KR20120051929A - Composition comprising black soybean anthocyanin for the prevention or treatment of neurodegenerative diseases by inhibition of oxidative stress-induced neural cell death - Google Patents

Abstract

PURPOSE: A composition for preventing or treating neural diseases is provided to suppress p-JNK and p-p38 cell apoptosis pathway and to protect neural cells. CONSTITUTION: A composition for preventing or treating neuronal diseases contains anthocyanine derived from black soybeans as an active ingredient. The oxidative stress is caused by H_2O_2. The composition prevents or treats Alzheimer's diseases caused by neural cell apoptosis. The content of anthocyanine is 0.01-1000 ug/ml.

Description

Composition Comprising Black Soybean Anthocyanin for the Prevention or Treatment of Neurodegenerative Diseases by Inhibition of Oxidative Stress-induced Neural Cell Death}

The present invention relates to pharmacological and / or food engineering compositions containing anthocyanins derived from black soybeans, and more particularly to prevent and / or prevent Alzheimer's disease as a disease caused by the death or damage of neuronal cells caused by oxidative stress. The present invention relates to a pharmacological and / or food engineering composition containing an anthocyanin derived from treatable black soybean as an active ingredient.

Anthocyanin is a plant-derived compound belonging to flavonoids and is a water-soluble pigment glycoside present in flowers, fruits, stems, leaves, and roots of plants, including black beans, and belongs to the most unstable compounds among natural products. It is a substance that is easily destroyed by temperature and coexistence with other compounds (Lila MA. 2004. Journal of Biomedicine and Biotechnology , 5: 306-313).

Often present in plant vacuoles, it is a natural pigment that shows the color of purple, red, blue, etc. by the acid concentration of cell fluid, chemical structure of pigment compound, and the state of binding to various metal ions. Anthocyanins are aglycon and It consists of glycosides. Anthocyanins are largely divided into six types of anthocyanins by methylation of hydroxyl groups and the number of characteristic hydroxyl groups, and several hundred types of anthocyanins according to the types of anthocyanin-linked sugars, acyl groups, and binding sites (Lila MA. 2004. Journal of Biomedicine and Biotechnology , 5: 306-313). In particular, black beans, unlike yellow beans, contain anthocyanin pigments in the seed (Bae EA, Moon GS. J Korean Soc Food Sci Nutr , 1997, 26: 203-208).

Anthocyanins are known to be very easy to absorb in the intestinal tract and are known to have several physiological activities (Takanori Tsuda et al. 1999. Archives of biochemistry and biophysics , 368: 361-366; Amorini AM et al. 2003. Free Radic. Res. 37: 453-460) That is, anthocyanins are known to have effects such as anti-aging, antibacterial, mutagenic, powerful antioxidant, cholesterol lowering, and vision improvement. Strong antioxidant activity has been reported to have protective effects on cells and tissues in animal models such as ischemic infarction of the liver and heart or acute inflammation in the lung (Lila MA. 2004. Journal of Biomedicine and Biotechnology , 5: 306-313).

On the other hand, Republic of Korea Patent No. 10-0785466 (Patent Document 1) in the anthocyanin such as cyanidin-3-glucoside, delfitidine-3-glucoside extracted from black soybean is a blood vessel adhesion molecule-1 (VCAM-1), cells It has been reported that it can be used to prevent or treat arteriosclerosis and heart disease by inhibiting myocardial necrosis by inhibiting the expression of endogenous adhesion molecule-1 (ICAM-1) and COX-2, and Korean Patent No. 10-0880876 (Patent Document 2) discloses that the anthocyanin component extracted from the black soybean skin can prevent or treat skin flap and hull-reperfusion injury. In addition, Korean Patent Publication No. 10-2009-0119085 (Patent Document 3) is useful in the preparation of cosmetics for protecting skin damage especially from the fact that anthocyanins derived from black soybeans inhibit apoptosis due to UV irradiation. It is reported that it can be used.

As described above, physiological effects of anthocyanins have been identified in various disease models, but the direct intracellular antioxidant effects of anthocyanins and the indirect antioxidant effects induced by activating Neu1 inhibit or block p-JNK and p-38 MAPK cell death pathways. There is no report on the possibility of developing an active ingredient in a composition for the prevention and treatment of new degenerative cerebral neuropathy diseases derived from natural plants, which can minimize side effects by protecting the.

1. Republic of Korea Patent No. 10-0785466 2. Republic of Korea Patent No. 10-0880876 3. Republic of Korea Patent Publication No. 10-2009-0119085

1. Takanori Tsuda et al. Archives of biochemistry and biophysics, 368: 361-366 2. Amorini A.M. et al. 2003. Free Radic. Res. 37: 453-460 3. Lila MA. 2004. Journal of Biomedicine and Biotechnology 5: 306-313

The present invention has been proposed to solve the above-mentioned problems, an object of the present invention is a pharmacological and / or food containing an anthocyanin derived from black soybeans as an active ingredient having an activity to prevent the death or damage of nerve cells by oxidative stress It is to provide an engineering composition.

Specifically, an object of the present invention is to oxidative stress through oxidative stress-induced oxidative stress through an indirect antioxidant effect due to the neuroprotective effect of anthocyanin derived from black soybean and anthocyanin and an increase in NEU1 activity. It is to provide a composition that can prevent and treat cerebral nervous system diseases by blocking the cell death pathways caused by p-JNK and p-p38 MAPK.

