KR20110134209A - An single chain-insulin analog complex using an immunoglobulin fragment - Google Patents

An single chain-insulin analog complex using an immunoglobulin fragment Download PDF

Info

Publication number
KR20110134209A
KR20110134209A KR1020100054067A KR20100054067A KR20110134209A KR 20110134209 A KR20110134209 A KR 20110134209A KR 1020100054067 A KR1020100054067 A KR 1020100054067A KR 20100054067 A KR20100054067 A KR 20100054067A KR 20110134209 A KR20110134209 A KR 20110134209A
Authority
KR
South Korea
Prior art keywords
immunoglobulin
region
proinsulin
chain insulin
insulin analogue
Prior art date
Application number
KR1020100054067A
Other languages
Korean (ko)
Other versions
KR101324828B1 (en
Inventor
김진선
허용호
김대진
정성엽
임창기
권세창
Original Assignee
한미홀딩스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한미홀딩스 주식회사 filed Critical 한미홀딩스 주식회사
Priority to KR1020100054067A priority Critical patent/KR101324828B1/en
Publication of KR20110134209A publication Critical patent/KR20110134209A/en
Application granted granted Critical
Publication of KR101324828B1 publication Critical patent/KR101324828B1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/58—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. poly[meth]acrylate, polyacrylamide, polystyrene, polyvinylpyrrolidone, polyvinylalcohol or polystyrene sulfonic acid resin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/28—Insulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/61—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule the organic macromolecular compound being a polysaccharide or a derivative thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2121/00—Preparations for use in therapy

Abstract

PURPOSE: A short chain insulin analog complex is provided to ensure insulin-like activity in vivo and to prevent low blood glucose. CONSTITUTION: A short chain insulin analog complex is linked through a non-peptide linker. The short chain insulin analog and immunoglobulin Fc region is polyethylene glycol, polypropylene glycol, ethylene glycol-propylene glycol copolymer, polyoxyethylation polyol, polyvinyl alcohol, polysaccharide, dextran, polyvinyl ethyl ether, biocompatible polymers, lipid polymers, chitins, hyaluronic acid, or mixture thereof. The immunoglobulin Fc region has CH1, CH2, CH3 or CH4 domain and additionally contains hinge domain.

Description

면역글로불린 단편을 이용한 단쇄 인슐린 아날로그 약물 결합체{An single chain-insulin analog complex using an immunoglobulin fragment}An single chain-insulin analog complex using an immunoglobulin fragment

본 발명은 단쇄 인슐린 아날로그 (single-chain insulin analog), 비 펩타이드성 중합체 및 면역글로불린 Fc 영역이 상호 공유결합에 의해 연결되어 있어 생체 내 지속성 및 안정성이 향상된 단쇄 인슐린 아날로그 결합체 및 그 이용에 관한 것이다. 더욱 구체적으로 본 발명은 생체 내에서 인슐린과 유사한 활성을 나타내고, 혈중 반감기가 현저히 증가 된 인슐린 아날로그 지속형 제형으로서, 인슐린 치료의 단점인 저혈당을 유도하지 않으며 지속성 특성이 부여되어 인슐린 치료의 부작용 및 투여 편의성을 향상시킨 획기적인 단쇄 인슐린 아날로그 결합체 및 이의 제조방법에 관한 것이다. The present invention relates to a short-chain insulin analogue conjugate having a single-chain insulin analog, a non-peptidyl polymer, and an immunoglobulin Fc region covalently linked to each other, thereby improving durability and stability in vivo. More specifically, the present invention is an insulin analogue sustained-release formulation that shows insulin-like activity in vivo and has a markedly increased half-life in blood, and does not induce hypoglycemia, which is a disadvantage of insulin therapy, and is endowed with persistent properties, thereby inducing side effects and administration of insulin therapy. A breakthrough short-chain insulin analogue conjugate with improved convenience and a method for preparing the same.

인슐린은 인체의 췌장에서 분비되는 혈당 조절 호르몬으로 혈액 내의 잉여 포도당을 세포로 옮겨 세포에 에너지원을 공급하는 한편 혈당을 정상 수준으로 유지시켜 주는 역할을 한다. 그러나 당뇨 환자의 경우 이러한 인슐린이 부족하거나 인슐린 저항성 및 베타 세포의 기능소실로 인하여 인슐린이 정상적인 기능을 나타내지 않아 혈액 내의 포도당을 에너지원으로 이용하지 못하고 혈중 포도당 수준이 높은 고혈당 증세를 나타내어 결국 소변으로 당을 배출하게 되며 여러 합병증과 연계되어 있다. 따라서 인슐린이 부족하거나 정상적인 기능을 나타내지 못하는 당뇨 환자에게는 인슐린 치료가 필수적이며, 인슐린 투여 시 정상 수준으로 혈당을 조절 할 수 있다.
Insulin is a glycemic control hormone secreted by the human pancreas, which transfers excess glucose in the blood to cells to supply energy to cells and maintain blood sugar at normal levels. However, in diabetic patients, due to the lack of insulin or insulin resistance and loss of beta-cell function, insulin does not show its normal function, which means that glucose in the blood cannot be used as an energy source and high blood glucose levels result in high blood glucose. It is associated with many complications. Therefore, insulin therapy is essential for diabetic patients who lack insulin or do not exhibit normal function, and can control blood sugar to normal levels when insulin is administered.

인슐린제제는 선천적으로 인슐린 생성에 이상이 있는 일형 (Type Ⅰ) 당뇨 환자나, 인슐린 내성, 인슐린 분비 부족 등에 의해 2차적으로 혈당치가 상승하는 이형 (Type Ⅱ) 당뇨이면서 경구용 당뇨약으로 조절이 잘 안되거나 금기인 환자, 임신성 당뇨환자에게 투여하는 혈당 조절제이다.
Insulin preparations are type 1 diabetes patients who have inherent abnormalities in insulin production, or type II diabetes whose secondary blood sugar levels rise due to insulin resistance and lack of insulin secretion. It is a glycemic regulator administered to patients with or without contraindications and gestational diabetes.

초기에는 소나 돼지의 인슐린을 정제하여 쓰는 방법을 이용했지만, 유전공학 및 DNA 조작 기술의 발달로 세균, 효모 등을 이용하여 사람 인슐린의 대량 생산이 가능하게 되었고(참조: EP 0055945), 사람 인슐린을 변형시켜 작용시간 등을 개선한 인슐린 아날로그 등을 생산할 수 있게 되었다.
In the early stages, cows and pigs were used to purify and use insulin, but genetic engineering and DNA manipulation techniques have made it possible to produce large amounts of human insulin using bacteria and yeast (see EP 0055945). By modifying it, it is possible to produce an insulin analog and the like which have improved the working time and the like.

유전자 재조합 기술에 의한 최초의 사람 인슐린 변형체는 일라이릴리사(Eli lilly)의 인슐린 리스프로(Lispro)로 B쇄 카복실말단 두 번째 라이신 잔기와 세 번 째 프롤린 잔기를 순서를 바꾸어 인슐린 이량체 및 육량체의 형성을 막아 주사 투여시 혈당 강하 활성이 좋은 단량체 인슐린의 양을 늘린 인슐린 변형체이다. 노보노디스크사(Novo Nordisk)의 인슐린 아스파트(aspart)는 B쇄 28번 프롤린 잔기를 아스파틱산 잔기로 치환하여, 전하의 반발력(repulsion)을 증가시켜 인슐린 육량체의 형성을 막아 초속효성 활성을 나타내도록 만들어진 변형체이다. 사노피 아벤티스사의 인슐린 글루이진(Glulisine)은 B쇄 3번 아스파라진(asparagine) 잔기를 라이신(Lysine) 잔기로 치환하고, B쇄 29번 라이신(Lysine) 잔기를 글루탐산(glutamic acid) 잔기로 치환하여 빠른 혈당 강하 효과를 나타내도록 만들어진 변형체이다.
The first human insulin variant by genetic recombination technology is Eli lilly's insulin Lispro, which reverses the order of the second lysine residue and the third proline residue of the B chain carboxyl terminus to produce insulin dimers and hexamers. It is an insulin variant that prevents formation and increases the amount of monomeric insulin having good blood glucose lowering activity when injected. Novo Nordisk's insulin aspart replaces the B-chain proline residue with an aspartic acid residue to increase the repulsion of the charge, preventing the formation of insulin hexamers for super fast-acting activity. It is a variant made to represent. Insulin Glulisine from Sanofi Aventis Co. replaces B-chain 3 asparagine residues with Lysine residues and B-chain 29 Lysine residues with glutamic acid residues. It is a variant made to have a hypoglycemic effect.

그러나, 인슐린의 경우 다른 단백질 및 펩타이드 호르몬과 마찬가지로 체내의 반감기가 극히 짧아 치료학적 효과를 지속적으로 나타내기 힘들며, 효과를 나타내기 위해서는 지속적으로 반복투여를 해야 한다는 단점이 있다. 또한 단백질 및 펩타이드 약물은 대부분 주사제 형태로 환자에게 투여되며, 따라서 생리활성 펩타이드의 혈중 농도를 유지하기 위하여 자주 주사하게 되는데, 이는 환자에게 엄청난 고통을 야기하게 된다. 따라서, 단백질의 생체내 반감기를 증가시켜 투여 횟수를 줄임으로써 치료학적 효과를 높이며 환자의 삶의 질을 높이기 위해 여러 단백질 제형화 연구와 화학변형이 연구되어 왔다.However, in the case of insulin, like other protein and peptide hormones, the half-life of the body is extremely short, so that it is difficult to continuously display the therapeutic effect. In addition, protein and peptide drugs are mostly administered to patients in the form of injections, and therefore are frequently injected to maintain blood levels of bioactive peptides, which causes tremendous pain in the patient. Therefore, various protein formulation studies and chemical modifications have been studied to increase the therapeutic half-life and increase the quality of life of patients by increasing the in vivo half-life of proteins.

이러한 인슐린 제제의 투여상의 문제점을 극복하기 위하여 다양한 시도 중 하나로 인슐린 약물의 생체막 투과도를 증가시켜 구강 또는 비강을 통한 흡입으로 인슐린 약물을 체내로 전달하는 시도가 있었다. 화이자사의 흡입형 당뇨병 인슐린 치료제 '엑수베라(Exubera)'는 주사투여의 불편함을 개선한 획기적인 흡입형 속효성 인슐린 제제로 주사형 인슐린제제와 유사한 혈당강하 효과를 나타내어 주목 받았으나, 폐암 발병 위험 등의 안전성 문제 및 매출 부진으로 인하여 시장에서 철수 되었다. 또한 노보노디스크사, 릴리사등 여러 제약회사에서 흡입형 인슐린 개발에 착수하였다가 중단한 바 있다.
In order to overcome the problem of administration of such insulin preparations, one of various attempts has been to increase the biomembrane permeability of insulin drugs to deliver insulin drugs to the body by inhalation through the oral cavity or nasal cavity. Pfizer's inhaled diabetic insulin treatment, Exubera, is a breakthrough fast-acting insulin preparation that improves the discomfort of injection administration.It has been noted for its hypoglycemic effect similar to that of injectable insulin, but it is safe for the risk of developing lung cancer. Due to problems and sluggish sales, it was withdrawn from the market. In addition, several pharmaceutical companies, including Novo Nordisk and Lilly, began developing inhaled insulin.

이러한 흡인형 투여 방법은 간단하고 환자 스스로도 고통 없이 투여할 수 있는 방법을 제공하여 기존의 주사 투여 보다는 확실하게 선호 되고 있지만 주사제에 비해 약물의 체내 전달 효율이 낮으며 약물의 체내 활성을 요구되는 조건으로 유지하는데 아직까지는 어려움이 많다. 또한 미생물 및 병원균에의한 오염, 안정성 및 내구성등 흡입형 투여에 알맞은 조성물을 준비하는데 어려움이 있다. 그리고 흡입형 제품을 폐로 전달하는 것은 부종, 세포손상 및 조직에 염증을 유발할 수 있는 부작용으로 인하여 폐 흡수 메카니즘에 대한 연구가 더 필요하며, 현재 흡수 메커니즘, 흡수율 및 범위를 예측하는 능력은 초기 단계에 있다.
Such aspirated administration method is a simple and painless administration method that is clearly preferred over the conventional injection administration, but the drug delivery efficiency of the drug is lower than that of the injection, and the drug activity is required It is still difficult to maintain. In addition, there is a difficulty in preparing a composition suitable for inhalation administration such as contamination, stability and durability by microorganisms and pathogens. And delivery of inhaled products to the lungs requires further study of lung absorption mechanisms due to side effects that can cause edema, cell damage, and inflammation in tissues, and the ability to predict absorption mechanisms, absorption rates and ranges is currently at an early stage. have.

그러나 아직도 많은 연구자 및 제약사들은 인슐린제제의 호흡기 전달을 가능한 것으로 보고 계속해서 개발 노력을 쏟고 있으며, 현재 엑수베라의 단점을 극복 한 맨카인드(mannkind)사의 흡입형 인슐린제제 아프레자(Afrezza)가 FDA 승인 대기 중에 있다.
However, many researchers and pharmaceutical companies continue to devote their efforts to seeing the respiratory delivery of insulin as possible, and are currently FDA approved by mannkind's inhalable insulin formulation, which overcomes the disadvantages of Exuvera. In the air.

이외 투여 편의성을 향상시키고 효과적인 치료에 충분한 수준의 생물학적 이용 가능성을 가진 투여 방법의 개발은 지난 수년간 진행 되어 왔으며, 경구, 비강 및 경피 흡수등의 투여 경로가 인슐린 제제가 현재 임상 시험 진행 중에 있다. (E.-S. Khafagy et al. , Advanced Drug Delivery Reviews ; 59, (2007) 15211546)In addition, the development of a method of administration that improves the convenience of administration and has a sufficient level of bioavailability for effective treatment has been in progress for several years, and the route of administration such as oral, nasal and transdermal absorption is currently under clinical trial. (E.-S. Khafagy et al., Advanced Drug Delivery Reviews; 59, (2007) 15211546)

한편, 인슐린 제제 약물의 혈중 안정성을 증가시키고 혈중 약물 농도를 오랫동안 높게 지속시켜 약효 극대화 및 투여 편의성을 향상 시키려는 노력이 계속되어 왔는데, 인슐린 약물의 지속형 제제는 인슐린의 안정성을 높이는 동시에 약물 자체의 역가가 충분히 높게 유지되고, 환자에게 저 혈당 반응을 유발하지 않아야 한다.
On the other hand, efforts have been made to increase the blood stability of insulin preparation drugs and to maintain high blood drug concentrations for a long time, thereby maximizing drug efficacy and improving the convenience of administration. The continuous preparation of insulin drugs increases the stability of insulin and the potency of the drug itself. Should remain high enough and do not cause a hypoglycemic response in the patient.

