KR20120002013A - A dna micro-array chip-based method for rapid and specific detection of spoilage bacteria - Google Patents

Abstract

PURPOSE: A DNA microarray for detecting microorganism causing food spoilage is provided to be used in hybridization and to shorten time for diagnosis. CONSTITUTION: A method for manufacturing a DNA microarray for detecting bacteria causing food spoilage comprises: a step of isolating genome DNA from Alicylobacillus sp. strain; a step of cleaving the genome DNA and isolating DNA fragments of 100-500bp; a step of performing ligation of the DNA fragments with a vector for a library; a step of isolating plasmid DNAs from a colony and performing PCR; a step of purifying the probe; and a step of fixing the probe to a support.

Description

Diagnosis DNA chip for rapid simultaneous detection of causative agents of food rot {A DNA micro-array Chip-based method for rapid and specific detection of spoilage bacteria}

The present invention relates to a DNA microarray capable of quickly detecting a causative microorganism causing food deterioration and quality deterioration and a method of manufacturing the same.

Research on the improvement of food quality and safety has been continuously conducted. The methods of detecting microorganisms in related foods include the method of diagnosing indicator microorganisms for evaluating the microbiological quality of food and the dynamics of specific bacteria. There are tests to identify the specific causative organism for the investigation. As a general identification method, in order to overcome the disadvantages of the microbial culture method, immunological methods such as fluorescent antibody, ELISA or agglutination assay, or molecular genetic methods using Polymerase chain reaction (PCR) were used.

However, PCR has a problem in detecting multiple food poisoning bacteria because of the limited number of primers used. In addition, there is a possibility of showing false-positive or false-negative by similarity or diversity of DNA sequences among similar genus strains. Microarray experiments based on DNA sequences have been used for experiments such as gene expression, genotyping and singlenucleotide polymorphism (Chizhikov et al. 2002. J. Clin. Microbiol. 40: 2398). -2407). In addition, the microarray test method has been proposed as a new method for detecting food poisoning bacteria due to the potential of detecting multiple food poisoning bacteria in one experiment (Alkhaldi et al. 2002. J. AOAC Int. 85: 906-910).

Currently, the development of a diagnostic kit for diagnosing various microorganisms at the same time is incomplete, and even in the case of using multiplex PCR, it is difficult to diagnose five or more strains at the same time.

In addition, most of the rapid diagnostic methods currently developed include amplifying the specific genes of microorganisms, which is possible only when information on a large amount of microbial genes is available.

Conventional DNA chip technology is one of the functional tools of functional genomics. It is a groundbreaking technology that searches for gene expression patterns using DNA molecules whose base sequence is known. However, in Korea, the study of DNA chip is mainly applied to a large amount of gene expression patterns, and microbiological diagnosis and application research using DNA chip technology is insignificant.

Recently, cDNA and oligonucleotide microarray techniques have been applied to the analysis of pathogenic microorganisms (Burton et al. 2005. Molecular and Cellular Probes. 19: 349-357) and can detect four food poisoning bacteria with one chip. Studies have been reported (Sergeev et al. 2004. Biosensors and Bioelectronics. 20: 684-698). Probes made in these previous studies were constructed from microbial flagelline genes or virulence genes (including pathogenic genes), 16S rRNA or 23S rRNA sequences. However, these target genes share their sequence among microorganisms of the same genus, which is likely to result in cross-hybridization. In addition, in these studies PCR is performed prior to hybridization, which is limited to the number of available probes, which makes it difficult to detect a large number of pathogens (Chizhikov et al. 2001. Appl. Environ. Microbiol. 67: 3258). -3263).

Most microbial diagnostic methods using DNA chips have been studied for the purpose of detecting specific microorganisms, so it is still impossible to diagnose various microorganisms simultaneously.

The present invention is to solve the above problems and the object of the present invention as the object of the present invention is to develop a DNA chip that can detect the bacteria quickly by specifically operating the presence or absence of microorganisms that deteriorate food quality It is.