Another object of the present invention is to provide a pharmacological and / or food engineering composition capable of preventing and / or treating a disease of degenerative cranial nerve cells, which may be represented by Alzheimer's disease, as a disease caused by oxidative stress.

Other objects and advantages of the present invention will become more apparent with reference to the drawings and the accompanying drawings.

In the present invention having the above object, neurons were killed by oxidative stress induced by H ₂ O ₂ treated for the neurological disease model, which occurs over the p-JNK and p-p38 MAPK cell death pathways. It was confirmed. Anthocyanins increase the direct antioxidant function and Neu1 expression to increase sialic acid, which acts as a hydrogen peroxide scavenger, thereby inducing the protection of neurons by inhibiting or blocking p-JNK and p-p38 cell death pathways. Invented. These results invented that anthocyanin is a natural plant material capable of preventing and treating degenerative neurological diseases such as dementia caused by oxidative stress.

Therefore, the present invention provides a composition for preventing or treating cerebral nervous system disease by inhibiting neuronal cell death induced by oxidative stress, containing anthocyanin derived from black soybean as an active ingredient.

At this time, oxidative stress is caused by hydrogen peroxide (H ₂ O ₂ ), the composition can prevent or treat Alzheimer's disease caused by the death of nerve cells induced by oxidative stress caused by hydrogen peroxide.

Neuronal cell death may be caused by apoptosis pathway via JNK (Jun N-terminal kinase) or apoptosis pathway via p38 (prtein 38), and may be directly inhibited by anthocyanins derived from black beans and by anthocyanins. Apoptosis pathway or p38 protein via p-JNK (phospho Jun N-terminal kinase) due to indirect antioxidant effects due to increased sialic acid by activated sialidase 1 (NEU1) 38) It is characterized by protecting nerve cells by inhibiting or blocking the cell death pathway via MAPK.

Preferably, the anthocyanin may be contained at a concentration of 0.01 to 1000 μg / ml.

Anthocyanin derived from black soybean according to the present invention inhibits neuronal cell death by inhibiting and blocking p-JNK and p-p38 cell death pathways in oxidative stressed Alzheimer's disease model (human neuroblastoma SK-N-SH). Protects nerve cells

Therefore, the method for producing a composition containing anthocyanin derived from black soybean as an active ingredient identified in the present invention can prevent and treat diseases such as Alzheimer's disease and various degenerative neurological diseases such as muscular dystrophy, Parkinson's disease, and myocardial infarction. It is expected to be.

After all, beverages, herbal preparations, dietary supplements and therapeutic agents containing anthocyanins derived from black soybeans identified in the present invention as effective ingredients have an effect on various degenerative neurological diseases including Alzheimer's disease, and the present invention is of course in the food and pharmaceutical industries. It is invention which can be utilized also in the food industry.

1 is a measure of the inhibition of cell death by anthocyanin derived from black beans against oxidative stress, Figure 1a concentration of hydrogen peroxide (H ₂ O ₂ ) of 0 ~ 25 μM in SK-N-SH cells for 6 hours It shows the effect on the cell viability after treatment dependently, Figure 1b is the result of measuring by MTT assay that inhibited neuronal cell death by oxidative stress after pretreatment with anthocyanin.
Figure 2 shows the anthocyanin inhibitory effect on ROS generation in SK-N-SH induced by H ₂ O ₂ , the cells were pretreated with 0 ~ 25 ㎍ / ㎖ anthocyanin for 2 hours 25 μM H ₂ O _The result of processing ₂ for 6 hours. Intracellular free radical production was detected by the DCF-DA method.
Figure 3 after the pretreatment of 0 ~ 25 ㎍ / ㎖ anthocyanin for 2 hours to SK-N-SH cells treated with 25μM H ₂ O ₂ for 6 hours to determine the expression changes of phosphorylated p-JNK and p-p38 These antibodies were analyzed by Western blot (3a, 3b) and ELISA (3c) analysis.
Figure 4 shows the results obtained by RT-PCR mRNA expression of Neu1 when SK-N-SH cells were treated with 25μM H ₂ O ₂ for 6 hours after 0-25 ㎍ / ㎖ anthocyanin pretreatment for ₂ hours will be.
Figure 5 shows the anthocyanin effect on the increase of HO-1 expression in SK-N-SH induced by H ₂ O ₂ . 5a and 5c are Western blot results of HO-1 after treatment with 25 μM H ₂ O ₂ for 6 hours after the cells were pretreated with 0-25 μg / ml anthocyanin for ₂ hours, and FIGS. 5b and 5d. Are graphs showing the density of the bands shown in the results of FIGS. 5A and 5C, respectively.

The present inventors completed the present invention by studying the physiological activity of anthocyanins obtained from black soybeans and finding that there is a prophylactic and / or therapeutic effect of Alzheimer's disease, which is a representative brain neurological disease caused by oxidative stress.

Specifically, in the present invention, in order to induce oxidative stress in SK-N-SH, a human neuroblastoma, and to confirm the inhibition of neuronal cell death by oxidative stress by anthocyanin derived from black soybean, as well as the survival rate of cells, After measuring the concentration of reactive oxygen species (ROS), we examined how anthocyanins can prevent and improve Alzheimer's disease by protecting neurons against oxidative stress. To investigate the intracellular antioxidant effects of anthocyanin, expression of HO-1 (Heme oxygenase-1) and NEU1 (sialidase 1) was examined. In addition, as a biomarker for identifying a signal transduction system that induces cell death, the expression level of phosphorylated JNK (phosphorous JNK, p-JNK) and phosphorylated p38 (phosphorous p38, p-p38) MAPK was examined. Measured.

