KR20120068235A - Rna aptamers for teichoic acid of staphylococcus - Google Patents

Abstract

PURPOSE: An RNA aptamer to teichoic acid of staphylococcus is provided to detect Staphylococcus and to prevent and treat staphylococcal pneumonia, sepsis, osteomyelitis, staphylococcus lymphocytic enteritis, sitotoxism, SSSS(staphylococcal scalded skin syndrome) and TSS(toxic shock syndrome). CONSTITUTION: An RNA aptamer which specifically binds to teichoic acid of staphylococcus aureus has a base of sequence number 1. A biosensor for detecting staphylococcus aureus contains the RNA aptamer. A pharmaceutical composition for preventing or treating pneumonia, sepsis, osteomyelitis, staphylococcus lymphocytic enteritis, or sitotoxism contains the RNA aptamer. A food additive composition contains the RNA aptamer.

Description

RNA Aptamer for Staphylococcus teichoic acid {RNA APTAMERS FOR TEICHOIC ACID OF STAPHYLOCOCCUS}

The present invention Staphylococcus aureus ) specifically relates to RNA aptamers.

Staphylococcus aureus, also called Staphylococcus aureus, is a pathogen that causes skin infections, soft tissue infections, osteoarthritis, pneumonia, bacteremia, and food poisoning, and has a high morbidity and mortality rate without proper antibiotic treatment. Staphylococcus aureus itself dies when heated at 80 ° C for 30 minutes, but enterotoxin produced by Staphylococcus aureus is not destroyed even when heated to 100 ° C, which can cause food poisoning even when heated food contaminated with Staphylococcus aureus. . Since staphylococcus aureus is widely spread in nature and can be multiplied in various kinds of foods, the causative foods are also very diverse.

Staphylococcus aureus infections frequently occur in nasal spermatozoa and in intensive care units, methicillin-resistant Staphylococcus A ureus , Because of the ease of hospitalization of patients infected with MRSA or colonies, the likelihood of transmission from one patient to another is very high. Therefore, it is important to take appropriate precautions through screening.

Due to this necessity, diagnostic methods for identifying staphylococci, the causative agents of infectious diseases, have been researched and developed for a long time. Significant advances have been made in detecting a large number of microorganisms over the last decade, but current diagnostic methods still require a lot of labor and are low in sensitivity and specificity.

On the other hand, aptamers are short strands of oligonucleotides that form a three-dimensional structure capable of binding to a target material with high affinity and specificity. Most of these aptamers can be used to determine the function of the target protein because it can specifically bind to the target protein as well as efficiently inhibit its function.

Aptamers recognized as replacements for antibodies can be used as components of biosensors that can recognize molecules in detection and analysis systems, just like antibodies. Oligonucleotide-based aptamers have several advantages over protein-based antibodies. First, the aptamer is obtained in vitro, and second, various organic and inorganic materials including toxins can be used as target molecules of the aptamer, and third, specific binding to the target molecule. Once aptamers have been identified and obtained, they can be reproduced with low cost and high batch-consisitency by automated oligomer synthesis. In addition, aptamers are relatively easy to introduce useful functional groups, such as fluorescent molecules or photoreactive groups, and their structure is reversible due to thermal denaturation-renaturation. It can have activity.

Of these aptamers, RNA aptamers select specific RNA molecules, namely aptamers, from random RNA libraries through repeated in vitro screening. RNA libraries are large because of their large library size and in vitro enzymatic reactions. Is superior to other biological or synthetic libraries for screening high affinity aptamers. Thus there is increasing interest in the potential use of RNA aptamers as therapeutic agents and high affinity RNA aptamers can be selected by the SELEX process.

RNA aptamers also have an advantage as inhibitors rather than small chemicals because they provide a broad binding site for the target protein. In addition, pathological protein-protein interactions can be excellent targets for RNA aptamers because high affinity RNA binds to the target protein and interferes with the binding of other proteins in the complex. Moreover, RNA aptamers can be expressed as intramers in cells using RNA vector systems.