The present invention to achieve the above object

a) extracting genomic DNA from the strain of genus Alicyclobacillus; b) cleaving the extracted genomic DNA to separate DNA fragments of 100 to 1500 bp; c) connecting the vector for library and the cut genomic DNA to colonies. D) extracting the plasmid from the obtained colonies and performing PCR after purifying the probe from the PCR product; And e) provides a method for producing a DNA microarray for simultaneous detection of food rot causing bacteria comprising the step of fixing the purified probe to the support.

In one embodiment of the invention, the Alicyclobacillus genus strain is preferably one or more strains selected from the group consisting of Alicyclobacillus acidoterrestris, Alicyclobacillus cycloheptanicus, and Alicyclobacillus acidocaldarius, but is not limited thereto.

In another embodiment of the present invention, the cutting in step b) is preferably performed by cutting the extracted genomic DNA with different types of restriction enzyme pairs, and the different types of restriction enzyme pairs are EcoRI / BamHI, HindIII. More preferably, it is one or more restriction enzyme pairs selected from the group consisting of / XhoI, and HindIII / SacII.

In another embodiment of the present invention, it is preferable to perform the linkage between the library vector of step c) and the cleaved genomic DNA so that the T3 / T7 sequence is located on both sides, and the T3 / T7 sequence is ( T3: ATT AAC CCT CAC TAA AGG GA; SEQ ID NO 1, T7: TAA TAC GAC TCA CTA TAG GG; SEQ ID NO 2)

It is more preferred to have the nucleotide sequence described in SEQ ID NO: 1 and SEQ ID NO: 2, but is not limited thereto.

In one embodiment of the present invention, the PCR is preferably performed using a T3 / T7 primer, and more preferably, the T3 / T7 primer has a nucleotide sequence described in SEQ ID NO: 1 and SEQ ID NO: 2 Not.

In one embodiment of the present invention, the step of purifying the probe from the PCR product is preferably performed using a restriction enzyme pair applied in step b), but is not limited thereto.

In one embodiment of the present invention, the library vector preferably has a cleavage map as described in FIG. 7, but is not limited thereto.

In one embodiment of the present invention, the support is silicon, glass, germanium, ceramic, silicon, semiconductor material, PTFE, carbon, polycarbonate, mica, plastic, quartz, polystyrene, gallium arsenide, metal, metal alloy It is preferably, but not limited to, a material selected from the group consisting of, and fabrics.

In addition, the present invention provides a DNA microarray for simultaneous detection of food spoilage pathogens produced by the method for producing a DNA microarray for simultaneous detection of food spoilage bacteria of the present invention.

In one embodiment of the present invention, the micro array preferably further includes a positive control and a negative control, but is not limited thereto.

In one embodiment of the present invention, the positive control used the MJ1 sequence of the bacteriophage, the negative control is preferably used but not limited to Peroxisome proliferator activated receptor (PPAR) -gamma.

In one embodiment of the present invention, the MJ1 sequence of the bacteriophage has a nucleotide sequence shown in SEQ ID NO: 3 and / or 4, the negative control sequence preferably has a nucleotide sequence shown in SEQ ID NO: 5 and / or 6 It is not limited to this.

Positive ctrl . MJ1 5'- cgggatccatgaaacgtgcagcattg -3 '(SEQ ID NO: 3) 5'- cgggaattcaccgaatgcatgttcgta -3 '(SEQ ID NO: 4) Negative ctrl . PPAR -gamma F 5'- CATTCTGGCCCACCAACTTTGG  -3 '(SEQ ID NO: 5) R 5'- TGGAGATGCAGGCTCCACTTTG  -3 '(SEQ ID NO: 6)

Table 1 is a table of positive and negative controls and their sequences.

In another aspect, the present invention provides a method for detecting the cause of microorganisms of food rot to determine the presence or absence of food rot causing bacteria at a time through the random priming method and hybridization using the microarray of the present invention.

In one embodiment of the present invention, the microorganism causing the food spoilage is preferably Alicyclobacillus strain, but is not limited thereto.

In one embodiment of the invention, the food is preferably a fruit juice, but is not limited thereto.

Hereinafter, the present invention will be described.

