtained indicate that the antibody dose had a similar or higher action than the 5 vancomycin dose, and that simultaneous dosing of the two drugs was more effective at killing bacteria than separate doses. These data are significant because the administration of vancomycin and antibodies allows for more effective recovery of patients in severe conditions and can be treated at lower therapeutic costs as antibodies.

In addition to the use of anti-PBP2a monoclonal antibodies to treat infection by MRSA, the present invention still contemplates the following applications.

(i) Enterococcus sp. by anti-PBP2a monoclonal antibody. Recognition of proteins with molecular weights close to one of the PBP5s in the strains suggests that a protective response against these pathogens can be obtained by antibody administration. PBP5 provides homology with PBP2a, both of which are classified as Class B multimodal PBPs with low affinity for beta-lactam 40. Enterococci are bacteria that cause serious hospital infections, which show a high degree of innate and acquired resistance to antimicrobials. Strains resistant to vancomycin (VRE) represent pathogens of genes resistant to glycopeptides and can be transferred to other pathogens 41.

(ii) Such antibodies can be applied for PBP2a identification by immunodiagnostic tests. For example, the use of an immunoassay based on the aggregation of latex particles bound to an antibody yields results that can predict resistance to all beta-lactam antibiotics in less time. In conventional antimicrobial sensitivity tests (such as antibiotic sensitivity tests), these results were obtained only after 12 to 24 hours.

(iii) the monoclonal antibody is a chronic ulcer (see Streit et. al . , And WO 1999041285 A1) had been successfully used as the main prescription for such antibodies, these antibodies would have been administered to promote nasal decay by MRSA and furthermore for the treatment of skin lesions caused by these pathogens.

Based on the knowledge and issues found in the prior art, the inventors have immunized animals with a DNA vaccine having a structure corresponding to the gene mec A (SEQ ID NO .: 2) without a membrane fixation site. In addition, immunization was carried out to the 76-amino acid internal site of the transpeptidase region (SED ID NO .: 3) containing the enzyme active core.

Immunization is given by Ohwada et al . And Senna et al . It was performed under the same conditions presented in the study. Ohwada et al . And Senna et al . Developed a DNA vaccine against PBP2a using the entire sequence of gene mec A (except for the membrane fixation site) and the internal fragment of the transpeptidase region. Immunization was performed at four doses, and the immunized and non-immunized control groups were challenged by exposure to systematic infection with MRSA and the number of bacteria present in the animal kidneys was measured in two different time periods. The results showed that immunization with transpeptidase fragments resulted in a much greater reduction in the number of bacteria present in the kidney than animals immunized with the gene mec A.

Thus, it can be seen that antibodies generated against transpeptidase provided better protection under the conditions used (DNA vaccine in mouse models) than antibodies against PBP2a. The transpeptidase fragment comprises the enzyme active core STQK (SEQ ID NO .: 4).

As a result, based on the findings, the inventors have identified monoclonal antibodies that can recognize and bind PBP2a protein and other proteins that provide sequences homologous to the PBP2a protein using a transpeptidase fragment comprising an enzyme active core. Invented to produce.

The present invention will be described in more detail with reference to the examples, which should not be construed in a limiting sense.

Material and Method:

1. Germs:

The following methicillin-resistant Staphylococcus aureus strain was used. That is, Iberian-MRSA, COL-MRSA (ceded by Unite des Agents Antimicrobiens - Institut Pasteur [Unit of Antimicrobial Agents-Pasteur Institute], Dr. Patrice Courvalin), WB79 CA-MRSA, and CEB-MRSA (ceded by Dr. Agnes Figueiredo, Instituto de Microbiologia [Microbiology Institute] of UFRJ); Vancomycin-Resistant Enterococcus faecalis strains; And methicillin-sensitive Staphylococcus aureus (MSSA) strain. Escherichia coli strains BL21 DE3 (Novagen) and TOP10 (Invitrogen) were also used.

2. Animals:

Four to eight week old female Balb / C mice taken from CECAL-FIOCRUZ and raised in LAEAN-BioManguinhos were used for immunization and in vivo defense assay measurements.

3. Immunization:

Mice (4 animals) received a 100 microgram dose of the pCI-Neo plasmid: MRSA mec A gene (18) fragments, which were then emulsified with complete Freund adjuvant after 14 days. A dose of 10 micrograms of purified recombination protein was administered to correspond to the internal site of MRSA PBP2a (21), followed by another dose emulsified with incomplete Freund adjuvant 14 days later. After 14 days, animals with the best immune response (as assessed by enzyme immunoassay-ELISA) were administered intravenously with 10 micrograms of purified protein diluted in phosphate buffered saline (PBS). After IV injection in 3 days day, the animal is CO ₂ - were euthanized by asphyxiation in (CEUA L0009 -07 FIOCRUZ protocol), the spleen was excised aseptically to the cell fusion. Serum from the animal with the best immune response was used as a positive regulator for other immunological tests.

4. Monoclonal  Generation of Antibodies:

Lymphocytes extracted from the spleen were placed in fusion with SP2 / 0-Ag14 myeloma cells (ATCC 1581), using polyethylene glycol for fusion, and Current According to the protocol for producing monoclonal antibodies in Protocols in Immunology (22), it was incubated in HAT medium (hypoxanthine-aminopterin-thymidine medium) at 37 ° C under an atmosphere of 10% CO ₂ . The resulting hybridomas were assessed by ELISA test after 14 days using recombination protein purified with antigen. The best hybridomas were cloned with the best clone selection by ELISA, which was stored in liquid nitrogen.

5. Enzyme Immunoassay- ELISA :

Maxisorb 98-well plastic plates were sensitized to 500 nanograms / well of recombination protein (PBP2a fragment) in carbonate / bicarbonate buffer and incubated at 4 ° C. overnight.

The next day, the plates were washed three times with PBS containing 0.05% Tween 20 and blocked in PBS and 5% skim milk for two hours at 37 ° C. Samples incubated at 37 ° C. for 2 hours were used as samples to be analyzed (serum or cell culture supernatant of immune animals diluted 1: 100). Plates were again washed three times with PBS and Tween 20 (0.05%), anti-Ig conjugate (anti-mouse HRP Ig SIGMA A 0412) was added at a 1: 5000 dilution and incubated at 37 ° C. for 90 minutes. After this period, the plates were washed three times with PBS and Tween 20 (0.05%) with the addition of TMB peroxidase color developer (BioRad) and incubated with protection from light for 15 minutes. The reaction was stopped by the addition of 0.5 NH ₂ S0 ₄ , and reading was performed at 450 nm. 1: 200 dilution hyperimmune polyclonal serum was used as a positive regulator.

5.1. Binding Activity Assay Based on Enzyme Immunoassay

5.1.1. Binding activity analysis using urea Niederhouser et al .  5.1):

The protocol is similar to the immunoassay (5) with the following changes.

That is, after sample incubation for 2 hours at 37 ° C. (100 ng of clone 10 purified monoclonal antibody and 2.0 ng of clone 38 purified monoclonal antibody), the sample was taken three times with 8M urea in PBS and Tween 20 (0.05%). It was washed and then washed four times in PBS and Tween 20 (0.05%), which generally provided the same treated sample (not treated with urea) as a regulator.

After reading the same absorbance, the binding activity rate was calculated as the ratio at which the reading with urea was divided by the reading without urea, and multiplied by 100 (percentile result).

5.1.2. Binding activity assay using ammonium thiocyanate Goldblat et al .  5.2)

The protocol is similar to the immunoassay (5) with the following changes.

That is, after sample incubation at 37 ° C. for 2 hours (100 ng of clone 10 purified monoclonal antibody and 2.0 ng of clone 38 purified monoclonal antibody), the sample was prepared at the following concentration: 3 M; 1.5 M; 1.0 M; 0.75 M; 0.50 M; 0.25 M; And ammonium thiocyanate at 37 ° C. for 30 minutes at 0.125 M. Samples untreated with ammonium thiocyanate were used as regulators for each clone.

After reading the same absorbance, the binding activity rate is given by the formula: AR (avidity rate) = [(log 50-log A ) x ( B-A ) / log B -log A ] + A ; where log 50 = 1.70. Where A is the lowest ammonium thiocyanate concentration, which indicates less than 50% absorbance decrease, and B is the highest ammonium thiocyanate concentration, which indicates more than 50% absorbance decrease.

6. Monoclonal  Antibody Production and Purification:

Previously selected clones 10 and 38 samples were incubated in serum-free medium (GIBCO VP-SFM) with 1% BSA added in a 100-mL vial in a stove with 10% CO ₂ atmosphere. The supernatant was centrifuged and then filtered through a 0.22-micrometer filter and purified on high performance chromatography (HPLC) with SelectSure protein A MAB resin (GE). Antibodies were neutralized at pH 7.0 with 1 M Tris, pH 10.0 dialyzed against PBS 0.5 × in deionized water. Samples were lyophilized, resuspended in deionized water, quantified by the Lowry method and evaluated by electrophoresis in polyacrylamide gel.

7. Target Recognition:

7.1. In vitro PBP2a  Recognition-immunoassay method:

MRSA (CEB) strain, methicillin-sensitive Staphylococcus aureus (MSSA) strain, vancomycin-resistant Enterococcus faecium strain and BL-21 DE3 Escherichia coli Strains were grown in exponential growth phase. 1 mL of each sample was centrifuged and dissolved in glass beads of a mini-Bead Beater device (Biospect Products) three times for 30 seconds. Subsamples of each sample were electrophoresed in a 12% modified polyacrylamide gel (SDS-PAGE), after which the protein was transferred to a nylon membrane (Hybond N-BioRad). The membrane was blocked under gentle agitation for 2 hours in PBS buffer containing 10% skim milk and 1% BSA (bovine serum albumin). The membrane was washed three times with PBS and Tween 20 (0.05%) and three times with PBS. It was then incubated for two hours with the supernatant of anti-PBP2a monoclonal antibody diluted in PBS in a 1: 1 ratio. After incubation, the membranes were washed as previously described and alkaline phosphatase conjugated at a ratio of 1: 15,000 (mouse anti-IgG antibody-Sigma A3688) and incubated for 90 minutes. After this period, it was washed again with PBS and development was carried out with Western Blue substrate for alkaline phosphatase (Promega).