현재 시판중인 지속형 인슐린 제제는 사노피-아베티스사(sanofi-aventis)의 인슐린 글라진(insulin glargine, lantus)과 노보노디스크사(Novo Nordisk)의 인슐린 디터미르(insulin detemir, levemir)가 있다. 사노피-아벤티스사의 인슐린 글라진은 최초의 지속형 인슐린으로 A쇄의 21번째 아스파라진을 글라이신으로 치환하고, B쇄에 2개의 아르지닌 잔기를 추가하여 산성 pH에서 가용성 성질을 가지며 생체내의 pH에서는 낮은 가용성 성질을 나타내어, 피하 투여시에 인슐린의 침전을 유도하여 천천히 흡수 되도록 제조 되었다. 인슐린 글라진의 지속 시간은 약 20~22시간으로 속효성(5~8시간) 및 초 속효소성(3~5시간) 인슐린 대비 작용시간이 길고 인슐린 농도의 피크가 없어 저혈당이 발생하지 않는다는 장점을 가지고 있다. 노보노디스크사의 인슐린 디터미르는 가장 최근에 개발 된 지속형 인슐린 제제로 B쇄의 30번째 트레오닌 잔기를 제거하고 B쇄의 29번 라이신 잔기에 아실화를 시켜 인체 투여 시에 알부민과 결합할 수 있도록 제작하여 지속형의 특성을 부여하였다(Allison J. et al, DM. 148-162, 2010). 지속 시간은 인슐린 글라진보다 약간 짧은 18~22시간으로 하루 1회 또는 2회 제형으로 개발 되었다. 이들 지속성 인슐린들은 혈중 인슐린 농도의 피크가 없어 기저 인슐린으로 적합하다. 그러나 이러한 지속형 인슐린들은 충분히 반감기가 길지 않아 매일 1회 또는 2회 투여해야 하는 불편함이 여전히 존재하여 장기간 투여해야 하는 당뇨병 환자의 경우 투여 빈도를 획기적으로 낮추어 환자의 편의성을 증가시킬 수 있는 제제의 필요성이 매우 요구되고 있다.
Currently available long-acting insulin preparations include insulin glargine (lantus) from Sanofi-Aventis and insulin detemir (levemir) from Novo Nordisk. Sanofi-Aventis's insulin glargine is the first long-acting insulin that replaces the 21st asparagine of the A chain with glycine and adds two arginine residues to the B chain, making it soluble at acidic pH and low at in vivo pH. It exhibits soluble properties, and induces precipitation of insulin upon subcutaneous administration, so as to be slowly absorbed. The duration of insulin glargine is about 20 ~ 22 hours, which has the advantage that the action time is longer than that of fast-acting (5-8 hours) and super fast-enzymatic (3-5 hours) insulin and there is no peak of insulin concentration, so hypoglycemia does not occur. have. Novo Nordisk's Insulin Determir is the most recently developed long-acting insulin preparation that removes the 30 th threonine residue in B chain and acylates the lysine residue in B chain so that it can be combined with albumin during human administration. It was constructed and endowed with the properties of sustained form (Allison J. et al, DM . 148-162, 2010). Durations were developed in dosage forms once or twice a day, 18-22 hours, slightly shorter than insulin glargine. These persistent insulins are suitable for basal insulin because they do not have peaks in the blood insulin concentration. However, these long-acting insulins do not have long enough half-lives, so there is still some inconvenience to be administered once or twice daily. Therefore, diabetic patients who need long-term administration can reduce the frequency of administration and increase the convenience of patients. The need is very demanding.

인슐린 제제의 지속형 및 저혈당 문제를 해결하기 위한 방법으로 단쇄 인슐린 아날로그를 사용할 수 있다. 단쇄 인슐린은 기존의 A 쇄와 B 쇄로 구성된 인슐린을 단쇄로 제조하여 사용함으로써 반감기 및 효력을 조절 할 수 있다. 단쇄 인슐린은 A 쇄와 B 쇄순으로 연결하거나 B 쇄와 A 쇄 순으로 연결할 수 있으며 각 쇄의 연결 시 펩타이드가 링커로 삽입될 수 있다. 또한 A 쇄와 B 쇄 어느 하나만을 사용할 수 있으며 이의 아날로그도 이에 포함된다.Short-chain insulin analogues can be used as a way to address the persistent and hypoglycemic problems of insulin preparations. Short-chain insulin can control the half-life and potency by using a short-chain insulin prepared by the conventional A chain and B chain. Short-chain insulin can be linked in the order of A chain and B chain, or in the order of B chain and A chain, and peptides can be inserted into the linker at the time of linking each chain. In addition, only one of the A chain and the B chain may be used, including analog thereof.

인슐린 제제의 지속형을 향상시키기 위한 다른 방법은 인슐린의 전구물질인 프로 인슐린의 이용이다. 프로 인슐린 그 자체는 약한 인슐린 아고니스트로서 인슐린에 비하여 활성은 낮지만 인슐린 대비 더 긴 반감기를 가진다 (William F. et al., The journal of biological chemistry, vol. 267; 419-425, 1992). 프로 인슐린은 인슐린과 달리 B쇄와 A쇄가 인슐린의 안정성 유지에 중요한 역할을 하는 C 펩타이드에 의해 연결되어 있어 혈중 반감기가 인슐린대비 더 길다. 따라서 많은 연구자들에 의해 프로 인슐린을 지속형 인슐린으로 개발하려는 여러 시도가 있었다. 그러나 활성에 중요한 역할을 하는 A쇄의 아미노말단 글라이신 잔기가 C 펩타이드에 가려져 있어 인슐린에 비해 활성이 낮은 단점이 있어(William F. et al., The journal of biological chemistry, vol. 267; 419-425, 1992) 아직 약물로 개발되지 못하였다.
Another method for improving the sustained form of insulin preparations is the use of pro insulin, a precursor of insulin. Pro insulin itself is a weak insulin agonist, which is less active than insulin but has a longer half-life than insulin (William F. et al., The journal of biological chemistry, vol. 267; 419-425, 1992). Unlike insulin, pro insulin has a longer half-life than insulin because chains B and A are linked by C peptides, which play an important role in maintaining insulin stability. Therefore, many researchers have attempted to develop pro insulin into sustained insulin. However, the amino-terminal glycine residue of the A chain, which plays an important role in the activity, is hidden by the C peptide and thus has a lower activity than insulin (William F. et al., The journal of biological chemistry, vol. 267; 419-425 , 1992) It has not been developed as a drug yet.

이에, 본 발명자들은 프로인슐린 아날로그의 혈당강화 효과 및 혈중 지속성 향상으로 투여의 편의성을 증대시키고, 생체 내 활성 유지 및 인슐린의 부작용인 저 혈당 효과를 감소시킬 수 있는 프로인슐린 아날로그 결합체를 제작하였다. 프로인슐린 아날로그 결합체에 새로운 특성을 부여하기 위한 방법으로 면역글로불린 Fc 영역, 비펩타이드성 중합체 및 프로 인슐린 아날로그를 공유 결합에 의해 부위 선택적으로 상호 연결시키는 제조방법을 사용하였고, 그 결과 인슐린 아날로그 결합체의 혈중 반감기를 획기적으로 증가시켜 기존의 지속형 인슐린 제제보다 월등히 개선된 혈중반감기 증가효과 및 저혈당 감소 효과를 확인함으로써 본 발명을 완성하였다.
Accordingly, the present inventors have made a proinsulin analogue conjugate which can increase the convenience of administration by improving the glycemic-enhancing effect and the blood persistence of proinsulin analog, and can maintain the activity in vivo and reduce the hypoglycemic effect which is a side effect of insulin. As a method for imparting new properties to proinsulin analogue conjugates, a method of site-selective interconnection of immunoglobulin Fc regions, non-peptidyl polymers, and proinsulin analogues by covalent bonds was used. The present invention has been completed by significantly increasing the half-life to confirm the effect of increasing blood half-life and reducing hypoglycemia, which is significantly improved over the existing sustained insulin preparation.

본 발명의 목적은 인슐린과 유사하거나 또는 우월한 생체 내 혈당 강하 효력을 유지하면서 혈중 반감기를 월등히 연장시켜 투여의 편의성 향상 및 인슐린의 부작용을 개선한 우수한 단쇄 인슐린 아날로그 지속형 제제 및 이의 제조 방법을 제공하는 것이다.Disclosure of Invention An object of the present invention is to provide an excellent short-chain insulin analogue sustained-release formulation and a method for preparing the same, which improves the convenience of administration and improves the side effects of insulin by maintaining the blood glucose lowering effect in vivo similar to or superior to that of insulin. will be.

상기 목적을 달성하기 위하여, 본 발명은 단쇄 인슐린 아날로그 및 면역글로불린 Fc 영역이 양 말단에 반응기를 갖는 비 펩타이드성 중합체를 통하여 상호 공유결합에 의해 연결되어 있는 지속형 단쇄 인슐린 아날로그 결합체 및 그의 변이체 그리고 이의 제조 방법을 제공한다.In order to achieve the above object, the present invention provides a continuous short-chain insulin analogue conjugate and a variant thereof in which the short-chain insulin analogue and immunoglobulin Fc regions are covalently linked through a non-peptidyl polymer having a reactor at both ends thereof. It provides a manufacturing method.

상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 프로인슐린 아날로그 (pro-insulin analog) 및 면역글로불린 Fc 영역이 비펩타이드성 링커를 통해 연결된 프로인슐린 아날로그 결합체를 제공한다.
As one aspect for achieving the above object, the present invention provides a proinsulin analog conjugate in which a pro-insulin analog and an immunoglobulin Fc region are linked through a non-peptidyl linker.

이하, 본 발명을 상세히 설명한다. Hereinafter, the present invention will be described in detail.

본 발명은 단쇄 인슐린 아날로그 결합체를 제공하며 보다 구체적으로 프로인슐린 아날로그 결합체를 제공한다.      The present invention provides short chain insulin analogue conjugates and more specifically proinsulin analogue conjugates.

본 발명은 단쇄 인슐린 아날로그 및 면역글로불린 Fc 영역이 양 말단에 반응기를 갖는 비 펩타이드성 중합체를 통하여 상호 공유결합에 의해 연결되어 있는 지속형 단쇄 인슐린 아날로그 결합체에 관한 것이다.      The present invention relates to a sustained short chain insulin analogue conjugate wherein the short chain insulin analog and immunoglobulin Fc regions are covalently linked via a non-peptidyl polymer having a reactor at both ends.

또한, 본 발명은 프로인슐린 아날로그 및 면역글로불린 Fc 영역이 양 말단에 In addition, the present invention is a proinsulin analogue and immunoglobulin Fc region at both ends

반응기를 갖는 비 펩타이드성 중합체를 통하여 상호 공유결합에 의해 연결되어 있는 지속형 프로인슐린 아날로그 결합체에 관한 것이다.It relates to a sustained proinsulin analogue conjugate that is covalently linked through a non-peptidic polymer having a reactor.

본 발명의 “단쇄 인슐린”은 천연형 인슐린과 유사한 생체 내 혈당 강화 특성을 보유하며 A 쇄와 B 쇄가 하나의 쇄로 연결된 인슐린 아날로그이다. 바람직하게 본 발명의 단쇄 인슐린 아날로그는 프로인슐린 아날로그이다.The “short chain insulin” of the present invention is an insulin analogue having in vivo glycemic-enhancing properties similar to that of natural insulin and in which the A and B chains are connected in one chain. Preferably the short chain insulin analogue of the present invention is a proinsulin analogue.

본 발명의 “프로인슐린 아날로그”는 프로인슐린과 유사한 생체 내 혈당 강하 특성을 보유한 사람의 프로인슐린 변이체로서, 천연형 프로인슐린과 A쇄, B쇄, 그리고 C 펩타이드 배열이 하나 이상 다른 펩타이드를 의미한다. 본 발명의 프로 인슐린 아날로그는 A쇄, B쇄, C 펩타이드 각각의 아미노산 서열은 천연형이거나 아미노산이 추가 또는 삭제 된 형태 모두 가능하다. 바람직하게 본 발명의 프로인슐린 아날로그는 인슐린과 유사한 생체 내 혈당 강하 특성을 보유한 사람의 프로인슐린 변이체로서, 천연형 프로인슐린의 B쇄- C 펩타이드- A쇄의 배열과 달리 A쇄- C 펩타이드 -B쇄의 배열을 가지며, A쇄의 아미노 말단 부위가 자유롭다. The “proinsulin analogue” of the present invention is a proinsulin variant of a human having in vivo blood glucose lowering properties similar to that of proinsulin, and refers to a peptide having one or more different A-type, B-chain, and C-peptide sequences. . Pro insulin analogue of the present invention, the amino acid sequence of each of the A chain, B chain, C peptide is natural or can be added or deleted amino acid form. Preferably, the proinsulin analogs of the present invention are proinsulin variants of humans having similar in vivo blood glucose lowering properties as A-chain-C peptide-B, unlike the arrangement of B-chain-C peptide-A chains of native proinsulin. It has a chain arrangement, and the amino terminal portion of the A chain is free.

본 발명의 프로인슐린 아날로그는 상기 기술한 프로인슐린과 동일한 생체내의 혈당 조절기능을 보유한 펩타이드로서, 이러한 펩타이드는 프로인슐린 아고니스트(agonist), 유도체(derivatives), 단편(fragments), 변이체(variants) 등을 포함한다.The proinsulin analogue of the present invention is a peptide having the same in vivo glycemic control function as the proinsulin described above, which is a proinsulin agonist, derivatives, fragments, variants, etc. It includes.

본 발명의 프로인슐린 아고니스트는 프로인슐린의 구조와 상관없이 인슐린의 생체내 수용체에 결합하여 인슐린과 동일한 생물학적 활성을 나타내는 물질을 의미한다.The proinsulin agonist of the present invention refers to a substance that binds to the in vivo receptor of insulin and exhibits the same biological activity as insulin regardless of the structure of the proinsulin.