According to the present invention, it was confirmed that the intracellular HO-1 increased by oxidative stress was reduced by the direct antioxidant effect of anthocyanin, and anthocyanin increased NEU1 expression to act as an scavenger of hydrogen peroxide. acid), which indirectly has an antioxidant effect. Through these antioxidant effects, anthocyanins protect neurons by inhibiting or blocking the p-JNK and p-p38 cell death pathways induced by oxidative stress, and through this mechanism, Alzheimer's disease, known as senile dementia, It can be used for the prevention and treatment of the same cerebral nervous system diseases.

EMBODIMENT OF THE INVENTION Hereinafter, this invention is demonstrated in detail, referring an accompanying drawing.

The anthocyanins of the present invention are derived from black beans and are preferably purified. Anthocyanins usable in accordance with the present invention include cyanidin-3-glucoside, delphinidin-3-O-glucoside and petunidine-3-glucoside. (petunidin-3-glucoside).

In addition, in the present invention, SK-N-SH, which is a neuroblastoma of humans subjected to oxidative stress by hydrogen peroxide supply, was used as a model of neurological disease caused by oxidative stress.

Oxygen is indispensable for all living things in an aerobic environment, but due to environmental and biochemical factors such as enzymes, metabolism, chemicals, pollutants, and photochemical reactions, only a few percent of this oxygen is active. Superoxide anion radicals (O ₂ ^?- ), Hydroxyl radicals (OH ^?- ) And hydrogen peroxide (H ₂ ) are highly reactive substances called reactive oxygen speicies (ROS). O ₂ ), singlet oxygen ( ¹ O ₂ ) and the like. Reactive oxygen species may irreversibly destroy proteins, lipids, and DNA, which are cellular components of the human body, and various diseases are caused by this process (Chung et al., 2005).

By the way, our body has such a defense against free radicals, for example, superoxide dismutase (SOD), catalase (lacal), or lactoperoxidase (lactoperoxidase), glutathione peroxidase (glutathione peroxidase) Minimize the action of ROS by removing free radicals by the action of antioxidant enzymes such as (peroxidase) and low molecular weight antioxidants such as vitamin C (ascorbic acid), vitamin E (tocopherol), and uric acid can do. However, when these biological defenses fail or are exposed to excessive ROS, they may not be able to easily break down or repair the residual or excess oxygen species, or they may be subjected to oxidative stress. do.

These oxidative stresses result in excessive free radicals and reactive oxygen species such as hydrogen peroxide, which can cause fatal oxygen toxicity in the living body, as well as non-selective and irreversible effects on the cellular components of substrates, proteins, sugars, and DNA. It is known to cause various diseases such as aging, cancer, Alzheimer's disease, brain diseases such as Parkinson's disease, heart disease, ischemia, arteriosclerosis, skin disease, digestive disease, rheumatism and autoimmune diseases by inducing destruction. , CE et al. Ann.Intern.Med . 1987, 107: 526-45; Adelman, R. et al., Proc. Natl. Acad. Sci. USA, 1988, 85 (8): 2706-8, Moran Benhar et al. EMBO Reports , 2002, 3 (5): 420-425).

Degenerative neurodegenerative disorders (neurodegenerative disorders) refers to a variety of diseases associated with nerves, in particular the cranial nerves, in the context of the present invention particularly refers to diseases in which damage to the brain nerve cells caused by oxidative stress. Oxidative stress can be induced by a variety of factors, and the increase in the production of reactive oxygen species in mitochondria has been reported to cause oxidative damage, which is caused by degenerative cerebral neuropathy Alzheimer's disease, dementia, amyotrophic lateral sclerosis, Parkinson's disease, myocardial infarction, and others have been reported to be associated with (Maria Manczak et al. 2006). Hum Mol Genet. 15 (9): 1437-49; P. Hemachandra Reddy, 2006. J. Neurochem. 96 (1): 1-13)

Patients suffering from Alzheimer's disease, a representative neurodegenerative disorder, initially die from short-term memory loss, emotional ups and downs, loss of language skills and long-term memory impairment. To date, no effective method for treating Alzheimer's disease is known, and the extent to which Alzheimer's disease can be prevented to some extent through exercise or balanced diet.

The amyloid hypothesis that the pathogenesis of Alzheimer's disease during neurological disease is caused by the accumulation of amyloid peptides in the brain (amyloid cascade, Selkoe, DJ, Trends Neurosci, 1993, 16: 403-9; Hardy, J., Trends Neurosci, 1997). , 20: 154-9), oxidative stress (Behl, C .. Prog Neurobiol, 1999, 57: 301-323), which is caused by a decrease in the synthesis of the neurotransmitter acetylcholine. Hypotheses (acetylcholine hypothesis, cholinergic hypothesis, Whitehouse, PJ et al., Science 1982, 215: 1237-9), tau hypothesis that initiates Alzheimer's disease due to excessive phosphorylation of tau protein There are several known theories.

The most important pathological feature of Alzheimer's disease is the extensive deposition of amyloid beta peptides (Aβ) consisting of 42 amino acids. In recent years, this constitutes neurite plaques, particularly in areas of the brain that are associated with learning or memory (Soto et. 1994. J Neurochem 63: 1191-1198; Sisodia and Price 1995. FASEB J 9: 366 -370; Forloni et al. 1996. Prog Neurobiol 49: 287-315).

