KR20120032320A - Monoclonal antibody recognizing human n-terminally truncated pten-induced putative kinase 1 protein and uses thereof - Google Patents

Abstract

PURPOSE: A monoclonal antibody which recognizes human PINK1 amino terminal-cleaved protein is provided to effectively detect PINK1 in human brain or other organ. CONSTITUTION: A monoclonal antibody recognizes 98th-117th amino acid site from amino acid terminal of PINK1 having amino acids of sequence number 1. The antibody binds with a signal detectable probe. The probe is enzyme, fluorescent material, luminescent material, or radioactive material.

Description

Monoclonal antibody recognizing human N-terminally truncated PTEN-induced putative kinase 1 protein and uses according to the amino terminal cleaved protein of human PIIN1 protein

The present invention relates to a monoclonal antibody which recognizes a truncated amino terminal of human PINK1 protein and its use, and more particularly, to the amino acid of human PINK1 (PTEN-induced putative kinase 1) protein consisting of the amino acid sequence of SEQ ID NO: 1. 98th from the end? It relates to a monoclonal antibody that recognizes the 117th amino acid site and a method for quantifying PINK1 in a biological sample using the PINK1 monoclonal antibody.

Parkinson's disease (PD) is the second most common degenerative neurological disorder with clinical symptoms such as tremor, rigidity, bradykinesia, and postural instability. The cause of Parkinson's disease is not yet known, but it has been suggested as a possible pathogenesis of oxidative stress, mitochondrial dysfunction and protein aggregation (Valente et al . (2004) Science 304, 1158-1160). The development of Parkinson's disease is generally sporadic, but about 15% of cases have a family history. Over the last few decades, several gene mutations have been identified in patients with familial Parkinson's disease (Lesage and Brice (2009) Hum Mol Genet . 18 , 48-59).

PTEN - induced putative Mutations in the kinase 1 ( PINK1 ) gene have been found in autosomal recessive familial Parkinson's disease (Valente et al . (2004) Science 304, 1158-1160). Human PINK1 is a polypeptide of 581 amino acids comprising putative N-terminal mitochondrial targeting signal (MTS). PINK1 encrypts estimated mitochondrial protein kinase having the Ca ^{2 +} / knife module of highly conserved kinase with a serine / threonine kinase with homology to Lin family domain (Valente et al. (2004) Science 304, 1158-1160). Functional studies include maintenance of mitochondrial membrane potentials (MacKeigan et al . (2005) Nat Cell Biol. 7 , 591-600), protection against apoptosis by stressors of cells (Petit et al . (2005) J Biol Chem . 280 , 34025-34032), autophagy formation (Cristofol et al . (2010) Proc Natl Acad Sci USA . 107 , 378-383), and involved in mitochondrial cleavage and fusion (Yang et al. (2008) Proc Natl Acad Sci USA . 19 , 7070-7075, and some important roles of PINK1. Immunogold electron microscopy and biochemical studies showed that the N-terminal part of PINK1 is located in the mitochondrial lining and the C-terminal part containing the kinase domain is directed towards the cytoplasm (Muquit et al . (2006) J Neurochem . 98 . , 156-169). Biochemical analysis showed that full-length PINK1 protein (about 68 kDa) degrades after targeting to mitochondrial membranes to produce smaller fragments of 55 kDa (ΔN 55) or 45 kDa (ΔN 45) size that are N-terminally degraded. Muqit et al . (2006) J Neurochem . 98 , 156-169. The full-length PINK1 protein is preferentially present in the mitochondrial fraction or the Tween-20-insoluble fraction, while the 55-kDa PINK1 protein is found in the cytoplasmic fraction. Of the three isoforms of PINK1, ΔN 55 was highly accumulated in the presence of proteasome inhibitors, indicating that ΔN 55 is degraded by the ubiquitin-proteasome system (Lin and Kang (2008) J Neurochem . 106 , 464-474). Recently, carbonyl cyanide m-chlorophenylhydrazone (CCCP) treatment, which depolarizes the mitochondria by increasing membrane permeability to H ⁺ , is a Hela cell stably expressing Parkin (Hela). cells) have been reported to increase endogenous full-length PINK1 (Derek et al . (2010) PLoS Biol. 8 , 1-21). To investigate the complex endoproteolytic process and degradation of other PINK1 isoforms in the cytoplasm and mitochondria, we created two anti-PINK1 antibodies that specifically recognize full-length or 55-kDa PINK1 fragments. . Using the PINK1-isoform specific antibodies, we investigated the effect of mitochondrial depolarization or proteasome inhibition on intracellular location and metabolism of PINK1 isoform in vitro .

Korean Patent No. 10-0944636 discloses a DJ-1 missing mutant cell line capable of searching for Parkinson's disease pathogen markers, and Korean Patent No. 10-0644364 discloses Parkinson's disease gene marker and Parkinson's disease diagnostic kit using the same. Is disclosed.

The present invention is derived from the above requirements, and the present inventors specifically recognize that a monoclonal antibody made using a peptide consisting of amino acids 98-117 of the human PINK1 protein as an immunogen specifically recognizes only a 55kDa fragment of the human PINK1 protein. By confirming that the present invention was completed.

In order to solve the above problems, the present invention is directed to the 98th? Monoclonal antibodies which recognize the 117th amino acid site are provided.

The present invention also provides a method for quantifying PINK1 in a biological sample using the PINK1 monoclonal antibody.

Since the human PINK1 monoclonal antibody according to the present invention can effectively detect PINK1 of the human brain or other tissues, the disease marker (biomarker) is known as the mechanism by which PINK1 protein is involved in the development of Parkinson's disease or other degenerative neurological diseases is revealed. It may be used as).