본 발명의 프로인슐린 아날로그는 천연형 프로 인슐린의 A쇄, B쇄 그리고 C 펩타이드와 각각 최소한 80% 이상 아미노산 서열에서 상동성을 보이며, 아미노 한 잔기의 일부 그룹이 화학적으로 치환(예; alpha-methylation, alpha-hydroxylation), 제거(예;deamination) 또는 수식(예; N-methylation) 된 형태일 수 있고, 체내에서 혈당을 조절하는 기능을 보유한 펩타이드를 의미한다.The proinsulin analogs of the present invention are homologous in amino acid sequences of at least 80% or more, respectively, with A, B and C peptides of native proins, with some groups of amino residues chemically substituted (eg, alpha-methylation). , peptide, which may be in the form of (alpha-hydroxylation), eliminated (eg, demination) or modified (eg, N-methylation), and has a function of regulating blood glucose in the body.

본 발명의 프로인슐린 단편은 프로인슐린에 하나 또는 그 이상 아미노산이 추가 또는 삭제된 형태를 의미하며 추가된 아미노산은 천연에 존재하지 않는 아미노산 (예; D형 아미노산) 도 가능할 수 있고, 이러한 인슐린 단편은 체내에서 혈당조절 기능을 보유한다.The proinsulin fragment of the present invention refers to a form in which one or more amino acids are added or deleted to the proinsulin, and the added amino acid may be an amino acid (eg, a D-type amino acid) that does not exist in nature, and the insulin fragment may be It has a glycemic control function in the body.

본 발명의 프로인슐린 변이체는, 프로인슐린과 아미노산서열이 하나 이상 다른 펩타이드로서, 체내에서 혈당조절 기능을 보유한 펩타이드를 의미한다.The proinsulin variant of the present invention refers to a peptide having a glycemic control function in the body as one or more peptides having different amino acid sequences from proinsulin.

본 발명의 인슐린 아고니스트, 유도체, 단편 및 변이체에서 각각 사용된 제조방법은 독립적으로 사용될 수 있고 조합도 가능하다. 예를 들어 아미노산 서열이 하나 이상 다르고 아미노말단 아미노산 잔기에 탈아미노화(deamination) 된 체내에서 혈당조절 기능을 보유한 펩타이드도 포함된다.The preparation methods used in the insulin agonists, derivatives, fragments and variants of the present invention may be used independently and may be combined. For example, peptides having a glycemic control function in a body having one or more amino acid sequences different from each other and deaminated to amino terminal amino acid residues are also included.

구체적인 일 양태로서 본 발명에서 사용한 프로인슐린 아날로그는 재조합 방법을 통하여 생산될 수 있으며, Solid phase 합성법을 통하여 합성하는 방법으로도 생산 가능하다.As a specific aspect, the proinsulin analog used in the present invention may be produced through a recombinant method, and may also be produced by a method synthesized through a solid phase synthesis method.

바람직하게 본 발명에서 사용된 프로인슐린 아날로그 결합체는 프로인슐린 아날로그의 라이신 잔기에 비펩타이드성 중합체가 결합된 것을 특징으로 한다.Preferably, the proinsulin analogue conjugate used in the present invention is characterized in that the non-peptidyl polymer is bound to the lysine residue of the proinsulin analogue.

바람직하게 본 발명에서 사용된 프로인슐린 아날로그 결합체는, A쇄- C 펩타이드 -B쇄의 배열을 가지며 A쇄의 아미노말단 부위가 자유로운 프로인슐린의 A쇄의 아미노말단에 비펩타이드성 중합체가 결합된 것을 특징으로 한다.       Preferably, the proinsulin analogue conjugate used in the present invention is a non-peptidyl polymer conjugated to the amino terminus of A chain of proinsulin having the arrangement of A chain-C peptide-B chain and free of amino terminal region of A chain. It features.

구체적인 일 실시예로서, 본 발명자는 면역글로불린 Fc 영역의 아미노 말단 에 PEG를 결합시키고 여기에 프로인슐린 아날로그 특정 라이신 잔기에 선택적으로 커플링하여 프로인슐린 아날로그-PEG-면역글로불린 Fc 결합체를 제조하였다.In one specific embodiment, the inventors have prepared a proinsulin analogue-PEG-immunoglobulin Fc conjugate by binding PEG to the amino terminus of an immunoglobulin Fc region and selectively coupling it to a proinsulin analog specific lysine residue.

또 다른 구체적인 일 실시예로서, 본 발명자는 면역글로불린 Fc 영역의 아미노 말단에 PEG를 결합시키고 여기에 프로인슐린 아날로그 A쇄의 아미노 말단에 선택적으로 커플링하여 프로인슐린 아날로그-PEG-면역글로불린 Fc 결합체를 제조하였다. In another specific embodiment, the present invention binds PEG to the amino terminus of an immunoglobulin Fc region and selectively couples to the amino terminus of the proinsulin analog A chain thereby linking the proinsulin analog-PEG-immunoglobulin Fc conjugate. Prepared.

본 발명에서 제조한 프로인슐린 아날로그-PEG-면역글로불린 Fc 결합체 및 프로인슐린 아날로그 (55번 라이신 잔기와 56번 아르기닌 잔기가 제거된 프로인슐린 아날로그)-PEG-면역글로불린 Fc 결합체의 혈중반감기는 천연형 인슐린 및 프로인슐린 대비 월등히 증가 하였고, 질환모델 동물에서 혈당강하 효과를 보여 생체 내 활성이 유지된 새로운 지속형 인슐린제형을 제조할 수 있었다. The blood half-life of the proinsulin analogue-PEG-immunoglobulin Fc conjugate and proinsulin analogue (proinsulin analogue removed from lysine residue 55 and arginine residue) -PEG-immunoglobulin Fc conjugate prepared in the present invention is a natural insulin And prosulin was significantly increased compared to, and showed a hypoglycemic effect in the disease model animal was able to prepare a new sustained insulin formulation in which the activity was maintained in vivo.

면역글로불린 Fc 영역은 생체 내에서 대사되는 생분해성의 폴리펩타이드이기 때문에, 약물의 캐리어로 사용하기에 안전하다. 또한, 면역글로불린 Fc 영역은 면역글로불린 전체 분자에 비해 상대적으로 분자량이 적기 때문에 결합체의 제조,정제 및 수율 면에서 유리할 뿐만 아니라, 아미노산 서열이 항체마다 다르기 때문에 높은 비균질성을 나타내는 Fab 부분이 제거되기 때문에 물질의 동질성이 크게 증가되고 혈중 항원성의 유발 가능성도 낮아지게 되는 효과도 기대할 수 있다
Because immunoglobulin Fc regions are biodegradable polypeptides that are metabolized in vivo, they are safe for use as carriers of drugs. In addition, the immunoglobulin Fc region is advantageous in terms of preparation, purification and yield of the conjugate because of its relatively low molecular weight compared to the whole immunoglobulin molecule, and also removes the Fab moiety that exhibits high heterogeneity because the amino acid sequence varies from antibody to antibody. It can be expected that the homogeneity of the protein is greatly increased and the possibility of inducing blood antigens is lowered.

본 발명에서 사용되는 단쇄 인슐린 아날로그는 캐리어 물질과 비펩타이드성Short-chain insulin analogues used in the present invention are non-peptide carriers and

중합체로 연결된다.Connected by a polymer.

본 발명에 사용가능한 캐리어 물질은 면역글로불린 Fc 영역, 알부민, 트랜스페린 및 PEG로 구성된 군에서 선택될 수 있으며, 바람직하게는 면역글로불린 Fc 영역이다.Carrier materials usable in the present invention may be selected from the group consisting of immunoglobulin Fc region, albumin, transferrin and PEG, preferably the immunoglobulin Fc region.

본 발명에서, "면역글로불린 Fc 영역"은, 면역글로불린의 중쇄와 경쇄 가변영역, 중쇄 불변영역 1(CH1)과 경쇄 불변영역(CL1)을 제외한, 중쇄 불변영역 2(CH2) 및 중쇄 불변영역 3(CH3) 부분을 의미하며, 중쇄 불변영역에 힌지(hinge) 부분을 포함하기도 한다. 또한 본 발명의 면역글로불린 Fc 영역은 천연형과 실질적으로 동등하거나 향상된 효과를 갖는 한, 면역 글로불린의 중쇄와 경쇄 가변영역만을 제외하고, 일부 또는 전체 중쇄 불변영역 1(CH1) 및/또는 경쇄불변영역 1(CL1)을 포함하는 확장된 Fc영역일 수 있다. 또한, CH2및/또는 CH3에 해당하는 상당히 긴 일부 아미노산 서열이 제거된 영역일 수도 있다. In the present invention, the "immunoglobulin Fc region" refers to the heavy chain constant region 2 (CH2) and the heavy chain constant region 3, except for the heavy and light chain variable regions, heavy chain constant region 1 (CH1) and light chain constant region (CL1) of the immunoglobulin (CH3) portion, and may include a hinge portion in the heavy chain constant region. In addition, as long as the immunoglobulin Fc region of the present invention has substantially the same or improved effect as the natural type, except for the heavy and light chain variable regions of the immunoglobulin, some or all heavy chain constant region 1 (CH1) and / or light chain constant region It may be an extended Fc region including 1 (CL1). It may also be a region from which some fairly long amino acid sequences corresponding to CH 2 and / or CH 3 have been removed.

즉, 본 발명의 면역글로불린 Fc 영역은 1) CH1 도메인, CH2 도메인, CH3 도메인 및 CH4 도메인, 2)CH1 도메인 및 CH2 도메인, 3)CH1 도메인 및 CH3 도메인, 4)CH2 도메인 및 CH3 도메인, 5)1개 또는 2개의 이상의도메인과 면역글로불린 힌지 영역(또는 힌지 영역의 일부)와의 조합, 6)중쇄 불변영역 각 도메인과 경쇄 불변영역의 이량체일 수 있다. In other words, the immunoglobulin Fc region of the present invention comprises 1) CH1 domain, CH2 domain, CH3 domain and CH4 domain, 2) CH1 domain and CH2 domain, 3) CH1 domain and CH3 domain, 4) CH2 domain and CH3 domain, 5) Combination of one or two or more domains with an immunoglobulin hinge region (or a portion of the hinge region), 6) heavy chain constant region may be a dimer of each domain and light chain constant region.

또한, 본 발명의 면역글로불린 Fc 영역은 천연형 아미노산 서열뿐만 아니라 이의 서열 유도체(mutant)를 포함한다. 아미노산 서열 유도체란 천연 아미노산 서열 중의 하나 이상의 아미노산 잔기가 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합에 의하여 상이한 서열을 가지는 것을 의미한다. 예를 들면, IgG Fc의 경우 결합에 중요하다고 알려진 214 내지 238, 297 내지 299, 318 내지 322 또는 327 내지 331번 아미노산 잔기들이 변형을 위해 적당한 부위로서 이용될 수 있다.In addition, the immunoglobulin Fc regions of the present invention include not only native amino acid sequences but also sequence derivatives thereof. Amino acid sequence derivatives mean that one or more amino acid residues in a natural amino acid sequence have different sequences by deletion, insertion, non-conservative or conservative substitution, or a combination thereof. For example, for IgG Fc amino acid residues 214 to 238, 297 to 299, 318 to 322 or 327 to 331 which are known to be important for binding can be used as suitable sites for modification.

또한, 이황화 결합을 형성할 수 있는 부위가 제거되거나, 천연형 Fc에서 N-말단의 몇몇 아미노산이 제거되거나 또는 천연형 Fc의 N-말단에 메티오닌 잔기가 부가될 수도 있는 등 다양한 종류의 유도체가 가능하다. 또한, 이펙터 기능을 없애기 위해 보체결합부위, 예로 C1q 결합부위가 제거될 수도 있고, ADCC(antibody dependent cell mediated cytotoxicity) 부위가 제거될 수도 있다. 이러한 면역글로불린 Fc 영역의 서열 유도체를 제조하는 기술은 국제특허공개 제WO 97/34631호, 국제특허공개 제96/32478호 등에 개시되어 있다.In addition, various kinds of derivatives are possible, such as a site capable of forming disulfide bonds, a few amino acids at the N-terminus in the native Fc, or a methionine residue may be added at the N-terminus of the native Fc. Do. In addition, complement binding sites, such as C1q binding sites may be removed, or ADCC (antibody dependent cell mediated cytotoxicity) sites may be removed to eliminate effector function. Techniques for preparing such sequence derivatives of immunoglobulin Fc regions are disclosed in WO 97/34631, WO 96/32478, and the like.

분자의 활성을 전체적으로 변경시키지 않는 단백질 및 펩타이드에서의 아미노산 교환은 당해 분야에 공지되어 있다 (H.Neurath, R.L.Hill, The Proteins, Academic Press, New York,197 9). 가장 통상적으로 일어나는 교환은 아미노산 잔기 Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly 간의 교환이다.Amino acid exchange in proteins and peptides that do not alter the activity of the molecule as a whole is known in the art (H. Neuroath, R. L. Hill, The Proteins, Academic Press, New York, 197 9). The most commonly occurring exchanges are amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Exchange between Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, Asp / Gly.

경우에 따라서는 인산화(phosphorylation), 황화(sulfation), 아크릴화 (acrylation), 당화(glycosylation), 메틸화(methylation), 파네실화(farnesylation), 아세틸화(acetylation) 및 아밀화(amidation) 등으로 수식(modification)될 수도 있다.In some cases, it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, acetylation and amylation. may be modified.

상기 기술한 Fc 유도체는 본 발명의 Fc 영역과 동일한 생물학적 활성을 나타내나 Fc 영역의 열, pH 등에 대한 구조적 안정성을 증대시킨 유도체다. The above-described Fc derivatives are derivatives which exhibit the same biological activity as the Fc region of the present invention but increase structural stability against heat, pH, etc. of the Fc region.