7.2. On the bacterial surface PBP2a  Recognition-Flow Cytometry:

MRSA (CEB) strains were grown in stationary (ON) or exponential growth phases. Samples were washed with PBS 1 × and resuspended at DO ₆₀₀ (˜10 ⁸ bacteria / mL) of 0.6. Centrifuge in 1 mL (10 ⁸ bacteria) and resuspend in 1:10 dilution (mouse / human) of 0.5% BSA and normal serum. The samples were then incubated at 4 ° C. for 30 minutes, after which the concentrates (pellets) were washed twice with PBS and 100 microns of PBS containing 1: 10,000 dilutions of anti-PBP2a monoclonal antibody and 0.5% BSA. Resuspended in liters and incubated for 30 minutes at 4 ° C. After this step, the samples were washed again as before and resuspended in 100 microliters of PBS containing 0.5% BSA and dilution of PE (phycoerythrin) mouse anti-Ig conjugates. After incubation at 4 ℃ for 30 minutes in a dark atmosphere. The sample was then washed again and fixed for 15 minutes at 4 ° C. with PBS containing 2% paraformaldehyde. After this preparation, the samples were analyzed by flow cytometry (Becton and Dickinson-FACScalibur).

8. In vitro  Defense Assay-Determination of Minimum Inhibitory Concentration:

MRSA strains (CEB, Iberian, COL, and CA) were grown up to 600 nm during exponential growth with absorbances reaching 0.5. The inoculum was adjusted to contain approximately 100,000 bacteria.

Proliferated amounts of Mueller Hinton broth (MHB), bacterial inoculum and purified anti-PBP2a monoclonal antibody were added to test tubes or 24-cavity plates. The plate or tube was placed in culture at 37 ° C. for 12 hours. After this period, it was observed in the samples whether or not turbidity was present. Minimum inhibitory concentrations were considered to be less antibody amounts that could inhibit bacterial inoculum propagation (100,000 bacteria).

9. In vivo  Defense Analysis:

9.1. MRSA  Lethal dose for the strain and LD ₅₀ Decision.

Lethal dose and LD ₅₀ determination was performed according to the Reed-Muench method (23) for MRSA strains (CEB, Iberian, WB79 CA, and COL). A group of 8-week female Balb / C mice received the proliferating bacteria via the intraperitoneal route and was observed for 7 days. After this period, surviving animals were euthanized according to pre-established animal welfare regulations.

9.2. Systematic infection and bacterial kidney quantitation.

MRSA strains (CEB, Iberian, and WB79 CA) was grown in exponential growth phase (DO ₆₀₀ ~ 0.6), was washed, and was resuspended in sterile 1x PBS at approximately 2 x 10 ⁸ DO ₆₀₀ ~ 0.5 corresponding to the bacteria. This concentration was calculated by dilution and seeding on a BHI agar plate containing 10 micrograms of oxacillin / mL. Female 8-week Balb / C mice received intraperitoneal administration of 400 micrograms of purified anti-PBP2a monoclonal antibody on the first day. On day 6, animals were euthanized and kidneys were aseptically extracted. The kidneys were then homogenized in 1 mL of sterile Luria medium and successfully diluted 10 consecutively.

100 microliters of each dilution were seeded into BHI umbilical plates containing 10 micrograms / mL oxacillin and incubated at 37 ° C. for 24 hours. At this time the count of the resulting colonies and the calculation of the total dilutions were performed.

9.3. Survival analysis.

MRSA strains were grown under the same conditions as previously described, but inoculum adjustment was performed with the previously established LD ₅₀ . Female 8-week Balb / C mice received 500 micrograms of purified anti-PBP2a monoclonal antibody intraperitoneally on the first day. The next day, the animal and control group were infected at a dose of about 2.5 to 6.0 × 10 ⁸ bacteria via the intraperitoneal route according to the LD ₅₀ of each strain. Animals were observed for 10 days and surviving animals were euthanized.

10. Anti- PBP2a Monoclonal  Contrast of Antibodies and Vancomycin In vivo  Defense Study-Kidney Quantification:

Analysis I

Four groups of female 8-week Balb / C mice (four animals per group) received doses of 6.0 x 10 ⁷ bacteria (CEB-MRSA) via the intraperitoneal route. Animals received purified monoclonal antibody (MAB), vancomycin, MAB + vancomycin and negative modulators in the following groups.

Group 1: MAB (400 micrograms) (first day)

Group 2: vancomycin (150 micrograms, intramuscular route, 12/12 hours)

Group 3: vancomycin + MAB (350 micrograms) (first day post-infection)

Group 4: adjuster

The first dose of antibody and vancomycin was administered 4 hours after administration of the infectious pathogen. Animals were euthanized after the fourth day, kidneys were aseptically extracted and subjected to kidney quantitation according to the method described above.

analysis II

This assay was performed in the same way as the previous assay, but received a lower infection amount (7.0 x 10 ⁶ bacteria), group 1 was treated with 500 micrograms of purified monoclonal antibody, and group 2 was vancomycin (150 micrograms). , Intramuscular route, 12/12 hours; 5 doses), group 3 was treated with 500 micrograms of vancomycin plus monoclonal antibody, and group 4 was the modulator (non-treated animals).

11. PBP2a Monoclonal  Antibody Light chain  And Heavy chain  Complementary Decision Site ( CDRs Identification

11.1. Hybridoma  From the cell mRNA  extraction

Cell culture 10-mL centrifuges (pellets) of monoclonal antibody-producing hybridomas were processed for mRNA extraction using the RNeasy Minikit kit (Qiagen).

11.2. cDNA  Obtain

Reverse Transcriptase Reaction: M-MLV reverse transcriptase kit (Invitrogen) was used to obtain complementary DNA and the following preparation guidelines were followed.

11.3. Polymerase chain reaction PCR )on By VH  And VL  Amplification of chains

The reaction was carried out using the following initiator sequence ( primer ).

11.4. term- PBP2a Monoclonal  Antibody Light chain  And Heavy chain  order

Seasoning  step:

I. Amplification

This was done using the previous initiator sequence, which is defined as SEW ID NO .: 18 to SEQ ID NO .: 39.

II . Sequencing

ABI Prism 3100 and Genetic Analyser (Hitachi) were used.

11.5. Light chain  And Heavy chain CDR Identification and Sequence Analysis

The obtained DNA sequences were analyzed with the help of the DNA Star program and translated into amino acid sequences (ExPASy site-translation program) for later analysis by Kabat (24) and Chotia (25) algorithms for the identification of light and heavy chain CDRs. .

12. Monoclonal  Determination of Association and Dissociation Constants for Antibodies (Surfaces) Plasmon  resonance( 표면 plasmon resonance  [ SPR ] [ Biacore Clones by method 10 and 38)

SPR measurements were performed using a CM-5 sensor on a Biacore X ^® (Biacore AB, Uppsala, Sweden) device. Binding reagents and HBS-EP buffer (10 mM hepes, 150 mM NaCl, 3 mM EDTA, 0.005% P20 [Tween 0, pH 7.4]) were obtained from Company GE Healthcare.

Example  2

1. Mouse anti- PBP2a Monoclonal  Acquisition of Antibodies:

Animal groups were tested according to the immunization protocol according to the previously described method. The results evaluated by the ELISA test are shown in FIG. 1.

After the fusion process (fusion of 90-LATAM), supernatants from 96 cavities (hybridoma) were analyzed by ELISA test. From this total, the five best samples were selected and the cells proliferated (replicated). Then, the resulting supernatant was again analyzed by ELISA. Positive samples were validated by immunoassay on purified recombination protein (PBP2a) to validate the results obtained by ELISA.

The final result is in Table I.

)을 나타낸다. 1 shows the results obtained from an immunoenzyme test (ELISA) on serum of immunized animals to produce anti-PBP2a antibodies. Each dashing corresponds to 1: 100 diluted serum of the immunized animal. Positive regulator serum was angular dashed (

).

First bar of each dish: pre-immune serum

Second bar: serum after fourth immunization

Third bar: serum after fifth immunization

Table I. Replication of Fusion 90: Final Balance

From selected clones, clones 77-38 were subjected to recloning to confirm cell stability to hide monoclonal antibodies. Everything from the 50 analyzed cavities gave positive results by ELISA test. These clones were propagated and stored in liquid nitrogen in the LATAM (Monoclonal Antibody Technology Research Institute) facility.

2. Monoclonal  Proliferation, Production and Purification of Antibodies:

The process was standardized according to the method previously described. The result obtained was about 4 mg monoclonal antibody for every 100 mL of supernatant, which was purified. The obtained results can be found below.

In Figure 2, a polyacrylamide gel can be seen with the raw sample and the sample after purification. This FIG. 2 shows a non-modified polyacrylamide gel with supernatant samples before purification (pillar 1) and after purification (pillar 2) in an HPLC column with MAB SelectSure resin. Pillars 3 to 9 correspond to the purified sample portions obtained. Arrows indicate approximate size of 150 kDA.

3. Monoclonal  Functional Properties of Antibodies:

3.1. In vitro PBP2a  Recognition-immunoassay

In order to investigate the ability of antibodies to targets in pathogens (PBP2a and similar sequences), immunoassay tests were conducted using bacterial donor PBP2a (CEB and COL MRSA), MSSA (methicillin-sensitive Staphylococcus). aureus ) strain (does not provide PBP2a), vancomycin-resistant Enterococcus sp. strain (provides PBP5), low-affinity transpeptidase for beta-lactam antibiotics (equivalent to PBP2a), and Escherichia as a negative regulator coli strains, where the recombination protein is produced. The results obtained showed that the antibodies were MRSA and Enterococcus sp. Within the strain, it can be seen that proteins with molecular weights of about 76 kDa corresponding to the sizes of PBP2a and PBP5, respectively. Escherichia Methicillin -sensitive Staphylococcus with coli strains No response of monoclonal antibodies could be confirmed for proteins of aureus ) (PBP2a-negative).

The results can be seen in Figure 3 (immunoassay method for MRSA and MSSA).

The results of immunoassay tests of MRSA and MSSA lysates on supernatants containing anti-PBP2a monoclonal antibodies are shown in FIG. 3.

1. molecular weight marker (Kaleidoscope);

2. MSSA samples grown in exponential phase;

3 and 4. MRSA samples grown in exponential growth phase;

5. MSSA samples grown overnight at stationary phase; And

6 and 7. MRSA samples grown in stationary phase.

Left arrow indicates PBP2a molecular weight.