1 is a schematic showing the functional domains in PINK1 protein. The immunogen used to produce the antibody (21A8 or MAV21) is indicated by a line at the bottom. Numbers indicate amino acid residues. MTS: N-terminal mitochondrial targeting signal, TM: transmembrane domain, N: N-terminal and C: C-terminal.
Figure 2 shows the isoform of PINK1 produced in cells transiently or stably expressing PINK1 protein. 2A and 2B transiently transfect with pcDNA empty vector (mock), pcDNA-PINK1 (PINK1), pcDNA-PINK1-Myc-His (PINK1-Myc-His), or pRK5-Myc-PINK1 (Myc-PINK1) Western blot analysis of detergent-soluble fractions from Sean HEK 293T cells. Anti-c-Myc antibody was used to detect expressed PINK1 and blots were rerobed with polyclonal anti-PINK1 antibody (MAV21). The full length PINK1 protein (arrow head) was about 65 kDa and the N-terminally degraded PINK1 fragments were 55 kDa (short arrow) and 45 kDa (long arrow). The 45 kDa PINK1 fragment was isolated in duplicate (a). Regardless of the label, the MAV21 antibody only recognized full length PINK1. 2C shows Western blot analysis of the SHSY5Y cell derived detergent-soluble fraction stably expressing PINK-Myc-His. Anti-c-Myc antibodies to the C-terminal label represent two isoforms of full length PINK1 (arrow head) and N-terminally degraded PINK1 protein (short arrow and long arrow). MAV21 antibody recognizes full-length PINK1-Myc-His protein in this stable cell line. 2D shows that the signal of full length PINK1 by MAV21 antibody disappeared after addition of excess PINK1 peptide antigen (amino acids 107-127). A band of 90 kDa (asterisk) cross reacts with MAV21 antibody. Expression of β-actin is shown as a control for protein loading in FIGS. 2A-2D. Standard molecular weight (kDa) is shown on the right.
Figure 3 shows the subcellular fractionation of SHSY-5Y cells stably expressing PINK1-Myc-His. Cells were harvested to prepare cytoplasm- (C) and mitochondrial-rich fractions (M) using fractional centrifugation. 3A shows two isoforms of full length PINK1 (arrow head) and N-terminally degraded PINK1 fragments with Western blots probed with anti-c-Myc antibody (55 kDa (short arrow) and 45 kDa (long arrow)). Is the result. Full-length PINK1 protein was preferentially located in the mitochondrial-rich fractions, while 55-kDa and 45-kDa PINK1 fragments were present in the cytoplasmic and mitochondrial-rich fractions. 3B shows that the same blot reloved with MAV21 antibody allows detection of full length PINK1 protein in mitochondrial-rich fractions. Longer exposures showed weak signals of full length PINK1 protein in the cytoplasmic fraction (FIG. 3B, bottom).
4 shows proteasome degradation of 55-kDa PINK1 fragment. FIG. 4A shows the results of analysis of Western Blot using SHSY-5Y cells stably expressing PINK1 with MG132 (5 μM) for 0.5 to 16 hours and then using anti-c-Myc antibody or MAV21 antibody. N-terminally degraded 55-kDa PINK1 protein accumulated significantly after cell treatment with MG132. Treatment of MG132 for longer than 8 hours resulted in the accumulation of full length PINK1. 4B shows that in HEK293T cells transiently transfected with pcDNA-PINK1-Myc-His, proteasome inhibitor treatment resulted in the accumulation of 55-kDa PINK1 fragment for 3 hours, but not the accumulation of full-length PINK1. . Additional bands above the 55-kDa PINK1 fragment [55 kDa-PINK1- (Ub) _n ] appeared only after proteasome inhibitor treatment. FIG. 4C shows the results of Western blot analysis of cytoplasmic- (C) and mitochondrial-rich fractions (M) of SHSY5Y cells stably expressing PINK1-Myc-His after proteasome inhibitor treatment for 3 hours. 55-kDa PINK1 fragments accumulated in the cytoplasm and mitochondrial fraction after proteasome inhibitor treatment, while mitochondrial expression levels of full length PINK1 were not changed by proteasome inhibition. Additional bands appeared above the 55-kDa PINK1 fragment. 4D shows the results of Western blot analysis of SHSY5Y cell-derived cell lysates stably expressing pcDNA empty vector (mock) or pcDNA solution-His (PINK1-Myc-His). Cell lysates were also prepared in the same stable cell lines as above after treatment with proteasome inhibitors for 3 hours (PINK1-Myc-His / MG132 treatment). PINK1 protein purified from the same stable cell line using a Ni-NTA column (PINK1-Myc-His / Ni-NTA purification) was used as a positive control for the three isoforms of PINK1. Anti-PINK1 monoclonal antibody (21A8) specifically recognizes a 55-kDa PINK1 fragment. In cells treated with proteasome inhibitors, several additional bands [55 kDa-PINK1- (Ub) _n ] were detected above the 55-kDa PINK1 fragment. 4E shows that the signal of 55-kDa PINK1 by 21A8 antibody disappeared after addition of excess PINK1 peptide antigen (amino acids 98-117). Expression levels of β-actin (FIGS. 4A and 4B) or α-tubulin (FIG. 4C) were shown as controls for protein loading and Tom-20 was used as a mitochondrial marker. Standard molecular weight (kDa) is shown on the right.
5 shows the mutation effect of PINK1 on the stability of PINK1 isoform. Using site directed mutagenesis, the amino acid side chains between residues 98 and 101 of pcDNA-PINK1-Myc-His were mutated with opposite properties (hydrophobic to hydrophilic, and vice versa). SHSY-5Y cell-derived cell lysates transiently expressing wild-type or mutant PINK1 constructs were analyzed by Western blot. The expression level of full length PINK1 was reduced in cells expressing mutant PINK1 except PINK1-R98L. In contrast, the expression level of the 55-kDa PINK1 fragment was increased regardless of the position of the mutation. Expression of β-actin was used as a control for protein loading. Standard molecular weight (kDa) is shown on the right. pcDNA empty vector (Mock), wild type PINK1 (PINK1 WT), PINK1 mutant R98 (Ψ +)> L (Φ) (PINK1-R98L); A99 (Φ)> E (Ψ) (PINK1-A99E); V100 (Φ)> D (Ψ-) (PINK1-V100D); F101 (Φ)> C (Ψ) (PINK1-F101C).
6 shows the accumulation of full-length and 55-kDa PINK1 fragments in other cell regions after mitochondrial depolarization. 6a SHSY-5Y cells stably expressing PINK1 were treated with 10 μM CCCP for 0 to 3 hours in DMEM + serum. Total cell lysates were separated by SDS-PAGE and analyzed by Western blot using MAV21 antibody against full length PINK1 and 21A8 antibody against 55-kDa PINK1 fragment. A large increase in full length PINK1 expression level was observed at 30 minutes and lasted for at least 3 hours. An increase in the expression level of the 55-kDa PINK1 fragment was also seen after CCCP treatment. FIG. 6B shows Western blot analysis of total cell lysates derived from SHSY-5Y cells stably expressing PINK1 treated with 10 μM CCCP and / or 5 μM MG132 for 3 hours. Full-length and expression levels of 55-kDa PINK1 increased after CCCP treatment, whereas accumulation of 55-kDa PINK1 fragments appeared after proteasome inhibitor treatment. 6C shows subcellular fractionation of the same cells after treatment for 3 hours with 10 μM CCCP and / or 5 μM MG132. After CCCP treatment, full-length PINK1 accumulated in the mitochondrial fraction (M), while the expression level of the 55-kDa PINK1 fragment increased in the cytoplasmic fraction (C). 6D shows expression of endogenous PINK1 (arrow head) after mitochondrial depolarization. Expression of β-actin was used as a control for protein loading. Standard molecular weight (kDa) is shown on the right. Tom-20 was used as a mitochondrial marker.
FIG. 7 shows the subcellular distribution of PINK1 isoforms in the mitochondria and cytoplasm of SHSY-5Y cells expressing PINK1. 7A shows SHSY-5Y cells transfected with pcDNA-PINK1-Myc-His. Double immunofluorescence was shown for full length PINK1 (FIG. 7A, top row) and 55-kDa PINK1 fragment (FIG. 7B, bottom row). The battlefield PINK1 is co-located in the mitochondria labeled with the mitotracker. A small number of PINK1-positive punctas appeared unco-distributed to the mitotracker-labeling mitochondria (FIG. 7A, arrow). The 55-kDa PINK1 fragment not only co-locates in the mitochondria but also accumulates in the cytoplasm (FIG. 7A, bottom row). 7B shows that full-length PINK1 co-distributes around the nucleus with a 55-kDa PINK1 fragment. Compared to full length PINK1, the 55-kDa PINK1 fragment was more abundant in the cytoplasm and at the periphery of the cells. Endogenous full-length PINK1 was also detected using MAV21 antibody.

