KR20120087410A - Composition for Prevention or Treatment of ER-stress Mediated Disease Comprising NELL2 - Google Patents

Abstract

PURPOSE: A composition containing NELL2 for preventing or treating ER stress-associated diseases is provided to relieve ER stress. CONSTITUTION: A composition for preventing or treating ER stress-associated diseases contains NELL2(neural tissue-enriched epidermal growth factor-like repeat domain-containing protein) as an active ingredient. NELL2 has an amino acid sequence of sequence number 1. A composition for preventing or treating the diseases contains a vector containing a promoter and a polynucleotide encoding NELL2, which is operatively linked to the promoter.

Description

Composition for prevention or treatment of ER stress-related diseases comprising NELL2 as an active ingredient {Composition for Prevention or Treatment of ER-stress Mediated Disease Comprising NELL2}

The present invention relates to a composition for preventing or treating endoplasmic reticulum stress-related diseases, and more specifically, to prevent endoplasmic reticulum stress-related disorders comprising NELL2 protein or a nucleic acid encoding NELL2 protein as an active ingredient exhibiting an effect of alleviating vesicle stress. Or to a therapeutic composition.

The lumen of the endoplasmic reticulum (ER) is a specialized cellular environment for post-translational modification and protein folding. The endoplasmic reticulum is a membrane-like structure extending from the nuclear membrane and branching into two types: rough endoplasmic reticulum attached to ribosomes, and smooth vesicles without ribosomes. About one-third of intracellular proteins are transcribed from mRNA to protein in rough endoplasmic reticulum: folding, assembly, glycosylation, and disulfide bonds. This results in a protein structure with an active form. It is also a synthesizing place of lipids and steroid hormones and plays an important role in regulating intracellular calcium levels.

ER stress refers to the inflow of immature proteins beyond the ability of the endoplasmic reticulum to process by the physiological or pathological environment into the cell body or to the depletion of the endoplasmic reticulum due to the depletion of calcium in the endoplasmic reticulum. It means beyond the ER protein folding ability. When endoplasmic reticulum occurs, cells have a defense mechanism to survive. This is called the ER stress response.

The endoplasmic reticulum stress response is signaled through the ER transmembrane receptor, the pancreatic ER kinase (PKR) -like ER kinase (PERK), activation transcription factor 6, and inositol-requiring enzyme 1 (IRE1). Delivered. In normal cells, these three vesicle stress receptors are inactivated by the endoplasmic reticulum GRP78 / BiP, which is inactivated, and when unfoled proteins accumulate in the endoplasmic reticulum, GRP78 / BiP is isolated from the receptor, activating the receptor, resulting in a vesicle stress response. do. This induced vesicle stress response restores vesicle function and reduces the accumulation of unfoled proteins. However, if the accumulation of unfoled proteins continues and the vesicle stress is not relieved, the apoptosis pathway is activated, resulting in cell death.

Diseases caused by endoplasmic reticulum stress include Parkinson's disease, glutamine multimer-induced coagulation disease, Huntington's disease, Alzheimer's disease, ischemic disease, cardiovascular disease, neurorodegenerative disease, bipolar disorder, and diabetes mellitus Vesicular stress, including atherosclerosis, inflammation, inflammation, ischemia, heart diseases, liver diseases, pancreatic diseases, cancer, etc. It is known to be involved in development.

Therefore, in the case of controlling the vesicle stress, it has been suggested that the occurrence of the above-described vesicle stress-related diseases can be prevented and treated. However, there are many unknown parts about the vesicle stress response mechanism. Therefore, there is a need to develop a target that can effectively control the vesicle stress.

The NELL2 gene is similar to the neural tissue-specific EGF-like repeat domain containing protein (nel) found in chicken embryos. In humans, there are two genes similar to the nel of these chickens, which are called NELL1 and NELL2, respectively. . In particular, NELL2 was reported to have high similarity to chicken NELL and specifically expressed in adult brain tissue (Watanabe et al., 1996).

NELL2 was found to be one of the estrogen-dependent genes in the hypothalamus of a rat model in which a large amount of estrogen was administered immediately after birth, an experimental model for finding genes that regulate sex differentiation in the mammalian brain. This gene has the six epidermal growth factor (EGF) -like repeat domain , and has three Ca ^{2 +} -binding EGF-like domain is thought to be associated with a Ca ^{2 +} in. NELL2 is reported to be specifically expressed in neural tissue after birth in mammals, and is known to promote neuronal survival under various neuronal cell death conditions.

However, with respect to the NELL2 gene having the above characteristics, there is no report on the effect of protecting the cells from endoplasmic reticulum stress.

Therefore, the present inventors attempted to investigate how NELL2 affects the survival of cells from vesicle stress, and as a result, NELL2 is involved in the expression of various proteins related to vesicle stress, and also apoptosis protease associated with apoptosis ( The present invention was completed by confirming that the expression of pro-apoptotic protein and anti-apoptotic protein has an effect of relieving vesicle stress.

Accordingly, an object of the present invention is to provide a composition for preventing or treating endoplasmic reticulum stress-related diseases using NELL2.

In order to achieve the above object of the present invention, the present invention provides a composition for the prevention or treatment of vesicle stress-related diseases comprising NELL2 (neural tissue-enriched epidermal growth factor-like repeat domain-containing protein) as an active ingredient do.

In one embodiment of the present invention, the NELL2 may have an amino acid sequence represented by SEQ ID NO: 1.

In one embodiment of the present invention, NELL2 is an increased expression of endoplasmic reticulum chaperone GRP94, calnexin or BiP protein; Increased expression of XBP1 enzyme with vesicular stress relieving function; Or it may have an activity to reduce the endoplasmic reticulum stress through increased expression of the anti-cell death factor Bcl-xL.

In one embodiment of the present invention, the NELL2 may have an activity of inhibiting the activity of caspase-3, caspase-7 or PARP, or reducing vesicle stress through reducing expression of apoptosis factor CHOP. have.

In one embodiment of the present invention, the vesicle stress-related diseases are type 1 diabetes, type 2 diabetes, Alzheimer's disease, immunoglobulin light chain amyloidosis, Parkinson's disease, Amyotrophic lateral sclerosis (ALS), hemodialysis-related amyloidosis, reactive amyloidosis, cystic fibrosis, sickle cell anemia, Huntington's disease (Huntington's disease H) disease, Creutzfeldt-Jakob disease, familial hypercholesterolaemia, Alpha1-antitrypsin deficiency, cirrhosis, systemic emphysema, Cerebral hereditary amyloidoses, Wolcott-Rallison syndrome, wool May be selected from the people Syndrome (Wolfram syndrome), inflammatory bowel disease, colon's disease, ulcerative colitis, a group consisting of breast cancer and prostate cancer.