3.2. On the bacterial surface PBP2a  Recognition-Flow Cytometry

The purpose of the flow cytometry test is to demonstrate the efficiency of target recognition in bacteria by monoclonal antibodies in their native form. In previous tests (immunoassay), it was observed that target recognition in the protein undergoes a denaturation process, which occurs during protein separation by electrophoresis in a modified polyacrylamide gel. In addition, it can be seen that the negative regulator strain (MSSA, PBP2a-negative) and MRSA strain (CEB) is proliferated in the exponential growth and stationary phase. The results obtained show that the antibody can recognize targets on the bacterial surface under both conditions. The presence of protein A on the Staphylococcus surface could not inhibit the binding of the antibody to PBP2a. The obtained result can be confirmed in FIG.

4 shows the results of flow cytometry for MRSA (CEB) and MSSA bacteria incubated with anti-PBP2a monoclonal antibody and labeled with phycoerythrin (PE). (1) shows MSSA bacteria, (2) shows MRSA grown at stationary phase, and (3) shows MRSA grown at exponential stage. MRSA populations are shifted to the right, indicating an increase in the cells indicated by the fluorescent conjugates.

4. Anti- PBP2a Monoclonal  Evaluation of the defenses conferred by the antibody

4.1. In vitro  Defense testing

Minimum inhibitory concentration ( MIC ) Determination

This assay aims to assess the ability of the antibody to bind itself directly to the target in a closed system. For monoclonal antibodies for the final treatment, positive results have significant significance. This means that antibodies can recognize targets and block bacterial growth without the help of the host immune system, such as complement activation and opsonization mechanisms that can result from the binding action associated with the host's innate and adaptive immune system. .

CEB, COL, and Iberian MRSA strains were evaluated, where similar MIC values (approximately 500 micrograms) were identified under the conditions evaluated. These data indicate that the antibody dosages required to block proliferation are not the same, regardless of the genetic background of the different MRSA strains.

These results can be seen in FIG.

5 shows in vitro defense (MIC-minimal inhibitory concentration) tests conferred by anti-PBP2a purified monoclonal antibody and vancomycin against inoculations of 10 ⁵ cells from different MRSA strains.

The absence of turbidity indicates no bacterial growth under the conditions analyzed.

1A: CEB MRSA (Brazil Infectious Disease Clone) + 250 μg antibody;

2A: CEB MRSA + 500 μg antibody;

3A: CEB MRSA + antibody 750 μg;

4A and 6A: negative regulators of CEB MRSA strains;

1B: 250 μL COL MRSA + antibody;

2B: COL MRSA + 500 μg antibody;

3B: COL MRSA + antibody 750 μg;

4B and 6B: negative regulators of COL MRSA strains;

1C: Iberian MRSA (European Plague Clone-EEC) + 250 μg antibody;

2C: EEC MRSA + 500 μg antibody;

3C: 750 μg EEC MRSA + antibody;

4C and 6C: Negative Modulators of EEC MRSA Strains

1D: 150 μg CEB MRSA + vancomycin;

2D: 300 μg CEB MRSA + vancomycin;

3D: 500 μg CEB MRSA + vancomycin;

4D: 750 μg CEB MRSA + vancomycin;

5D and 6D: Voice Adjuster.

4.2. In vivo  Defense testing

4.2.1. CEB , Iberian , WB79 CA , And COL MRSA  For strains Plaque  And An associate governor Quantity determination

This assay assesses kidney quantification by two used model-quantitative doses and in vivo protection in a survival test after systematic infection with more bacterial inoculations, resulting in death in about 50% of animals (LD ₅₀ ). It is necessary to do The route chosen is the intraperitoneal mode of administration, which is intended to reduce administration facilities and losses. The Reed-Muench method was adapted to perform this analysis, with two animals per condition (increasing concentrations of infected bacteria) and three different doses tested to determine the LD ₅₀ and subcatalyst doses. And already Staphylococcus for aureus He had knowledge of average mortality. The first MRSA clone to sequence the COL MRSA strain and genome is used as a reference strain for research in this pathogen.

However, it showed that the pathogenicity was not strong and that higher infection doses were required with respect to other MRSA clones to cause infection in the animals. Therefore, it was not used in defense analysis.

4.2.2. Quasi dose  Kidney Defense Analysis After Systemic Infection

By using a quantitative model of infection after infection, this assay allows one to assess the ability of antibodies to reduce the presence of bacteria in critical periods (kidneys) after systematic infection. Reductions higher than 3 log (1000 times) were achieved by performing three independent assays with MRSA strains that were highly pathogenic from different genetic backgrounds. In this assay, the animals received a dose of 500 micrograms of antibody. The protection conferred by the lower antibody dose (250 micrograms) was assessed in the analysis done with the CA-MRSA strain. Here, bacterial reduction was also observed, but lower than that obtained with the 500-microgram dose. The results can be seen in Figures 6A, 6B and 6C.

FIG. 6A shows the results of kidney quantitation of animals that have been systematically infected with sub-quantitative doses of the MRSA CEB strain, treated and untreated with anti-PBP2a monoclonal antibody. Horizontal stripes: log of bacterial concentration isolated from kidney of each untreated animal. Checkerboard: A log of the amount of bacteria isolated from the kidneys of each animal treated with the antibody. Bacterial Determination: Regulator: C1: 2000 Bacteria; C2: 29,000 bacteria; C3: 220,000 bacteria ;; C4: 52,000 bacteria (average of 75,750 bacteria). Treated (defended) animals: P1: 20 bacteria; P2, P3, and P4: 10 bacteria (average of 12.5 bacteria). Reduction of bacterial load recovered from treated animals in relation to non-treated animals: 6060 fold.

FIG. 6B shows the results of kidney quantitative analysis of animals that were systematically infected with sub-quantitative doses of the Iberian MRSA strain (European epidemic clone) and treated with anti-PBP2a monoclonal antibody. Horizontal stripes: log of bacterial concentration isolated from kidney of each untreated animal. Large checkered: log of bacterial mass isolated from kidney of each animal treated with antibody. Small checker bars indicate the average value from each. Bacterial Determination: Regulator: C1: 210,000 Bacteria; C2: 44,000 bacteria; C3: 300,000 bacteria ;; C4: 290,000 bacteria (average of 211,000 bacteria). Treated (defended) animals: P1: 80 bacteria; P2: 200 bacteria; P3: 10 bacteria, and P4: 60 bacteria (average of 87.5 bacteria). Reduction of bacterial load recovered from treated animals in relation to non-treated animals : 2420 fold.

FIG. 6C shows the results of kidney quantitation of animals that were systematically infected with subtotal dose of the WB79 CA-MRSA strain (Brazil regional strain), treated with and not treated with anti-PBP2a monoclonal antibody. Five initial bars (xx stripes, horizontal stripes and large checkerboard): Log of bacterial concentrations isolated from the kidneys of each untreated animal. First Bar (xx Patterns): Estimates related to animals that died before euthanasia. Bars 6, 7, 8, and 9 (horizontal stripes and checkered): Log of bacterial mass isolated from kidneys of animals treated with 250 μg anti-PBP2a monoclonal antibody. Bars 10, 11, 12 and 13 (triangle pattern): log of bacterial mass isolated from kidney of each animal treated with 500 μg antibody. Checkered bars (5 ^th , 9 ^th , and 13 ^th bars) indicate that the mean value was obtained from each. Bacterial Determination: Regulator: C1: 650,000 bacteria; C2: 26,000 bacteria; C3: 17,000 bacteria ;; C4: 500,000 bacteria (dead animal estimates) (average of 231,000 bacteria). Animals treated with 250 μg antibody: P1: 0; P2: 5,400 bacteria; P3: 830 bacteria, and P4: 10 bacteria (average of 1560 bacteria). Animals treated with 500 μg antibody: P1: 80; P2: 0; P3: 210; P4: 80 bacteria (average of 92.5). Reduction of bacterial load recovered from animals treated with non-treated animals with 250 μg antibody : 149 fold. At 500 μg: 2,497 fold .

4.2.3. Survival analysis

With this assay, 50% or more of the animal (LD ₅₀ ) can be infected with a killing amount of bacteria, and then the defenses conferred by the antibody against the animal can be assessed. Defense against three strains used in kidney quantitation was evaluated. (I) Survival time and (ii) increase in survival of animals being treated with anti-MRSA monoclonal antibody were observed in three independent assays. In assays involving CEB MRSA strains, 70% of the treated animals survived infection and only 10% of the modulator group (non-treatment) survived. With respect to the Iberian MRSA strain, the results obtained are similar: 60% of the treated animals survived in defense and 100% of the modulator group died. In assays involving CA MRSA strains, 100% protection was observed compared to 70% in control animals. These results can be seen in Figures 7a, 7b and 7c.

7A shows survival curves of treated (protected) and untreated (controller) animals following infection with a dose of 2.3 × 10 ⁸ bacteria (CEB MRSA) administered via the intraperitoneal route (LD ₅₀ ). To show.

7B shows survival rates of treated (protected) and untreated (controller) animals following infection with a dose of 4.2 × 10 ⁸ bacteria (Iberian MRSA) administered via the intraperitoneal route (~ LD ₅₀ ). The curve is shown.

7A shows treated (unprotected) and untreated (controller) animals following infection with a dose of 1.1 × 10 ⁹ bacteria (WB79 CA-MRSA) administered via the intraperitoneal route (~ LD ₅₀ ). The survival rate curve of FIG.

4.2.4. Monoclonal  Comparative Study of Defense Conferred by Antibody vs. Vancomycin

Since vancomycin is the first antimicrobial agent selected for the treatment of severe infections by MRSA, comparative studies on defense have been conducted in different models than the previous model. In this study, the animals were infected and administration of the antimicrobial or monoclonal antibody was initiated just 4 hours after infection. The study was conducted in three separate groups, one treated with vancomycin, the other treated with monoclonal antibody, and the third treated with concurrent antimicrobial plus antibody. Vancomycin doses were adjusted and administered in a similar manner as for human infections (500 mg every 12 hours). The results obtained indicate that there was an approximately 15-fold reduction in the amount of bacteria present in the kidneys of animals treated with antimicrobial agents or antibodies three days after infection. However, a 4,617 fold reduction was seen in the groups treated with antimicrobials and antibodies. Based on these results, it can be concluded that the defenses conferred by the antibody dose corresponded to the 5 vancomycin doses and that simultaneous administration of vancomycin and the antibody was the most effective in reducing the number of bacteria observed in the kidneys of infected animals. there was. This study was repeated with several smaller doses in order to better observe the protective action of anti-MRSA monoclonal antibodies isolated from or associated with vancomycin (see FIG. 8). After performing the second analysis with a lower infection dose, the results obtained confirmed the original results. The protection conferred by treatment with monoclonal antibodies resulted in a 89-fold reduction, which was higher than the protection obtained by treatment with a 5 vancomycin dose (35-fold reduction). However, the most significant reduction was observed in the group treated with antibody + vancomycin, which resulted in a 450-fold reduction.