또한, 이러한 Fc 영역은 인간 및 소, 염소, 돼지, 마우스, 래빗, 햄스터, 랫트, 기니아 픽 등의 동물의 생체 내에서 분리한 천연형으로부터 얻어질 수도 있고, 형질전환된 동물세포 또는 미생물로부터 얻어진 재조합형 또는 이의 유도체 일 수 있다. 여기서, 천연형으로부터 획득하는 방법은 전체 면역글로불린을 인간 또는 동물의 생체로부터 분리한 후, 단백질 분해효소를 처리하여 얻을 수 있다. 파파인을 처리할 경우에는 Fab 및 Fc로 절단되고, 펩신을 처리할 경우에는 pF'c 및 F(ab)2로 절단된다. 이를 크기 배제 크로마토그래피(size-exclusion chromatography) 등을 이용하여 Fc 또는 pF'c를 분리할 수 있다.In addition, the Fc region may be obtained from natural types separated in vivo from humans and animals such as cows, goats, pigs, mice, rabbits, hamsters, rats, and guinea pigs, and may be obtained from transformed animal cells or microorganisms. It may be recombinant or a derivative thereof. Here, the method obtained from the natural form can be obtained by separating the whole immunoglobulin from the human or animal living body, and then treating the protease. Papain is cleaved into Fab and Fc, and pepsin is cleaved into pF'c and F (ab) 2. This may be separated by Fc or pF'c using size-exclusion chromatography.

바람직하게는 인간 유래의 Fc 영역을 미생물로부터 수득한 재조합형 면역글로불린 Fc 영역이다.Preferably, the recombinant immunoglobulin Fc region obtained from a microorganism is a human-derived Fc region.

또한, 면역글로불린 Fc 영역은 천연형 당쇄, 천연형에 비해 증가된 당쇄, 천연형에 비해 감소한 당쇄 또는 당쇄가 제거된 형태일 수 있다. 이러한 면역글로불린 Fc 당쇄의 증감 또는 제거에는 화학적 방법, 효소학적 방법 및 미생물을 이용한 유전 공학적 방법과 같은 통상적인 방법이 이용될 수 있다. 여기서, Fc에서 당쇄가 제거된 면역글로불린 Fc 영역은 보체(c1q)의 결합력이 현저히 저하되고, 항체-의존성 세포독성 또는 보체-의존성 세포독성이 감소 또는 제거되므로, 생체 내에서 불필요한 면역반응을 유발하지 않는다. 이런 점에서 약물의 캐리어로서의 본래의 목적에 보다 부합하는 형태는 당쇄가 제거되거나 비당쇄화된 면역글로불린 Fc 영역이라 할 것이다.In addition, the immunoglobulin Fc region may be in a natural sugar chain, an increased sugar chain compared to the natural form, a reduced sugar chain or a sugar chain removed from the natural form. Conventional methods such as chemical methods, enzymatic methods, and genetic engineering methods using microorganisms can be used to increase or decrease such immunoglobulin Fc sugar chains. Herein, the immunoglobulin Fc region in which the sugar chain is removed from the Fc has a significant decrease in the binding capacity of the complement (c1q), and the antibody-dependent cytotoxicity or the complement-dependent cytotoxicity is reduced or eliminated, thereby not causing an unnecessary immune response in vivo. Do not. In this regard, a form more consistent with the original purpose as a carrier of the drug would be the immunoglobulin Fc region from which the sugar chains have been removed or unglycosylated.

본 발명에서 당쇄의 제거(Deglycosylation)는 효소로 당을 제거한 Fc 영역을 말하며, 비당쇄화(Aglycosylation)"는 원핵동물, 바람직하게는 대장균에서 생산하여 당쇄화되지 않은 Fc 영역을 의미한다.In the present invention, deglycosylation refers to an Fc region in which sugar is removed by an enzyme, and aglycosylation " means an Fc region that is not glycosylated in prokaryotes, preferably in Escherichia coli.

한편, 면역글로불린 Fc 영역은 인간 또는 소, 염소, 돼지, 마우스, 래빗, 햄스터, 랫트, 기니아 픽 등의 동물기원일 수 있으며, 바람직하게는 인간기원이다. 또한, 면역글로불린 Fc 영역은 IgG, IgA, IgD, IgE, IgM 유래 또는 이들의 조합(combination) 또는 이들의 혼성(hybrid)에 의한 Fc 영역일 수 있다. 바람직하게는 인간 혈액에 가장 풍부한 IgG 또는 IgM 유래이며 가장 바람직하게는 리간드 결합 단백질의 반감기를 향상시키는 것으로 공지된 IgG 유래이다.On the other hand, the immunoglobulin Fc region may be a human or animal origin, such as cattle, goats, pigs, mice, rabbits, hamsters, rats, guinea pigs, preferably human origin. In addition, the immunoglobulin Fc region may be an Fc region by IgG, IgA, IgD, IgE, IgM derived or combinations thereof or hybrids thereof. It is preferably derived from IgG or IgM, which is most abundant in human blood and most preferably from IgG known to enhance the half-life of ligand binding proteins.

한편, 본 발명에서 조합(combination)이란 이량체 또는 다량체를 형성할 때, 동일 기원 단쇄 면역글로불린 Fc 영역을 암호화하는 폴리펩타이드가 상이한 기원의 단쇄 폴리펩타이드와 결합을 형성하는 것을 의미한다. 즉, IgG Fc, IgA Fc, IgM Fc, IgD Fc 및 IgE의 Fc 단편으로 이루어진 그룹으로부터 선택된 2개 이상의 단편으로부터 이량체 또는 다량체의 제조가 가능하다.On the other hand, in the present invention, the combination (combination) means that, when forming a dimer or multimer, the polypeptide encoding the single-chain immunoglobulin Fc region of the same origin forms a bond with the single-chain polypeptide of different origin. That is, it is possible to prepare dimers or multimers from two or more fragments selected from the group consisting of Fc fragments of IgG Fc, IgA Fc, IgM Fc, IgD Fc and IgE.

본 발명에서 "하이브리드(hybrid)"란 단쇄의 면역글로불린 Fc 영역 내에 2개 이상의 상이한 기원의 면역글로불린 Fc 단편에 해당하는 서열이 존재함을 의미하는 용어이다. 본 발명의 경우 여러 형태의 하이브리드가 가능하다. 즉, IgG Fc, IgM Fc, IgA Fc, IgE Fc 및 IgD Fc의 CH1, CH2, CH3 및 CH4로 이루어진 그룹으로부터 1개 내지 4개 도메인으로 이루어진 도메인의 하이브리드가 가능하며, 힌지를 포함할 수 있다.As used herein, the term "hybrid" is a term used to mean that there is a sequence corresponding to two or more immunoglobulin Fc fragments of different origins within an immunoglobulin Fc region of a single chain. In the case of the present invention, various types of hybrids are possible. That is, hybridization of a domain consisting of 1 to 4 domains from the group consisting of CH1, CH2, CH3 and CH4 of IgG Fc, IgM Fc, IgA Fc, IgE Fc and IgD Fc is possible, and may include a hinge.

한편, IgG 역시 IgG1, IgG2, IgG3 및 IgG4의 서브클래스로 나눌 수 있고 본 발명에서는 이들의 조합 또는 이들의 혼성화도 가능하다. 바람직하게는 IgG2 및 IgG4 서브클래스이며, 가장 바람직하게는 보체 의존적 독성(CDC, complementdependent cytotoxicity)과 같은 이펙터 기능(effector function)이 거의 없는 IgG4의 Fc 영역이다. 즉, 가장 바람직한 본 발명의 약물의 캐리어용 면역글로불린 Fc 영역은, 인간 IgG4 유래의 비-당쇄화된 Fc 영역이다. 인간 유래의 Fc 영역은 인간 생체에서 항원으로 작용하여 이에 대한 새로운 항체를 생성하는 등의 바람직하지 않은 면역 반응을 일으킬 수 있는 비-인간 유래의 Fc 영역에 비하여 바람직하다.
On the other hand, IgG can also be divided into subclasses of IgG1, IgG2, IgG3 and IgG4 and combinations or hybridization thereof are also possible in the present invention. Preferred are the IgG2 and IgG4 subclasses, most preferably the Fc region of IgG4 with little effector function such as complementdependent cytotoxicity (CDC). That is, the most preferred immunoglobulin Fc region for a carrier of the drug of the present invention is a non-glycosylated Fc region derived from human IgG4. Human-derived Fc regions are preferred over non-human-derived Fc regions that can cause undesirable immune responses, such as acting as antigens in human living organisms to produce new antibodies against them.

본 발명에서 비펩타이드성 중합체는 반복 단위가 2개 이상 결합된 생체 적합성 중합체를 의미하며, 상기 반복 단위들은 펩타이드 결합이 아닌 임의의 공유결합을 통해 서로 연결된다. In the present invention, non-peptidyl polymer means a biocompatible polymer having two or more repeating units bonded thereto, and the repeating units are connected to each other through any covalent bond, not a peptide bond.

본 발명에 사용가능한 비펩타이드성 중합체는 폴리에틸렌 글리콜, 폴리프로Non-peptidyl polymers usable in the present invention include polyethylene glycol, polyprop

필렌 글리콜, 에틸렌 글리콜과 프로필렌 글리콜의 공중합체, 폴리옥시 에틸화 폴리Pylene glycol, copolymer of ethylene glycol and propylene glycol, polyoxy ethylated poly

올, 폴리비닐 알콜, 폴리사카라이드, 덱스트란, 폴리비닐 에틸 에테르, PLA(폴리락All, polyvinyl alcohol, polysaccharide, dextran, polyvinyl ethyl ether, PLA (polylac

트산, polylactic acid) 및 PLGA(폴리락틱-글리콜산, polylactic-glycolic acid)와 같은 생분해성 고분자, 지질 중합체, 키틴류, 히아루론산 및 이들의 조합으로 구성 된 군으로부터 선택될 수 있으며, 바람직하게는 폴리에틸렌글리콜이다. 당해 분야에 이미 알려진 이들의 유도체 및 당해 분야의 기술 수준에서 용이하게 제조할 수 있는 유도체들도 본 발명의 범위에 포함된다. Biodegradable polymers such as acid, polylactic acid) and PLGA (polylactic-glycolic acid), lipid polymers, chitin, hyaluronic acid and combinations thereof, preferably polyethylene Glycol. Derivatives thereof known in the art and derivatives which can be easily prepared at the technical level in the art are included in the scope of the present invention.

기존 인프레임 퓨전(inframe fusion) 방법으로 제조된 융합 단백질에서 사용된 펩타이드성 링커의 단점은 생체 내에서 단백질분해효소에 의해 쉽게 절단되어 캐리어에 의한 활성 약물의 혈중반감기 증가 효과를 기대만큼 얻을 수 없다는 것이다. 그러나, 본 발명에서는 단백질분해효소에 저항성있는 중합체를 사용하여 캐리어와 유사하게 펩타이드의 혈중반감기를 유지할 수 있다. 그러므로, 본 발명에서 사용될 수 있는 비펩타이드성 중합체는 상기와 같은 역할, 즉 생체 내 단백질분해효소에 저항성 있는 중합체이면 제한없이 사용될 수 있다. 비펩타이드성 중합체의 분자량은 1 내지 100 kDa 범위, 바람직하게는 1 내지 20 kDa 범위이다. The disadvantage of the peptidic linker used in the fusion proteins prepared by the conventional inframe fusion method is that it is easily cleaved by proteases in vivo, so that the effect of increasing the blood half-life of the active drug by the carrier cannot be achieved as expected. will be. However, in the present invention, it is possible to maintain the blood half-life of the peptide similarly to the carrier by using a polymerase resistant polymer. Therefore, the non-peptidyl polymer that can be used in the present invention can be used without limitation as long as it is a polymer that is resistant to the above-described role, that is, protease in vivo. The molecular weight of the non-peptidyl polymer is in the range of 1 to 100 kDa, preferably in the range of 1 to 20 kDa.

또한, 상기 면역글로불린 Fc 영역과 결합되는 본 발명의 비펩타이드성 중합체는 한 종류의 중합체 뿐만 아니라 상이한 종류의 중합체들의 조합이 사용될 수도 있다.In addition, the non-peptidyl polymer of the present invention bound to the immunoglobulin Fc region may be used not only one kind of polymer but also a combination of different kinds of polymers.

본 발명에 사용되는 비펩타이드성 중합체는 면역글로불린 Fc 영역 및 단백질 약물과 결합될 수 있는 반응기를 가진다.Non-peptidyl polymers used in the present invention have a reactor that can be combined with immunoglobulin Fc regions and protein drugs.

상기 비 펩타이드성 중합체의 양 말단 반응기는 반응 알데히드 그룹, 프로피온 알테히드 그룹, 부틸 알테히드 그룹, 말레이미드(maleimide) 그룹 및 석시니미드(succinimide) 유도체로 이루어진 군으로부터 선택되는 것이 바람직하다. 상기에서, 석시니미드 유도체로는 석시니미딜 프로피오네이트, 히드록시 석시니미딜, 석시니미딜 카르복시메틸 또는 석시니미딜 카보네이트가 이용될 수 있다. 특히, 상기 비펩타이드성 중합체가 양 말단에 반응 알데히드 그룹의 반응기를 갖는 경우, 비특이적 반응을 최소화하고, 비펩타이드성 중합체의 양 말단에서 생리활성 폴리펩타이드 및 면역글로불린과 각각 결합하는데 효과적이다. 알데히드 결합에 의한 환원성 알킬화로 생성된 최종 산물은 아미드 결합으로 연결된 것보다 훨씬 안정적이다. 알데히드 반응기는 낮은 pH에서 N-말단에 선택적으로 반응하며, 높은 pH, 예를 들어 pH 9.0 조건에서는 라이신 잔기와 공유결합을 형성할 수 있다.Both terminal reactors of the non-peptidic polymer are preferably selected from the group consisting of reaction aldehyde groups, propion aldehyde groups, butyl aldehyde groups, maleimide groups and succinimide derivatives. In the above, succinimidyl propionate, hydroxy succinimidyl, succinimidyl carboxymethyl or succinimidyl carbonate may be used as the succinimid derivative. In particular, when the non-peptidyl polymer has a reactor of reactive aldehyde groups at both ends, it is effective to minimize nonspecific reactions and to bind bioactive polypeptides and immunoglobulins at each end of the non-peptidyl polymer, respectively. The final product resulting from reductive alkylation by aldehyde bonds is much more stable than those linked by amide bonds. The aldehyde reactor selectively reacts at the N-terminus at low pH and can form covalent bonds with lysine residues at high pH, for example pH 9.0 conditions.