In order to achieve the object of the present invention, the present invention is directed from the amino terminus of the human terminal of the amino acid sequence of SEQ ID NO. Monoclonal antibodies which recognize the 117th amino acid site are provided. The monoclonal antibody can specifically recognize only 55kDa fragment of human PINK1 protein. The location of the full-length PINK1 protein to be cleaved to form the 55 kDa fragment is unknown. Since the antibody does not recognize the full-length PINK1 protein but recognizes only 55 kDa, the cleavage site is likely to be in the antigen peptide since the antigen peptide used to construct the antibody includes a determinant newly generated by cleavage of the PINK1 protein.

The monoclonal antibody may preferably be combined with a detection label capable of generating a detectable signal, and the detection label may be an enzyme, a fluorescent material, a luminescent material or a radioactive material, but is not limited thereto.

The term "antibody" is a term known in the art and means a molecule or active fragment of a molecule that binds a known antigen. Examples of active fragments that bind known antigens include Fab and F (ab) ₂ fragments. Such active fragments can be derived from the antibodies of the invention by a number of techniques. For example, purified monoclonal antibodies can be cleaved by enzymes such as pepsin and filtered by HPLC gel. Suitable fractions containing Fab fragments can be collected and concentrated by membrane filtration and the like. A description of general techniques for active fragment separation of antibodies can be found in, for example, Khaw, BA et al., J. Nucl. Med. 23: 1011-1019 (1982). The term “antibody” also includes bispecific and chimeric antibodies.

The term “monoclonal antibody” is a term known in the art and is a highly specific antibody directed against a single antigenic site. Unlike polyclonal antibodies, which typically include different antibodies directed against different determinants (epitopes), monoclonal antibodies are directed against a single determinant on an antigen. Monoclonal antibodies of the invention can be prepared using conventional cloning and cell fusion techniques. For example, an immunogen of interest (antigen) can be administered to wild type or breeding mice (eg BALB / c) to produce natural or human monoclonal antibodies. Such antigens can be administered alone, in admixture with an adjuvant, can be expressed from a vector, and can elicit an immune response as a DNA or fusion protein. Fusion proteins include carrier proteins coupled with peptides intended for an immune response, such as β-galactosidase, glutathione S-transferase, keyhole limpet hemocyanin (KLH), or bovine serum albumin, Carrier proteins are not limited thereto. In this case the peptide acts as a hapten for the carrier protein. The method for producing monoclonal antibody is briefly described as follows. After boosting the animal, the spleen is removed and the spleen cells are extracted by methods known in the art [Kohler and Milstein, Nature 256: 495-497 (1975); and Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1988). The resulting hybridoma cells are cloned by conventional methods, eg, by limiting dilution, and the resulting clones are cultured to produce the desired monoclonal antibody. Monoclonal antibodies have the advantage of improving the selectivity and specificity of diagnostic and analytical assays using antigen-antibody binding, and because they are synthesized by hybridoma culture, they also have another advantage that they are not contaminated by other immunoglobulins. Have