8A depicts bacterial quantitation in kidneys of animals treated with anti-PBP2a monoclonal antibody, vancomycin and antibody + vancomycin associations and non-treated animals following infection of 6.0 × 10 ⁷ bacteria (CEB MRSA). Treatment was performed 4 hours after infection. Vancomycin was administered every 12 hours (5 doses). Bars 1, 2, 3, 4, and 5 (stripes): log of bacterial concentrations recovered from non-treated animals (controller). C1: 7,000,000; C2: 295,000; C3: 380,000; C4: 3,200,000 (mean: 2,718,750 bacteria). Bars 6, 7, 8, 9, and 10 (checkered): log of bacterial concentrations recovered from animals treated with 400 μg of anti-PBP2a monoclonal antibody. P1: 4,200; P2: 310,000; P3: 330,000; P4: 90,000 (average of 183,550 bacteria). Rods 11, 12, 13, 14, and 15 (spheres): animals treated with vancomycin. P1: 110,000; P2: 58,000; P3: 500,000; P4: 21,000 (average of 172,250 bacteria). Bars 16, 17, 18, 19, and 290 (triangular shaped): log of bacterial concentrations recovered from animals treated with antibody (300 μg) + vancomycin. P1: 1,100; P2: 700; P3: 450; P4: 90 (average of 585 bacteria).

8B shows non-PBP2a monoclonal antibodies (rods 7-12), vancomycin (rods 13-18), and antibody plus vancomycin associations (19-24) after infection with 7.0 x 10 ⁶ bacteria (CEB MRSA). Bacterial quantitative analysis in the kidneys of treated animals (endomembrane 1 to 6) is shown. Treatment was performed 4 hours after infection. Vancomycin was administered every 12 hours (5 doses). Bars 1 to 6: log of bacterial concentration recovered from non-treated animals (controller). C1: 6,000; C2: 1,000; C3: 500; C4: 118,000; And C5: 1,000 (mean: 25,220 bacteria). Bars 7 to 12: Log of bacterial concentrations recovered from animals treated with 500 μg anti-PBP2a monoclonal antibody. MB1: 450; MB2: 200; MB3: 100; MB4: 20; MB5: 0 (average of 284 bacteria). Bars 13 to 18: Animals treated with vancomycin. VC1: 100; VC2: 700; VC3: 0; VC4: 0; VC5: 2800 (average of 720 bacteria). Bars 19 to 24: Log of bacterial concentrations recovered from animals treated with antibody 500 μg + vancomycin. MBV1: 130; MBV2: 20; MBV3: 10; MBV4: 80; MBV5: 20 (average of 56 bacteria).

5. Binding Activity Assay

Binding activity test results of monoclonal antibody clones 10 and 38:

Element protocol binding active:

Clone 10: 1.03 / 1.46 (DOs with / without treatment) = 70.5%

Clone 38: 1.00 / 1.21 = 82.6%

Ammonium Thiocyanate Protocol Binding Activity:

Clone 10 (DOs):

Adjuster: 1.12

Thiocyanate-treated samples:

2 M = 0.046; 1.5 M = 0,047; 1 M = 0.107; 0.75 M = 0.483; 0.5 M = 0.602; 0.375 M = 0.684

Binding activity rate: 2.47

Clone 38 (DOs):

Adjuster: 1.22

Thiocyanate-treated samples:

2 M = 0.056; 1.5 M = 0.062; 1 M = 0.129; 0.75 M = 0.648; 0.5 M = 0.758; 0.375 M = 0.793

Binding activity rate: 4.40

In both assays it can be seen that the binding activity of clone 38 is higher than that of clone 10. In addition, according to both protocols, it was necessary to use 50 times more antibodies from clone 10 than clone 38 in order for DO to reach close to 1.0.

6. Monoclonal  Determination of Association and Dissociation Constants of Antibodies (Surface) Plasmon  Resonance Method [ SPR Clones 10 and 38 by BIAcore)

The results obtained with the SPR method confirm the preliminary results of the antibody binding activity, clone 38 again higher than clone 10. The data shown in Table II shows that clone 38 has 450 times higher affinity than clone 10. This affinity is mainly due to its high association rate, which is approximately 100 times higher than clone 10. Due to the very high affinity of clone 38, the measurement provides a limit close to the equipment detection threshold. However, by paying attention to implementation planning and implementation, the Langmuir model can be used to provide excellent control over trial data, and the resulting data is reliable.

9 shows the interaction between recombination PBP2a (antigen) and monoclonal antibody clone 38 (FIG. 9A) and clone 10 (FIG. 9B). Hazy stripes cover represent SPR data at concentration according to right key. All samples were replicated and analyzed, with a 1: 1 Langmuir theoretical model for each cover in black under each cover. The reaction unit is represented by the vertical axis and the time is shown on the horizontal line in seconds. The nearest line representing the horizontal axis represents the baseline for each sample (voice adjuster).

Table II

Dissociation and Interaction Constants Between Antigen (PBP2a) and Monoclonal Antibody Clones 10 and 38

7. Anti- PBP2a Monoclonal  Antibody Light chain  And In heavy chain  About Complementary Decision Sites (CDRs)  discrimination

After the mRNA extraction process in hybridoma cells of the clone producing the antibody used (clone 38), cDNA acquisition was performed and PCR reactions were carried out with these materials for different light and heavy chain alleles. The material obtained was sequenced using the same initiator sequence (defined as SEQ ID NO .: 18 to SEQ ID NO .: 39) used in the PCR reaction. Light chain 391 and heavy chain 310 were identified in three different sequencing. Kabat and Chotia algorithms can be applied to identify light and heavy chain CDRs, which are the subject of the appended claims.

The following light and heavy chain CDRs sequences are provided.

SEQ ID NO .: 6- CDR 1 light chain amino acid.

RSSQSIGHSNGNTYLE

SEQ ID NO .: 7-CDR 2 light chain amino acid.

KVSNRFS

SEQ ID NO .: 8-CDR 3 light chain amino acid.

FQGSYVPLT

SEQ ID NO .: 9-CDR 1 light chain DNA.

cgcagcagccagagcattggccatagcaacggcaacacctatctggaa

SEQ ID NO .: 10-CDR 2 light chain DNA.

aaagtgagcaaccgctttagc

SEQ ID NO .: 11-CDR 3 light chain DNA.

tttcagggcagctatgtgccgctgacc

SEQ ID NO .: 12-CDR 1 heavy chain amino acid.

GFSITSSSSCWH

SEQ ID NO .: 13-CDR 2 heavy chain amino acid.

RICYEGSISYSPSLKS

SEQ ID NO .: 14-CDR 3 heavy chain amino acids.

ENHDWFFDV

SEQ ID NO .: 15- CDR 1 heavy chain DNA.

ggctttagcattaccagcagcagcagctgctggcat

SEQ ID NO .: 16-CDR 2 heavy chain DNA.

cgcatttgctatgaaggcagcattagctatagcccgagcctgaaaagc

SEQ ID NO .: 17-CDR 3 heavy chain DNA.

gaaaaccatgattggttttttgatgtg

Complementary data

In addition, other analyzes have been conducted to drive the development of the present invention. This is illustrated through the following examples.

Example  3

A second study with the CEB MRSA strain was performed and followed the same protocol as described in Example 1, item 7.2. However, we added two pulses, swirling for 15 seconds after each wash, which was Staphylococcus The purpose is to break down the aureus mass and increase the amount of PBP2a exposed to the antibody.

Indicators FITC (Fluorescent Isothiocyanate) and PE (Picoerythrin) were tested with modulator samples (i. No contact with pure bacteria, monoclonal antibodies; and ii. Pure bacteria + FITC or PE indicator) Samples treated with monoclonal antibodies and labeled PE or FITC were analyzed. Reading in the FACsalibur device was performed in linear mode.

10 is a graph analyzed by flow cytometry for MRSA samples in the presence of FITC-labeled anti-PBP2a antibody. Cover x corresponds to a non-display sample and cover y corresponds to a display sample. The results obtained indicate that about 22% of the marker population was detected by the device, confirming that the target (PBP2a) present on the bacterial surface was recognized by the anti-PBP2a antibody (FIG. 10).

Example  4

Inventors enterococcus and methicillin-resistant Staphylococcus The protection conferred by the anti-PBP2a monoclonal antibody against aureus has still been investigated. According to the foregoing, the antibody is known as Enterococcus sp. Proteins present in the strain, perhaps transpeptidase with low affinity for PBP5-betalactam, have a molecular weight of about 76 kDA (237 amino acids) and recognize proteins present in all enterococcus strains.

These enzymes provide homology showing PBP2a of MRSA according to the related arrangement (ClustalW) below.

The arrangement was performed with sequences corresponding to PBP5 from enterococci E. faecalis (Efas) and E. faecium (Efam) with MRSA PBP2a. The indicated sequence (bold sequence-PBP5; underlined sequence-PBP2a) corresponds to the PBP2a site used to produce the monoclonal antibody. Amino acids corresponding to enzyme active cores are indicated in italics.

Thus, lethal dose and LD ₅₀ determination were performed in in vitro defense assays and in vivo analysis (survival analysis using sublethal dose and lethal dose by quantitative height) was performed with enterococcus strains in mouse models (Balb / C mice). This has been done with MRSA before.

These results can be found in the corresponding reports.

1.1. In vitro  Defense analysis

The purpose of this assay is to assess the in vitro protection conferred by the antibody against the VRE enterococcus strain. In in vitro defense tests (MIC), Enterococcus f. Clone 38 purified monoclonal antibody against clinical strain (VRE) (90 / DA5 / CB5 / AA3 hib 77), Richet laboratory.