상기 비펩타이드성 중합체의 양 말단 반응기는 서로 같거나 다를 수 있다. 예를 들어, 한쪽 말단에는 말레이미드 그룹을, 다른 쪽 말단에는 알데히드 그룹, 프로피온 알데히드 그룹, 또는 부틸 알데히드 그룹을 가질 수 있다. 양쪽 말단에 히드록시 반응기를 갖는 폴리에틸렌 글리콜을 비펩타이드성 중합체로 이용하는 경우에는 공지의 화학반응에 의해 상기 히드록시기를 상기 다양한 반응기로 활성화하거나, 상업적으로 입수 가능한 변형된 반응기를 갖는 폴리에틸렌 글리콜을 이용하여 본 발명의 단쇄 인슐린 아날로그 결합체를 제조할 수 있다. Both terminal reactors of the non-peptidyl polymer may be the same or different from each other. For example, one end may have a maleimide group and the other end may have an aldehyde group, a propion aldehyde group, or a butyl aldehyde group. When polyethylene glycol having a hydroxy reactor at both ends is used as a non-peptidyl polymer, the hydroxy group may be activated into the various reactors by a known chemical reaction, or a polyethylene glycol having a commercially available modified reactor may be used. The short chain insulin analogue conjugates of the invention can be prepared.

이러한 본 발명의 단쇄 인슐린 아날로그 결합체는 에너지 대사 및 당 대사와 같은 기존의 인슐린의 생체 내 활성이 유지될 뿐만 아니라 인슐린 아날로그의 혈중 반감기 및 이로 인한 상기 펩타이드의 생체 내 효력 지속효과가 획기적으로 증가하게 하므로, 당뇨(Diabetes)의 치료에 유용하다.
The short-chain insulin analogue conjugate of the present invention not only maintains the in vivo activity of the existing insulin such as energy metabolism and sugar metabolism, but also significantly increases the blood half-life of the insulin analogue and the sustained effect of the peptide in vivo. It is useful for the treatment of diabetes.

또한, 본 발명의 또 다른 양태로서, 본 발명은 (1) 양 말단에 알데히드, 말레이미드, 또는 석시니미드 유도체 반응기를 갖는 비펩타이드성 중합체를 사용하여 프로인슐린 아날로그의 아민 그룹 또는 티올그룹에 공유결합으로 연결하는 단계; (2) 상기 (1)의 반응 혼합물로부터 아미노말단 이외의 위치에 비펩타이드성 중합체가 공유결합된 단쇄 인슐린 아날로그를 포함하는 연결체를 분리하는 단계; 및 (3) 분리된 연결체의 비펩타이드성 중합체의 다른 쪽 말단에 면역글로불린 Fc 영역을 공유결합으로 연결하여 비펩타이드성 중합체의 양쪽 말단이 각각 면역글로불린 Fc 영역 및 프로인슐린 아날로그와 결합된 펩타이드 결합체를 생성하는 단계를 포함하는 프로인슐린 아날로그 결합체의 제조방법을 제공한다. In addition, as another embodiment of the present invention, the present invention is (1) a non-peptidyl polymer having an aldehyde, maleimide, or succinimide derivative reactor at both ends is shared with the amine group or thiol group of the proinsulin analogue. Connecting in a bond; (2) separating a linkage from the reaction mixture of (1) comprising a short-chain insulin analog in which a non-peptidyl polymer is covalently bonded to a position other than the amino terminus; And (3) a peptide conjugate in which the immunoglobulin Fc region is covalently linked to the other end of the non-peptidyl polymer of the isolated linker so that both ends of the non-peptidyl polymer are linked to the immunoglobulin Fc region and the proinsulin analog, respectively. It provides a method for producing a proinsulin analogue conjugate comprising the step of producing a.

본 발명에서 용어 "연결체"란 비펩타이드성 중합체와 단쇄 인슐린 아날로그 만이 공유결합으로 연결된 중간체로서, 이후 이 연결체에 있는 비펩타이드성 중합체의 단쇄 인슐린 아날로그가 연결되지 않은 다른 쪽 말단에 면역글로불린 Fc 영역을 결합시키게 된다.As used herein, the term "linker" refers to an intermediate in which only a non-peptide polymer and a short-chain insulin analog are covalently linked to each other, followed by an immunoglobulin Fc at the other end to which the short-chain insulin analog of the non-peptide polymer in the linker is not linked. Join the regions.

또한, 바람직한 일 양태로서 본 발명은 (1) 양 말단에 알데히드 반응기를 갖는 비펩타이드성 중합체를 프로인슐린 아날로그의 라이신 잔기에 공유결합으로 연결시키는 단계; (2) (1)의 반응 혼합물로부터 라이신잔기에 비펩타이드성 중합체가 공유결합된 프로인슐린 아날로그를 포함하는 연결체를 분리하는 단계; 및 (3) 분리된 연결체의 비펩타이드성 중합체의 다른쪽 말단에 면역글로불린 Fc 영역을 공유결합으로 연결하여 비펩타이드성 중합체의 양쪽 말단이 각각 면역글로불린 Fc 영역 및 프로인슐린 분비 펩타이드와 결합된 단백질결합체를 생성하는 단계를 포함하는 제조방법을 제공한다. In another preferred embodiment, the present invention provides a method for preparing a non-peptidyl polymer having an aldehyde reactor at both ends by covalently linking a lysine residue of a proinsulin analogue; (2) separating from the reaction mixture of (1) a linker comprising a proinsulin analog in which a non-peptidyl polymer is covalently bonded to a lysine residue; And (3) a covalent bond of an immunoglobulin Fc region to the other end of the non-peptidyl polymer of the isolated linker, so that both ends of the non-peptidyl polymer are bound to the immunoglobulin Fc region and the proinsulin secreting peptide, respectively. It provides a manufacturing method comprising the step of producing a conjugate.

더욱 바람직하게는 (1)의 비펩타이드성 중합체 및 프로인슐린 분비 펩타이드의 라이신 잔기는 pH 7.5 이상에서 연결된다.
More preferably, the lysine residues of the non-peptidyl polymer and proinsulin secreting peptide of (1) are linked at pH 7.5 or above.

또한, 본 발명의 또 다른 양태로서, 본 발명의 프로인슐린 아날로그 결합체를 포함하는 당뇨병 치료용 약제학적 조성물을 제공한다.In another aspect, the present invention provides a pharmaceutical composition for treating diabetes comprising the proinsulin analogue conjugate of the present invention.

본 발명의 결합체를 포함한 약제학적 조성물은 약제학적으로 허용가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구투여시에는 결합제, 활택제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소 및 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장화제 및 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제 및 보존제 등을 사용할 수 있다. 본 발명의 약제학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서, 서스펜션, 시럽 및 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 환약, 캡슐 및 서방형 제제 등으로 제형화 할 수 있다. Pharmaceutical compositions comprising the conjugates of the invention may comprise a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers can be used as oral administration binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments and flavoring agents, and in the case of injectables, buffers, preservatives, analgesic A topical agent, a solubilizer, an isotonicity agent, a stabilizer, etc. can be mixed and used, and in case of topical administration, a base, an excipient, a lubricant, a preservative, etc. can be used. The formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, oral administration may be in the form of tablets, troches, capsules, elixirs, suspensions, syrups and wafers, and in the case of injections, they may be prepared in unit dosage ampoules or multiple dosage forms. Others may be formulated into solutions, suspensions, tablets, pills, capsules and sustained release preparations.

한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다.Examples of suitable carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil and the like can be used.

또한, 충진제, 항응집제, 윤활제, 습윤제, 향료 및 방부제 등을 추가로 포함할 수 있다.In addition, fillers, anti-coagulants, lubricants, wetting agents, fragrances and preservatives may be further included.

본 발명에 따른 결합체는 당뇨 치료에 유용한바, 이를 포함하는 약제학적 조성물을 투여함으로써, 상기 질환의 치료를 도모할 수 있다.The conjugate according to the present invention is useful for treating diabetes, and by administering a pharmaceutical composition comprising the same, the treatment of the disease can be achieved.

본 발명에서 "투여"는, 어떠한 적절한 방법으로 환자에게 소정의 물질을 도입하는 것을 의미하며, 상기 결합체의 투여 경로는 약물이 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 복강 내 투여, 정맥내 투여, 근육내 투여, 피하 투여, 피내 투여, 경구 투여, 국소 투여, 비내 투여, 폐내 투여 및 직장 내 투여 등이 될 수 있으나, 이에 제한되지는 않는다. 그러나 경구 투여시, 펩타이드는 소화가 되기 때문에 경구용 조성물은 활성 약제를 코팅하거나 위에서의 분해로부터 보호되도록 제형화 하는 것이 바람직하다. 바람직하게는 주사제 형태로 투여될 수 있다. 또한, 약제학적 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.In the present invention, "administration" means introducing a predetermined substance into a patient by any suitable method, and the route of administration of the conjugate may be administered through any general route as long as the drug can reach the target tissue. Intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, nasal administration, pulmonary administration and rectal administration, and the like, but are not limited thereto. However, upon oral administration, since the peptide is digested, it is desirable to formulate the oral composition to coat the active agent or to protect it from degradation in the stomach. It may preferably be administered in the form of an injection. In addition, the pharmaceutical composition may be administered by any device in which the active agent may migrate to the target cell.

또한, 본 발명의 약제학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별 및 체중 및 질환의 중등도 등의 여러 관련 인자와 함께, 활성성분인 약물의 종류에 따라 결정된다. 본 발명의 약제학적 조성물은 생체 내 지속성 및 역가가 우수하므로, 본 발명의 약제학적 제제의 투여 횟수 및 빈도를 현저하게 감소시킬 수 있다. In addition, the pharmaceutical composition of the present invention is determined according to the type of drug that is the active ingredient, along with various related factors such as the disease to be treated, the route of administration, the age, sex and weight of the patient and the severity of the disease. Since the pharmaceutical composition of the present invention has excellent persistence and titer in vivo, the frequency and frequency of administration of the pharmaceutical preparations of the present invention can be significantly reduced.

본 발명의 단쇄 인슐린 아날로그 결합체는 생체 내에서 안정적인 혈당 강하 효과를 유지하고, 혈중 반감기가 현저히 증가하여 인슐린의 투여 편의성 및 부작용을 개선하는 효과가 있다. The short-chain insulin analogue conjugate of the present invention maintains a stable hypoglycemic effect in vivo, and has a significant increase in blood half-life, thereby improving convenience and side effects of insulin administration.

도 1은 프로인슐린 아날로그 유전자 증폭 모식도이다.
도 2는 A-C△KR-B 프로인슐린-PEG-Fc를 RP HPLC로 분석한 결과이다.
도 3은 A-C△KR-B 프로인슐린-PEG-Fc를 SE HPLC로 분석한 결과이다.
도 4는 A-C△KR-B 프로인슐린-PEG-Fc를 12% SDS-PAGE로 분석한 결과이다.
도 5는 A-C△KR-B 프로인슐린-PEG-Fc를 RP HPLC로 분석한 결과이다.
도 6는 A-C△KR-B 프로인슐린-PEG-Fc를 SE HPLC로 분석한 결과이다.
도 7은 A-C△KR-B 프로인슐린-PEG-Fc를 12% SDS-PAGE로 분석한 결과이다.
도 8은 A-C△KR-B 프로인슐린-PEG-Fc의 STZ 랫트에서의 효력 결과이다.
1 is a schematic diagram of proinsulin analog gene amplification.
2 shows the results of analysis of ACΔKR-B proinsulin-PEG-Fc by RP HPLC.
Figure 3 shows the result of analysis of ACΔKR-B proinsulin-PEG-Fc by SE HPLC.
4 shows the analysis of ACΔKR-B proinsulin-PEG-Fc by 12% SDS-PAGE.
5 shows the results of analyzing ACΔKR-B proinsulin-PEG-Fc by RP HPLC.
6 shows the results of analysis of ACΔKR-B proinsulin-PEG-Fc by SE HPLC.
Figure 7 shows the analysis of ACΔKR-B proinsulin-PEG-Fc by 12% SDS-PAGE.
8 is the potency result of STZ rats of ACΔKR-B proinsulin-PEG-Fc.

이하, 하기 실시예에 의하여 본 발명을 보다 상세하게 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐 본 발명의 범위가 이들로 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are only for illustrating the present invention and the scope of the present invention is not limited thereto.

실시예Example 1:  One: 단쇄Short chain 인슐린 아날로그의 발현 벡터의 제작 Production of Expression Vectors of the Insulin Analogue

1. 프로인슐린 아날로그 (A-C-B 프로인슐린 아날로그) 발현 벡터의 제작1. Construction of Proinsulin Analog (A-C-B Proinsulin Analog) Expression Vectors

사람의 인슐린 아날로그, 프로인슐린 아날로그를 암호화하는 발현 벡터를 제작하였다. 상기 발현 벡터는 인슐린 A쇄의 아미노 말단을 자유롭게 하기 위하여 천연 프로인슐린 유전자의 서열 (B쇄-C 펩타이드-A쇄, 서열 번호 1, 2)과 다른 프로인슐린 아날로그 (A쇄-C 펩타이드-B쇄, 서열 번호 3, 4)을 암호화하는 유전자 서열을 포함하며, 다음과 같이 제조하였다. Expression vectors encoding human insulin analogues and proinsulin analogues were constructed. The expression vector has a sequence of natural proinsulin genes (B chain-C peptide-A chain, SEQ ID NO: 1, 2) and other proinsulin analogues (A chain-C peptide-B chain) to free the amino terminus of insulin A chain. , Comprising the gene sequence encoding SEQ ID NOs: 3, 4), was prepared as follows.

86개의 아미노산을 암호화하는 프로인슐린 아날로그 발현 벡터의 제작을 위하여, 보고 된 프로인슐린 유전자 서열(NM_000207.2, from NCBI)을 바탕으로 아래와 같은 6개의 올리고 뉴클레오타이드를 합성하고, 프로인슐린 cDNA (입수처 : Origene)를 주형으로 하여 A쇄 및 C 펩타이드 그리고 B쇄를 PCR 방법으로 각각 증폭한 뒤, 3개의 PCR 증폭 산물과 올리고 뉴클레오타이드를 함께 섞어 PCR 수행하여 프로인슐린 아날로그 유전자를 합성하였다. To prepare a proinsulin analog expression vector encoding 86 amino acids, the following six oligonucleotides were synthesized based on the reported proinsulin gene sequence (NM_000207.2, from NCBI), and a proinsulin cDNA (obtained from: After amplifying the A chain, the C peptide, and the B chain using PCR as a template, PCR was performed by mixing three PCR amplification products and oligonucleotides together to synthesize a proinsulin analog gene.