Recent studies have reported that there is a direct link between amyloid deposition (Aβ plaque) and the generation of free radicals, as well as direct oxidative stress, which reports that Aβ plaque is a living animal model or human tissue with Alzheimer's. Free radicals can be produced and suggested that antioxidative therapy may be one of the important methods for treating patients with Alzheimer's disease (McLellan, ME et al. 2003. J. Neurosci. 23: 2212-7 )

Meanwhile, c-JUN binds to c-FOS to form transcription factor AP-1 (Activation Protein 1), which is known as one of the onco-genes, and is activated by phosphorylation by the JNK pathway. . That is, JNK (c-Jun N-terminal kinases) binds to and phosphorylates two serines (Ser63 and Ser73) that form the transcription activation domain of c-JUN.

In addition, even in mitogen-activated protein kinase (MAPK), a representative signaling mediator that mediates various intracellular responses through a series of phosphorylation in response to external stimuli, p38 MAPK is an external stimulus such as cytokines and UV. Activated in response to. p38 MAPK identified four isoforms (p38-α (MAPK14), p38-β (MAPK11), p38-γ (MAPK12 or ERK6) and p38-δ (MAPK13 or SAPK4)), similar to the JNK cell death pathway p38 MAPK is also activated by various external stresses such as inflammatory cytokines, lipopolysaccharides (LPS), and growth factors. To date, known substances such as MKK3 and SEK phosphorylate Thr180 and Tyr182 constituting p38 MAPK to activate p38 MAPK, and activated p38 MAPK phosphorylates / activates MAPK-AP kinase 2 and finally the transcription factor ATF- 2, Mac and phosphorylation is involved in intracellular signaling mechanisms.

Mitogen-activated protein kinase (MAPK), particularly JNK, which is known to be involved in various signal transduction systems due to stress, stimulation of inflammatory cytokines and growth factors, Stimulation is known to cause cell biological responses such as inflammatory reactions, apoptosis, cell necrosis, growth and differentiation through various pathways. In addition, JNK and its downstream DNA-binding transcription factor, p53, are known to be involved in nerve damage and apoptosis (Moran Benhar et al. 2000. EMBO Reports, vol. 3 (5): 420 -425). Among them, ROS is known to play an important role in the regulation of cell death by activating JNK and p38 MAPK (p38). Neuronal cell death is known to cause neurodegenerative disorders (Akterin et al., 2006. Cell Differ. 13: 1454-1465; Karunakaran et al. 2007. FASEB J. 21: 2226- 2236; Nishitoh et al. 2002. Genes Dev. 22: 1451-1464; Nishitoh et al. 2008. Genes Dev. 16: 1345-1355).

Meanwhile, sialidase-1 (Neu1) is known as neuramidase belonging to a group of glycohydrolytic enzymes that remove sialic acid residues from various sialoglyco-conjugated. Neu1 is known to be induced in various biological processes such as infection, proliferation, differentiation, metabolism, etc. Especially, sialic acid (N-acetylneuraminic acid, N-acetylneuraminic acid) isolated by Neu1 activity is a hydrogen peroxide remover. has antioxidative function (hydroji peroxide scavenger) (Lijima et al. 2004. FEBS Lett. 561: 163-166)

In addition, heme oxygenase (HO) is an enzyme that catalyzes the conversion of heme (billiverdin) by cleaving heme during the metabolism of heme (heme), heme oxygenase-1 ( HO-1), heme oxygenase-2 (HO-2), and heme oxygenase-3 (HO-3) exist in three subtypes, which are products of different genes, except for the heme binding domain. There is little similarity in structure or regulatory mechanisms. HO-1, known as heat shock protein 32, is an enzyme induced by stimulation of oxidative stress, cytokines, etc. (Bang et al. 2006. Korean J Anesthesiol. 50 (6): 706-716).

Based on this fact, in the present invention, neurons were killed by oxidative stress induced by H ₂ O ₂ treated for the Alzheimer's disease model, which occurred over the p-JNK cell death pathway and the p38 MAPK cell death pathway. It was confirmed that anthocyanins derived from black soybeans invented to protect neurons by inhibiting or blocking the p-JNK cell death pathway and / or the p38 MAPK cell death pathway. These results can fully support that anthocyanin derived from black soybean is a natural plant material capable of preventing and treating various degenerative neurological diseases including Alzheimer's caused by oxidative stress.

Specifically, in the present invention, using SK-N-SH cell line which is a representative neuroblast model (Lee HJ et al. 2008. Korean J. Phys. Anthropol. 21 (1): 31-40; Chae HS et al. 2002 J. Anat. 35 (6): 509-516), pretreatment with anthocyanins derived from black soybeans prior to treatment with hydrogen peroxide to give oxidative stress significantly reduced cell death, especially 5 μg / When anthocyanin was pretreated at a concentration of ㎖ or more, it was confirmed that more than 95% of neurons survive despite oxidative stress (see FIG. 1B).

In addition, despite the oxidative stress, the concentration of reactive oxygen species (ROS) was significantly reduced in neurons pretreated with anthocyanin derived from black soybean (see FIG. 2), and heme oxygenase, which is known to be expressed by oxidative stress- Expression of 1 (HO-1) was confirmed that not only inhibits and decreases (FIG. 3A) but also significantly inhibits and reduces JNK expression (see FIG. 4A). Based on these experimental results, it was expected that anthocyanins derived from black soybeans could be used as an effective ingredient for preventing or treating Alzheimer's disease by inhibiting the death of neuronal cells caused by oxidative stress. At this time, preferably the anthocyanin derived from black soybean is used in a concentration of 0.01 to 1000 ㎍ / ㎖, preferably 1.0 to 500 ㎍ / ㎖, more preferably 5.0 to 100 ㎍ / ㎖ the physiological effects described above Can be achieved.