Condition:

Samples: Purification from supernatant by HPLC, SelecSure MAB resin, dialysis, lyophilization. Antibody Quantitation (Lowry Method): 3.5 mg / mL

Inoculum : VRE strain

Pre-inoculation: 1 VRE colony in 20 mL Lb and vancomycin (10 mg / mL), ON 37 ^o C, 160 rpm

Inoculum: 400 mL of pre-inoculation in 20 mL Lb, 200-mL erlenmayer, 37 ^o C, 160 rpm

DO _{600 nm} readout after 7 hours: 0.7

Quantification: 5.5 x 10 ⁸ bacteria / mL

test requirements:

Inoculum : 5.5 x 10 ⁵ bacteria

Antibody Concentrations: Antibodies 300, 400, 500, 600, and 700 mg

Culture medium: 1 mL Luria medium

Cell Culture Plates, 24 Cavities

Positive regulator: Luria medium + bacterial inoculum

Voice Adjuster: Luria Badge

Incubation: 18 hours, 37 ^o C

11 shows the results of evaluating the defenses imparted by the antibodies. In Figure 11 has the following.

A. 300 mg antibody

B. Antibody 400 mg

C. Antibody 500 mg

D. 600 mg antibody

E. Voice Adjuster

F. Positive Modulators

G. Antibody 700 mg

1.2. Abdominal cavity  By route LD ₅₀  And lethal dose determination-vancomycin-resistant Enterococcus faecium

protocol:

Female 7-week Balb / C animals, weighing an average of 20 grams

Day 01-Pre-inoculation: 1 VRE strain colonies and vancomycin (10 mg / mL), 50-mL Falkow tube, propagation ON 37 ^o C, 160 rpm in 10 mL Lb medium

Day 02-Inoculum: 1 mL / vancomycin (250-mL erlenmayer) in 50 mL Lb medium-4 vials, 37 ^o C, 160 rpm, OD _{600 nm} = 0.80

Centrifuge for 10 minutes, 4000 rpm, resuspend in PBS 1x sterile, OD 1.2

Quantification: 2.1 x 10 ⁸ bacteria / mL

A. 60 microliters (1.5 x 10 ⁷ )

B. 300 microliters (6.5 x 10 ⁷ )

C. 900 microliters (reduced to 300 microliters / dose) (1.5 x 10 ⁸ )

D. 4.5 mL (reduced to 300 microliters / dose) (6.5 x 10 ⁸ )

E. 9.0 mL (1.2 x 10 ⁹ bacteria) (reduced to 300 microliters / dose)

F. 45.0 mL (6.5 x 10 ⁹ bacteria) (reduced to 300 microliters / dose)

Animal observations were performed from day 02 to day 10 of the test. The results are shown in FIG. 12 and the conclusion is that the lethal dose is 1.2 × 10 ⁹ bacteria and LD ₅₀ is 6.5 × 10 ⁸ bacteria.

Kidney Quantification of Surviving Animals on Day 7:

A (1.5 x 10 ⁷ ): no bacterial growth

B (6.5 x 10 ⁷ ): no bacterial growth

C (1.5 x 10 ⁸ ): 3100 bacteria

D (6.5 x 10 ⁸ ): 2.8 x 10 ⁴ bacteria

1.3. In vivo  Defense test-survival test-lethal dose, in mouse model Abdominal cavity  Systemic Infection Through Pathway

The purpose of this analysis is to enterococcus of lethal doses To evaluate the efficacy of in vivo defense of an anti-PBP2a monoclonal antibody against an animal systematically infected with a faecium (VRE) strain.

1. Antibody (purified from supernatant via cell culture in medium with serum)

Dialysis and lyophilized tablet samples (HPLC SelecSure MAB), resuspended and filtered prior to use.

Quantification (Lowry method): 1.0 mg / mL

2. Mouse Model: Female, 8-week Balb / C Animal, weighing 23-25 grams

3. Protocol:

Group A (6 animals): 650 mg (350 mg + 300 mg) antibody

Group B (6 animals): Adjuster (saline administration)

4. Bacteria Inoculum  Ready:

VRE strains:

Pre-inoculation, date 01, 10 mL of BHI medium and vancomycin 10 mg / mL ON, 37 ^o C, 160 rpm

Inoculum, date 03: 300 mL pre-inoculation in 30 mL BHI and vancomycin, DO ₆₀₀ 1.31, centrifuged for 10 minutes, 4,000 rpm, resuspended in sterile PBS 0.5x, adjusted to OD = 1.10, quantified ( Dilution and plates for 2.0 × 10 ⁸ bacteria / mL); Inoculum: 12 mL, centrifuge, resuspend in 300 mL, IP route (~ 2.2 x 10 ⁹ bacteria)

Time schedule:

Date 01: IP inoculation of antibody (350 mg)

Date 02: IP inoculation of antibody (300 mg), systematic infection in the afternoon (IP, 250 mL bacterial solution-2.2 x 10 ⁹ bacteria)

Date 02-13: Animal observation.

The results are shown in FIG. Only two treated animals died (66.6% of defense). All Adjuster animals died on the second day.

1.4. In vivo  Defense test-vancomycin-resistant Enterococcus faecium Against mouse model Abdominal cavity  Systemic Infection Through Pathway

The objective is to evaluate the efficacy of in vivo defense of anti-PBP2a and PBP5 monoclonal antibodies against systemic infection of E. faecium (VRE) strains.

exam:

1. Antibody (purified from supernatant via cell culture in medium with serum)

Dialysis, lyophilization and resuspension purification samples (AffiPrep ProteinA Biorad / HPLC SelecSure MAB).

Quantification (Lowry method): 1.5 μg / mL

2. Mouse Model: Female, 8-week Balb / C Animal, weighing 19-23 grams

3. protocol :

Group A (4 animals): 500 micrograms of antibody (within 2 months, d01, d02)

Group B (4 animals): non-protected modulator

4. Bacteria Inoculum  Ready:

Iberian MRSA strains:

Pre-inoculation, 10 mL of Lb medium ON, 37 ° C., 120 rpm

Inoculum: 200 microliters of pre-inoculated in 20 mL of Lb, DO ₆₀₀ 0.80, centrifuged for 10 min, 4,000 rpm, resuspended in sterile PBS 0.5x, adjusted to OD = 0.51, quantitative (2.4 x 10 Dilution and plates for ⁸ bacteria / mL); Inoculum: 500 microliters, IP route (2.4 x 10 ⁸ bacteria)

Time schedule:

Day 01: 250 microgram antibody inoculated via the intraperitoneal route

Day 02: 250 microgram antibody inoculation and systematic infection via the intraperitoneal route (intraperitoneal, 500 microliters of bacterial solution)

Day 06: Euthanasia, bacterial determination of kidneys

Based on the above results, the following can be emphasized:

In Vitro Defense Assay -Determination of Minimum Inhibitory Concentration:

A total of 700 micrograms of antibody can block the growth of 550,000 bacteria. This value is higher than the MiC obtained for MRSA which was approximately 500 micrograms.

In vivo  Defense Analysis:

In Vivo Defense Tests -Vancomycin-Resistant Enterococcus Systemic infection via the intraperitoneal route in a mouse model with lethal dose of faecium

The animals received 500 micrograms of monoclonal antibody via the intraperitoneal route (IP) and were placed in a systematic infection situation via the IP route with 2.4 x 10 ⁸ bacteria. After 4 days, the animals were restran and kidneys were extracted for bacterial quantitation. Treated animals represented an average of 87.5 bacteria / animals, whereas regulators (non-treated infected animals) exhibited an average of 211,000 bacteria / animals.

Lethal dose After administration  Survival test

Animals received 650 micrograms of monoclonal antibody (IP pathway), placed in a systemic infection (IP pathway) and observed daily for 10 days. The control (non-treated) animals died until the second day after infection, two of the treated animals (6) died on the second day, and the others survived to the end of the test. Survival was 66.6%.

Thus, once again we showed that MRSA anti-PBPa monoclonal antibodies confer cross protection against enterococci. However, the dosage required to confer defense was higher than that used against MRSA under similar conditions. This is probably due to the lower ability of the antibody to recognize PBP5 with the same efficacy as PBP2a.

Thus, the present invention described herein—anti-PBP2a monoclonal antibodies capable of specifically binding to PBP2a and homologous sequences—consists of such proteins or similar substrates (MRSA, MRSE, and Enterococcus spp., And proteins homologous to PBP2a). Eggplant has applicability to infections caused by bacteria that provide all other pathogens).

This infection is a global problem, and such an analysis has been performed on known infectious MRSA clones, and it is once again emphasized that the product of the present invention can be widely applied everywhere with infection by this pathogen.

As mentioned in the detailed description of the invention, documents relating to the inventor's prior art citations are listed as follows.

1 . Kopp, BJ. Nix DE, Armstrong EP. Clinical and economic analysis of methicillin-resistant Staphylococcus aureus infections). The Annals of Pharmacotherapy; 38: 1377-82. 2004.

2 . Boyce, JM. Are the epidemiology and microbiology of methicillin-resistant Staphylococcus aureus changing? Are the epidemiology and microbiology of methicillin-resistant Staphylococcus aureus changing? JAMA; 279 (8): 623-4. 1998.

3 . Hunt, C; Dionne M, et . al . Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus in Minnesota and North Dakota aureus in Minnesota and North Dakota), 1997-1999. Morbidity and Mortality weekly report-CDC USA. 48 (32): 707-10. 1999.

4 . O'BRIEN, FG; Pearman, JW; Gracey, M; Riley, TV. Grubb, WB. Community strain of methicillin-resistant Staphylococcus associated with hospital invention aureus involved in a hospital outbreak). Journal of Clin Microbiol. 37 (9): 2858-62. 1999.

5 . Tenover, FC; Lancaster, MV; Hill, BC; Stedward, CD; Stocker, SA; Hancock, GA; et . al . Characterization of staphylococci with reduced susceptibilities to vancomycin and other glycopeptides. Journal of Clin Microbiol. 36 (4): 1020-27. 1998.

6 . Lutz, L; Matos, SB; Kuplich, N; Machado A; Barth AL. Characteristicas laboratoriais de Staphylococcus aureus isolado de paciente que nao respondeu ao tratamento com vancomicina. Primeiro Encontro de Controle de Infeccao Hospitalar do MERCOSUL. 1999.

7 . Cosgrove, SE; Carroll, KC; Perl, TM. Staphylococcus aureus with reduced susceptibility to vancomycin (Staphylococcus aureus with reduced susceptibility to vancomycin). Clin Infect Diseases. 39 (4): 539-45. 2004.

8 . JARVIS, WR; SCHLOSSER JMA, CHINN RY, TWETTEN S, JACSON M.