The present invention extracts genomic DNA from the pure culture of microorganisms without information on the genetic nucleotide sequence of the microorganisms that cause food corruption and quality degradation to be detected, build a random genomic DNA library according to this, and produce a DNA chip as a product of the library Through random priming and hybridization methods, it is possible to detect specific microorganisms and to develop a DNA micro array useful for detecting or analyzing specific microorganisms in a food product.

The present invention, Alicyclobacillus spp. Is found in a lot of fruit juices, especially known to cause decay or reduce the quality of food. The microorganisms were used, and genetic chips developed to be useful for detecting or analyzing specific microorganisms in foods in circulation.

Considering that the present invention is generally widely used for analyzing genomic DNA microorganisms, it is determined that random genomic DNA cut and fragmented by restriction enzyme pairs can also be used as specific information on the microorganism. If you can, you can save a lot of time, labor, money and effort for individual microbial diagnosis.

In addition, if a particular microorganism can be detected on a DNA chip through fragments of random genomic DNA, it may be a chance to change the view of DNA chip production that only DNA having a specific base sequence should be used. Not only can DNA shorten the time required for diagnosis by using a hybridization reaction without amplification using PCR, but also the DNA chip to be developed according to the present invention does not need sequence information to prepare specific probes. You can save time and money.

In addition, it is possible to solve the potential non-specific hybridization problem that appeared in the method using the existing 16S rDNA as a probe by using a combination of a plurality of random probes can reduce the error due to cross-reaction.

The present invention is described in detail as follows.

The present invention extracts genomic DNA from the pure culture of the microorganisms without information on the gene sequence of the decay-causing microorganisms to be detected, and fabricates a DNA chip using a random genomic DNA fragments probe.

Thereafter, the present invention relates to a method of constructing a DNA micro array useful for detecting or analyzing a specific microorganism in an ecological sample by determining the presence of a specific microorganism through random priming and general hybridization.

First, the process of producing a DNA micro-arry for detecting microorganisms causing food corruption according to the present invention is as follows.

1) Purely cultivate the causative microorganisms to be detected and extract genomic DNA from it.

2) Double digestion of the extracted genomic DNA with three pairs of restriction enzymes, and then separate them into 100 ~ 500bp, 500bp ~ 1kb, 1kb ~ 1.5kb using gel extraction method.

3) Using random genomic DNA fragments obtained in step 2), construct a random genomic DNA library using a vector containing T3 / T7 sequence.

4) Using colony obtained from the constructed library, colony pcr is carried out, and DNA chips are produced after QC obtained products.

5) As a purely purified product, a DNA chip with spotted microorganisms is manufactured and completed.

The produced DNA chip is composed of three kinds of microorganisms causing decay: Alicyclobacillus acidocaldarius (ATCC 43030), Alicyclobacillus acidoterrestris (ATCC 49025), and Alicyclobacillus cycloheptanicus (ATCC 49029).

Through the random priming and hybridization methods generally used using the DNA chip thus prepared, it is confirmed whether the microorganisms causing the decay in the DNA chip are detected.

As can be seen through the present invention, the DNA microarray for detecting the cause of microorganisms of corruption using the random genomic probe according to the present invention can accurately detect microorganisms that cause deterioration of food quality and cause corruption, as well as specific genes of individual microorganisms. However, the use of nonspecific gene fragments will eliminate the need for detailed analysis of microbial genes. It can also be used for hybridization reactions to shorten the time it takes to diagnose, and there is no need to worry about errors caused by cross reactions. Therefore, it is expected that the present invention can contribute a lot to economic aspects and public health.