After all, the present invention is whether the death of human neuroblastoma SK-N-SH due to oxidative stress can affect degenerative neurological diseases such as dementia and can prevent or treat these diseases and protect neurons by anthocyanin treatment. I found out. Treatment with anthocyanin to SK-N-SH resulted in decreased oxidative stress induction and increased cell viability. Phosphorylated JNK (p-JNK) and Phosphorylation as a biomarker to investigate the signaling effects of anthocyanin's intracellular antioxidant effects on HO1 and Neu1 expression and to induce cell death. The expression level of p38 (phospho-p38) was measured. The present invention confirms that HO-1 increased by oxidative stress is decreased by the direct antioxidant effect of anthocyanin, and anthocyanin increases the expression of Neu1 and increases the sialic acid acting as a hydrogen peroxide scavenger, thereby indirectly having an antioxidant effect. It was confirmed that there is. These antioxidant effects were found to protect neurons by inhibiting or blocking the p-JNK and p-38 cell death pathways induced by oxidative stress.

On the other hand, it was confirmed in the present invention through the inhibition of the expression of enzymes caused by oxidative stress that the anthocyanin derived from black soybean inhibits the degeneration of neurodegenerative neurons caused by oxidative stress, thus the anthocyanin derived from black soybean is for example Alzheimer It can be applied to the prevention and treatment of neurodegenerative neurodegenerative diseases represented by the disease. That is, it can be utilized in pharmaceutical (pharmacological) compositions or food engineering compositions (health functional foods) containing anthocyanins derived from black beans as active ingredients.

For example, pharmacological compositions containing as an active ingredient anthocyanins derived from black soybeans, which inhibit the death of cerebral nerve cells by oxidative stress according to the present invention, are suitable carriers, excipients and diluents commonly used in the preparation of pharmacological compositions. It may further include. At this time, the anthocyanin derived from black soybean identified in accordance with the present invention may be contained in an amount of 0.1 to 50% by weight relative to the total weight of the pharmacological composition for the prevention or treatment of Alzheimer's disease.

Specifically, pharmacological compositions comprising anthocyanins derived from black soybeans according to the present invention each include oral formulations, external preparations, suppositories, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. according to conventional methods. It can be formulated and used in the form of sterile injectable solutions. Carriers, excipients and diluents that may be included in compositions comprising anthocyanins derived from black soybeans include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate , Calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and the solid preparations include at least one excipient such as starch, calcium carbonate, sucrose in the extract. ) Or lactose, gelatin and the like are mixed. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

The pharmacological composition containing the anthocyanin derived from black soybean of the present invention as an active ingredient can be administered to mammals such as mice, mice, livestock, humans, and the like by various routes. All modes of administration may be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine or intracerebroventricular injections.

On the other hand, it can be used as a health functional food as a method of using as a food engineering composition containing anthocyanin derived from black soybean of the present invention as an active ingredient. Examples of foods to which anthocyanins derived from black soybeans according to the present invention can be added include various foods, beverages, gums, teas, vitamin complexes, and health functional foods. At this time, the content of the anthocyanin derived from the black soybean of the present invention in food or beverage may be added at 0.01 to 15% by weight of the total food weight, the health beverage composition is 0.02 to 5g, preferably 0.3 to 1g based on 100 ml Can be added in proportion. Health functional food of the present invention includes the form of tablets, capsules, pills, liquids and the like.

For example, when used as a dietary supplement, in addition to the anthocyanin extract derived from black soybean of the present invention, various flavors or food supplements such as natural carbohydrates may be used. Natural carbohydrates that can be used include glucose, monosaccharides such as fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumartin, stevia extract, synthetic sweeteners such as saccharin, aspartame, and the like can be used. In addition to the anthocyanins derived from black soybean, it can be used in health functional foods, as well as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavoring agents, colorants and neutralizers (cheese, chocolate, etc.) , Pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks and the like. In addition, the extract of the present invention may contain natural fruit juice and fruit flesh for the production of fruit juice beverages and vegetable beverages. These components can be used independently or in combination. The proportion of such additives is not so critical but is generally selected from the range of 0 to about 20 parts by weight per 100 parts by weight of anthocyanins of the present invention.

On the other hand, the component that can be included in the health functional beverage composition containing anthocyanin derived from black soybean according to the present invention is not particularly limited and may contain various flavors or natural carbohydrates as additional ingredients, such as ordinary drinks. For example, examples of natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those mentioned above, natural flavoring agents (tauumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

In conclusion, the anthocyanins derived from the soybeans of the present invention, which have been found to have an activity of decreasing the production of HO-1, p-JNK and p-p38 increased by oxidative stress, are degenerative due to oxidative stress represented by Alzheimer's disease. It may help prevent and treat cerebral nerve cell disease. Putting all the results together, the present invention relates to anthocyanins derived from black soybeans having an activity capable of preventing and treating degenerative brain nerve cell diseases caused by oxidative stress such as Alzheimer's disease and pharmacological or food engineering compositions containing the anthocyanins as an active ingredient. will be.

Hereinafter, the present invention will be described in detail based on the illustrative examples, but the present invention is not limited to the following examples.