The term “epitope” is a term known in the art and generally refers to the region of the antigen that interacts with the antibody. Epitopes of peptide or protein antigens may be formed from consecutive or discontinuous amino acid sequences of the antigen. Many proteins can contain many epitopes. Epitopes recognized by the antibodies of the invention form an aspect of the invention. Antibodies that recognize specific epitopes can be used in immunoaffinity columns to purify specific epitopes. Since antigenic epitopes are reported to be exhibited by as few as five amino acid residues, terminal truncations of certain epitopes may also be possible.

The term “hybridoma” is known in the art and means a cell formed by fusion of antibody producing cells with immortal cells, such as myeloma cells. The hybridoma cells can continue to supply antibodies.

Monoclonal antibodies of the invention can be produced in animals by inoculating cells expressing PINK1 protein or epitopes thereof by methods known in the art. The protein can be isolated from the cells at various levels of homogeneity by conventional biochemical methods. Synthetic peptides prepared by in vitro synthetic methods and optionally conjugated to heterologous amino acid sequences are also included in the antibody preparation methods of the invention. Animals used for the inoculation may include cattle, sheep, pigs, mice, rats, rabbits, hamsters, goats or primates. Preferred animals for inoculation may include rodents such as mice, rats or hamsters. The most preferred animal is a mouse.

Monoclonal antibodies provided by the present invention are also produced by recombinant genetic engineering methods known to those skilled in the art, and the present invention includes antibodies by the above methods, which are immunologically reactive with epitopes of the PINK1 protein of the present invention. The present invention may also include, but is not limited to, fragments of such antibodies, such as F (ab) and F (ab) ₂ . The fragments are prepared by any method, including but not limited to the preparation of such fragments by proteolytic cleavage, chemical synthesis or genetic engineering methods. The invention may also include single-chain antibodies immunologically reactive with PINK1 protein, prepared by methods known to those skilled in the art. The invention also includes chimeric antibodies comprising light and heavy chain peptides that are immunologically reactive with the PINK1 induced epitopes according to the invention. Chimeric antibodies provided herein include natural antibodies as well as chimeric antibodies prepared by methods of genetic engineering techniques known to those skilled in the art.

Monoclonal antibodies provided in the present invention are produced by hybridoma cell lines, which are also provided by the present invention and prepared by methods known in the art. See Harlow and Lane, Antibodies: A Laboratory. Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988). Hybridoma cell lines immunize each cell of a myeloma cell line with a homogenizing agent of PINK1 protein, including the PINK1 protein itself or a heterologous or fusion protein construct, a membrane comprising the same, a cell encoding the protein, the protein Prepared by fusion with splenocytes derived from animals. Myeloma cell lines used in the present invention include cell lines derived from myeloma of mice, rats, hamsters, primates or humans. As myeloma cells, for example, P3X63Ag8, p3-U1, NS-1, MPC-11, SP-2 / 0, F0, P3x63Ag8. Mouse derived such as V653 or S194 can be used. In addition, cell lines such as R-210 which are rat-derived cells can be used.

Preferred animals from which the spleen can be obtained after immunization can include rats, mice or hamsters, preferably mice. Splenocytes and myeloma cells can be fused using a number of methods known in the art. The fusion method may include, but is not limited to, inoculation with Sendai virus or inoculation with polyethylene glycol (PEG). Monoclonal antibodies produced by hybridoma cell lines can be recovered from cell culture supernatants through in vitro cell growth, or hybridoma cells are injected into animals, most preferably mice subcutaneously and / or intraperitoneally, followed by blood or It can recover from ascite. Hybridoma cells producing monoclonal antibodies against PINK1 according to the present invention are cells in which myeloma cells (line Sp2 / 0-Ag14) are fused to spleen cells producing antibodies to PINK1.

Antibodies of the invention may be coupled with a detectable substance, ie a detection labeling agent, to facilitate detection. Examples of detection labels include various enzymes, prosthesis molecules, fluorescent materials, luminescent materials, bioluminescent materials or radioactive materials, and the like. Detection markers can be directly coupled or coupled to the PINK1 monoclonal antibodies of the invention using techniques known in the art, or indirectly coupled or coupled through intermediates (eg, linkers known in the art). The antibody may be coupled or bound to another monoclonal antibody that recognizes PINK1 protein or to a secondary antibody that is an antibody that recognizes PINK1 antibody. Examples of suitable enzymes are horseradish peroxidase, acetylcholine esterase, peroxidase, alkaline phosphatase, β-D-galactosidase, glucose oxidase, malate dehydrogenase, glucose-6-phosphate Dehydrogenase or invertase and the like; Examples of suitable submolecular complexes include streptavidin / biotin or avidin / biotin; Examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, phycoerythrin or picobiliprotein, and the like; Examples of luminescent materials include luminol, isoleucinol or lucigenin; Examples of bioluminescent materials include luciferase, luciferin or aequorin; Examples of suitable radioactive materials may include, but are not limited to, ¹²⁵ I, ¹³¹ I, ¹¹¹ In, ⁹⁹ Tc ¹⁴ C or ³ H, and the like.