먼저, 프로인슐린 아날로그 유전자의 A쇄 합성을 위하여, 순방향 올리고 뉴클레오타이드(서열번호: 7)는 개시 ATG 코돈 및 NdeI 제한 효소 부위를 포함하도록 합성하고, 역방향 올리고 뉴클레오타이드(서열번호: 8)는 A쇄의 3‘ 말단 부위 서열과 C 펩타이드 5’ 부위 서열을 삽입하도록 합성하였다. C 펩타이드를 암호화하는 유전자를 합성하기 위하여 순방향 올리고 뉴클레오타이드(서열번호: 9)는 A쇄의 아미노말단 서열 및 C 펩타이드의 서열을 그리고 역방향 올리고 뉴클레오타이드(서열번호: 10)는 C 펩타이드 3‘ 말단 서열 및 B쇄의 5‘ 말단 서열을 포함하도록 합성하였다. B쇄를 암호화하는 유전자를 합성하기 위하여 순방향 올리고 뉴클레오타이드(서열번호: 11)는 C 펩타이드의 3’ 말단 서열과 B쇄의 서열을 그리고 역방향 올리고 뉴클레오타이드(서열번호: 12)는 B쇄의 5‘ 말단 서열과 제한 효소 BamH I 서열을 포함하도록 합성하였다. First, for the A chain synthesis of the proinsulin analog gene, the forward oligonucleotide (SEQ ID NO: 7) is synthesized to include the initiating ATG codon and the NdeI restriction enzyme site, and the reverse oligo nucleotide (SEQ ID NO: 8) is derived from the A chain The 3 'terminal region sequence and the C peptide 5' region sequence were inserted. To synthesize a gene encoding a C peptide, the forward oligonucleotide (SEQ ID NO: 9) is the amino terminal sequence of the A chain and the sequence of the C peptide, and the reverse oligo nucleotide (SEQ ID NO: 10) is the C peptide 3 'terminal sequence and It was synthesized to include the 5 'terminal sequence of the B chain. To synthesize the gene encoding B chain, the forward oligo nucleotide (SEQ ID NO: 11) is the 3 'terminal sequence of the C peptide and the sequence of the B chain, and the reverse oligo nucleotide (SEQ ID NO: 12) is the 5' terminal of the B chain. Sequence and the restriction enzyme BamH I sequence were synthesized.

상기의 올리고 뉴클레오타이드를 이용하여 각각의 유전자를 증폭한 뒤, 각각의 PCR 증폭 산물과 서열 번호 7로 기재되는 올리고 뉴클레오타이드와 서열번호 12로 기재되는 올리고 뉴클레오타이드를 함께 섞어서 최종 A쇄- C 펩타이드 -B쇄의 서열을 가지는 프로인슐린 아날로그를 합성하였다 (도 1). After amplifying each gene using the oligonucleotides described above, the final A chain-C peptide-B chain was mixed by mixing each PCR amplification product with the oligonucleotide represented by SEQ ID NO: 7 and the oligonucleotide represented by SEQ ID NO: 12 together. A proinsulin analogue having the sequence of was synthesized (FIG. 1).

상기의 프로인슐린 아날로그의 증폭을 위한 PCR 조건은 어닐링 온도 60℃에서 20초로 하였으며, 연장은 68℃에서 20초로 진행하였다.
PCR conditions for the amplification of the proinsulin analog was 20 seconds at the annealing temperature 60 ℃, the extension was carried out at 68 ℃ 20 seconds.

5‘ GGAATTCCATATGGGCATTGTGGAACAATGCTGT 3’ (서열 번호 7)    5 'GGAATTCCATATGGGCATTGTGGAACAATGCTGT 3' (SEQ ID NO: 7)

5‘ CTGCCTCCCGGCGGTTGCAGTAGTTCTCCAGCTG 3’ (서열 번호 8)    5 'CTGCCTCCCGGCGGTTGCAGTAGTTCTCCAGCTG 3' (SEQ ID NO: 8)

5‘ GAACTACTGCAACCGCCGGGAGGCAGAGGACCTG 3’ (서열 번호 9)    5 'GAACTACTGCAACCGCCGGGAGGCAGAGGACCTG 3' (SEQ ID NO: 9)

5‘ GTTGGTTCACAAAACGCTTCTGCAGGGACCCCTC 3’ (서열 번호 10)    5 'GTTGGTTCACAAAACGCTTCTGCAGGGACCCCTC 3' (SEQ ID NO: 10)

5‘ CCTGCAGAAGCGTTTTGTGAACCAACACCTGTGC 3’ (서열 번호 11)    5 'CCTGCAGAAGCGTTTTGTGAACCAACACCTGTGC 3' (SEQ ID NO: 11)

5‘ CGCGGATCCCTAGGTCTTGGGTGTGTAGAAGAAG 3’ (서열 번호 12)
5 'CGCGGATCCCTAGGTCTTGGGTGTGTAGAAGAAG 3' (SEQ ID NO: 12)

상기에서 얻어진 프로인슐린 아날로그 단편 DNA(285bp)을 pET22b 벡터(입수처: Novagen)에 클로닝하였다. 프로인슐린 아날로그를 세포내의 봉입체의 형태로 발현시키기 위하여 pET22b 벡터를 제한 효소 NdeI 및 BamHI로 처리하여 신호 서열을 제거하고, 프로인슐린 아날로그 PCR 산물을 동일한 제한효소 Nde I과 BamHI으로 처리하고 분리된 각각의 DNA를 T4 DNA 리가제를 이용하여, pET22b 클로닝 벡터에 삽입하였다. 상기 결과로 얻어진 발현벡터를 p22b-InvPI 명명하였다.The proinsulin analog fragment DNA (285bp) obtained above was cloned into pET22b vector (Novagen). To express the proinsulin analogs in the form of intracellular inclusion bodies, the pET22b vector was treated with restriction enzymes NdeI and BamHI to remove signal sequences, and the proinsulin analog PCR product was treated with the same restriction enzymes Nde I and BamHI and separated from each other. DNA was inserted into the pET22b cloning vector using T4 DNA ligase. The resulting expression vector was named p22b-InvPI.

상기 p22b-InvPI 발현 벡터는 T7 프로모터의 조절 하에 서열번호: 4의 아미노산 서열을 암호화하며, 숙주 세포 내에서 프로인슐린 아날로그 단백질을 봉입체의 형태로 발현시켰다.
The p22b-InvPI expression vector encodes the amino acid sequence of SEQ ID NO: 4 under the control of the T7 promoter and expresses the proinsulin analog protein in the form of inclusion bodies in the host cell.

2. 55번 라이신 잔기와 56번 아르기닌 잔기가 제거 된 프로인슐린 아날로그 (A-C△KR-B 프로인슐린) 발현 벡터의 제작2. Construction of a Proinsulin Analogue (A-CΔKR-B Proinsulin) Expression Vector with 55 Lysine and 56 Arginine Residues Removed

55번 라이신 잔기와 56번 아르기닌 잔기를 제거한 프로인슐린 아날로그 (A-C△KR-B 프로인슐린; 서열 번호 5, 6)을 제작하기 위하여, 아래와 같은 2개의 추가적인 올리고 뉴클레오타이드를 합성하였다.
In order to construct a proinsulin analogue (ACΔKR-B proinsulin; SEQ ID NOs: 5, 6) from which lysine residues 55 and 56 arginine residues were removed, two additional oligonucleotides were synthesized as follows.

5‘ GGGGTCCCTGCAGTTTGTGAACCAACACCTGTGC 3’ (서열번호 13)    5 'GGGGTCCCTGCAGTTTGTGAACCAACACCTGTGC 3' (SEQ ID NO: 13)

5‘ GTTGGTTCACAAACTGCAGGGACCCCTCCAGGGC 3’ (서열번호 14)
5 'GTTGGTTCACAAACTGCAGGGACCCCTCCAGGGC 3' (SEQ ID NO: 14)

서열 번호 13으로 기재되는 순 방향 올리고 뉴클레오타이드 및 서열 번호 14으로 기재되는 역 방향 올리고 뉴클레오타이드는 C 펩타이드의 3‘ 말단 서열 중 라이신과 아르기닌을 암호화하는 AAG CGT 서열을 제거하고 합성하였다. B쇄 34번 라이신 잔기와 35번 아르기닌 잔기가 제거된 변이체의 증폭 및 발현 벡터의 제작은 상기 실시예에 기재 된 조건과 동일한 내용으로 진행 하였다. 상기의 방법으로 제작한 프로인슐린 아날로그 발현벡터를 22b-InvPI △KR 이라고 명명하였다. The forward oligonucleotides set forth in SEQ ID NO: 13 and the reverse oligonucleotides set forth in SEQ ID NO: 14 removed and synthesized the AAG CGT sequence encoding lysine and arginine in the 3 'terminal sequence of the C peptide. Amplification of the variant from which the B-chain 34 lysine residue and the 35-arginine residue were removed and the production of the expression vector were performed under the same conditions as described in the above examples. The proinsulin analog expression vector produced by the above method was named 22b-InvPI ΔKR.

상기 p22b-InvPI △KR 발현 벡터는 T7 프로모터의 조절 하에 서열번호: 6의 아미노산 서열을 암호화하며, 숙주 세포내에서 프로인슐린 아날로그 단백질을 봉입체의 형태로 발현시켰다.
The p22b-InvPI ΔKR expression vector encodes the amino acid sequence of SEQ ID NO: 6 under the control of the T7 promoter and expresses the proinsulin analog protein in the form of inclusion bodies in the host cell.

실시예 2: 재조합 융합 펩타이드의 발현Example 2: Expression of Recombinant Fusion Peptides

T7 프로모터 조절하의 재조합 프로인슐린 아날로그 발현을 수행 하였다. 각각의 재조합 프로인슐린 아날로그 발현 벡터로 E.coli BL21DE3(E. coli B F-dcm ompT hsdS(rB-mB-) gal λ(DE3); 노바젠)을 형질전환하였다. 형질 전환 방법은 노바젠사에서 추천하는 방법을 이용하였다. 각 재조합 발현 벡터가 형질 전환된 각각의 단일 콜로니를 취하여 암피실린(50ug/ml)이 포함된 2X 루리아 브로스(Luria Broth) 배지에 접종하고, 37℃에서 15시간 배양하였다. 재조합 균주 배양액과 30% 글리세롤이 포함된 2X LB 배지를 1:1(v/v)의 비율로 혼합하여 각 1ml씩 cryo-튜브에 분주하고, -140℃에 보관하였다. 이를 재조합 융합 단백질의 생산을 위한 세포 스톡(cell stock)으로 사용하였다.
Recombinant proinsulin analog expression was performed under T7 promoter control. Each recombinant proinsulin analog expression vector was transformed with E. coli BL21DE3 ( E. coli B F-dcm ompT hsdS (rB-mB-) gal λ (DE3); Novagen). The transformation method used a method recommended by Novagen. Each single colony transformed with each recombinant expression vector was taken and inoculated in 2X Luria Broth medium containing ampicillin (50ug / ml) and incubated at 37 ° C for 15 hours. Recombinant strain culture and 2X LB medium containing 30% glycerol were mixed at a ratio of 1: 1 (v / v), and each 1 ml was aliquoted into cryo-tubes and stored at -140 ° C. This was used as a cell stock for the production of recombinant fusion proteins.

재조합 프로인슐린 아날로그들의 발현을 위하여, 각 세포 스톡 1 비알을 녹여 500ml의 2X LB에 접종하고 37℃에서 14~16시간 동안 진탕 배양하였다. OD.600nm의 값이 5.0 이상을 나타내면 배양을 종료하고, 이를 종 배양액으로 사용하였다. 5L 발효기(MDL-8C, B.E.MARUBISHI, 일본)를 이용하여 종 배양액을 1.7L의 발효 배지에 접종하고 초기 배스 발효를 시작하였다. 배양조건은 온도 37℃, 공기량 20 sL/분(1vvm), 교반 속도 500rpm 그리고 30% 암모니아수를 사용하여 pH 6.70으로 유지시켰다. 발효 진행은 배양액내의 영양소가 제한되었을 때, 추가배지(feeding solution)을 첨가하여 유가배양을 진행하였다. 균주의 성장은 OD 값에 의해 모니터링하며, OD 값이 70이상에서 최종 농도 100uM의 IPTG로 도입하였다. 배양은 도입 후 약 23~25시간까지 더 진행하며, 배양 종료 후, 원심 분리기를 사용하여 재조합 균주를 수획하여 사용 시까지 -80℃에 보관하였다.
For the expression of recombinant proinsulin analogs, 1 vial of each cell stock was dissolved, inoculated in 500 ml of 2 × LB, and incubated at 37 ° C. for 14-16 hours. When the value of OD.600 nm showed 5.0 or more, the culture was terminated, and this was used as the seed culture solution. Seed cultures were inoculated into 1.7 L fermentation medium using a 5 L fermenter (MDL-8C, BEMARUBISHI, Japan) and initial bath fermentation started. Culture conditions were maintained at a pH of 6.70 using a temperature of 37 ℃, air volume 20 sL / min (1vvm), stirring speed 500rpm and 30% aqueous ammonia. Fermentation proceeded when the nutrients in the culture was limited, the addition of feeding medium (feeding solution) was carried out in the value-added culture. The growth of the strains was monitored by OD values and introduced with IPTG at a final concentration of 100 uM at OD values of 70 or higher. The culture was further proceeded to about 23-25 hours after introduction, and after completion of the culture, the recombinant strain was harvested using a centrifuge and stored at -80 ° C until use.