Example 1 Experimental Material of the Invention

Anthocyanins extracted from Glycine max (L.) Merr were provided by the RDA laboratory (Dr. ha's laboratory in Rural Development Administration). Eagle's minimal essential medium (EMEM), fetal bovine serum (FBS) and antibiotics (penicillin / streptomycin) were obtained from Gibco BRL (Rockville, MD). Anti-phospho-JNKs (c-Jun N-terminal kinases), anti-phsopho-p38 MAPKs (p38 mitogen-activated protein kinase), and anti-β-actin antibodies were purchased from Cell Signaling Technology (Danvers, MA) and anti-HO -1 was purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). Hydrogen peroxide solution (H ₂ O ₂ ) was purchased from Sigma Aldrich (St. Louis, MO).

Example 2 Cell Culture

Human neuroblastoma SK-N-SH was cultured in RPMI 1640 (Gibco-BRL) containing 10% fetal bovine serum (Gibco-BRL, CA, USA) and 1% penicillin / streptomycin in Korea Cell Line Bank (Seoul, Korea). Incubate at 37 ° C conditions in a 5% CO ₂ incubator. After 48 hours, cells were washed with serum free medium and replaced with medium without FBS 12 hours before anthocyanin treatment.

Example 3: Measurement of Cell Viability

SK-N-SH cells cultured in Example 2 were spread on 96-well plates at a density of 1 X 10 ⁴ cells / well and incubated for 24 hours. 0-25 μg / ml of anthocyanin obtained in Example 1 was pretreated for 2 hours, and H ₂ O ₂ was treated for 6 hours after the medium was removed.

After 6 hours, 20 μl of 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, St. Louis, MO, USA) (2 mg / ml in PBS) After adding to each well and artificial culture for 4 hours, the medium containing MTT solution was carefully removed and dried for 30 minutes. MTT tetrazolium, a yellow water-soluble substrate, was reduced by dehydrogenase action, and blue-purple non-water-soluble MTT formazan was added to 100 μl of Me ₂ SO per well and shaken with a plate shaker for 15 to 20 minutes. The absorbance was measured at a wavelength of 570 nm using an ELISA reader (the absorbance represents the amount of MTT reduced by cells and is proportional to the number of viable cells present in each well).

The cytoprotective effect of anthocyanin against apoptosis induced by hydrogen peroxide (H ₂ O ₂ ) was found to be concentration-dependent from 10 μM when SK-N-SH cells were treated with 1 to 50 μM H ₂ O ₂ . Cells were killed (FIG. 1A).

Subsequently, anthocyanins at concentrations of 1 to 25 μg / ml were pretreated for 2 hours prior to H ₂ O ₂ treatment to determine the effects of anthocyanins against these oxidative stresses on cell viability, followed by 25 μM H ₂ O ₂ Was treated to SK-N-SH cells to induce oxidative stress. Anthocyanin pretreatment increased cell viability in a concentration dependent manner, in particular anthocyanin pretreatment at concentrations of 10 μg / ml or more showed high survival rates of 90% or more (FIG. 1B).

Example 4 Measurement of Intracellular Active Oxygen Species (ROS)

In this example, the DCF-DA method was used to determine whether the production of reactive oxygen species (ROS) of neuronal cell lines was inhibited by anthocyanin to determine whether anthocyanins derived from black beans inhibit oxidative stress.

In order to confirm the presence of oxidative stress in SK-N-SH cells, intracellular ROS levels were measured using 2 ', 7'-dichrolofluorescein diacetate (DCF-DA) as prove. 96-well plates were spread at a density of 2 X 10 ⁴ cells / well and incubated for 72 hours. After pretreatment with 0-25 μg / ml anthocyanin for 2 hours, the medium was removed, and then treated with H ₂ O ₂ for 6 hours. After removing the medium, 50 μM DCF-DA was incubated for 45 minutes, and then the medium containing DCF-DA was removed and washed twice with PBS (X1, pH 7.4). 2,7 dichlorofluorescein fluorescence was measured at 485 nm excitation wavelength and 538 nm emission wavelength.

To investigate the oxidative stress reduction effect induced by H ₂ O ₂ by anthocyanin treatment, first examine whether 25 μM H ₂ O ₂ is treated with SK-N-SH cells and then induces oxidative stress. We examined whether the anthocyanin pretreatment can suppress the oxidative stress induced by H ₂ O ₂ . In order to confirm these results, the amount of intracellular ROS was measured using DCF-DA fluorescence (see FIG. 2).

When the average DCF fluorescence intensity of the control group (H ₂ O ₂ untreated group) was 100%, the 25 μM H ₂ O ₂ treated group was 498 ± 60% for 6 hours without anthocyanin pretreatment (FIG. 2). On the other hand, H ₂ O ₂ treatment after 1, 2, 5, 10 and 25 μg / ml of anthocyanin pretreatment for 2 hours resulted in 455 ± 49%, 330 ± 30%, 271 ± 29% and 222 ± 23%, respectively. ROS accumulation was reduced in a concentration dependent manner compared to the H ₂ O ₂ alone treatment group (FIG. 2).