In addition, the present invention provides a prevention of vesicle stress-related diseases comprising a vector comprising a polynucleotide encoding a promoter and a NELL2 (neural tissue-enriched epidermal growth factor-like repeat domain-containing protein) operably linked thereto. Or a therapeutic composition.

In one embodiment of the present invention, the NELL2 may have an amino acid sequence represented by SEQ ID NO: 1.

In one embodiment of the present invention, the polynucleotide may have a nucleotide sequence represented by SEQ ID NO: 2.

In one embodiment of the present invention, the vesicle stress-related diseases are type 1 diabetes, type 2 diabetes, Alzheimer's disease, immunoglobulin light chain amyloidosis, Parkinson's disease, Amyotrophic lateral sclerosis (ALS), hemodialysis-related amyloidosis, reactive amyloidosis, cystic fibrosis, sickle cell anemia, Huntington's disease (Huntington's disease H) disease, Creutzfeldt-Jakob disease, familial hypercholesterolaemia, Alpha1-antitrypsin deficiency, cirrhosis, systemic emphysema, Cerebral hereditary amyloidoses, Wolcott-Rallison syndrome, wool May be selected from the people Syndrome (Wolfram syndrome), inflammatory bowel disease, colon's disease, ulcerative colitis, a group consisting of breast cancer and prostate cancer.

In one embodiment of the present invention, the endoplasmic reticulum stress may be a stress induced by thapsigargin.

The NELL2 protein of the present invention is involved in the expression of various proteins associated with vesicle stress, and also the expression of pro-apoptotic protein and anti-apoptotic protein associated with apoptosis. It has an effect on relieving vesicle stress.

More specifically, the expression of BiP protein, an endoplasmic reticulum chaperone, when the NELL2 protein of the present invention is overexpressed; Increased expression of XBP1 enzyme with vesicular stress relieving function; Reduced expression of CHOP, a protein involved in cell death; Increased mRNA expression of endoplasmic reticulum chaperones, GRP94, calnexin, BiP; Inhibit the activity of caspase 3, caspase 7 and PARP, proteins involved in cell death; And a mechanism for increasing the expression of Bcl-xL, a protein involved in cell survival, to alleviate vesicle stress.

Therefore, the composition of the present invention comprising a NELL2 protein or a nucleic acid encoding the NELL2 protein as an active ingredient having the above effects can be usefully used for the prevention or treatment of vesicle stress-related diseases.

1 is a graph showing the treatment of Cos7 cells by thapsigargin by concentration and measuring cell viability using MTS assay after 24 hours. (DEST40-control, NELL2-NELL2 overexpressed experimental group) .
FIG. 2 is a graph showing the cell survival rate using MTS assay after 48 hours of treatment with dab gargin for concentration in Cos7 cells.
Figure 3 is a graph measuring the number of live cells using trypan blue exclusion assay over time after treatment with dapsigargin to Cos7 cells.
Figure 4 is a graph measuring the number of cells killed by trypan blue exclusion assay over time after treatment with dapsigargin to Cos7 cells.
FIG. 5 shows the results of Western blot analysis of CHOP, BiP, and XBP1 splicing expression after 24 hours of serum-free medium containing DMSO added to Cos7 cells.
FIG. 6 shows the results of confirming CHOP, BiP, and XBP1 splicing expression by Western blot after 24 hours of treatment with dab gargin in Cos7 cells.
Figure 7 shows the results of confirming CHOP, BiP, XBP1 splicing expression amount by Western blot after 48 hours after treatment with dapsigargin in Cos7 cells.
The upper side of Figure 8 is the result of confirming the mRNA changes of GRP94, BiP, calnexin after RT-GAR treatment for 24 hours, 48 hours to Cos7 cells.
8 is a graph showing the relative amount of each marker (GRP94, BiP, calnexin) compared to the control group after standardizing the result of confirming the mRNA change of the GRP94, BiP, calnexin by RT-PCR based on GAPDH. .
9 shows the results of Western blot expression of caspase 3, caspase 7 and PARP after 24 hours treatment of dapsigargin in Cos7 cells.
FIG. 10 shows the results of Western blot expression of caspase 3, caspase 7 and PARP after 48 hours of dapsgarin treatment in Cos7 cells.
11 is a result of confirming the expression level of Bcl-xL by Western blot after treatment with dapsigargin for 24 hours and 48 hours in Cos7 cells.

The present invention is characterized by providing a composition for preventing or treating vesicle stress-related diseases comprising NELL2 as an active ingredient.

NELL2 (neural tissue-enriched epidermal growth factor-like repeat domain-containing protein) is a gene similar to the neural tissue-specific EGF-like repeat domain containing protein (nel) found in chicken embryos. The homologues of two mammals of nel were identified, and these are called NELL1 and NELL2, respectively. In particular, NELL2 is known to be highly similar to chicken nel and expressed specifically in adult brain tissue. NELL2 is reported to be specifically expressed in neural tissue after birth in mammals, and is known to promote neuronal survival under various neuronal cell death conditions.

The inventors have identified for the first time that NELL2 protein expressed by the NELL2 gene can alleviate endoplasmic reticulum stress.

According to the present invention, the NELL2 protein is involved in the expression of various proteins related to vesicle stress, and is also associated with the pro-apoptotic protein and the anti-apoptotic protein associated with apoptosis. Influence on the expression was confirmed to alleviate the endoplasmic reticulum stress.

More specifically, to compare the effect of NELL2 protein on endoplasmic reticulum stress, the present inventors compared negative control group with an overexpression of NELL2 protein after artificially generating endoplasmic reticulum stress in cells in vitro. As a result, it was confirmed that the splicing of XBP1 related to the biopolymer chaperone protein BiP and the endoplasmic reticulum stress was increased in the test group in which NELL2 protein was overexpressed, and the expression of CHOP, a cell death related protein, was decreased.

In addition, the present inventors investigated the effect of NELL2 protein at the gene level to alleviate the endoplasmic reticulum stress, that is, the mRNA expression level of the endoplasmic reticulum chaperone was measured. As a result, it was confirmed that mRNA expression levels of GRP94, calnexin, and BiP, which are types of endoplasmic reticulum chaperon, were increased in the experimental group overexpressing NELL2 protein.