1 shows a DNA micro-array design fabricated using a probe of random genomic DNA according to the present invention.
2 is a detection result of Alicyclobacillus acidocaldarius (ATCC 43030) using a DNA micro-array according to the present invention.
3 is a detection result of Alicyclobacillus acidoterrestris (ATCC 49025) using a DNA micro-array according to the present invention.
4 is a detection result of Alicyclobacillus cycloheptanicus (ATCC 49029) using a DNA micro-array according to the present invention.
5 is a result of detection using DNA in the same strain and different Genus having a different number using the DNA micro-array according to the present invention. 5A shows Alicyclobacillus acidoterrestris ATCC 49027, FIG. 5B shows Alicyclobacillus cycloheptanicus ATCC 49028, FIG. 5C shows Alicyclobacillus acidocaldarius ATCC 27009, FIG. 5D shows Bacillus cereus F381284, and FIG. 5E shows Bacillus subtilis ATCC 6633 strain.
6 is Alicyclobacillus spp. Bacteria that cause rot in orange juice in a DNA micro-array according to the present invention. Genomic DNA is extracted and detected. FIG. 6A shows Alicyclobacillus acidocaldarius ATCC 43030, FIG. 6B shows Alicyclobacillus acidoterrestris ATCC 49025, and FIG. 6C shows Alicyclobacillus cycloheptanicus ATCC 49029.
7 is a diagram illustrating a cleavage map of a vector for a library.

The present invention will now be described in more detail by way of non-limiting examples. However, the following examples are set forth to illustrate the present invention and the scope of the present invention is not to be construed as being limited by the following examples.

Example  One

In order to confirm the present invention, in particular, the experiment was carried out as detectable in Alicyclobacillus acidocaldarius (ATCC 43030), Alicyclobacillus acidoterrestris (ATCC 49025), and Alicyclobacillus cycloheptanicus (ATCC 49029), which are known as causative agents of deterioration and rot in fruit juices.

Three microorganisms were purely cultured and a random genomic DNA library was constructed as follows.

First, genomic DNA was extracted from the microorganism obtained through pure culture using Nucleogen Genomic DNA flexible kit. The extracted genomic DNA 2ug was double digested with three different pairs of different restriction enzymes (EcoRI / BamHI, HindIII / XhoI, HindIII / SacII). Genomic DNA cut by each restriction enzyme pair was gel loaded with 50% electrophoresis with 1% agarose gel, and then cut from 100-500bp, 500bp-1kb, 1kb-1.5kb based on 100 bp size marker. And recovered using an RBC gel extraction kit. To construct a random genomic DNA library, pPCR-Script Amp vector [STRATAGENE, USA] double digested with the same restriction enzyme pair was prepared. At this time, both sides of the vector cut by the restriction enzyme are positioned so that the T3 sequence and the T7 sequence are located. In addition, S.A.P treatment was performed to prevent self ligation of the vector during cloning. Random genomic DNA fragments cut and recovered with restriction enzymes were also ligation with the vector prepared with the same restriction enzyme pair.

After ligation, the cells were transformed into competant cells (E. coli DH5α), and then placed on agar plates containing IPTG + X-gal on LB agar plates containing empicillin antibiotics. Pure colonies transformed by white and blue selection were obtained. Approximately 30 to several hundred colonies are obtained from random genomic DNA framents cut out from one restriction enzyme pair. Among them, pure colonies separated by white and blue selection were randomly selected and colony PCR was performed using T3 / T7 primers. Was performed. (Preheated at 95 ° C. for 5 minutes, 30 cycles at 94 ° C., 30 seconds at 57 ° C., 30 seconds at 72 ° C., and then allowed to stand for 5 minutes at 72 ° C. After PCR, the PCR product was purified.

The purified probes were integrated with 52 Alicyclobacillus acidocaldarius (ATCC 43030), 50 Alicyclobacillus acidoterrestris (ATCC 49025) and 47 Alicyclobacillus cycloheptanicus (ATCC 49029) on amine-coated glass slide glass. Meanwhile, the positive control probe used MJ1 sequence of bacteriophage. See FIG. 1.

In order to confirm the specific detectability of each microorganism, genomic DNA (50 ng) of the microorganism to be detected was random priming using Cy3-dCTP. Random priming was performed using Roche's Random Primed DNA Labeling kit. The random priming reaction solution included random hexamers, dNTPs, Klenow fragments, and buffers, and 1 µl of 25 nM Cy3-dCTP in a total 20 µl reaction. .