National prevalence of methicillin resistant Staphylococcus aureus in inpatients at US health care facilities, 2006. Am J Infect Control. 35 (10): 631-7. 2007.

9 . YAMAUCHI, M. Japan was hit by resistant Staphylococcus aureus ). British Medical Journal. 306: 740. 1993.

10 . PANLILIO, AL; CULVER, DH; GAYNES, RP. Methicillin-resistant Staphylococcus aureus in US hospitals, 1975-1991. Infection Control and Hospital Epid. 13: 582-86. 1992.

11 . LOWRY, F. Staphylococcus aureus infections (Staphylococcus aureus infections). New England Journal of Medicine. 339: 520-32. 1998.

12 . FARR, BM. Prevention and control of methicillin-resistant Staphylococcus aureus infections). Current Opinion Infectious Diseases. 17: 317-22. 2004.

13 . TIEMERSMA, EW; BRONZWA, ER; SLAM, et . al . Methicillin-resistant Staphylococcus in Europe aureus in Europe), 1999-2002. Emerging Infectious Diseases. 10: 1627-34, 2004.

14 . BERETTA, ALRZ; TRABASSO, P .; STUCCHI, RB; MORETTI, ML. Use of molecular epidemiology to monitor the nosocomial dissemination of methicillin-resistant Staphylococcus aureus in an University hospital from 1991-2001). Braz. Journal of Medical and Biological Research. 37: 1345-51. 2004.

15 . PANNUTI, CS; GRINBAUM, RS. An overview of nosocomial infection control in Brazil. Infection Control and Hospital Epidemiology. 16 (3): 170-74. 1995.

16 . RESENDE, EM; COUTO, BRGM; STARLING, CEF; MODENA, CM. Prevalence of nosocomial infections in general hospitals in Belo Horizonte. Infection Control and Hospital Epidemiology. 19 (11): 872-76. 1998.

16a . Grundmann H., Aires de Souza M., Boyce J. and Tiemersma J. Emergence and resurgence of Methicillinn-resistant Staphylococcus aureus as a public trhreat health). Lancet. 2006. 368: 874-85.

17 . GUIGNARD, B; ENTENZA, JM; BETA-lactams against methicillin-resistant Staphylococcus aureus . MOREILLON P. methicillin-resistant Staphylococcus aureus . Curr. Opin Pharmacol. 5 (5): 479-89. 2005.

18 . SENNA, JP; ROTH, DM; OLIVEIRA, JS; MACHADO, DC, SANTOS DS.

Protective immune response against methicillin resistant Staphylococcus in a mouse model using a DNA vaccine approach aureus in a murine model using a DNA vaccine approach). Vaccine. 21: 2661-66. 2003.

19 . OHWADA, A; SEKIYA, M; HANAKI, H; ARAI, KK; HIRAMATSU, K, FUKUCHI, Y.

DNA vaccination by mecA sequence evokes an antibacterial immune response against methicillin-resistant Staphylococcus aureus ). Antimicrob Agents and Chemother. 44: 767-74. 1999.

20 . DOMBROWSKI, JC; WINSTON, LG. Clinical failures of appropriately-treated methicillin-resistant Staphylococcus aureus infections. J. Infect. 57 (2): 110-5. 2008.

20 bis . RYFFEL, C; TESCH, W; BICH-MACHIN, I .; REYNOLDS, PE; BARBERIS-MAINO, L; KAYSER, FH; BERGER-BACHI, B. mechi cylinder-resistant Staphylococcus aureus and sequence comparison of the mec A gene isolated from staphylococcal skin (Sequence comparison of mec A genes isolated from methicillin-resistant S. aureus and S. epidermidis ). Gene. 94: 137-38. 1990.

21 . ROTH, DM; SENNA, JP; MACHADO, DC. Evaluation of the humoral immune response in BALB / c mice immunized with a naked DNA vaccine anti-methicillin-resistant Staphylococcus aureus ). Genetics Molecular Research. 5 (3): 503-12. 2006.

22 . YOKOYAMA, W. Production of Monoclonal Antibodies; Production of monoclonal antibodies: induction of immune responses, p. 2.5.4-2.5.8. In: JE Coligan, AM Kruisbeek, DH Margulies, EM Shevach and W. Strober (ed). Current protocols in Immunology, vol. Wiley and Sons, Hoboken, NJ 1995.

23 . REED, LJ AND MUENCH H. Am. J. Hyg. 27: 493-97. 1938.

24 . KABAT, EA; WU, TT; BILOFSKY, H; M REID-MULLER, PERRY, H. Sequence of proteins of immunological interest. National Institutes of Health, Bethesda. 1993.

25 . CHOTIA, C; LESK, AM; TRAMONTANO, A; LEVITT, M; SMITH-GILL, PADLAN, EA; DAVIES, D; TULIP, WR. Conformations of immunoglobulin hypervariable regions. Nature, 342: 877-883. 1989.

26 . GOULD IM. The clinical significance of methicillin-resistant Staphylococcus aureus ). J. Hospital Infections, 61 (4): 277-82. 2005.

27 . ANDREMONT, A; TIBON-CORNILLOT, M. Le triomphe des bactcteries, la fin des antibiotiques? Ed Max Milo, 1 ed, 2007.

28 . Silverstein, Arthur M. Paul Ehrlich's receptor immunology . San Diego: Academic Press, 2002.

29 . LIM, D; STRINADKA NC. Structural basis for the beta lactam resistance of PBP2a from methicillin-resistant Staphylococus aureus ). Nat Struct Biol. 9 (11): 870-6. 2002.

30 . PAPAKYIRIAKOU, H; VAZ, D; SIMOR, A; LOUIE M; MCGAVIN MJ. Molecular analysis of the accessory gene regulator (agr) locus and balance of virulence factor expression in epidemic methicillin- in infectious methicillin-resistant Staphylococcus aureus resistant Staphylococcus aureus ). J Infect Dis. 181 (3): 2400-4. 2000.

31 . TEIXEIRA, LA; RESENDE, CA; ORMONDE, LR; ROSENBAUM, R; FIGUEIREDO AM, DE LENCASTRE H, TOMASZ A. Geographic spread of epidemic multiresistant Staphylococcus aureus clone in Brazil. J Clin Microbiol. 33 (9): 2400-4.1995.

32 . DA SILVA, COIMBRA MV; TEIXEIRA, LA; RAMOS, RL; PREDARI, SC; CASTELLO, L; FAMIGLIETTI A, VA, C; KLAN, L; FIGUEIREDO AM. Spread of the Brazilian epidemic clone of a multiresistant MRSA in two cities in Argentina. J Med Microbiol. 49 (2): 187-92. 2000.

33 . SENNA, JP; PINTO, CA; MATEOS, S; QUINTANA, A; SANTOS DS. Spread of a dominant methicillin-resistant Staphylococcus between Uruguay and South Brazilian hospitals aureus (MRSA) clone between Uruguayan and South Brazil Hospitals). J Hospital Infect. 53 (2): 15607. 2003.

34 . MELTER, O; SANTOS SANCHES, I; SCHINDLER, J; AIRES DE SOUZA, M; KOVAROVA, V; ZEMLICKOVA, H; DE LENCASTRE H. Methicillin-resistant Staphylococcus in the Czech Republic aureus clonal types in the Czech Republic). J Clin Microbiol, 37 (9): 2798-803. 1999.

35 . DA SILVA COIMBRA MV, SILVA-CARVALHO MC; WISPLINGHOFF H; HALL GO; TALLENT S; WALLACE, S; EDMOND, MB; FIGUEIREDO, AM; WEINZEL, RP. Clonal spread of methicillin-resistant Staphylococcus in the large geographical region of the United States aureus in a large geographic area of the United States). J Hosp Infect. 53 (2): 103-10. 2003.

36 . NYGAARD, TK; DELEO, FR; VOYICH, JM. Area-Related Methicillin-Resistant Staphylococcus Skin Infections: Community-associated methicillin-resistant Staphylococcus aureus skin infections: advances toward identifying the key virulence factors). Curr Op Infect Dis. 21 (2): 147-52. 2008.

37 . DIEP, BA; CHAMBERS, HF; GRABER, CJ; SZUMOWSKI, JD; MILLER, LG; HAN, LL; CHEN, JH; LIN, F; et . al . Emergence of multidrug-resistant, community-associated, methicillin-resistant Staphylococcus aureus clone USA 300 in men who have sex with men). Ann Intern Med. 148 (4): 249-57. 2008.

38 . REICHERT, JM; DEWITZ, MC. Anti-infective monoclonal antibodies: perils and promise of development. Nat Rev Drug Discov. 5 (3): 191-5. 2006.

39 . GAO, J; STEWART, GC. Regulatory elements of the Staphylococcus promoter aureus protein A (Spa) promoter). J Bacteriol. 186 (12): 3738-48. 2004.

40 . GOFFIN, C; GHUYSEN JM. Multimodular penicillin-binding proteins: an enigmatic family of orthologs and parologs. Microbiol Mol Biol Rev. 62 (4): 1079-93. 1998.

41 . COURVALIN P. vancomycin resistance in gram-positive cocci. Clin Infect Dis. 1; 42 Suppl 1: S25-34. 2006.

42 . BAILIE GR, NEAL D. Vancomycin ototoxicity and nephrotoxicity. Med Toxicol Adverse Drug Exp. 3: 376-86. 1988.

43 . SALGUERO E; PLAZA D; MARINO A; MORENO C; DELGADO G.

Characterizing vancomycin's immunotoxic profile using Swiss and CFW mice as na experimental model. Biomed Pharmacother. Sept 16. 2008.