실시예Example 3: 재조합 프로인슐린 아날로그의 회수 및 설폰화( 3: Recovery and sulfonation of recombinant proinsulin analogs ( sulfonationsulfonation ))

상기 실시예 2에서 발현시킨 재조합 프로인슐린 아날로그들을 가용성 형태로 바꾸기 위해 세포를 파쇄하고 리폴딩하였다. 세포 펠렛 200g(wet weight)을 3L 용해 완충액(50mM Tris-HCl (pH9.0), 1mM EDTA(pH8.0), 0.2M NaCl 및 0.5% 트리톤 X-100)에 재부유하였다. 미세용액화(Microfluidizer) 프로세서 M-110EH(AC Technology Corp. Model M1475C)를 이용하여 15,000psi 압력으로 수행하여 세포를 파쇄하였다. 파쇄된 세포 용해물을 7,000rpm으로 4℃에서 20분 원심분리하여 상층액을 버리고, 3L 세척완충액(0.25% 트리톤 X-100 및 20mM Tris-HCl (pH7.5), 1M NaCl)에 재부유하였다. 7,000rpm으로 4℃에서 20분 동안 원심분리하여 펠렛을 20mM 트리스-HCl(pH7.5) 또는 증류수에 재부유한 후, 동일한 방법으로 원심분리하였다. 펠렛을 취하여 2L 가용화 완충액(8M 우레아, 20mM 트리스-HCl (pH9.0, 1mM EDTA))에 재부유하여 상온에서 2시간 동안 교반하였다. 가용화된 재조합 프로인슐린 아날로그의 설폰화(sulfonation)를 위하여 7,000rpm으로 4℃에서 30분 동안 원심분리한 후 상층액을 취하여, 여기에 최종 농도 0.3M의 아황산 나트륨(sodium sulfite)와 0.1M 사티온산 나트륨(sodium tetrathionate)을 넣어주고 3시간 동안 추가로 교반하여 프로인슐린 아날로그의 시스테인잔기들을 설폰화 시켰다. 20L의 완충액(10mM ammonium acetate, pH7.4)을 연동 펌프(peristaltic pump)를 이용하여 1000ml/hr의 유속으로 20시간 동안 첨가 한 후, 6N HCl을 첨가하여 pH를 3.6으로 낮추어 반응을 정지시켰다.
Cells were disrupted and refolded to convert the recombinant proinsulin analogs expressed in Example 2 into soluble form. 200 g (wet weight) of the cell pellet were resuspended in 3 L lysis buffer (50 mM Tris-HCl (pH 9.0), 1 mM EDTA (pH 8.0), 0.2 M NaCl and 0.5% Triton X-100). Cells were disrupted by performing at 15,000 psi pressure using a Microfluidizer processor M-110EH (AC Technology Corp. Model M1475C). The lysed cell lysates were centrifuged at 7,000 rpm at 4 ° C. for 20 minutes to discard supernatant and resuspended in 3 L wash buffer (0.25% Triton X-100 and 20 mM Tris-HCl (pH 7.5), 1 M NaCl). . The pellet was resuspended in 20 mM Tris-HCl (pH 7.5) or distilled water by centrifugation at 7,000 rpm for 20 minutes at 4 ° C, and then centrifuged in the same manner. The pellet was taken and resuspended in 2L solubilization buffer (8M urea, 20 mM Tris-HCl (pH9.0, 1 mM EDTA)) and stirred at room temperature for 2 hours. For sulfonation of the solubilized recombinant proinsulin analogue, centrifuged at 7,000 rpm for 30 minutes at 4 ° C, and then the supernatant was taken, and the final concentration was 0.3M sodium sulfite and 0.1M sationic acid. Sodium tetrathionate was added and further stirred for 3 hours to sulfonate the cysteine residues of the proinsulin analogue. 20L buffer (10 mM ammonium acetate, pH7.4) was added at a flow rate of 1000 ml / hr for 20 hours using a peristaltic pump, and then the reaction was stopped by adding 6N HCl to pH 3.6 to stop the reaction.

실시예Example 4: 시아노겐 브로마이드 처리 4: cyanogen bromide treatment

침전된 프로인슐린 아날로그을 1.8L의 70% 개미산(formic acid)으로 용해시키고, 단백질양의 100몰비에 해당하는 시아노겐 브로마이드(CNBr)을 첨가하여 25℃의 암실에서 16시간이상 반응 하였다. 반응 종료 후, 감압증류 장치(Rotavapor R210)를 이용하여 완전히 건조 시킨 다음 요소가 포함 된 완충액(7.5M urea, 20mM Bis-Tris, pH6.0)으로 용해시켰다. 프로인슐린 아날로그의 정제를 위하여 요소 완충액으로 용해시킨 시료를 0.45um의 크기를 가진 필터를 통과시켜 이물질을 제거하였다.
The precipitated proinsulin analog was dissolved in 1.8L of 70% formic acid, and cyanogen bromide (CNBr) corresponding to 100 molar ratio of protein was added and reacted in the dark at 25 ° C. for more than 16 hours. After the reaction was completed, completely dried using a reduced pressure distillation apparatus (Rotavapor R210) and then dissolved in a buffer containing urea (7.5M urea, 20mM Bis-Tris, pH6.0). For purification of the proinsulin analogue, a sample dissolved in urea buffer was removed through a 0.45 um filter to remove foreign substances.

실시예Example 5: 음이온 크로마토그래피 정제 5: Anion Chromatography Purification

상기 실시예 4에서 수득한 시료에서 시아노겐 브로마이드로 절단한 프로인슐린 아날로그 S-설포네이트만을 순수 분리하기 위해 음이온 교환 컬럼(HiTrap Q HP; Amersham Bioscience AB)으로 정제하였다. 먼저, 완충 용액 A(7.5M urea, 20mM Bis-Tris, pH6.0)를 약 5ml/min의 유속으로 컬럼으로 흘려 평형을 시킨 뒤, 시아노겐 브로마이드 절단 시료를 컬럼에 흘려 레진에 결합시키고, 완충 용액 B (7.5M urea, 20mM Bis-Tris, pH6.0, 0.5M NaCl)를 0-100% 구배로 10 컬럼 볼륨만큼 흘려주어 재조합 프로인슐린 아날로그를 용출하였다. 용출 구간은 10-20 ms/cm 이었다.
The sample obtained in Example 4 was purified by an anion exchange column (HiTrap Q HP; Amersham Bioscience AB) to purely separate only the proinsulin analog S-sulfonate cut with cyanogen bromide. First, buffer solution A (7.5M urea, 20 mM Bis-Tris, pH6.0) was flowed to the column at a flow rate of about 5 ml / min to equilibrate, and then the cyanogen bromide cleaved sample was flowed to the column to bind to the resin, and buffered. Solution B (7.5 M urea, 20 mM Bis-Tris, pH 6.0, 0.5 M NaCl) was eluted with 10 column volumes with a 0-100% gradient to elute the recombinant proinsulin analog. The elution section was 10-20 ms / cm.

실시예Example 6: 프로인슐린 아날로그의 재접힘( 6: Refolding of Proinsulin Analogues refoldingrefolding ))

디솔팅 컬럼(Desalting column)으로 용출 된 시료에서 염을 제거하고, 완충 용액(1M urea, 50mM Glycine, ph10.6)으로 교체하였다. 완충 용액내의 프로인슐린 아날로그의 농도는 1mg/ml이 되도록 정용 여과법(Diafiltration)을 이용하여 조절하였다. 완충 용액으로 전환 된 프로인슐린 아날로그 S-설포네이트 시료의 재 접힘(refolding)을 통한 프로인슐린 아날로그의 전환을 위하여, 시스테인 또는 시스테인 염화수소(Cystein-HCl)를 최종 농도 1mM 되도록 첨가한 후, 4℃에서 24시간 동안 교반하였다. 24시간 후, 6N HCl을 첨가하여 pH를 3.0으로 낮추어 반응을 종료한 뒤, HPLC 및 SDS-PAGE로 재 접힘을 분석하였다.
Salt was removed from the sample eluted with a desalting column and replaced with a buffer solution (1M urea, 50 mM Glycine, ph10.6). The concentration of proinsulin analog in the buffer solution was adjusted using diafiltration to 1 mg / ml. For conversion of the proinsulin analogues by refolding the proinsulin analog S-sulfonate sample converted to the buffer solution, cysteine or cysteine hydrogen chloride (Cystein-HCl) was added to a final concentration of 1 mM and then at 4 ° C. Stir for 24 hours. After 24 hours, the reaction was terminated by adding 6N HCl to lower the pH to 3.0 and analyzed for refolding by HPLC and SDS-PAGE.

실시예Example 7: 소수성  7: hydrophobicity 컬럼column 크로마토그래피 정제 Chromatography Purification

디솔팅 컬럼(Desalting column)으로 용출 된 시료에서 염을 제거하고, 완충 용액(1M urea, 50mM Glycine, ph10.6)으로 교체하였다. 이 시료를 소수성 성질을 이용한 페닐 컬럼(phenyl HP; Amersham Bioscience AB)에 적용하여 프로인슐린 아날로그을 정제 하였다. Salt was removed from the sample eluted with a desalting column and replaced with a buffer solution (1M urea, 50 mM Glycine, ph10.6). This sample was applied to a phenyl column (phenyl HP; Amersham Bioscience AB) using hydrophobic properties to purify the proinsulin analogue.

완충 용액 A(10mM Tris-Hcl, pH 7.5, 0.6M ammonium sulfate)으로 평형화된 Phenyl HP 컬럼에 로딩하고 완충 용액 B(10mM Tris-Hcl pH 7.5)을 100-0% 구배로 10 컬럼 볼륨 흘려주어 단백질을 용출하였다. 용출 구간은 52-20 ms/cm 이었다.
Protein was loaded onto a Phenyl HP column equilibrated with Buffer Solution A (10 mM Tris-Hcl, pH 7.5, 0.6 M ammonium sulfate), and 10 mL volume flow of Buffer Solution B (10 mM Tris-Hcl pH 7.5) in a 100-0% gradient. Eluted. The elution section was 52-20 ms / cm.

실시예Example 8: 양이온 결합 크로마토그래피 정제 8: Cationic Bond Chromatography Purification

30 % 에탄올이 포함된 20 mM 소디움 사이트레이트 (pH2.0) 완충액으로 평형화된 Source S (25 mm/20 cm, GE healthcare사) 컬럼에 소수성 컬럼에서 용출된 시료를 5∼10배 희석하여 6 ml/min 유속으로 부하하여 결합시킨 후, 염화칼륨 0.5 M 과 30 % 에탄올이 포함된 20 mM 소디움 사이트레이트 (pH2.0) 완충액을 사용하여 농도가 0 % 에서 100 % 가 되도록 10 컬럼 용량의 선형 농도구배로써 프로인슐린 아날로그 단백질을 용출하였다.
6 ml of the sample eluted in a hydrophobic column on a Source S (25 mm / 20 cm, GE healthcare) column equilibrated with 20 mM sodium citrate (pH2.0) buffer containing 30% ethanol. Load and binding at flow rate / min, linear gradient of 10 column volume using 20 mM sodium citrate (pH2.0) buffer containing 0.5 M potassium chloride and 30% ethanol to concentration from 0% to 100% As such, proinsulin analogue proteins were eluted.

실시예 9: 역상 크로마토그래피 정제Example 9: Reversed Phase Chromatography Purification

10 ％ 아세토니트릴 및 0.1 % 트리프루오로아세트산으로 평형화된 C18 300 컬럼 (10 mm /25 cm, 페노메넥스사) 컬럼에 양이온 결합 크로마토그래피 컬럼에서 용출된 시료를 2 ml/min 유속으로 부하하여 결합시킨 후, 80 ％ 아세토니트릴 및 0.1 % 트리프루오로아세트산까지 10 컬럼 용량의 선형 농도구배를 이용하여 목적 단백질을 용출하였다. A sample eluted from a cationic bond chromatography column on a C18 300 column (10 mm / 25 cm, Fenomenex) column equilibrated with 10% acetonitrile and 0.1% trifluoroacetic acid was loaded at a flow rate of 2 ml / min. After binding, the desired protein was eluted using a linear gradient of 10 column capacity to 80% acetonitrile and 0.1% trifluoroacetic acid.

상기 역상 크로마토그래피에 따라 최종 정제된 프로인슐린 아날로그를 RP-HPLC, SE-HPLC, SDS PAGE 로 분석하여 각각 도 1, 2, 3에 나타내었다.
The final purified proinsulin analogues were analyzed by RP-HPLC, SE-HPLC, and SDS PAGE according to the reversed phase chromatography.

실시예 10: 프로인슐린 아날로그 페길화(Pegylation)Example 10 Proinsulin Analog Pegylation

상기 실시예의 공정으로 고 순도로 정제된 프로인슐린 아날로그를 100 mM 포타슘포스페이트(pH 6.0)으로 버퍼 교환 후 5 mg/mL로 농도를 맞추고, 3.4 kDa PropionylALD2 PEG를 프로인슐린 아날로그의 아미노 말단에 페길화시키기 위하여 인터페론과 PEG의 몰비 1 : 10 이 되도록 PEG를 첨가한 후 완전히 녹였다. 이후 환원제인 소디움시아노보로하이드라이드(NaCNBH3)를 20mM이 되도록 넣어준 후 상온에서 70 분 동안 반응시켰다. 이후 30 % 에탄올이 포함된 10 mM 소디움 사이트레이트, pH 2.0 버퍼로 10 배 희석한 후 Source S 컬럼(25 mm/ 20 cm, GE Healthcare사)에 주입하였다. Source S 컬럼은 30 % 에탄올이 포함된 10 mM 소디움 사이트레이트, pH 2.0 버퍼로 평형이 잡힌 컬럼이며, 유속은 6 mL/min으로 하였다. 하나의 페길화 인터페론을 정제하기 위해 30 % 에탄올이 포함된 10 mM 소디움 사이트레이트, pH 2.0, 0.5 M KCl 버퍼를 0에서 50 %가 되도록 10 컬럼 부피를 흘려주어 하나 페길화된 프로인슐린 아날로그를 정제하였다.
The high-purity purified proinsulin analog was exchanged with 100 mM potassium phosphate (pH 6.0) to adjust the concentration to 5 mg / mL, and 3.4 kDa PropionylALD 2 PEG was PEGylated at the amino terminus of the proinsulin analog. In order to make the molar ratio of interferon and PEG 1: 10, PEG was added and completely dissolved. Then, sodium cyanoborohydride (NaCNBH 3 ), a reducing agent, was added to 20 mM and reacted at room temperature for 70 minutes. After diluting 10 times with 10 mM sodium citrate, pH 2.0 buffer containing 30% ethanol, it was injected into a Source S column (25 mm / 20 cm, GE Healthcare). The Source S column was equilibrated with 10 mM sodium citrate, pH 2.0 buffer containing 30% ethanol, and the flow rate was 6 mL / min. To purify one PEGylated interferon, one PEGylated proinsulin analog was purified by pouring 10 column volumes of 10 mM sodium citrate, pH 2.0, 0.5 M KCl buffer containing 30% ethanol from 0 to 50%. It was.