Thus, patents for various drugs using such aptamers have been proposed, and Korean Patent Publication No. 2004-14307 proposes an RNA aptamer that promotes coagulation and fibrinolysis. However, the RNA aptamers that specifically bind to teicosic acid staphylococcus are not disclosed.

It is an object of the present invention to provide an RNA degrading enzyme resistant RNA aptamer of teicos acid of Staphylococcus aureus and its use.

The present invention specifically binds to Teicoic acid of Staphylococcus aureus and has an nucleotide sequence of SEQ ID NO: 1, wherein the 2 'hydroxyl group of U (uracil) and C (cytosine) is substituted with a fluorine group. Provide a tamer.

In addition, the present invention provides a biosensor comprising the above RNA aptamer.

In addition, the present invention is a pharmaceutical for the prevention or treatment of staphylococcal pneumonia, sepsis, osteomyelitis, staphylococcal enteritis, food poisoning, staphylococcal thermophilic syndrome (SSSS) and toxin shock syndrome (TSS) containing a stomach RNA aptamer Compositions and food additive compositions.

The RNA aptamer of the present invention is useful for detecting staphylococci by specifically binding to teicos acid of staphylococci, which is a major cause of food poisoning.

The RNA aptamer of the present invention can prevent the corruption of food by specifically binding to staphylococcus and inhibiting its action.

The RNA aptamer of the present invention prevents and treats various diseases caused by Staphylococcus aureus, staphylococcal pneumonia, sepsis, osteomyelitis, staphylococcal enteritis, food poisoning, staphylococcal staphylococcal syndrome (SSSS) and toxin shock syndrome (TSS). It can be usefully used in pharmaceutical compositions.

Figure 1 shows the SELEX method for screening RNA aptamers that bind to teicosan of Staphylococcus aureus.
2 and 3 show the results of real-time PCR to confirm whether the SERNA aptamer clone discovered specifically binds to staphylococcus.
Figure 4 shows the sequencing results of the 6 SERNA aptamer clones discovered.
FIG. 5 shows the results of real-time PCR in order to select optimized aptamers that bind with high affinity to Staphylococcus teichoic acid among SERNA aptamer clones discovered.
6 shows the structure of selected clone # 2 RNA aptamers.

The present invention specifically binds to teicos acid of Staphylococcus aureus, and has a base sequence of SEQ ID NO: 1 in which 2 'hydroxyl groups of uracil (U) and cytosine (C) are substituted with a fluorine group, such as food poisoning. It is useful for the detection of staphylococcus, which is the main cause of the disease, and can prevent the decay of food by specifically binding to staphylococcus and inhibiting its action. The present invention relates to RNA aptamers useful for the prevention and treatment of diseases selected from the group consisting of staphylococcal laceration-like syndrome (SSSS) and toxic shock syndrome (TSS).

Hereinafter, the present invention will be described in more detail.

The RNA aptamer of the present invention specifically binds to teicosic acid of Staphylococcus aureus having a specific structure. Preferably, the RNA aptamer of the present invention has a nucleotide sequence of SEQ ID NO: 1, but is not limited thereto, even if the nucleotide sequence of SEQ ID NO: 1 further includes any base sequence. Anything that can bind can be considered to be substantially the same as the RNA aptamer of the present invention.

In the nucleotide sequence of SEQ ID NO: 1, uracil (U) and cytosine (C) have a 2 'hydroxyl group substituted with a fluorine group. Such modifications are made to produce RNA resistant to RNA degrading enzymes.

Since the RNA aptamer of the present invention specifically binds to staphylococcus, which is one of the main strains causing food poisoning, it is possible to confirm whether staphylococcus is included in foods such as beverages, and the disease is caused by staphylococcus disease. It can function as a sensor to determine if you have streptococcal pneumonia, sepsis, osteomyelitis, staphylococcal enteritis, food poisoning, staphylococcal thermophilic syndrome (SSSS) and toxin shock syndrome (TSS).