In addition, the present inventors negatively examined the NELL2 protein and the experimental group overexpressing the NELL2 protein after artificially generating the endoplasmic reticulum stress in the cell under in vitro conditions, in order to examine how the NELL2 protein protects the cell from apoptosis when intracellular vesicle stress occurs. Controls were compared. As a result, in the experimental group overexpressing the NELL2 protein, it inhibited the activity of caspase 3, caspase 7 and PARP, which are pro-apoptotic proteins, and Bcl-xL, which is an anti-apoptotic protein. It was confirmed that the expression of increased.

These results demonstrate that NELL2 relieves endoplasmic reticulum stress through several intracellular mechanisms.

Therefore, the composition of the present invention comprising NELL2, preferably NELL2 polypeptide having the above characteristics, or a polynucleotide encoding the polypeptide as an active ingredient, can be usefully used for the prevention or treatment of vesicle stress-related diseases.

In the present invention, NELL2 protein, that is, NELL2 polypeptide is a protein having an amino acid sequence of NELL2, characterized in that represented by the amino acid sequence of SEQ ID NO: 1, but not limited to the above amino acid sequence and 70% or more, preferably Protein expressed by an amino acid sequence having at least 80%, more preferably at least 90% and most preferably at least 95% homology.

The NELL2 protein of the invention is a concept that includes post-translational modifications including phosphorylation, glycosylation, proteolytic cleavage, and the like.

In addition, the NELL2 protein of the present invention can also be prepared by directly isolated from mammalian tissue, chemically synthesized, or obtained using genetic recombination techniques. Isolation and purification of NELL2 protein contained in cells or tissues can be carried out by many known methods. Examples of these methods include methods using solubility such as salt precipitation and solvent precipitation, methods using molecular weight differences such as dialysis, ultrafiltration, gel filtration and SDS-polyacrylamide gel electrophoresis, charges such as ion exchange column chromatography. The method using the difference of, the method using the difference of hydrophilicity, such as reverse phase high performance liquid chromatography, the method using the difference of isoelectric points, such as isoelectric focusing electrophoresis, etc. can be illustrated.

NELL2 protein can also be synthesized chemically. When prepared by chemical synthesis, it can be obtained using a polypeptide synthesis method well known in the art. Peptides can be prepared using conventional stepwise liquid or solid phase synthesis, fragment condensation, F-MOC or T-BOC chemistry. In particular, a preferred method of preparing a polypeptide is to use solid phase syntheses. NELL2 can be synthesized in a conventional solid phase method by condensation reaction between protected amino acids, starting from the C-terminus and proceeding sequentially according to its sequence. After the condensation reaction, the carrier to which the protecting group and the C-terminal amino acid are linked can be removed by a known method such as acid decomposition or aminolysis. The peptide synthesis described above is described in detail in the related book (Gross and Meienhofer's, The Peptides, vol 2., Academic Press (1980)).

The NELL2 protein can also be obtained using genetic recombination techniques. When using a recombinant technique, a polynucleotide encoding a NELL2 protein is inserted into an appropriate expression vector, the vector is transformed into a host cell, the host cell is cultured to express the NELL2 protein, and then the NELL2 protein is recovered from the host cell. It can be obtained by the process. Proteins are expressed in selected host cells and then subjected to conventional biochemical separation techniques, such as treatment with protein precipitants (salting), centrifugation, sonication, ultrafiltration, dialysis, molecular sieve chromatography for isolation and purification. (Gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, and the like can be used. In general, these are used in combination to separate proteins of high purity.

Accordingly, the present invention provides a method for preventing vesicle stress-related diseases comprising a promoter comprising a vector comprising a polynucleotide encoding a promoter and a neural tissue-enriched epidermal growth factor-like repeat domain-containing protein (NELL2) operably linked thereto. Therapeutic compositions can be provided.

In the present invention, the polynucleotide encoding the NELL2 may be isolated or artificially modified in nature, the base sequence encoding the NELL2 protein may be modified by substitution, deletion or insertion of one or more nucleic acid bases, such The protein expressed by the modification should not contain significant changes in its biological functionality. Such modifications include modifications to heterologous homologous genes.

Therefore, the polynucleotide encoding the NELL2 protein is characterized by being represented by the nucleotide sequence of SEQ ID NO: 2, but not limited to 70% or more, preferably 80% or more, and more preferably 90% or more with the nucleic acid sequence. Characterized by the base sequence having homology.

Preferably, the polynucleotide encoding the NELL2 protein of the present invention may be provided in the form of a recombinant expression vector operably linked to the vector expressing it. Expression vectors comprising NELL2 polynucleotides include, but are not limited to, plasmids, phages, cosmids, viral vectors or other mediators known in the art. The vector may be self-replicating or integrated into the host DNA. In the following examples of the present invention, the pcDNA-DEST40 vector (Invitrogen) was used.

Polynucleotides encoding the NELL2 protein may be combined with expression control sequences such as promoter / enhancer sequences and other sequences required for transcription, translation or processing. Regulatory sequences include tissue-specific regulatory and / or inducible sequences as well as direct constitutive expression of nucleotides. The design of the expression vector may be determined by factors such as the host cell to be transfected, the level of expression desired, and the like.

As the expression vector expressing the NELL2 protein included in the composition of the present invention, a non-viral vector or a viral vector may be used. Viral vectors include, for example, replication defective retroviruses, adenoviruses, adenovirus-associated viruses, and the like. Viral vectors must meet the following criteria: (1) be able to infect the cells of interest, and thus a viral vector with an appropriate host range must be selected, and (2) the delivered genes will be preserved in the cells for an appropriate period of time. And be able to be expressed, and (3) the vector must be safe for the host. Other viral vectors that can be used for gene transfer into cells include murine leukemia virus (MLV), JC, SV40, polyoma, Epstein-Barr virus papilloma virus, vaccinia, poliovirus, herpes virus, sindbis virus, lenti Viruses, and other human and animal viruses.

The expression vector according to the present invention can be introduced into cells using methods known in the art. For example, but not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran- DEAE Dextran-mediated transfection, polybrene-mediated transfection, electroporation, gene guns and other known methods for introducing nucleic acids into cells Can be introduced into cells by the method of (Wu et al., J. Bio. Chem., 267: 963-967, 1992; Wu and Wu, J. Bio. Chem., 263: 14621-14624, 1988). .

In addition, in the present invention, the meaning of including the polynucleotide encoding the NELL2 protein as an active ingredient includes the polynucleotide itself encoding the NELL2 protein as an active ingredient, and the expression vector into which the polynucleotide encoding the NELL2 protein is inserted. Means to include as an active ingredient.