Example 5 RT-PCR Analysis

1. Intracellular RNA Extraction

After removing the medium, 1 ml of TRIzol Reagent (Invitrogen) was added to each culture well and mixed with a pipette several times to obtain RNA extraction samples from the cultured cells. After standing at room temperature for 5 minutes, 0.2 ml of chloroform per 1 ml of TRIzol solution was added thereto, shaken well for 15 seconds, and further reacted at room temperature for 2-3 minutes. Centrifugation (12,000 × g) at 4 ° C. for 15 minutes separated the top layer of RNA, the middle layer of DNA, and the bottom layer of protein. Carefully separate the upper layer carefully so as not to contaminate the DNA, transfer to another tube, and 0.5 ml of isopropyl alcohol was added and reacted for 10 minutes to precipitate RNA.

Thereafter, after centrifugation (12,000xg) for 10 minutes at 4 ℃ discarded the supernatant, the precipitate was added 1 ml of 75% DEPC-ethanol and shaken several times, and again centrifuged (12,000xg) for 5 minutes at 4 ℃. Again, the supernatant was discarded and the precipitate was dried at room temperature for 5-10 minutes and then dissolved in RNase-free distilled water or 0.1% DEPC distilled water. 5 ml of RNA was added to 995.0 ml of 0.1% DEPC distilled water, and diluted 200 times, and the absorbance was measured at 260 nm and 280 nm. The concentration of RNA was calculated as the absorbance value x 40 μg / ml x (dilution factor) at 260 nm, and when the ratio of absorbance values at 260 nm and 280 nm was 1.6 or more, the next step was performed.

2. cDNA synthesis

SuperScript III Reverse Transcriptase (Invitrogen) was used to produce First-stand cDNA in the present invention. That is, first put oligo (dT) ₁₅ primer (500 μg / ml) into 1 μl PCR tube, then add 1 μl dNTP Mix (10 mM), and finally add RNA (2 μg) and RNase-free water. The volume was adjusted to 12 μl, boiled at 65 ° C. for 5 minutes and immediately cooled on ice. Add 4 μl of 5 X first-strand buffer, 1 μl of RNase-free water, 2 μl of DTT (100 mM) and 1 μl of SuperScript III Reverse Transcriptase (Invitrogen), respectively, and then mix with a pipette. Thereafter, the reaction was carried out at 42 ° C. for 50 minutes and at 70 ° C. for 15 minutes.

3. PCR

PCR was performed to determine the expression of each gene. Primer sequences for amplifying each gene in this example are shown in Table 1.

Primer sequence Sequence ¹⁾ Sense (Forward) Antisence (Reverse) Neu1 TCCAAGGCTGAGAACGACTT (SEQ ID NO: 1) CAACATGGTAGAGGCCACCT (SEQ ID NO: 2) HO-1 TGCGGTGCAGCTCTTCTG (SEQ ID NO: 3) GCAACCCGACAGCATGC (SEQ ID NO: 4) 18S rRNA CGGCTACCACATCCAAGGAA (SEQ ID NO: 5) GCTGGAATTACCGCGGCTGC (SEQ ID NO: 6)

¹⁾ Primer: represented by 5 → 3

^{GoTaq? Green Master Mix, 2X (} Promega, USA) 10 ㎕, Forward Primer (15 μM) , and Reverse Primer (15 μM) for 0.5 ㎕ each, of distilled water 8 ㎕, and a first-strand cDNA synthesis in front of (DNA template) 1 ㎕ was added to the PCR tube and mixed well. Each mixture was pre-denatured at 94 ° C. for 4 minutes, followed by cycles for 30 seconds at 94 ° C. (different annealing temperatures for each primer) for 30 seconds at 72 ° C. and 30 seconds at 72 ° C. (different cycles for each gene). Finally, extension reaction was performed at 72 ° C. for 5 minutes. PCR products were subjected to electrophoresis for 30 hours at 80V on 1.2% agarose gel containing 0.002% ethidium bromide, and then the degree of gene expression was determined by UV light. The intensity of the band was analyzed and quantified by SigmaGel (Jandel Scientific) software. 18S was used as a standard.

Example 6: Western blot and ELISA analysis

Treatment cells were obtained for western blot analysis and homogenized with cold RIPA lysis buffer (upstate biotechnology, USA) containing protease inhibitors (0.1 mM PMSF, 5 μg / ml aprotinin, 5 μg / ml pepstatin A). It was ground in the group and homogenized. Homogenized samples were quantified in the same amount using Lowry protein assay kit (Bio-Rad Laboratories, Inc.), SDS sample buffer (50 mM Tris-HCL, pH 6.8), 100 mM DTT, 2% SDS, 0.1% bromophenol blue , 10% glycerol) was boiled at 100 ℃ for 5 minutes to separate the protein in 10% SDS-PAGE, and then the separated protein was transferred to the PVDF membrane. The PVDF membrane was reacted with Tris-buffered saline (TBS) buffer (0.02 M Tris-HCl, 0.5 M NaCl, pH 7.4) in 5% (w / v) skim milk powder for 1 hour, followed by HO-1 or p-JNK. The antibody and p-p38 MAPK antibody were mixed in the same buffer at a ratio of 1: 250 and reacted at 4 ° C. for one day. Then, the membrane was washed three times for 10 minutes with TBS buffer (TBS-T) containing 0.1% tween 20 to remove the primary antibody, followed by IgG antibody with horseradish peroxidase (HRP) (Calbiochem, USA) (2 Primary antibody) for 1 hour. After washing three times with TBS-T buffer for 10 minutes, the resultant was observed by immersing the antibody-bound protein on the film using an enhanced chemiluminescence (ECL) kit (Amersharm Pharmacia Biotech, UK). ELISA was purchased by the cell signanaling kit and measured by the given protocol.