In addition, since the RNA aptamer of the present invention can specifically bind to staphylococcus and decrease its function, the pharmaceutical composition comprising the same has various diseases caused by staphylococcus, ie, staphylococcal pneumonia, sepsis, osteomyelitis, and staphylococcus. It can be effective in the prevention or treatment of enteritis, food poisoning, staphylococcal laceration-like syndrome (SSSS) and toxic shock syndrome (TSS).

In addition, the use of the RNA aptamer of the present invention in food additives prevents the growth of Staphylococcus aureus.

Hereinafter, preferred embodiments are provided to help the understanding of the present invention, but it is apparent to those skilled in the art that various changes and modifications can be made within the scope and spirit of the present invention only to illustrate the present invention. Naturally, the modifications belong to the following claims.

Example

Example 1

One. RNA Aptamer  excavation

To prepare the RNA library required to perform the SELEX process, a single oligonucleotide containing 40 bases randomly was used as a template.

 5'-primer (5'-GGTAATACGACTCACTATAGGGAGAGCGGAAGCGTGCTGGG-3 ')

DNA libraries were prepared by PCR with 3'-primers (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3 '). The 5'- primer contains a T7 RNA polymerase promoter portion for synthesizing RNA.

PCR was performed by mixing 0.25 μM 5′-primer, 0.25 μM 3′-primer, 10 × PCR buffer, 200 μM dNTP mixture, and DNA taq polymerase (Finzzyme) 3 units. As a PCR cycle, 10 cycles were repeated under conditions of 30 seconds at 95 ° C, 30 seconds at 58 ° C, and 30 seconds at 72 ° C, and finally, various DNA libraries were prepared at 72 ° C for 7 minutes.

As a template of a DNA library prepared by PCR, an RNA library having various nucleotide sequences was prepared through in vitro transcription using T7 RNA polymerase (Epicentre Technologies). In this case, by the transcription of a template synthesized in vitro using 2 'deoxy 2' fluoro CTP and UTP (Epicentre Technologies) and normal GTP and ATPs and T7 RNA polymerase to prepare RNA resistant to RNA degrading enzyme The fluoro group produced RNA modified with pyrimidine groups every two positions.

Specifically, 20 μl of a DNA library, 5 × transcription buffer, 5 mM DTT, 5 mM ATP, GTP, 2′-F CTP, 2′-F UTP, T7 RNA polymerase, DEPC-H 2 O and reacted at 37 ° C. for 6 hours. RNA library was extracted from 7M urea-8% polyacrylamide gel after treatment with DNaseI (Epicentre Technologies) for 30 minutes at 37 ° C. to remove the DNA used as a template.

The following RNA library sequences obtained are N40, where A, G, C and U represent 40 nucleotides each incorporated in the same mole of position.

(5'GGGAGAGCGGAAGCGTGCTGGGCCN40CATAACCCAGAGGTCGATGGATCCCCCC 3 ').

FIG. 1 shows a schematic diagram of discovering RNA aptamers specific for Staphylococcus aureus using SELEX method and will be described in detail below for discovering RNA aptamers specific for Staphylococcus aureus using Staphylococcus aureus.

The first 300 picomolar teicosane was immobilized in 100 μl immobilization buffer (1% BSA, 1XPBS) in polystyrene 96 wells for 16 hours. After washing twice with 200 μL binding buffer (30 mM TrisHCl, pH 7.5, 150 mM NaCl, 1.5 mM MgCl ₂ , 2 mM dithiothreitol, and 1% BSA), the 300 picomolar RNA library was not treated with teicosan. After 20 minutes at room temperature in the empty well to remove the RNA bound to the well was transferred to the well with the fixed teicosan acid was reacted for 20 minutes at room temperature. After washing three times with 200 μl of binding buffer, 200 μl of DEPC-H ₂ O warmed at 95 ° C. was added to denature RNA bound to teichoic acid. The RNA thus obtained was subjected to reverse transcription-gene amplification and in vitro transcription, and the amplified DNA was cloned after 6 selections, and the nucleotide sequences of 22 clones were analyzed.