Meanwhile, the composition for preventing or treating vesicle stress-related diseases including NELL2 provided by the present invention as an active ingredient may be used as a pharmaceutical composition.

The pharmaceutical composition of the present invention may be administered in an appropriate formulation with a carrier and diluent known in the art in addition to the NELL2 protein or polynucleotide encoding the NELL2 protein as an active ingredient, and parenteral administration, for example, For example, it may have a formulation such as intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection, suppository and the like. When the therapeutic agent of the present invention is orally administered, the therapeutic agent can be administered in the form of tablets, capsules, particles, powders, pills, troches, liquids, suspensions, emulsions or syrups.

The formulations are suitable excipients, fillers, binders, wetting agents, disintegrating agents, lubricants, surfactants, dispersants, buffers, preservatives, dissolution aids, disinfectants, sweeteners, spices, analgesics, stabilizers, isotonic agents commonly used in pharmaceutical compositions. It may be produced by a conventional method using the same.

Each formulation described above may comprise a pharmaceutically acceptable carrier or additive. Specific examples of the carrier or additive include water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidine, carboxyvinyl polymer, sodium alginate, water soluble dextran, carboxymethyl sodium starch, pectin, xanthan rubber , Gum arabic, casein, gelatin, agar, glycerol, propylene glycol, polyethylglycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, and lactic acid. One or more additives may be selected or appropriately combined depending on the type of preparation. Furthermore, as a method of administering a gene therapy treatment, topical administration to target cells may be performed in addition to conventional systemic administration such as intravenous and intraarterial administration, and a combination of catheter technique and surgical operation may be used. have.

The vesicular stress-related diseases in which the pharmaceutical composition of the present invention may have a therapeutic effect include type 1 diabetes, type 2 diabetes, Alzheimer's disease, immunoglobulin light chain amyloidosis, and Parkinson's disease. (Parkinson's disease), amyotrophic lateral sclerosis (ALS), hemodialysis-related amyloidosis, reactive amyloidosis, cystic fibrosis, sickle cell anemia (sickle cell anemia) ), Huntington's disease, Creutzfeldt-Jakob disease, familial hypercholesterolaemia, Alpha1-antitrypsin deficiency, cirrhosis, systemic emphysema (emphysema systemic), cerebral hereditary amyloidoses, and wolcott-rally symptoms (Wolcott-Rallison syndrome), Wolfram syndrome (Wolfram syndrome), include inflammatory bowel disease, colon's disease, ulcerative colitis, breast cancer and prostate cancer itdoe including, but not limited thereto.

The pharmaceutical composition of the present invention may comprise a NELL2 protein or a polynucleotide encoding the same in a pharmaceutically effective amount with a pharmaceutically acceptable carrier.

In the present invention, the `` pharmaceutically effective amount '' refers to the amount of the active ingredient exhibiting alleviation, suppression, improvement and / or cure effect on the vesicle stress-related diseases to be treated. The dosage of the NELL2 protein or nucleic acid encoding the same of the present invention varies depending on the weight, age, sex, health condition, diet, time of administration, administration method and severity of disease of the patient. For example, therapeutically effective dosages can be initially determined using in vitro assays through cell culture, and performed in an animal model to determine the IC50 (in vitro) in which the concentration range of blood NELL2 protein is determined in cell culture. In assays, drug treatments, the concentration of the test compound at a lethal dose relative to 50% of the cultured cells) can be determined. It will be possible to determine the amount effective for treatment without undue experimentation in the art, and this information can be used to more accurately determine the useful dose in humans. In one embodiment, when subcutaneously injecting the pharmaceutical composition of the present invention, the dose is generally from 1,000 to 150,000 units per kg of body weight, which is administered once or in several divided doses per day, but the dose is appropriately increased or decreased depending on the symptoms. You can. The pharmaceutical compositions of the invention may be administered according to the dosages recommended by the manufacturer. In a preferred embodiment, the compositions of the present invention can be injected subcutaneously at a concentration of 1 ug / ml. At this time, the NELL2 protein may be included in an amount of 0.1 to 10 ug / ml.

The present invention also provides the use of a composition comprising the NELL2 protein or a nucleic acid encoding the same as an active ingredient for the manufacture of a medicament for the prevention or treatment of vesicle stress-related diseases. The composition of the present invention comprising the above-described NELL2 protein or a nucleic acid encoding the same as an active ingredient can be used for the manufacture of a medicament for the prevention or treatment of vesicle stress-related diseases.

The present invention also provides a method for preventing or treating vesicle stress related diseases comprising administering to a mammal a therapeutically effective amount of a pharmaceutical composition of the present invention.

As used herein, the term “mammal” refers to a mammal that is the subject of treatment, observation or experiment, preferably human.

The term 'therapeutically effective amount' as used herein is the same concept as the pharmaceutically effective amount.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

< Example  1>

Endoplasmic reticulum under stress conditions NELL2 Effect on cells

To determine whether NELL2 protects cells from ER stress conditions, cell survival rates were compared using NELL2 overexpressing cells as experimental groups after inducing ER stresses. Cell viability was measured through MTS assay and trypan blue exclusion assay, and specific methods for these experiments were described below.

<1-1> Cell Culture

Cos7 cells were cultured in a high-Dulbecco's modified Eagle medium (DMEM) in a 37 ° C, 5% CO2 incubator with 10% fetal bovine serum (Hyclone) and penicillin-streptomycin solution (100 units / ml). Cultured.

<1-2> NELL2  Overexpressing Cell Preparation

The NELL2 full gene sequence of the rat was cloned into the pcDNA-DEST40 vector (Invitrogen), and the cloned expression vector confirmed the insertion of the NELL2 full gene into the vector by sequencing. Cos7 cells were dispensed in 6-well plates at 2 × 10 ⁵ cells / well and incubated overnight in a 37 ° C. incubator. The next day the NELL2 expression vector was transfected with lipofectamine (Invitrogen). Thereafter, 300 μg of G418 (Sigma) was treated and cultured for 3 weeks to select cells transfected with NELL2.

<1-3> MTS assay

Each of Cos7 cells (control) cultured through <1-1> and NELL2 overexpressing cells (experimental group) selected through <1-2> were dispensed at 96 × plate (NUNC) at 1 × 10 ⁴ / well After incubation overnight in a 37 ℃ incubator. Next day, thapsigargin, which induces endoplasmic reticulum, was diluted in serum free high glucose DMEM at concentrations of 0.5 μM, 1 μM, 2 μM, 5 μM, and 10 μM, treated with cells, and then treated with MTS solution after 24 and 48 hours. (Promega) and PMS solution (Promega) were dissolved at room temperature for 90 minutes, MTS: PMS ratio of 1:20 mixed solution was made and added 20μ each well and left in a 37 ℃ incubator for 1 hour. . Thereafter, absorbance values were measured at a wavelength of 490 nm.