In addition,

i) contacting the biological sample with a PINK1 monoclonal antibody of the invention bound to a detection labeling agent,

ii) quantitatively detecting the immunological complex obtained in step i),

iii) quantifying the immunological complex obtained by contacting the purified PINK1 antigen with the PINK1 monoclonal antibody of claim 1 in combination with a detection marker to obtain a standard curve, and

iv) quantifying PINK1 present in the biological sample by comparing the amount of protein quantified in step ii) with the standard curve obtained in step iii)

It provides a method comprising quantifying PINK1 in a biological sample, using a PINK1 monoclonal antibody. The biological sample may include a biological material including a cell, tissue or biological fluid. In the present invention, numerous immunoassays used to detect and / or quantify antigens are known to those skilled in the art and are described in Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York 1988, 556-612. See.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Materials and methods

Molecular Cloning

Full length human PINK1 cDNA was incorporated into pcDNA3.1-Myc-His (Invitrogen) by restriction enzyme digestion of the pcDNA3.1-PINK1 (+) construct (provided by Dr. Nakamura) using Hind III and Xho I (New England Biolabs). Subcloned. In this original construct, the stop codon is generated by a reverse ATACTCGAGCAGGGCTGCCCTCCATGAGCAG (SEQ ID NO: 2) sequence, which lacks a stop codon allowing the fusion of the myc epitope label and the poly-histidine label to the C-terminus of PINK1. Removed by replacement with the PCR product. The pRK5-Myc-PINK1 construct was provided by Dr. Nick Wood. All constructs were confirmed by sequencing.

PINK1 Polyclonal  Antibody production

Rabbit anti-PINK1 antibody (MAV21) was generated from peptide MAVRQALGRGLQLFRALLLRF corresponding to amino acids 1-21 of mature human PINK1. Peptides were conjugated with BSA protein according to the manufacturer's instructions, and the same amount of peptide conjugate was injected subcutaneously and intramuscularly four times every three weeks. Peptide antiserum was purified using protein-A-agarose (Pierce) according to the manufacturer's instructions.

PINK1  Monoclonal antibody production

Mouse anti-PINK1 monoclonal antibody (21A8) was generated from peptide RAVFLAFGLGLGLIEEKQAE corresponding to amino acids 98-117 of mature human PINK1. Mice were initially injected subcutaneously with 100 μg of protein emulsified in Freund's complete adjuvant and then further subcutaneously injected with 50 μg of protein emulsified in Freund's incomplete adjuvant on days 21 and 42. On day 109, the cells were intraperitoneally injected with 50 μg of protein dissolved in PBS. On day 112 spleens were removed and lymphocytes were fused to myeloma cells (line Sp2 / 0-Ag14) using polyethylene glycol 1500. IgG was purified using Hitrap Protein G Sepharose column (Amersham Biosciences, Piscataway, NJ).

Cell culture and PINK1 Cell lines stably overexpressing

Human neuroblastoma SH-SY5Y and human embryonic kidney HEK 293T cells (ATCC) comprise DMEM containing 10% FBS and 1% (vol / vol) penicillin-streptomycin at 37 ° C., 95% humidity and 5% carbon dioxide conditions (Invitrogen). Stable transfectants expressing PINK1-Myc-His were obtained after transfection of each expression vector in SH-SY5Y human neuroblastoma cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Transfected cells were incubated in large quantities for 20 days in selection medium containing 500 μg / mL G418 (Invitrogen), after which each colony was expanded and screened for protein expression by western blotting. As a control, cell lines stably expressing the pcDNA3.1 empty vector were also made following a similar protocol.

Immune cell chemistry and Confocal  microscope

Cells transiently transfected with various constructs using Superfect (Qiagen) or Lipofectamine 2000 (Invitrogen) and treated according to the manufacturer's instructions were incubated in glass coverslips. Primary antibodies were rabbit anti-PINK1 antibody (MAV21), mouse anti-PINK1 antibody (21A8), mouse anti-Myc antibody (Santa Cruz) and rabbit anti-Tom20 antibody (Santa Cruz). Secondary antibodies were IgG of the appropriate species conjugated with Alexa Fluor 594 or Alexa Fluor 488 (Invitrogen). For mitochondrial labeling, cells were incubated with Mito-Tracker Red CMXRos (Invitrogen) for 45 minutes according to the manufacturer's instructions. Digital images were acquired using a Laser Scanning Microscope (LSM) 700 (Zeiss, Germany). Images were processed using the LSM image browser and the Adobe Photoshop CS3 program (Adobe Inc., CA).

Mitochondrial Fractionation

Separation of the mitochondrial fraction was performed as described in the Mitochondrial Separation Kit (Pierce). Purity of each fraction was determined using anti-Tom20 and anti-β-actin antibodies. Cytoplasmic fractions were concentrated using a centricon YM-10 device (Millipore) according to the manufacturer's instructions. Cytosolic fractions were also prepared using fractional centrifugation, as described by Kegel et al. (2000, J Neurosci . 20 , 7268-7278).

Transfected  Cell to cell Lysate  Manufacture and Weston Blot  analysis

SHSY-5Y and HEK 293T cells were incubated in confluence in 6-cm tissue culture plates. The medium was removed, and the cells were washed twice with ice-cold PBS and then lysed buffer containing a protease inhibitor cocktail (complete, mini-EDTA-free; Boehringer Mannheim) (20 mM Tris HCl pH 7.4, 150 mM NaCl, 1% Triton X-100, 0.1% NP-40, 2 mM EDTA) was lysed and incubated for 15 minutes on ice. The lysate was harvested at 4 ° C and 16,000 × g Centrifuged for 15 minutes. Supernatants were stored and insoluble pellets were resuspended in the same buffer containing detergent and sonicated. Protein concentration was determined by the BCA method (Pierce).