Figure 4 shows the results of nucleotide sequence analysis of the number 6 SERNA aptamer clones selected through the above process and the specific nucleotide sequence is as follows.

GGGAGAGCGGAAGCGUGCUGGGCCGGGAAGUUUUGAUACGGCUUCAUGCAAGUAAUGUUUUUAUCAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 2 RNA Aptamer)

GGGGCGGAAGCGUGCUGGGCCAGGAUAGGGGAUGAAGAAAAAAAGAAGGGUGCCGUGGGCGCCAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 4 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCGUGAAGAAAAAGGGGCGGAUUGGGUAGUAGGGAGGAGAUCCAUAACCCAGAGGUCGAUGGAUCCC (Clone # 5 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCUAUGACAUAAGGUGGGCUGGGAAGCUAGAGCAUGUAAGGCAUAACCCAGAGGUCGAUGGAUCCC (Clone # 6 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCACUUGGGGACGACGAGUAGAUAGUAAGGUGGAGACCUGGUCAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 7 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCGUUAAUACGGUGUCUUUUUCGGUCGUGUAUAAAACGGAAUCAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 10 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCUCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGACAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 11 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCUAGGACAGUUCGUCCUCAUUACAUCGCCGCCUAACACAUCCAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 14 RNA Aptamer)

GGGAGGCGGAAGCGUGCUGGGCCUUAGAAGUAGCCUGCUACGCAUGGUCGACUUCAAGAAUCGCAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 16 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCUCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGACAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 17 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCUCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGACAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 19 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCAGUCUGACCACGUAGACAGUUCUAUUACUUUACGUCGAGACAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 21 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCACAGUGUUCUAAUGCGACAAUGGAGUCUGUGGCAAAGUGUCAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 23 RNA Aptamer)

GGGAGAGCGGAAGCGUGCUGGGCCUCUCAGGCCGACAUUACUGAGAACGCGAGGCGUAUUGAAGCAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 24 RNA Aptamer)

GGGAGGCGGAAGCGUGCUGGGCCUUCAAGUAGGGGCGGUUUACUAUCUGGAUCUUGUAGUUAUCAUAACCCAGAGGUCGAUGGAUCCCCCC (Clone # 26 RNA Aptamer)

2. Excavated Aptamers (No. 6 SERNA Aptamers  Binding Assay (Real Time) of Staphylococcus Aureus in Clones PCR  Use)

In order to confirm whether the 6th SERNA aptamer clone specifically binds to Staphylococcus aureus, real-time PCR was performed three times to measure the amount of RNA bound to teichoic acid. The results are shown in FIG. 3, and FIG. 2 shows CT values. Referring to FIG. 2, the CT values of teicosane + 6 RNA aptamer (1) and teicosine + 6 RNA aptamer (2) were calculated to be relatively lower than those of the control groups in 1, 2, and 3 times. Aptamer + PBS 6 indicates 327.4, whereas Aptamer + Teichoic acid 6 shows 1684.4, thus confirming that the selected SERNA aptamer clone binds to teicosan.

Hereinafter, the RT PCR and the real time PCR process performed using the RNA and the initial RNA library where the six SELEX processes are performed will be described in detail.

The RNAs bound to teicosane were obtained by reacting the RNAs of the six SELEX processes with 300 femtomol and teicosane respectively.

After RNA was obtained through phenol extract / ethanol deposition process, DEPC-H2O was added to dissolve RNA, 200 nM 3 'primer was added thereto, heated at 65 ° C for 5 minutes, and RNA and 3' primer were combined at room temperature for 10 minutes.