<110> Funda 豫 o Oswaldo Cruz        Funda 豫 o Oswaldo Cruz   <120> Anticorpos Monoclonais <130> P1704 <160> 39 <170> PatentIn version 3.3 <210> 1 <211> 668 <212> PRT <213> Staphylococcus aureus <220> <221> MISC_FEATURE <223> sequencia de amino acid de PBP2a <400> 1 Met Lys Lys Ile Lys Ile Val Pro Leu Ile Leu Ile Val Val Val Val 1 5 10 15 Gly Phe Gly Ile Tyr Phe Tyr Ala Ser Lys Asp Lys Glu Ile Asn Asn             20 25 30 Thr Ile Asp Ala Ile Glu Asp Lys Asn Phe Lys Gln Val Tyr Lys Asp         35 40 45 Ser Ser Tyr Ile Ser Lys Ser Asp Asn Gly Glu Val Glu Met Thr Glu     50 55 60 Arg Pro Ile Lys Ile Tyr Asn Ser Leu Gly Val Lys Asp Ile Asn Ile 65 70 75 80 Gln Asp Arg Lys Ile Lys Lys Val Ser Ly Lys Asn Lys Lys Arg Val Asp                 85 90 95 Ala Gln Tyr Lys Ile Lys Thr Asn Tyr Gly Asn Ile Asp Arg Asn Val             100 105 110 Gln Phe Asn Phe Val Lys Glu Asp Gly Met Trp Lys Leu Asp Trp Asp         115 120 125 His Ser Val Ile Ile Pro Gly Met Gln Lys Asp Gln Ser Ile His Ile     130 135 140 Glu Asn Leu Lys Ser Glu Arg Gly Lys Ile Leu Asp Arg Asn Asn Val 145 150 155 160 Glu Leu Ala Asn Thr Gly Thr Ala Tyr Glu Ile Gly Ile Val Pro Lys                 165 170 175 Asn Val Ser Lys Lys Lys Asp Tyr Lys Ala Ile Ala Lys Glu Leu Ser Ile             180 185 190 Ser Glu Asp Tyr Ile Lys Gln Gln Met Asp Gln Asn Trp Val Gln Asp         195 200 205 Asp Thr Phe Val Pro Leu Lys Thr Val Lys Lys Met Asp Glu Tyr Leu     210 215 220 Arg Asp Phe Ala Lys Lys Phe His Leu Thr Thr Asn Glu Thr Glu Ser 225 230 235 240 Arg Asn Tyr Pro Leu Gly Lys Ala Thr Ser His Leu Leu Gly Tyr Val                 245 250 255 Gly Pro Ile Asn Ser Glu Glu Leu Lys Gln Lys Glu Tyr Lys Gly Tyr             260 265 270 Lys Asp Asp Ala Val Ile Gly Lys Lys Gly Leu Glu Lys Leu Tyr Asp         275 280 285 Lys Lys Leu Gln His Glu Asp Gly Tyr Arg Val Thr Ile Val Asp Asp     290 295 300 Asn Ser Asn Thr Ile Ala His Thr Leu Ile Glu Lys Lys Lys Lys Asp 305 310 315 320 Gly Lys Asp Ile Gln Leu Thr Ile Asp Ala Lys Val Gln Lys Ser Ile                 325 330 335 Tyr Asn Asn Met Lys Asn Asp Tyr Gly Ser Gly Thr Ala Ile His Pro             340 345 350 Gln Thr Gly Glu Leu Leu Ala Leu Val Ser Thr Pro Ser Tyr Asp Val         355 360 365 Tyr Pro Phe Met Tyr Gly Met Ser Asn Glu Glu Tyr Asn Lys Leu Thr     370 375 380 Glu Asp Lys Lys Glu Pro Leu Leu Asn Lys Phe Gln Ile Thr Thr Ser 385 390 395 400 Pro Gly Ser Thr Gln Lys Ile Leu Thr Ala Met Ile Gly Leu Asn Asn                 405 410 415 Lys Thr Leu Asp Asp Lys Thr Ser Tyr Lys Ile Asp Gly Lys Gly Trp             420 425 430 Gln Lys Asp Lys Ser Trp Gly Gly Tyr Asn Val Thr Arg Tyr Glu Val         435 440 445 Val Asn Gly Asn Ile Asp Leu Lys Gln Ala Ile Glu Ser Ser Asp Asn     450 455 460 Ile Phe Phe Ala Arg Val Ala Leu Glu Leu Gly Ser Lys Lys Phe Glu 465 470 475 480 Lys Gly Met Lys Lys Leu Gly Val Gly Glu Asp Ile Pro Ser Asp Tyr                 485 490 495 Pro Phe Tyr Asn Ala Gln Ile Ser Asn Lys Asn Leu Asp Asn Glu Ile             500 505 510 Leu Leu Ala Asp Ser Gly Tyr Gly Gln Gly Glu Ile Leu Ile Asn Pro         515 520 525 Val Gln Ile Leu Ser Ile Tyr Ser Ala Leu Glu Asn Asn Gly Asn Ile     530 535 540 Asn Ala Pro His Leu Leu Lys Asp Thr Lys Asn Lys Val Trp Lys Lys 545 550 555 560 Asn Ile Ile Ser Lys Glu Asn Ile Asn Leu Leu Thr Asp Gly Met Gln                 565 570 575 Gln Val Val Asn Lys Thr His Lys Glu Asp Ile Tyr Arg Ser Tyr Ala             580 585 590 Asn Leu Ile Gly Lys Ser Gly Thr Ala Glu Leu Lys Met Lys Gln Gly         595 600 605 Glu Thr Gly Arg Gln Ile Gly Trp Phe Ile Ser Tyr Asp Lys Asp Asn     610 615 620 Pro Asn Met Met Met Ala Ile Asn Val Lys Asp Val Gln Asp Lys Gly 625 630 635 640 Met Ala Ser Tyr Asn Ala Lys Ile Ser Gly Lys Val Tyr Asp Glu Leu                 645 650 655 Tyr Glu Asn Gly Asn Lys Lys Tyr Asp Ile Asp Glu             660 665 <210> 2 <211> 2007 <212> DNA <213> Staphylococcus aureus <220> <221> misc_feature <223> acido nucleico do gene mecA que codifica para a PBP2a <400> 2 ttattcatct atatcgtatt ttttattacc gttctcatat agctcatcat acactttacc 60 tgagattttg gcattgtagc tagccattcc tttatcttgt acatctttaa cattaatagc 120 catcatcatg tttggattat ctttatcata tgatataaac cacccaattt gtctgccagt 180 ttctccttgt ttcattttga gttctgcagt accggatttg ccaattaagt ttgcataaga 240 tctataaata tcttctttat gtgttttatt tacgacttgt tgcataccat cagttaatag 300 attgatattt tctttggaaa taatattttt cttccaaact ttgtttttcg tgtcttttaa 360 taagtgaggt gcgttaatat tgccattatt ttctaatgcg ctatagattg aaaggatctg 420 tactgggtta atcagtattt caccttgtcc gtaacctgaa tcagctaata atatttcatt 480 atctaaattt ttgtttgaaa tttgagcatt ataaaatgga taatcacttg gtatatcttc 540 accaacacct agttttttca tgcctttttc aaatttctta ctgcctaatt cgagtgctac 600 tctagcaaag aaaatgttat ctgatgattc tattgcttgt tttaagtcga tattaccatt 660 taccacttca tatcttgtaa cgttgtaacc accccaagat ttatcttttt gccaaccttt 720 accatcgatt ttataacttg ttttatcgtc taatgttttg ttatttaacc caatcattgc 780 tgttaatatt ttttgagttg aacctggtga agttgtaatc tggaacttgt tgagcagagg 840 ttctttttta tcttcggtta atttattata ttcttcgtta ctcatgccat acataaatgg 900 atagacgtca tatgaaggtg tgcttacaag tgctaataat tcacctgttt gagggtggat 960 agcagtacct gagccataat catttttcat gttgttataa atactctttt gaactttagc 1020 atcaatagtt agttgaatat ctttgccatc ttttttcttt ttctctatta atgtatgtgc 1080 gattgtattg ctattatcgt caacgattgt gacacgatag ccatcttcat gttggagctt 1140 tttatcgtaa agtttttcga gtcccttttt accaataact gcatcatctt tatagccttt 1200 atattctttt tgttttaatt cttcagagtt aatgggacca acataaccta atagatgtga 1260 agtcgctttt tctagaggat agttacgact ttctgtttca ttagttgtaa gatgaaattt 1320 ttttgcgaaa tcacttaaat attcatccat ttttttaacg gttttaagtg gaacgaaggt 1380 atcatcttgt acccaatttt gatccatttg ttgtttgata tagtcttcag aaatacttag 1440 ttctttagcg attgctttat aatctttttt agatacattc tttggaacga tgcctatctc 1500 atatgctgtt cctgtattgg ccaattccac attgtttcgg tctaaaattt taccacgttc 1560 tgattttaaa ttttcaatat gtatgctttg gtctttctgc attcctggaa taatgacgct 1620 atgatcccaa tctaacttcc acataccatc ttctttaaca aaattaaatt gaacgttgcg 1680 atcaatgtta ccgtagtttg ttttaatttt atattgagca tctactcgtt ttttattttt 1740 agatactttt tttattttac gatcctgaat gtttatatct ttaacgccta aactattata 1800 tatttttatc ggacgttcag tcatttctac ttcaccatta tcgcttttag aaatataact 1860 gctatcttta taaacttgtt tgaaattttt atcttcaatt gcatcaatag tattattaat 1920 ttctttatct tttgaagcat aaaaatatat accaaacccg acaactacaa ctattaaaat 1980 aagtggaaca atttttatct ttttcat 2007 <210> 3 <211> 76 <212> PRT <213> Staphylococcus aureus <220> <221> MISC_FEATURE <223> sequencia de amino acido de fragmento de PBP2a <400> 3 Met Tyr Gly Met Ser Asn Glu Glu Tyr Asn Lys Leu Thr Glu Asp Lys 1 5 10 15 Lys Glu Pro Leu Leu Asn Lys Phe Gln Ile Thr Thr Ser Pro Gly Ser             20 25 30 Thr Gln Lys Ile Leu Thr Ala Met Ile Gly Leu Asn Asn Lys Thr Leu         35 40 45 Asp Asp Lys Thr Ser Tyr Lys Ile Asp Gly Lys Gly Trp Gln Lys Asp     50 55 60 Lys Ser Trp Gly Gly Tyr Asn Val Thr Arg Tyr Glu 65 70 75 <210> 4 <211> 4 <212> PRT <213> Staphylococcus aureus <220> <221> MISC_FEATURE <223> sequencia de amino acido do centro ativo da PBP2a <400> 4 Ser Thr Gln Lys One <210> 5 <211> 228 <212> DNA <213> Staphylococcus aureus <400> 5 atgtatggca tgagcaacga agaatataac aaactgaccg aagataaaaa agaaccgctg 60 ctgaacaaat ttcagattac caccagcccg ggcagcaccc agaaaattct gaccgcgatg 120 attggcctga acaacaaaac cctggatgat aaaaccagct ataaaattga tggcaaaggc 180 tggcagaaag ataaaagctg gggcggctat aacgtgaccc gctatgaa 228 <210> 6 <211> 16 <212> PRT <213> Staphylococcus aureus <220> <221> MISC_FEATURE <223> sequencia de amino acido da cadeia leve para CDR1 <400> 6 Arg Ser Ser Gln Ser Ile Gly His Ser Asn Gly Asn Thr Tyr Leu Glu 1 5 10 15 <210> 7 <211> 7 <212> PRT <213> Staphylococcus aureus <220> <221> MISC_FEATURE <223> sequencia de amino acido da cadeia leve para CDR2 <400> 7 Lys Val Ser Asn Arg Phe Ser 1 5 <210> 8 <211> 9 <212> PRT <213> Staphylococcus aureus <220> <221> MISC_FEATURE <223> sequencia de amino acido da cadeia leve para CDR3 <400> 8 Phe Gln Gly Ser Tyr Val Pro Leu Thr 1 5 <210> 9 <211> 48 <212> DNA <213> Staphylococcus aureus <220> <221> misc_feature <223> sequencia de DNA da cadeia leve para CDR1 <400> 9 cgcagcagcc agagcattgg ccatagcaac ggcaacacct atctggaa 48 <210> 10 <211> 21 <212> DNA <213> Staphylococcus aureus <220> <221> misc_feature <223> sequencia de DNA da cadeia leve para CDR2 <400> 10 aaagtgagca accgctttag c 21 <210> 11 <211> 27 <212> DNA <213> Staphylococcus aureus <220> <221> misc_feature <223> sequencia de DNA da cadeia leve para CDR3 <400> 11 tttcagggca gctatgtgcc gctgacc 27 <210> 12 <211> 12 <212> PRT <213> Staphylococcus aureus <220> <221> MISC_FEATURE <223> sequencia de amino acido da cadeia pesada para CDR1 <400> 12 Gly Phe Ser Ile Thr Ser Ser Ser Ser Cys Trp His 1 5 10 <210> 13 <211> 16 <212> PRT <213> Staphylococcus aureus <220> <221> MISC_FEATURE <223> sequencia de amino acido da cadeia pesada para CDR2 <400> 13 Arg Ile Cys Tyr Glu Gly Ser Ile Ser Tyr Ser Pro Ser Leu Lys Ser 1 5 10 15 <210> 14 <211> 9 <212> PRT <213> Staphylococcus aureus <220> <221> MISC_FEATURE <223> sequencia de amino acido da cadeia pesada para CDR3 <400> 14 Glu Asn His Asp Trp Phe Phe Asp Val 1 5 <210> 15 <211> 36 <212> DNA <213> Staphylococcus aureus <220> <221> misc_feature <223> sequencia de DNA da cadeia pesada para CDR1 <400> 15 ggctttagca ttaccagcag cagcagctgc tggcat 36 <210> 16 <211> 48 <212> DNA <213> Staphylococcus aureus <220> <221> misc_feature <223> sequencia de DNA da cadeia pesada para CDR2 <400> 16 cgcatttgct atgaaggcag cattagctat agcccgagcc tgaaaagc 48 <210> 17 <211> 27 <212> DNA <213> Staphylococcus aureus <220> <221> misc_feature <223> sequencia de DNA da cadeia pesada para CDR3 <400> 17 gaaaaccatg attggttttt tgatgtg 27 <210> 18 <211> 33 <212> DNA <213> Staphylococcus aureus <400> 18 atggaagctt gctgggtcta caagctgtgg att 33 <210> 19 <211> 30 <212> DNA <213> Staphylococcus aureus <400> 19 atggaaatgg cagcctggtc ttattcctct 30 <210> 20 <211> 20 <212> DNA <213> Staphylococcus aureus <400> 20 gatgtgaagc ttcaggagtc 20 <210> 21 <211> 20 <212> DNA <213> Staphylococcus aureus <400> 21 caggtgcagc tgaaggagtc 20 <210> 22 <211> 20 <212> DNA <213> Staphylococcus aureus <400> 22 caggtgcagc tgaagcagtc 20 <210> 23 <211> 20 <212> DNA <213> Staphylococcus aureus <400> 23 caggttactc tgaaagagtc 20 <210> 24 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 24 gaggtccagc tgcaacaatc t 21 <210> 25 <211> 20 <212> DNA <213> Staphylococcus aureus <400> 25 gaggtccagc tgcagcagtc 20 <210> 26 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 26 caggtccaac tgcagcagcc t 21 <210> 27 <211> 20 <212> DNA <213> Staphylococcus aureus <400> 27 gaggtgaagc tggtggagtc 20 <210> 28 <211> 20 <212> DNA <213> Staphylococcus aureus <400> 28 gatgtgaact tggaagtgtc 20 <210> 29 <211> 29 <212> DNA <213> Staphylococcus aureus <400> 29 tggacaggga tccagagttc caggtcact 29 <210> 30 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 30 gacattgtga tgacccagtc t 21 <210> 31 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 31 gatgttttga tgacccaaac t 21 <210> 32 <211> 18 <212> DNA <213> Staphylococcus aureus <400> 32 gatattgtga taacccag 18 <210> 33 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 33 gacattgtgc tgacccaatc t 21 <210> 34 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 34 gatattgtgc taactcagtc t 21 <210> 35 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 35 gatatccaga tgacacagac t 21 <210> 36 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 36 gacatccagc tgactcagtc t 21 <210> 37 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 37 caaattgttc tcacccagtc t 21 <210> 38 <211> 21 <212> DNA <213> Staphylococcus aureus <400> 38 caggctgttg tgactcagga a 21 <210> 39 <211> 18 <212> DNA <213> Staphylococcus aureus <400> 39 tacagttggt gcagcatc 18