Samples were separated by SDS-PAGE using 10% polyacrylamide gels and transferred to nitrocellulose. The antibody concentration used for Western blot analysis was 1: 500 for rabbit anti-PINK1 antibody (MAV21), 1: 100 for mouse anti-PINK1 antibody (21A8), 1: 1,000 for c-Myc (9E10) antibody (Santa Cruz) , β-actin (Santa Cruz), α-tubulin (Santa Cruz) and Tom20 (Santa Cruz) antibodies were 1: 2,000. As the blocking buffer, 5% milk dissolved in TBST (50 mM Tris, pH 7.5, 150 mM NaCl and 0.01% Tween 20) was used.

Example  1: in the cell PINK1  Full-length and degraded forms of protein Subcellular  location

Human PINK1 is a polypeptide consisting of 581 amino acids comprising a putative MTS at the N-terminus, a transmembrane domain located immediately after the MTS, and a serine-threonine kinase domain at the C-terminus (FIG. 1) (Valente et al . 2004) Science 304, 1158-1160. Zhou et al. (2008, Proc Natl Acad Sci USA . 105 , 12022-12027) suggested that PINK1 spans the mitochondrial envelope, with the N-terminal end inside the mitochondria and the kinase domain towards the cytoplasm. PINK1 has been reported to degrade in cells inside the N-terminal region (Takatori et al . (2008) Neurosci Lett . 430 , 13-17). To confirm this finding, we expressed PINK1 protein in HEK 293T cells, either unlabeled or labeled with myc-His at the C-terminal region. We identified not only 65-kDa full-length PINK protein but also PINK1 digested fragments of 55 kDa and 45 kDa (FIGS. 2A and 2B). 45-kDa PINK1 fragment was analyzed in double bands. In addition, the expression of PINK1 protein in SHSY-5Y neurons showed full length PINK1 and two digested fragments (FIG. 2C). We made a polyclonal antibody against the epitope of PINK1 (MAV21), which recognized only full-length PINK1 protein in a Western blot of HEK 293T or SHSY-5Y cell derived cell lysates expressing human PINK1 protein (FIG. 2D). .

Studies using immunofluorescence and confocal microscopy have found that the PINK1 protein is located in the mitochondria (Beilina et al . (2005) Proc Natl Acad Sci USA . 102 , 5703-5708). Other researchers have reported that the N-terminally degraded form of PINK1 protein is located in the cytoplasm and degraded by the proteasome. To investigate the subcellular location of full-length or N-terminally degraded PINK1 protein, subcellular fractions of cells stably expressing human PINK1 protein were examined by SDS-PAGE and Western blot (FIG. 3). Full-length PINK1 protein was mainly located in the mitochondria (FIG. 3B), whereas two N-terminally degraded PINK1 proteins (55 kDa and 45 kDa) were present in the cytoplasm and mitochondrial fraction (FIG. 3A). The results suggest that 55-kDa and 45-kDa PINK1 proteins are produced by degradation of full-length PINK1 after being located in the mitochondria.

To examine the isoform of PINK1 protein degraded by proteasomes, cells expressing PINK1 protein were treated with MG132 (FIG. 4). N-terminally degraded 55-kDa PINK1 protein was markedly accumulated after SHSY-5Y cells (stablely expressing PINK1-Myc-His protein) for 2 hours with MG132 (FIG. 4A), Full length PINK1 did not accumulate after treatment with proteasome inhibitors. Prolonged treatment of the cells with MG132 for more than 8 hours resulted in the accumulation of full length PINK1 protein, which is probably an indirect effect of signal changes due to proteasome inhibition in the cells. Similarly, HEK 293 cells transiently expressing PINK1-Myc-His protein accumulated 55-kDa PINK1 protein after proteasome inhibitor treatment for 3 hours, but did not accumulate full-length PINK1 protein (FIG. 4B). Interestingly, when the PINK1-expressing cells were treated with MG132, several bands appeared above the 55-kDa PINK1 protein, which was immune responsive to the anti-c-Myc antibody (FIG. 4B). To investigate the subcellular zone in which 55-kDa PINK1 protein was accumulated due to proteasome inhibition, cells stably expressing the PINK1-Myc-His protein were fractionated and cell lysates were analyzed by SDS-PAGE and Western blot. Was investigated (FIG. 4C). Accumulation of 55-kDa protein by proteasome inhibitor treatment was found in mitochondria and cytoplasmic fractions. The 55 kDa band present after proteasome treatment was found only in the mitochondrial fraction. Taken together, the data show that the 55-kDa PINK1 protein present in the mitochondria and cytoplasm is degraded by the ubiquitin proteasome system.

Example  2: 55- kDa PINK  Sites of degradation for proteins ( cleavage site ) And 55- kDa PINK1  Generation of Antibodies That Recognize Proteins Specificly

Most mitochondrial presequences are known to include arginine residues ("R-2 law") at the -2 position from the site of degradation and residues having aromatic side chains at the +1 position (Kitada et al. (2003) J Biol Chem . 278 , 1879-1885). We believe that full-length PINK1 protein is treated by mitochondrial peptidase at a potential cleavage site that is one or two amino acid positions from arginine (residue 98) in the N-terminal transmembrane domain to produce a 55-kDa PINK1 protein. Expected. To produce monoclonal antibodies that specifically recognize 55-kDa fragments of the PINK1 protein, we used a PINK1 peptide corresponding to amino acids 98-117 as the immunogen. Anti-PINK1 monoclonal antibody (clone 21A8) specifically recognized the 55-kDa PINK1 protein fragment (FIGS. 4D and 4E), but was full-length PINK1 present in total cell lysate or PINK1 protein purified by Ni-NTA agarose. Was not recognized (FIG. 4D). Due to proteasome inhibitor treatment, antibody 21A8 recognized additional ladder-like bands on the accumulated PINK1 protein and 55-kDa PINK1 protein. Since this additional band was consistently observed only in two other antibodies after proteasome inhibitor treatment, we assumed that the band was a modified form of 55-kDa PINK1 protein, such as the ubiquitination form of 55-kDa PINK1 protein. .