1. Effects of Anthocyanin Pretreatment on Increased p-JNK and p38 MAPK Expression Induced by H ₂ O ₂

In FIG. 3a, the control is not treated with anthocyanin, 0 is treated with hydrogen peroxide only, the remaining underlined numbers indicate the concentration of pretreated anthocyanins, and the bottom shows the concentration of hydrogen peroxide causing oxidative stress. The lower part of Figure 3a is a Western blot measuring the expression of beta-actin (β-actin), a protein that is continuously expressed regardless of oxidative stress, β-actin confirms that the same amount of the electrophoresis of the protein It was used as a control for. Meanwhile, FIG. 3B is a result of ELISA analysis for p-JNK, and FIG. 3C is a result of ELISA analysis for p-p-38.

As shown, the expression of p-JNK was increased by oxidative stress in the cells, and the anthocyanin treatment group significantly decreased the expression level of p-JNK compared to the H ₂ O ₂ treatment group (FIG. 3A, FIG. 3). 3b). p-p38 MAPK also showed a similar trend with p-JNK (FIG. 3C). This is thought to be the result of indicating that anthocyanin is involved in the p-JNK cell death pathway and the p-p38 cell death pathway to inhibit or block neuronal cell death.

2. Effect of Anthocyanin Pretreatment on NEU1 Expression

Figure 4a is the RT-PCR results for NEU1, Figure 4b is a measure of the density (density) of the band according to the result of Figure 4a. Compared with the treatment with hydrogen peroxide alone, it can be seen that the expression level of NEU1 mRNA was significantly increased when pretreated with anthocyanin.

3. Effects of Anthocyanin Pretreatment on Increased HO-1 Expression Induced by H ₂ O ₂

Heme oxygenase-1 (HO-1) plays an important role in regulating and sensing oxidative stress (Bang and Park, 2006. Korean J Anesthesiol, 50: 706-13). The mRNA and protein expression levels of HO-1 induced by oxidative stimulation were measured to determine whether the anthocyanin has a protective effect on brain cell protection by oxidative stress. Figure 5a is a measure of the mRNA expression amount of HO-1 displayed with the internal standard 18S by RT-PCR, Figure 5b is a measure of the density (density) of the band measured in Figure 5a. On the other hand, Figure 5c is measured by Western blot protein expression of HO-1 compared to beta-actin (β-actin), Figure 5d is a measure of the density (density) of the band measured in Figure 5c. In Figure 5c the bottom is measured by Western blot the expression level of beta-actin (β-actin), a protein that is continuously expressed irrespective of oxidative stress, β-actin confirms that the same amount of protein electrophoresis It was used as a control for. Control is no treatment and 0 is only hydrogen peroxide. The remaining underlined numbers indicate the concentration of pretreated anthocyanins, and the last one represents the concentration of hydrogen peroxide causing oxidative stress.

Induction of oxidative stress by treatment with H ₂ O ₂ significantly increased the mRNA expression of HO-1 compared to the untreated group (see FIGS. 5A and 5C), and an image analysis program (SigmaGel software, Jandel Scientific). , San Rafael, CA), the analysis of the RT-PCR results, it was observed that the amount of HO-1 expression in the anthocyanin treated group compared to the H ₂ O ₂ only group (Fig. 5c, 5d).

In the above, the present invention has been described based on the preferred embodiments of the present invention, but the present invention is not limited to these examples. Rather, one of ordinary skill in the art to which the present invention pertains will readily conceive various modifications and changes based on the embodiments of the present invention. However, it will be further apparent from the appended claims that such modifications and variations are all within the scope of the present invention.

<110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Composition Comprising Black Soybean Anthocyanin for the          Prevention or Treatment of Neurodegenerative Diseases by          Inhibition of Oxidative Stress-induced Neural Cell Death <160> 6 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sense Primer for Neu1 <400> 1 tccaaggctg agaacgactt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense Primer for Neu1 <400> 2 caacatggta gaggccacct 20 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sense Primer for HO-1 <400> 3 tgcggtgcag ctcttctg 18 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Antisense Primer for HO-1 <400> 4 gcaacccgac agcatgc 17 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sense Primer for 18S rRNA <400> 5 cggctaccac atccaaggaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense Primer for 18S rRNA <400> 6 gctggaatta ccgcggctgc 20

Claims (5)

A composition for preventing or treating cerebral nervous system disease by inhibiting neuronal cell death induced by oxidative stress, containing anthocyanin derived from black soybean as an active ingredient.
The method of claim 1,
The oxidative stress is caused by hydrogen peroxide (H ₂ O ₂ ), the composition is a composition for preventing or treating Alzheimer's disease caused by the death of nerve cells induced by oxidative stress induced by hydrogen peroxide.
3. The method according to claim 1 or 2,
The neuronal cell death occurs by a cell death pathway via JNK (Jun N-terminal kinase) or a cell death pathway via p38 MAPK (protein 38 Mitogen-activated protein kinase).

3. The method according to claim 1 or 2,
JNK (Jun N-terminal) due to the direct antioxidant effect of the anthocyanin derived from the black soybean and the indirect antioxidant effect caused by the increase in sialic acid by sialidase 1 (NEU1) activated by anthocyanin A composition for protecting nerve cells by inhibiting or blocking a cell death pathway via kinase or a cell death pathway via p38 MAPK (protein 38 Mitogen-activated protein kinase).
3. The method according to claim 1 or 2,
The anthocyanin is a composition characterized in that it is contained at a concentration of 0.01 ~ 1000 ㎍ / ㎖.

Images