To obtain a reference signal, genomic DNA (50 ng) was priming with Cy5-dCTP in three microorganisms: Alicyclobacillus acidocaldarius (ATCC 43030), Alicyclobacillus acidoterrestris (ATCC 49025), Alicyclobacillus cycloheptanicus (ATCC 49029), and Alicyclobacill cycloheptanicus. Positive control was added 10ng to Test and Reference respectively.

Random priming reaction was proceeded for 10 minutes at 98 ℃, 2 hours at 37 ℃ and heated at 65 ℃ 10 minutes. Each fluorescently labeled random probe reaction solution (Cy3-dCTP, Cy5-dCTP) obtained here was mixed and purified by a PCR purification kit to obtain a fluorescently labeled probe. 2.5 μl of hybridization solution (6 × SSC, 0.2% SDS, 5 × Denherdt's solution, 0.1 mg / ml of denatured salmon sperm DNA) was made and heated at 100 ° C. for 2 minutes. Prehybridization DNA (1.75 X SSC, 0.1% SDS, 10 mg / mL of bovine serum albumin) was washed with DNA micro array for 30 minutes in a solution preheated at 65 ° C for 30 minutes and then immersed in distilled water for 5 minutes. It was. After washing, the DNA micro array was dried by centrifugation at 3500 rpm for 3 minutes. After covering the cover slide glass on the DNA micro array, a solution containing 12.5 μl of the probe dissolved in the gap between the cover glass and the chip was injected and reacted for 16 hours in a 65 ° C. hybridization chamber.

After completion of the reaction, the DNA micro array was immersed in 2 X SSC to remove the cover glass, washed with 2 X SSC and 0.2% SDS solution preheated to 65 ° C for 10 minutes, and twice for 5 minutes with 0.05 X SSC solution. The process was performed at 3500 rpm for 3 minutes. The dried DNA micro array was scanned with a scanner (GenePix 4000B) and the hybridization results were confirmed.

As a result of the DNA micro array experiment, the target Alicyclobacillus acidocaldarius (ATCC 43030) was identified from the hybridization results of Cy3-dCTP containing only Genomic DNA of Alicyclobacillus acidocaldarius (ATCC 43030). Therefore, specific hybridization was confirmed only in the genomic DNA of the specific microorganism. [See FIG. 2]

Example  2

Alicyclobacillus acidoterrestris (ATCC 49025) strain was carried out in the same manner as in Example 1. The genomic DNA of the target microorganism was extracted and 50 ng of genomic DNA was detected by random priming to detect it. It was confirmed that the detection was specifically detected only in the part where the Alicyclobacillus acidoterrestris (ATCC 49025) probe was planted. See FIG. 3.

Example  3:

Alicyclobacillus cycloheptanicus (ATCC 49029) strain was carried out in the same manner as in Example 1,2. Genomic DNA of the desired microorganism was extracted and 50 ng of genomic DNA was detected by random priming and detected, and it was confirmed that it was specifically detected only in the part where Alicyclobacillus cycloheptanicus (ATCC 49029) probe was planted. See FIG. 4.

Example  4:

In order to check whether the fabricated DNA micro array works specifically, three existing alicyclobacillus spp. In addition to microorganisms, there are two strains of different strains: Alicyclobacillus acidocaldarius (ATCC 27009), Alicyclobacillus acidoterrestris (ATCC 49027), and Alicyclobacillus cycloheptanicus (ATCC 49028). Using Bacillus subtilis ATCC 6633, Bacillus cereus F3812, the experiment was conducted in the same manner as in Example 1.

In the same pure culture, genomic DNA was extracted from five microorganisms,

50 ng of genomic DNA to be tested was randomly primed with Cy3-dCTP. See FIG. 5.

5 it can be seen that the detection chip produced according to the present invention can detect only a specific microorganism of interest.

Example  5:

By using the DNA micro-array according to the present invention, Alicyclobacillus spp. Genomic DNA is extracted and detected.

As can be seen in Figure 6, it can be seen that the antimicrobial detection chip produced by the present invention can be detected even when applied to the actual food (juice).