Assuming that degradation of PINK1 occurs at adjacent sites of the transmembrane domain, we have created a series of mutant PINK1 constructs to modify the degradation of PINK1 at the N-terminus. Using site-directed mutagenesis, we converted the properties of amino acid side chains between residues 98 and 101 from hydrophobic to hydrophilic or vice versa. Total cell lysates from cells transiently expressing wild-type or mutant PINK1 constructs were separated by SDS-PAGE and western blots were performed (FIG. 5). In cells expressing mutant PINK1 protein, the expression level of full length PINK1 was reduced compared to wild type, except for the R98L mutant. In contrast, expression of the 55-kDa PINK1 fragment was slightly increased compared to wild-type protein regardless of the location of the mutation. Taken together, the data indicate that a single amino acid change in the region adjacent to the transmembrane domain may affect the stability of the full-length PINK1 protein, whereas the proteases process the full-length PINK1 to generate a 55-kDa PINK1 fragment. It does not affect sensitivity.

Example  3: PINK1  protein Isoform Subcellular  Mitochondria for location and decomposition Depolarized  effect

The C-terminal portion of the PINK1 protein is towards the cytoplasm at the surface of the mitochondria (Zhou et al . (2008) Proc Natl Acad Sci USA . 105 , 12022-12027). Narendra et al. (2010) recently reported the accumulation of PINK1 in depolarized mitochondria and the potential of Parkin in the presence of only PINK1. To investigate the accumulation of isoforms of PINK1 after mitochondrial depolarization, SHSY-5Y cells stably expressing PINK1-Myc-His protein were treated with CCCP and expression levels of full length or 55-kDa PINK1 protein were measured ( 6). A large increase in full length PINK1 level was observed at 30 minutes and the level continued to increase for at least 3 hours. After CCCP treatment, the level of 55-kDa PINK1 fragment also increased (FIG. 6A). Increased accumulation of 55-kDa PINK1 fragments occurred after proteasome inhibitor treatment, which indicates that accumulation of 55-kDa PINK1 protein after CCCP treatment is not due to dysfunction of the ubiquitin proteasome system secondary to mitochondrial depolarization. Suggest that. We performed similar experiments with CCCP treatment on HEK 293T cells transiently expressing PINK1 and confirmed an increase in full length and 55-kDa PINK1 protein levels (data not shown). Of accumulated full-length or 55-kDa PINK1 protein To examine subcellular location, cells were fractionated into mitochondrial-rich and cytoplasmic fractions after treatment for 3 hours with 10 μM CCCP and / or 5 μM MG132. After CCCP treatment, full-length PINK1 accumulated in the mitochondrial-rich fractions, whereas 55-kDa PINK1 fragments increased preferentially in the cytoplasmic fraction (FIG. 6C). The results suggest that full-length PINK1 protein accumulated in depolarized mitochondria is processed to produce a 55-kDa PINK1 fragment that translocates into the cytoplasm. In contrast, proteasome inhibitor treatment increases the expression level of the full-length PINK1 protein in the cytoplasm and the 55-kDa PINK1 fragment in the mitochondrial-rich fraction. Taken together, the data show that the 55-kDa PINK1 fragment remaining on the surface of the mitochondria and the full-length PINK1 protein in the cytoplasm are degraded by the ubiquitin proteasome system.

To investigate whether the MAV21 antibody recognizes endogenous PINK1 protein, we fractionated wild-type SHSY-5Y cells into mitochondria and cytoplasmic fractions, and cell lysates were examined by SDS-PAGE and Western blot (FIG. 6D). Small amounts of endogenous full-length PINK1 protein were identified in the mitochondrial fraction but not in the cytoplasmic fraction.

Most previous studies have focused on the presence of the 55-kDa PINK1 protein in the cytoplasm (Lin et al. (2008) J Neurochem . 106 , 464-474), while the inventors have found that the fragment is present in the mitochondrial and cytoplasmic fractions. Was observed. To identify the mitochondrial position of the 55 kDa PINK1 protein, we performed immunofluorescence and confocal microscopy using two anti-PINK1 antibodies. One of the antibodies specifically recognizes the full length PINK1 protein (MAV21), and the other specifically recognizes the 55-kDa PINK1 protein 21A8. Full length PINK1 is located primarily in the mitochondria, while 55-kDa PINK1 protein is located in the cytoplasm and mitochondria (FIG. 7).