As a result, as shown in FIG. 1, when thapsigargin was treated at concentrations of 0.5 μM, 1 μM, 2 μM, 5 μM and 10 μM for 24 hours, the difference in cell viability was significantly different between the control group and the experimental group overexpressing NELL2. While no difference was shown, when treated with thapsigargin at concentrations of 0.5 μM, 1 μM, 2 μM, 5 μM and 10 μM for 48 hours, as shown in FIG. 2, the experimental group overexpressed NELL2 cells compared to the control group. Survival was shown to be better.

These results show that the inventors of NELL2 protects the cells from the endoplasmic reticulum stress to improve the cell survival rate.

<1-4> trypan blue exclusion assay

Cytoprotective activity from the endoplasmic reticulum stress of NELL2 confirmed in Example <1-3> was once again confirmed by trypan blue exclusion analysis. That is, for this purpose, each of Cos7 cells cultured through <1-1> and NELL2 overexpressing cells selected through <1-2> were dispensed at 2.0 × 10 ⁵ cells / well in 6-well plate (NUNC). After incubation for about one day and treated with thapsigargin diluted to 5μM in serum-free high glucose DMEM and cell viability was confirmed after 12 hours, 24 hours, 36 hours, 48 hours. Cell viability was determined using a trypan blue exclusion assay using a hemacytometer to determine the number of living and dead cells (Behl et al., 1995).

As a result, as shown in Figures 3 and 4, in the experimental group overexpressed NELL2, it was confirmed that the number of living cells is more present as time increases compared to the control group (see Figure 3), on the contrary The number of experimental groups overexpressed NELL2 was found to be reduced compared to the control group (see FIG. 4). This suggests that NELL2 protects cells from endoplasmic reticulum stress.

< Example  2>

NELL2 Autumn endoplasmic reticulum stress Marker  Impact on expression

To determine the mechanism by which NELL2 protects against cellular vesicle stress, the protein expression level of ER vesicle stress markers (CHOP, XBP1, BiP) was measured. MRNA expression levels of stress response genes (GRP94, calnexin, BiP) were measured. Protein expression level measurement was performed by Western blot, mRNA expression level of the endoplasmic reticulum stress response gene was measured by RT-PCR, detailed experimental method is as described below.

<2-1> Protein Isolation ( SDS - PAGE )

Cos7 cells cultured through <1-1> and NELL2 overexpressing cells selected through <1-2> were dispensed at 2.0 × 10 ⁵ cells / well in 6 well plates (NUNC), and then cultured for about 1 day. After treatment with thapsigargin diluted to 5 μM in serum free high glucose DMEM, cells were obtained with culture medium after 24 and 48 hours. The obtained cells and medium were treated with M-PER mammalian cell protein extract reagent (Pierce) containing a protease inhibitor cocktail (Roche), sonicated and incubated on ice for 15 minutes. I was. After centrifugation at 14000rpm, the supernatant was taken to separate proteins from the cells, and the separated proteins were quantified, followed by SDS-sample loading buffer (0.1875M Tris-HCl, pH 6.8), 6% SDS, 30% glycerol. After addition, 0.03% bromophenol blue, 15% beta-mercaptoethanol was added to boil for 5 minutes, denatured, and then electrophoresed on 12% SDS-polyacrylamide gel to separate proteins present in cells according to size.

<2-2> vesicle stress Marker  Protein expression measurement

The protein isolated through <2-1> was transferred to a polyvinylidene difluoride (PVDF, Whatman) membrane. Complete migration of PVDF membranes with Tri-buffered saline / Tween 20 (0.1% Tween 20, 150 mM NaCL, 10 mM Tris-HCL) to prevent binding of antibodies to non-specific sites The cells were blocked with TBS-twin containing 5% non fat dry milk (Difco) for 90 minutes at room temperature. The primary antibody treatment was CHOP (1: 1000, Santa cruze biotechnology), spliced XBP1 (1: 1000, Biolegend), BiP (1: 2000, Cell signaling technology), β-actin (1: 4000, SIGMA). Diluted in TBS-Twin and then treated with the membrane. The primary antibody was treated with CHOP, spliced XBP1, and BiP overnight at 4 ° C in a cold room, and β-actin for 60 minutes. After the first antibody treatment, washing with TBS-Twin for 3 minutes for 5 minutes and twice for 10 minutes, β-actin was treated with anti-mouse IgG HRP antibody (1: 4000.Santa Cruz Biotechnology) for 60 minutes with secondary antibody and CHOP. , spliced XBP1, BiP was treated with anti-rabbit IgG HRP antibody (1: 4000, GE Healthcare) for 60 minutes. After washing 3 times for 5 minutes and 2 times for 10 minutes with TBS-twin, it was detected by ECL plus western blotting detection system kit (Amersham Biosciences). Membranes were identified by a Luminescent image analyzer (GE Healthcare).

As a result, in the group not treated with thapsigargin, that is, the group that did not induce the endoplasmic reticulum stress, there was no change in the expression level of the vesicle stress markers in both the control group and the experimental group overexpressing NELL2 (see FIG. 5). In contrast, in the group treated with thapsigargin for 24 hours, the expression of CHOP, a protein related to apoptosis, was decreased in the experimental group overexpressing NELL2 than the control group. Phosphorus BiP was found to be more expressed in the experimental group overexpressed NELL2. In the case of XBP1, the splicing form was also increased in the experimental group overexpressing NELL2 (see FIG. 6), and these results were also the same in the group treated with thapsigargin for 48 hours (FIG. 7). Reference).

<2-3> Reticulum Stress Response Genes mRNA  Expression measurement

Cos7 cells cultured through <1-1> and NELL2 overexpressing cells selected through <1-2> were dispensed at 2.0 × 10 ⁵ / well per well into 6 well plates and cultured for about 1 day. Thapsigargin was treated with 5 μM for 24 hours and 48 hours. After moving to a microfuge tube, centrifugation at 5000rpm for 3 minutes to remove sup, add 1ml of TRI-regent (Bio science), lyse the cells, and vortex for 15 seconds by treating 200μl of chloroform (sigma). After 5 minutes at room temperature, RNA, DNA, and protein layers were separated by centrifugation at 14000 rpm for 20 minutes. Transfer the supernatant containing RNA to a new microfuge tube, add 500μl of isopropanol (MERCK), vortex, and leave at 4 ℃ for 5 minutes, wash for 15 minutes at 14000rpm, remove supernatant, and add 10μl of DEPC treated water to RNA Melted. The extracted RNA was measured for concentration with a spectrophotometer.