<110> KOREAN UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> A DNA micro-array Chip-based method for rapid and specific          detection of spoilage bacteria <160> 6 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> T3 <400> 1 attaaccctc actaaaggga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> T7 <400> 2 taatacgact cactataggg 20 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MJ1 <400> 3 cgggatccat gaaacgtgca gcattg 26 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MJ1 <400> 4 cgggaattca ccgaatgcat gttcgta 27 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PPAR-gamma <400> 5 cattctggcc caccaacttt gg 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PPAR-gamma <400> 6 tggagatgca ggctccactt tg 22

Claims (19)

a) extracting genomic DNA from Alicyclobacillus genus strains;
b) cleaving the extracted genomic DNA to separate DNA fragments of 100 to 1500 bp size;
c) concatenating a library vector with the cleaved genomic DNA to obtain colonies;
d) extracting the plasmid from the obtained colonies, performing PCR, and then purifying the probe from the PCR product; And
e) a method for preparing DNA microarray for simultaneous detection of food rot causing bacteria, comprising fixing the purified probe to a support. The method of claim 1, wherein the Alicyclobacillus genus strain is one or more strains selected from the group consisting of Alicyclobacillus acidoterrestris, Alicyclobacillus cycloheptanicus, and Alicyclobacillus acidocaldarius. The method of claim 1, wherein the cutting in step b) is performed by cutting the extracted genomic DNA with different types of restriction enzyme pairs. The method of claim 3, wherein the different types of restriction enzyme pairs are one or more restriction enzyme pairs selected from the group consisting of EcoRI / BamHI, HindIII / XhoI, and HindIII / SacII. The method of claim 1, wherein the connection of the library vector and the cleaved genomic DNA of step c) is performed by placing the T3 / T7 sequence on both sides of the production of the DNA microarray for the simultaneous detection of food-causing bacteria Way. The method according to claim 5, wherein the T3 / T7 sequence has a nucleotide sequence as set out in SEQ ID NO: 1 and SEQ ID NO: 2. The method of claim 1, wherein the PCR is performed using a T3 / T7 primer. The method of claim 7, wherein the T3 / T7 primer has a nucleotide sequence set forth in SEQ ID NO: 1 and SEQ ID NO: 2. The method of claim 1, wherein the purifying the probe from the PCR product is performed by using a restriction enzyme pair applied in step b). The method of claim 1, wherein the library vector has a cleavage map of FIG. 7. The support of claim 1 wherein the support is silicon, glass, germanium, ceramic, silicon, semiconductor material, PTFE, carbon, polycarbonate, mica, plastic, quartz, polystyrene, gallium arsenide, metals, metal alloys, and textiles Method for producing a DNA microarray for the simultaneous detection of food-causing bacteria that is a substance selected from the group consisting of. DNA microarray for simultaneous detection of food-causing bacteria produced by the production method of claim 1 to claim 11. The DNA microarray of claim 12, wherein the microarray further comprises positive control and negative control. The method of claim 13, wherein the positive control was used for the MJ1 sequence of the bacteriophage, the negative control was used for simultaneous detection of food spoilage causative bacteria, characterized in that using Peroxysome proliferator activated receptor (PPAR) -gamma DNA microarrays. 15. The method of claim 14, wherein the MJ1 sequence of the bacteriophage has at least one nucleotide sequence selected from SEQ ID NO: 3 and 4, the peroxysome proliferator activated receptor (PPAR) -gamma sequence is at least one selected from SEQ ID NOs: 5 and 6 DNA microarray for simultaneous detection of food-causing bacteria that has a nucleotide sequence. A method for detecting microorganisms of food rot, wherein the microarray according to any one of claims 12 to 15 is used to determine the presence or absence of bacteria causing food rot at one time through random priming and hybridization. The method for detecting food corruption causing microorganisms according to claim 16, wherein the food decay causing microorganism is Alicyclobacillus sp. The method of claim 17, wherein the Alicyclobacillus genus strain is at least one strain selected from the group consisting of Alicyclobacillus acidoterrestris, Alicyclobacillus cycloheptanicus, and Alicyclobacillus acidocaldarius. 19. The method according to any one of claims 16 to 18, wherein said food is fruit juice.

Images