<110> Industry Academic Cooperation Foundation, Hallym University <120> Monoclonal antibody recognizing human N-terminally truncated          PTEN-induced putative kinase 1 protein and uses <130> PN10162 <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 581 <212> PRT <213> Homo sapiens <400> 1 Met Ala Val Arg Gln Ala Leu Gly Arg Gly Leu Gln Leu Gly Arg Ala   1 5 10 15 Leu Leu Leu Arg Phe Thr Gly Lys Pro Gly Arg Ala Tyr Gly Leu Gly              20 25 30 Arg Pro Gly Pro Ala Ala Gly Cys Val Arg Gly Glu Arg Pro Gly Trp          35 40 45 Ala Ala Gly Pro Gly Ala Glu Pro Arg Arg Val Gly Leu Gly Leu Pro      50 55 60 Asn Arg Leu Arg Phe Phe Arg Gln Ser Val Ala Gly Leu Ala Ala Arg  65 70 75 80 Leu Gln Arg Gln Phe Val Val Arg Ala Trp Gly Cys Ala Gly Pro Cys                  85 90 95 Gly Arg Ala Val Phe Leu Ala Phe Gly Leu Gly Leu Gly Leu Ile Glu             100 105 110 Glu Lys Gln Ala Glu Ser Arg Arg Ala Val Ser Ala Cys Gln Glu Ile         115 120 125 Gln Ala Ile Phe Thr Gln Lys Ser Lys Pro Gly Pro Asp Pro Leu Asp     130 135 140 Thr Arg Arg Leu Gln Gly Phe Arg Leu Glu Glu Tyr Leu Ile Gly Gln 145 150 155 160 Ser Ile Gly Lys Gly Cys Ser Ala Ala Val Tyr Glu Ala Thr Met Pro                 165 170 175 Thr Leu Pro Gln Asn Leu Glu Val Thr Lys Ser Thr Gly Leu Leu Pro             180 185 190 Gly Arg Gly Pro Gly Thr Ser Ala Pro Gly Glu Gly Gln Glu Arg Ala         195 200 205 Pro Gly Ala Pro Ala Phe Pro Leu Ala Ile Lys Met Met Trp Asn Ile     210 215 220 Ser Ala Gly Ser Ser Ser Glu Ala Ile Leu Asn Thr Met Ser Gln Glu 225 230 235 240 Leu Val Pro Ala Ser Arg Val Ala Leu Ala Gly Glu Tyr Gly Ala Val                 245 250 255 Thr Tyr Arg Lys Ser Lys Arg Gly Pro Lys Gln Leu Ala Pro His Pro             260 265 270 Asn Ile Ile Arg Val Leu Arg Ala Phe Thr Ser Ser Val Pro Leu Leu         275 280 285 Pro Gly Ala Leu Val Asp Tyr Pro Asp Val Leu Pro Ser Arg Leu His     290 295 300 Pro Glu Gly Leu Gly His Gly Arg Thr Leu Phe Leu Val Met Lys Asn 305 310 315 320 Tyr Pro Cys Thr Leu Arg Gln Tyr Leu Cys Val Asn Thr Pro Ser Pro                 325 330 335 Arg Leu Ala Ala Met Met Leu Leu Gln Leu Leu Glu Gly Val Asp His             340 345 350 Leu Val Gln Gln Gly Ile Ala His Arg Asp Leu Lys Ser Asp Asn Ile         355 360 365 Leu Val Glu Leu Asp Pro Asp Gly Cys Pro Trp Leu Val Ile Ala Asp     370 375 380 Phe Gly Cys Cys Leu Ala Asp Glu Ser Ile Gly Leu Gln Leu Pro Phe 385 390 395 400 Ser Ser Trp Tyr Val Asp Arg Gly Gly Asn Gly Cys Leu Met Ala Pro                 405 410 415 Glu Val Ser Thr Ala Arg Pro Gly Pro Arg Ala Val Ile Asp Tyr Ser             420 425 430 Lys Ala Asp Ala Trp Ala Val Gly Ala Ile Ala Tyr Glu Ile Phe Gly         435 440 445 Leu Val Asn Pro Phe Tyr Gly Gln Gly Lys Ala His Leu Glu Ser Arg     450 455 460 Ser Tyr Gln Glu Ala Gln Leu Pro Ala Leu Pro Glu Ser Val Pro Pro 465 470 475 480 Asp Val Arg Gln Leu Val Arg Ala Leu Leu Gln Arg Glu Ala Ser Lys                 485 490 495 Arg Pro Ser Ala Arg Val Ala Ala Asn Val Leu His Leu Ser Leu Trp             500 505 510 Gly Glu His Ile Leu Ala Leu Lys Asn Leu Lys Leu Asp Lys Met Val         515 520 525 Gly Trp Leu Leu Gln Gln Ser Ala Ala Thr Leu Leu Ala Asn Arg Leu     530 535 540 Thr Glu Lys Cys Cys Val Glu Thr Lys Met Lys Met Leu Phe Leu Ala 545 550 555 560 Asn Leu Glu Cys Glu Thr Leu Cys Gln Ala Ala Leu Leu Leu Cys Ser                 565 570 575 Trp Arg Ala Ala Leu             580 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 atactcgagc agggctgccc tccatgagca g 31

Claims (5)

98th from the amino terminus of the human PINK-induced putative kinase 1 protein consisting of the amino acid sequence of SEQ ID 1; Monoclonal antibody which recognizes 117th amino acid site. The monoclonal antibody of claim 1, wherein the antibody specifically recognizes only a 55kDa fragment of human PINK1 protein. The monoclonal antibody according to claim 1, wherein the antibody is bound to a detection label capable of generating a detectable signal. The monoclonal antibody according to claim 3, wherein the detection labeling agent is an enzyme, a fluorescent substance, a luminescent substance or a radioactive substance. i) contacting the biological sample with the PINK1 monoclonal antibody of claim 1 bound to a detection label,
ii) quantitatively detecting the immunological complex obtained in step i),
iii) quantifying the immunological complex obtained by contacting the purified PINK1 antigen with the PINK1 monoclonal antibody of claim 1 in combination with a detection marker to obtain a standard curve, and
iv) quantifying PINK1 present in the biological sample by comparing the amount of protein quantified in step ii) with the standard curve obtained in step iii)
A method of quantifying PINK1 in a biological sample, comprising a PINK1 monoclonal antibody.

Images