After adding 1 mM dNTP, 5X RTase buffer, 200 units M-MLV RTase (Finzzyme) for 1 hour at 42 ° C, RTase was inactivated at 95 ° C for 5 minutes. Only one third of the back-transferred single DNA was used as a PCR template.

At this time, real-time PCR (Rotor Gene RG-6000) was used to measure the amount of generated DNA under the following conditions. Specifically, cDNA, 100 nM 5 'primer, 100 nM 3' primer, 10 μl PCR buffer 10 μl, 500 μM After mixing dNTP, 7 μl of 5X RTase buffer, 100XSyber green, and 2 units Taq polymerase (Finnzyme), the mixture was kept at 95 ° C for 5 minutes, and then maintained at 95 ° C for 30 seconds, 58 ° C for 30 seconds, and 72 ° C for 30 seconds. The amount of RNA obtained by repeating 40 cycles was measured.

3. Excavated Aptamer Teikosan  With staphylococcus Combination  Screening through Measurement

Real-time PCR was performed to find optimized aptamers that bind with high affinity to Staphylococcus teichoic acid among SERNA aptamer clones discovered. 5, the ompC aptamer and the excavated RNA aptamer did not show a significant difference in the CT values of clone # 11 RNA aptamer and clone # 18 RNA aptamer, and the relative RNA amount combined was also found to be small. Among RNA aptamer clones, clone # 2 RNA aptamer was confirmed to bind with high affinity to teicos acid of Staphylococcus aureus. It can be expected that clone # 2 RNA aptamer can be used to detect staphylococci by binding to teichoic acid and FIG. 6 shows the structure and sequence of the selected clone # 2 RNA aptamer.

Hereinafter, the real-time PCR experiments performed to find an optimized aptamer that binds to teicosan of staphylococci will be described in detail.

An A16 tail was applied to the 3 'end of selected RNA aptamers and nonspecific RNAs. 10 picomolar of A16 tailed RNA and 100 picomolar of dT (16) -biotin were reacted for 30 minutes in 10 DE DEPC-H2O at room temperature. The bound hybrid RNA was reacted with 1 × ^{10 8} staphylococcus in 200 μl binding buffer (30 mM TrisHCl, pH 7.5, 150 mM NaCl, 1.5 mM MgCl 2, 2 mM dithiotretol and 1% BSA) and precipitated to pellet 400 μl. Washed twice with binding buffer. The obtained RNA was confirmed by real time PCR.

The aptamer sequences capable of binding with a specific and high affinity for teicos acid of staphylococci of the present invention were shown in SEQ ID NO: 1.

<110> Korea Food Research Institute <120> RNA APTAMERS FOR TEICHOIC ACID OF STAPHYLOCOCCUS <130> P-2010-3 <160> 1 <170> KopatentIn 2.0 <210> 1 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Clone 2 <400> 1 gggagagcgg aagcgugcug ggccgggaag uuuugauacg gcuucaugca aguaauguuu 60 uuaucauaac ccagaggucg auggaucccc cc 92

Claims (5)

An RNA aptamer having a nucleotide sequence of SEQ ID NO: 1 that specifically binds to teicosan of staphylococci.
The RNA aptamer of claim 1, wherein the uracil (U) and cytosine (C) of SEQ ID NO: 1 are substituted with a fluorine group with a 2 ′ hydroxyl group.
Biosensor for detecting staphylococcus comprising the RNA aptamer of claim 1 or 2.
Of a disease selected from the group consisting of staphylococcal pneumonia, sepsis, osteomyelitis, staphylococcal enteritis, food poisoning, staphylococcal thermophilic syndrome (SSSS) and toxin shock syndrome (TSS) comprising the RNA aptamer of claim 1 or 2 Prophylactic or therapeutic pharmaceutical composition.
Food additive composition comprising the RNA aptamer of claim 1 or 2.

Images