3μg of RNA isolated by the above method was added 1μl of oligo dT (QIAGEN), and the mixed solution of 9μl with DEPC treated water was mixed well. Then denature in a 65 ° C. water bath for 10 minutes, immediately put on ice and cool for 10 minutes, then 4 μl of 5X M-MLV reaction buffer (Promega), 2 μl of 100 mM DTT (Promega), 4 μl of 2.5 mM dNTP (TaKaRa), After adding 1 μl of M-MLV Reverse Transcription (Promega), cDNA was synthesized in a water bath at 37 ° C. for 2 hours. The synthesized cDNA1 μl was used as a template, and PCR was performed using primers prepared as shown in Table 1 below. Was performed. After adding 10 μl / μl forward and 1 μl reverse primer, respectively, the total amount was adjusted to 10 μl using 2x EF PCR Pre-mix (SOLGENT), and then PCR was performed. PCR conditions are 27 ~ 30 cycles with pre-denaturation at 94 ℃ for 4 minutes, denaturation at 94 ℃ for 30 seconds, annealing for 30 seconds according to the appropriate temperature of each primer, and elongation at 72 ℃ for 30 seconds. Finally, post-elongation was performed at 72 ° C. for 5 minutes.

Primer sequence gene Primer sequence (5 '→ 3') Accession number Product size (bp) SEQ ID NO: GAPDH Forward CACTGCCACCCAGAAGACTG AY 624139 429 3 Reverse ACCCTGTTGCTGTAGCCAAAT 4 GRP94 Forward TTCAGGCCCTTCCTGAATTT NM 001195524 534 5 Reverse CCTTTGCATCAGGGTCAATG 6 BiP Forward CTGGCAAAGACGTCAGGAAA AB 232154 484 7 Reverse TTGGTCATGACACCTCCCAC 8 calnexin Forward CCAGACGCAGAGAAACCTGA XM 002804665 500 9 Reverse AGGATAACCAGGAACACGGG 10

(GAPDH: Glyceraldehyde 3-phosphate dehydrogenase)

As a result, as shown in Figure 8, the mRNA expression of the endoplasmic reticulum chaperon GRP94, calnexin, BiP mRNA was increased in the experimental group overexpressed NELL2 compared to the control group.

In conclusion, in the experimental group overexpressing NELL2, the expression of CHOP, a protein related to apoptosis, was decreased in the ER stress markers, whereas the BiP protein and XBP1 splicing form were increased. In addition, mRNA expression of GRP94, calnexin, and BiP, a type of endoplasmic reticulum, was increased. These results indicate that NELL2 influences cell survival by modulating the expression of various vesicle stress markers exhibited by vesicle stress and plays a role in mitigating vesicle stress in cells.

< Example  3>

NELL2 Apoptosis Proprotein  And effect on expression of anti-apoptotic proteins

The following western blot was performed to determine how NELL2 regulates the expression of pro-apoptotic protein and anti-apoptotic protein in cytoprotective action. Western blot was performed in the same manner as in Example 2, and the cleaved caspase 3 (1: 1000, Cell signaling technology), cleaved caspase 7 (1: 1000, Cell signaling technology), cleaved PARP as the primary antibody (1: 1000, Cell signaling technology), Bcl-xL (1: 1500, Cell signaling technology), β-actin (1: 4000, SIGMA) was used in the same manner except that.

As a result, in the group treated with thapsigargin for 24 hours, the activated forms of the pro-apoptotic proteins caspase 3, caspase 7 and PARP were expressed in the experimental group overexpressing NELL2 compared to the control group. Was found to be reduced (see FIG. 9), and this result was the same in the group treated with thapsigargin for 48 hours (see FIG. 10).

In addition, Bcl-xL, a type of anti-apoptotic protein, increased the expression level of NELL2 overexpressed group in both groups treated with thapsigargin for 24 hours and 48 hours. It was confirmed (see FIG. 11).

Taken together, NELL2 inhibits the activity of caspase 3 and caspase 7, PARP, which are involved in apoptosis, and increases the expression of Bcl-xL, a protein involved in cell survival, thus protecting cells from vesicular stress. In addition, it was found that NELL2 can be used for the treatment of various diseases related to endoplasmic reticulum stress.