Claims (19)

Group SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 12, SEQ ID NO .: 13, and SEQ ID NO .: 14 or at least 80% identical to them An isolated monoclonal antibody that itself binds to PBP2a protein from methicillin-resistant bacteria (MRSA), characterized by comprising a variable chain region comprising an amino acid sequence, according to one selected from the corresponding amino acid sequences. Group SEQ ID NO .: 9, SEQ ID NO .: 10, SEQ ID NO .: 11, SEQ ID NO .: 15, SEQ ID NO .: 16, and SEQ ID NO .: 17 or at least 80% identical to them An isolated monoclonal antibody which itself binds to PBP2a protein from methicillin-resistant bacteria (MRSA), characterized by comprising a variable chain region comprising a DNA sequence, according to one selected from the corresponding amino acid sequences. Group SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 12, SEQ ID NO .: 13, and SEQ ID NO .: 14 or at least 80% identical to them An isolated monoclonal antibody that itself binds to a PBP5 protein from Enterococcus spp., Characterized by comprising a variable chain region comprising an amino acid sequence, according to being selected from the corresponding amino acid sequences. Group SEQ ID NO .: 9, SEQ ID NO .: 10, SEQ ID NO .: 11, SEQ ID NO .: 15, SEQ ID NO .: 16, and SEQ ID NO .: 17 or at least 80% identical to them An isolated monoclonal antibody which itself binds to a PBP5 protein from Enterococcus spp., Characterized by comprising a variable chain region comprising a DNA sequence, according to the one selected from the corresponding amino acid sequences. For a bacterial sample suspected of containing PBP2a or a protein homologous to it, comprising purely or in association with another substance, comprising the addition of an isolated monoclonal antibody as defined in claim 1. A method for diagnosing resistance to beta-lactam antibacterial agents. Infection with a bacterium having a protein homologous to PBP2a, characterized in that it comprises a large amount of isolated monoclonal antibody as defined in claim 1 or any one of a carrier or excipient which is a pharmaceutical carrier. Pharmaceutical compositions for treating or preventing the disease. Treating an infection by a bacterium having PBP2a or a protein homologous thereto, comprising administering a large amount of isolated monoclonal antibody as defined in claim 1 or 2 to a human or animal patient; How to prevent it. The antibody of claim 1, wherein the antibody is characterized by a variable heavy chain (heavy chain) having a CDR1 site comprising sequence GFSITSSSSCWH (SEQ ID NO .: 12) (CDR1 VH) and a corresponding nucleic acid sequence. The antibody of claim 1, wherein the antibody is characterized by a variable heavy chain having a CDR2 site comprising the sequence RICYEGSISYSPSLKS (SEQ ID NO .: 13) (CDR2 VH) and a corresponding nucleic acid sequence. The antibody of claim 1, wherein the antibody is characterized by a variable heavy chain having a CDR3 site comprising the sequence ENHDWFFDV (SEQ ID NO .: 14) (CDR3 VH) and the corresponding nucleic acid sequence. The antibody of claim 1, wherein the antibody is characterized by a variable light chain (light chain) having a CDR1 site comprising the sequence RSSQSIGHSNGNTYLE (SEQ ID NO .: 6) (CDR1 VL) and a corresponding nucleic acid sequence. The antibody of claim 1, wherein the antibody is characterized by a variable light chain having a CDR2 site comprising sequence KVSNRFS (SEQ ID NO .: 7) (CDR2 VL) and a corresponding nucleic acid sequence. The antibody of claim 1, wherein the antibody is characterized by a variable light chain having a CDR3 site comprising sequence FQGSYVPLT (SEQ ID NO .: 8) (CDR3 VL) and a corresponding nucleic acid sequence. The antibody of claim 2, wherein the antibody is characterized by a variable light chain having a CDR1 site comprising sequence SEQ ID NO .: 9 and a corresponding nucleotide sequence, with possible denaturation. The antibody of claim 2, wherein the antibody is characterized by a variable light chain having a CDR2 site comprising sequence SEQ ID NO .: 10 and a corresponding nucleotide sequence, with possible denaturation. The antibody of claim 2, wherein the antibody is characterized by a variable light chain having a CDR3 site comprising the sequence SEQ ID NO .: 11 and the corresponding nucleotide sequence, with possible denaturation. The antibody of claim 2, wherein the antibody is characterized by a variable heavy chain having a CDR1 site comprising sequence SEQ ID NO .: 15 and a corresponding nucleotide sequence, with possible denaturation. The antibody of claim 2, wherein the antibody is characterized by a variable heavy chain having a CDR2 site comprising sequence SEQ ID NO .: 16 and a corresponding nucleotide sequence, with possible denaturation. 4. The antibody of claim 3, wherein the antibody is characterized by a variable heavy chain having a CDR3 site comprising sequence SEQ ID NO .: 16 and a corresponding nucleotide sequence, with possible denaturation.

Images