So far I looked at the center of the preferred embodiment for the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> University of Ulsan Foundation For Industry Cooperation <120> Composition for Prevention or Treatment of ER-stress Mediated          Disease Comprising NELL2 <130> NP11-1002 <160> 2 <170> Kopatentin 1.71 <210> 1 <211> 819 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of NELL2 <400> 1 Met His Ala Met Glu Ser Arg Val Leu Leu Arg Thr Phe Cys Val Ile   1 5 10 15 Leu Gly Leu Glu Ala Val Trp Gly Leu Gly Val Asp Pro Ser Leu Gln              20 25 30 Ile Asp Val Leu Ser Glu Leu Glu Leu Gly Glu Ser Thr Ala Gly Val          35 40 45 Arg Gln Val Pro Gly Leu His Asn Gly Thr Lys Ala Phe Leu Phe Gln      50 55 60 Asp Ser Pro Arg Ser Ile Lys Ala Pro Ile Ala Thr Ala Glu Arg Phe  65 70 75 80 Phe Gln Lys Leu Arg Asn Lys His Glu Phe Thr Ile Leu Val Thr Leu                  85 90 95 Lys Gln Ile His Leu Asn Ser Gly Val Ile Leu Ser Ile His His Leu             100 105 110 Asp His Arg Tyr Leu Glu Leu Glu Ser Ser Gly His Arg Asn Glu Ile         115 120 125 Arg Leu His Tyr Arg Ser Gly Thr His Arg Pro His Thr Glu Val Phe     130 135 140 Pro Tyr Ile Leu Ala Asp Ala Lys Trp His Lys Leu Ser Leu Ala Phe 145 150 155 160 Ser Ala Ser His Leu Ile Leu His Ile Asp Cys Asn Lys Ile Tyr Glu                 165 170 175 Arg Val Val Glu Met Pro Ser Thr Asp Leu Pro Leu Gly Thr Thr Phe             180 185 190 Trp Leu Gly Gln Arg Asn Asn Ala His Gly Tyr Phe Lys Gly Ile Met         195 200 205 Gln Asp Val Gln Leu Leu Val Met Pro Gln Gly Phe Ile Ala Gln Cys     210 215 220 Pro Asp Leu Asn Arg Thr Cys Pro Thr Cys Asn Asp Phe His Gly Leu 225 230 235 240 Val Gln Lys Ile Met Glu Leu Gln Asp Ile Leu Ser Lys Thr Ser Ala                 245 250 255 Lys Leu Ser Arg Ala Glu Gln Arg Met Asn Arg Leu Asp Gln Cys Tyr             260 265 270 Cys Glu Arg Thr Cys Thr Met Lys Gly Thr Thr Tyr Arg Glu Phe Glu         275 280 285 Ser Trp Thr Asp Gly Cys Lys Asn Cys Thr Cys Leu Asn Gly Thr Ile     290 295 300 Gln Cys Glu Thr Leu Val Cys Pro Ala Pro Asp Cys Pro Ala Lys Ser 305 310 315 320 Ala Pro Ala Tyr Val Asp Gly Lys Cys Cys Lys Glu Cys Lys Ser Thr                 325 330 335 Cys Gln Phe Gln Gly Arg Ser Tyr Phe Glu Gly Glu Arg Ser Thr Val             340 345 350 Phe Ser Ala Ser Gly Met Cys Val Leu Tyr Glu Cys Lys Asp Gln Thr         355 360 365 Met Lys Leu Val Glu Asn Ala Gly Cys Pro Ala Leu Asp Cys Pro Glu     370 375 380 Ser His Gln Ile Ala Leu Ser His Ser Cys Cys Lys Val Cys Lys Gly 385 390 395 400 Tyr Asp Phe Cys Ser Glu Lys His Thr Cys Met Glu Asn Ser Val Cys                 405 410 415 Arg Asn Leu Asn Asp Arg Ala Val Cys Ser Cys Arg Asp Gly Phe Arg             420 425 430 Ala Leu Arg Glu Asp Asn Ala Tyr Cys Glu Asp Ile Asp Glu Cys Ala         435 440 445 Glu Gly Arg His Tyr Cys Arg Glu Asn Thr Met Cys Val Asn Thr Pro     450 455 460 Gly Ser Phe Leu Cys Ile Cys Gln Thr Gly Tyr Ile Arg Ile Asp Asp 465 470 475 480 Tyr Ser Cys Thr Glu His Asp Glu Cys Leu Thr Asn Gln His Asn Cys                 485 490 495 Asp Glu Asn Ala Leu Cys Phe Asn Thr Val Gly Gly His Asn Cys Val             500 505 510 Cys Lys Pro Gly Tyr Thr Gly Asn Gly Thr Thr Cys Lys Ala Phe Cys         515 520 525 Lys Asp Gly Cys Arg Asn Gly Gly Ala Cys Ile Ala Ala Asn Val Cys     530 535 540 Ala Cys Pro Gln Gly Phe Thr Gly Pro Ser Cys Glu Thr Asp Ile Asp 545 550 555 560 Glu Cys Ser Glu Gly Phe Val Gln Cys Asp Ser Arg Ala Asn Cys Ile                 565 570 575 Asn Leu Pro Gly Trp Tyr His Cys Glu Cys Arg Asp Gly Tyr His Asp             580 585 590 Asn Gly Met Phe Ala Pro Gly Gly Glu Ser Cys Glu Asp Ile Asp Glu         595 600 605 Cys Gly Thr Gly Arg His Ser Cys Ala Asn Asp Thr Ile Cys Phe Asn     610 615 620 Leu Asp Gly Gly Tyr Asp Cys Arg Cys Pro His Gly Lys Asn Cys Thr 625 630 635 640 Gly Asp Cys Val His Asp Gly Lys Val Lys His Asn Gly Gln Ile Trp                 645 650 655 Val Leu Glu Asn Asp Arg Cys Ser Val Cys Ser Cys Gln Thr Gly Phe             660 665 670 Val Met Cys Arg Arg Met Val Cys Asp Cys Glu Asn Pro Thr Val Asp         675 680 685 Leu Ser Cys Cys Pro Glu Cys Asp Pro Arg Leu Ser Ser Gln Cys Leu     690 695 700 His Gln Asn Gly Glu Thr Val Tyr Asn Ser Gly Asp Thr Trp Val Gln 705 710 715 720 Asp Cys Arg Gln Cys Arg Cys Leu Gln Gly Glu Val Asp Cys Trp Pro                 725 730 735 Leu Ala Cys Pro Glu Val Glu Cys Glu Phe Ser Val Leu Pro Glu Asn             740 745 750 Glu Cys Cys Pro Arg Cys Val Thr Asp Pro Cys Gln Ala Asp Thr Ile         755 760 765 Arg Asn Asp Ile Thr Lys Thr Cys Leu Asp Glu Met Asn Val Val Arg     770 775 780 Phe Thr Gly Ser Ser Trp Ile Lys His Gly Thr Glu Cys Thr Leu Cys 785 790 795 800 Gln Cys Lys Asn Gly His Val Cys Cys Ser Val Asp Pro Gln Cys Leu                 805 810 815 Gln glu leu             <210> 2 <211> 2460 <212> DNA <213> Artificial Sequence <220> <223> NELL2 cDNA sequence <400> 2 atgcacgcca tggaatcccg ggtattactg agaacgttct gcgtgatcct cgggctcgaa 60 gcggtttggg gacttggtgt ggacccctcc ctacagattg acgtcttatc agagttagaa 120 cttggggagt ccacagctgg agtgcgccaa gtcccaggac tgcataatgg gacgaaagcc 180 ttcctcttcc aagattctcc cagaagcata aaagcaccca ttgctacagc tgagcggttt 240 ttccagaagc tgaggaataa acacgagttc acaattctgg tgaccctgaa acagatccac 300 ttaaattcgg gagtcattct ctccatccac cacttggatc acaggtacct ggaactggaa 360 agcagcggcc accggaatga gatcagactg cattaccgct ctggaactca ccgcccgcac 420 acggaagtgt ttccttacat tttggctgat gccaagtggc acaagctctc cttagccttc 480 agtgcctccc acttaatttt acacatcgac tgcaacaaga tctatgaacg agtggtggaa 540 atgccttcta cagacttgcc tctgggcacc acattttggt tgggacagag aaataacgca 600 cacgggtatt ttaagggaat aatgcaagat gtgcaattac ttgtcatgcc ccaggggttc 660 atcgctcagt gcccggatct taatcgaacc tgtccaacat gcaacgactt ccatgggctt 720 gtgcagaaaa tcatggagct gcaggacatt ttatcgaaga cgtcagccaa gttgtctaga 780 gctgaacaac gaatgaacag gctggatcag tgctactgtg agcggacgtg caccatgaag 840 ggaaccacct accgggagtt cgagtcctgg acagacggct gcaagaactg cacatgcttg 900 aatgggacca tccagtgcga gactctggtc tgccctgctc ccgactgccc ggctaaatcg 960 gctccagcgt acgtggatgg caagtgctgt aaggagtgca agtccacctg ccagttccag 1020 gggcggagct actttgaggg agaaaggagc acagtcttct cagcttccgg aatgtgcgtc 1080 ttgtatgaat gcaaggatca gaccatgaag cttgttgaga acgccggctg cccggcttta 1140 gattgccccg agtctcatca gatcgccttg tctcacagct gctgcaaggt ttgcaaaggt 1200 tatgacttct gttctgagaa gcatacatgc atggagaact cagtctgcag gaacctgaac 1260 gacagggcag tgtgcagctg ccgggatggt ttccgggccc tccgggagga caatgcctac 1320 tgtgaagaca ttgacgagtg tgcagagggg cgccattact gccgtgagaa caccatgtgt 1380 gtgaacacac cgggctcttt cctgtgtatc tgccaaacag ggtacatcag aatcgacgat 1440 tactcgtgta cggaacatga cgagtgcctc acaaaccagc acaattgtga cgagaacgct 1500 ttgtgcttta acaccgttgg aggtcacaac tgcgtctgca agcctggcta cactgggaat 1560 ggaaccacgt gcaaagcttt ctgcaaagac ggctgcagaa acggaggtgc ctgcattgct 1620 gccaatgtct gtgcttgccc acaaggcttc accggaccca gctgtgagac agacattgat 1680 gagtgctctg agggctttgt tcagtgtgac agccgtgcca actgcattaa cctgcctggg 1740 tggtaccact gtgagtgcag agatggctac catgacaatg ggatgtttgc accaggtgga 1800 gaatcctgtg aagatattga tgaatgtggg actgggaggc acagctgtgc caatgacacc 1860 atttgcttca acttggacgg tggctacgat tgccggtgtc cccatggaaa gaactgcaca 1920 ggggactgcg tgcacgacgg gaaagtcaaa cacaacggcc agatctgggt gctggagaac 1980 gacaggtgct ctgtgtgttc ctgccagact ggatttgtta tgtgtcgacg gatggtctgt 2040 gactgcgaaa accccacagt tgacctctcc tgctgccctg agtgcgaccc aaggctgagc 2100 agccagtgcc tgcatcaaaa cggggaaacc gtgtacaaca gcggtgacac ctgggtccag 2160 gattgccgtc agtgccgctg cttgcaagga gaagttgact gctggcccct ggcttgccca 2220 gaggtagagt gtgaatttag tgtccttcct gagaacgagt gctgcccacg ctgtgtcacc 2280 gatccttgtc aggctgacac catccgcaat gacatcacca aaacctgcct ggacgagatg 2340 aacgtggttc gcttcactgg gtcttcctgg atcaagcacg gcacagagtg caccctctgc 2400 cagtgcaaga acggccacgt gtgctgctca gtggacccac agtgcctcca ggagctgtga 2460                                                                         2460

Claims (10)

A composition for preventing or treating vesicle stress-related diseases comprising NELL2 (neural tissue-enriched epidermal growth factor-like repeat domain-containing protein) as an active ingredient. The method of claim 1,
NELL2 has a amino acid sequence represented by SEQ ID NO: 1 composition for preventing or treating vesicle stress-related diseases. The method of claim 1,
NELL2 is an increased expression of endoplasmic reticulum chaperone GRP94, calnexin or BiP protein; Increased XBP1 splicing with endoplasmic reticulum stress elimination; Or the composition for the prevention or treatment of vesicle stress-related diseases characterized in that it has an activity to reduce the endoplasmic reticulum stress through increased expression of the anti-cell death factor Bcl-xL. The method of claim 1,
NELL2 inhibits the activity of caspase-3, caspase-7, or PARP, or prevents vesicle stress-related diseases, characterized in that it has an activity of reducing vesicle stress through decreased expression of apoptosis factor CHOP. Therapeutic composition. The method of claim 1,
The vesicle stress-related diseases include type 1 diabetes, type 2 diabetes, Alzheimer's disease, immunoglobulin light chain amyloidosis, Parkinson's disease, amyotrophic lateral sclerosis, ALS), hemodialysis-related amyloidosis, active amyloidosis, cystic fibrosis, sickle cell anemia, Huntington's disease, Creutzfeldt-Jakob disease ( Kreutzfeldt-Jakob disease, familial hypercholesterolaemia, Alpha1-antitrypsin deficiency, cirrhosis, systemic emphysema, cerebral hereditary amyloidoses, Wolfcott-Rallison syndrome, Wolfram syndrome, salt St. bowel disease, colon's disease, ulcerative colitis, the composition for the prevention or treatment of ER to being selected from the group consisting of breast cancer and prostate cancer, stress-related disorders. A composition for preventing or treating vesicle stress-related diseases comprising a vector comprising a polynucleotide encoding a promoter and a NELL2 (neural tissue-enriched epidermal growth factor-like repeat domain-containing protein) operably linked thereto. The method of claim 6,
NELL2 has a amino acid sequence represented by SEQ ID NO: 1 composition for preventing or treating vesicle stress-related diseases. The method of claim 6,
The polynucleotide has a nucleotide sequence represented by SEQ ID NO: 2 composition for the prevention or treatment of vesicle stress-related diseases. The method of claim 6,
The vesicle stress-related diseases include type 1 diabetes, type 2 diabetes, Alzheimer's disease, immunoglobulin light chain amyloidosis, Parkinson's disease, amyotrophic lateral sclerosis, ALS), hemodialysis-related amyloidosis, active amyloidosis, cystic fibrosis, sickle cell anemia, Huntington's disease, Creutzfeldt-Jakob disease ( Kreutzfeldt-Jakob disease, familial hypercholesterolaemia, Alpha1-antitrypsin deficiency, cirrhosis, systemic emphysema, cerebral hereditary amyloidoses, Wolfcott-Rallison syndrome, Wolfram syndrome, salt St. bowel disease, colon's disease, ulcerative colitis, the composition for the prevention or treatment of ER to being selected from the group consisting of breast cancer and prostate cancer, stress-related disorders. 7. The method according to claim 1 or 6,
The vesicle stress is a composition for preventing or treating vesicle stress-related diseases, characterized in that induced by thapsigargin (thapsigargin).

Images