실시예 11. 프로인슐린 아날로그-면역글로블린 Fc 결합체 제조Example 11 Preparation of Proinsulin Analog-Immune Globulin Fc Conjugates

실시예 5의 방법을 이용하여 얻은 하나 페길화된 프로인슐린 아날로그을 면역글로블린 Fc와 커플링 시켰다. 프로인슐린 아날로그과 면역글로블린 Fc 몰 비를 1:4 으로 하였으며, 전체단백질농도를 50 mg/mL로 하여 4℃에서 16시간 반응시켰다. 이때 환원제로 20 mM 이 되도록 소디움시아노보로하이드라이드(NaCNBH3)를 넣어주었다. 이후 20 mM Tris, pH 7.5 버퍼로 10 배 희석한 후 Source Q 컬럼(70 mm/ 26 cm, GE Healthcare사)에 주입하였다. Source Q 컬럼은 20 mM Tris, pH 7.5 버퍼로 평형이 잡힌 컬럼이며, 유속은 30 mL/min으로 하였다. 커플링 단백질을 용출하기 위해 20 mM Tris, pH 7.5 , 0.5 M NaCl 버퍼를 0 %에서 40 %까지 선형적으로 4 컬럼 부피를 흘려주어 용출하였다. Source Q 컬럼으로 미 반응한 면역글로블린 Fc를 제거할 수 있었다. 상기 Source Q에서 용출된 커플링 단백질 용액에 1.5 M 암모늄설페이트를 첨가하여 Source iso 컬럼(35 mm/ 18 cm, GE Healthcare사)에 주입하였다. Source iso 컬럼은 20 mM Tris-HCl, pH 7.5, 1.5 M 암모늄설페이트 버퍼로 평형이 잡힌 컬럼이며, 유속은 10 mL/min으로 하였다. 프로인슐린 아날로그-PEG-면역글로블린 Fc를 정제하기 위해 20 mM Tris-HCl, pH 7.5 버퍼를 0 %에서 100 %까지 선형적으로 17 컬럼 부피를 흘려주었다. One PEGylated proinsulin analog obtained using the method of Example 5 was coupled with an immunoglobulin Fc. The proinsulin analogue and the immunoglobulin Fc molar ratio were 1: 4, and the total protein concentration was 50 mg / mL for 16 hours at 4 ° C. At this time, sodium cyanoborohydride (NaCNBH 3 ) was added to 20 mM as a reducing agent. After diluting 10 times with 20 mM Tris, pH 7.5 buffer, it was injected into a Source Q column (70 mm / 26 cm, GE Healthcare). The Source Q column was equilibrated with 20 mM Tris, pH 7.5 buffer, and the flow rate was 30 mL / min. To elute the coupling protein, 20 mM Tris, pH 7.5, 0.5 M NaCl buffer was eluted by flowing 4 column volumes linearly from 0% to 40%. Unreacted immunoglobulin Fc could be removed with a Source Q column. 1.5 M ammonium sulfate was added to the coupling protein solution eluted in Source Q and injected into a Source iso column (35 mm / 18 cm, GE Healthcare). The source iso column was a column equilibrated with 20 mM Tris-HCl, pH 7.5, 1.5 M ammonium sulfate buffer, and the flow rate was 10 mL / min. To purify the proinsulin analog-PEG-immunoglobulin Fc, 20 mM Tris-HCl, pH 7.5 buffer was flowed 17 column volumes linearly from 0% to 100%.

상기 Source iso 컬럼에서 최종 정제된 프로인슐린 아날로그-면역글로블린 Fc 결합체를 RP-HPLC, SE-HPLC, SDS PAGE 로 분석하여 각각 도4, 5, 6에 나타내었다.
The final purified proinsulin analogue-immunoglobulin Fc conjugate in the Source iso column was analyzed by RP-HPLC, SE-HPLC, and SDS PAGE, and is shown in FIGS. 4, 5, and 6, respectively.

실시예Example 12: 지속형 프로인슐린 아날로그 결합체의 12: of sustained proinsulin analogue conjugates inin vivovivo PDPD 측정 Measure

지속형 프로인슐린 아날로그 결합체의 효력을 검증하기 위하여 당뇨모델 랫드를 이용하여 효력을 검증하였다. 당뇨모델은 정상 랫드에 Streptozotocin (STZ)을 투여하여 췌장내의 beta cell을 특이적으로 파괴하여 혈당을 지속적으로 증가시키는 방법을 이용하여 만들어졌다. STZ 투여에 따른 혈당증가가 발생한 모델 랫드에 지속형 프로인슐린 아날로그 결합체를 투여용량을 프로인슐린 아날로그 용량으로써 2 - 8 mg/kg으로 증가시켜 단회로 피하경로를 이용하여 투여하였다. 투여 전, 투여 후 매일동안 혈당을 측정하여 지속형 프로인슐린 아날로그 결합체의 효력을 측정하였다(Figure 8).To verify the efficacy of the long-acting proinsulin analogue conjugates, the efficacy of the diabetic model rats was verified. The diabetic model was developed by using Streptozotocin (STZ) in normal rats to specifically destroy the beta cells in the pancreas and continuously increase blood glucose levels. Sustained proinsulin analogue conjugates were administered to model rats with increased blood glucose following STZ administration using a single subcutaneous route by increasing the dosage to 2-8 mg / kg as the proinsulin analog dose. Blood glucose was measured before and after the administration every day to determine the potency of the sustained proinsulin analogue conjugate (Figure 8).

투여결과 지속형 프로인슐린 아날로그의 투여용량에 따른 혈당강하 현상이 나타났다. 투여용량에 효력지속기간이 최고 10일까지 도달하는 결과를 보였다. As a result of the administration, hypoglycemia was observed according to the dose of the sustained proinsulin analog. The effect duration of the dose reached up to 10 days.

<110> HANMI PHARM.IND.CO.LTD. <120> An single chain-insulin analog complex using an immunoglobulin fragment <130> PA100337KR <160> 14 <170> KopatentIn 1.71 <210> 1 <211> 258 <212> DNA <213> Homo sapiens <400> 1 tttgtgaacc aacacctgtg cggctcacac ctggtggaag ctctctacct agtgtgcggg 60 gaacgaggct tcttctacac acccaagacc cgccgggagg cagaggacct gcaggtgggg 120 caggtggagc tgggcggggg ccctggtgca ggcagcctgc agcccttggc cctggagggg 180 tccctgcaga agcgtggcat tgtggaacaa tgctgtacca gcatctgctc cctctaccag 240 ctggagaact actgcaac 258 <210> 2 <211> 86 <212> PRT <213> Homo sapiens <400> 2 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg 20 25 30 Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro 35 40 45 Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys 50 55 60 Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln 65 70 75 80 Leu Glu Asn Tyr Cys Asn 85 <210> 3 <211> 258 <212> DNA <213> Artificial Sequence <220> <223> proinsulin analog <400> 3 ggcattgtgg aacaatgctg taccagcatc tgctccctct accagctgga gaactactgc 60 aaccgccggg aggcagagga cctgcaggtg gggcaggtgg agctgggcgg gggccctggt 120 gcaggcagcc tgcagccctt ggccctggag gggtccctgc agaagcgttt tgtgaaccaa 180 cacctgtgcg gctcacacct ggtggaagct ctctacctag tgtgcgggga acgaggcttc 240 ttctacacac ccaagacc 258 <210> 4 <211> 86 <212> PRT <213> Artificial Sequence <220> <223> proinsulin analog <400> 4 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln 20 25 30 Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala 35 40 45 Leu Glu Gly Ser Leu Gln Lys Arg Phe Val Asn Gln His Leu Cys Gly 50 55 60 Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe 65 70 75 80 Phe Tyr Thr Pro Lys Thr 85 <210> 5 <211> 252 <212> DNA <213> Artificial Sequence <220> <223> proinsulin analog (A-C delta KR-B) <400> 5 ggcattgtgg aacaatgctg taccagcatc tgctccctct accagctgga gaactactgc 60 aaccgccggg aggcagagga cctgcaggtg gggcaggtgg agctgggcgg gggccctggt 120 gcaggcagcc tgcagccctt ggccctggag gggtccctgc agtttgtgaa ccaacacctg 180 tgcggctcac acctggtgga agctctctac ctagtgtgcg gggaacgagg cttcttctac 240 acacccaaga cc 252 <210> 6 <211> 84 <212> PRT <213> Artificial Sequence <220> <223> proinsulin analog (A-C delta KR-B) <400> 6 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln 20 25 30 Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala 35 40 45 Leu Glu Gly Ser Leu Gln Phe Val Asn Gln His Leu Cys Gly Ser His 50 55 60 Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr 65 70 75 80 Thr Pro Lys Thr <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> forward primer for A chain of proinsulin analog <400> 7 ggaattccat atgggcattg tggaacaatg ctgt 34 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for A chain of proinsulin analog <400> 8 ctgcctcccg gcggttgcag tagttctcca gctg 34 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> forward primer for C peptide of proinsulin analog <400> 9 gaactactgc aaccgccggg aggcagagga cctg 34 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for C peptide of proinsulin analog <400> 10 gttggttcac aaaacgcttc tgcagggacc cctc 34 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> forward primer for B chain of proinsulin analog <400> 11 cctgcagaag cgttttgtga accaacacct gtgc 34 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for B chain of proinsulin analog <400> 12 cgcggatccc taggtcttgg gtgtgtagaa gaag 34 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> forward primer for proinsulin analog (A-C delta KR-B) <400> 13 ggggtccctg cagtttgtga accaacacct gtgc 34 <210> 14 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for proinsulin analog (A-C delta KR-B) <400> 14 gttggttcac aaactgcagg gacccctcca gggc 34 <110> HANMI PHARM.IND.CO.LTD. <120> An single chain-insulin analog complex using an immunoglobulin          fragment <130> PA100337KR <160> 14 <170> KopatentIn 1.71 <210> 1 <211> 258 <212> DNA <213> Homo sapiens <400> 1 tttgtgaacc aacacctgtg cggctcacac ctggtggaag ctctctacct agtgtgcggg 60 gaacgaggct tcttctacac acccaagacc cgccgggagg cagaggacct gcaggtgggg 120 caggtggagc tgggcggggg ccctggtgca ggcagcctgc agcccttggc cctggagggg 180 tccctgcaga agcgtggcat tgtggaacaa tgctgtacca gcatctgctc cctctaccag 240 ctggagaact actgcaac 258 <210> 2 <211> 86 <212> PRT <213> Homo sapiens <400> 2 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr   1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg              20 25 30 Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro          35 40 45 Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys      50 55 60 Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln  65 70 75 80 Leu Glu Asn Tyr Cys Asn                  85 <210> 3 <211> 258 <212> DNA <213> Artificial Sequence <220> <223> proinsulin analog <400> 3 ggcattgtgg aacaatgctg taccagcatc tgctccctct accagctgga gaactactgc 60 aaccgccggg aggcagagga cctgcaggtg gggcaggtgg agctgggcgg gggccctggt 120 gcaggcagcc tgcagccctt ggccctggag gggtccctgc agaagcgttt tgtgaaccaa 180 cacctgtgcg gctcacacct ggtggaagct ctctacctag tgtgcgggga acgaggcttc 240 ttctacacac ccaagacc 258 <210> 4 <211> 86 <212> PRT <213> Artificial Sequence <220> <223> proinsulin analog <400> 4 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu   1 5 10 15 Glu Asn Tyr Cys Asn Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln              20 25 30 Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala          35 40 45 Leu Glu Gly Ser Leu Gln Lys Arg Phe Val Asn Gln His Leu Cys Gly      50 55 60 Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe  65 70 75 80 Phe Tyr Thr Pro Lys Thr                  85 <210> 5 <211> 252 <212> DNA <213> Artificial Sequence <220> <223> proinsulin analog (A-C delta KR-B) <400> 5 ggcattgtgg aacaatgctg taccagcatc tgctccctct accagctgga gaactactgc 60 aaccgccggg aggcagagga cctgcaggtg gggcaggtgg agctgggcgg gggccctggt 120 gcaggcagcc tgcagccctt ggccctggag gggtccctgc agtttgtgaa ccaacacctg 180 tgcggctcac acctggtgga agctctctac ctagtgtgcg gggaacgagg cttcttctac 240 acacccaaga cc 252 <210> 6 <211> 84 <212> PRT <213> Artificial Sequence <220> <223> proinsulin analog (A-C delta KR-B) <400> 6 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu   1 5 10 15 Glu Asn Tyr Cys Asn Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln              20 25 30 Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala          35 40 45 Leu Glu Gly Ser Leu Gln Phe Val Asn Gln His Leu Cys Gly Ser His      50 55 60 Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr  65 70 75 80 Thr Pro Lys Thr                 <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> forward primer for A chain of proinsulin analog <400> 7 ggaattccat atgggcattg tggaacaatg ctgt 34 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for A chain of proinsulin analog <400> 8 ctgcctcccg gcggttgcag tagttctcca gctg 34 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> forward primer for C peptide of proinsulin analog <400> 9 gaactactgc aaccgccggg aggcagagga cctg 34 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for C peptide of proinsulin analog <400> 10 gttggttcac aaaacgcttc tgcagggacc cctc 34 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> forward primer for B chain of proinsulin analog <400> 11 cctgcagaag cgttttgtga accaacacct gtgc 34 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for B chain of proinsulin analog <400> 12 cgcggatccc taggtcttgg gtgtgtagaa gaag 34 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> forward primer for proinsulin analog (A-C delta KR-B) <400> 13 ggggtccctg cagtttgtga accaacacct gtgc 34 <210> 14 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for proinsulin analog (A-C delta KR-B) <400> 14 gttggttcac aaactgcagg gacccctcca gggc 34

Claims (20)

단쇄 인슐린 아날로그 및 면역글로불린 Fc 영역이 폴리에틸렌글리콜, 폴리프로필렌 글리콜, 에틸렌 글리콜-프로필렌 글리콜 공중합체, 폴리옥시에틸화폴리올, 폴리비닐알콜, 폴리사카라이드, 덱스트란, 폴리비닐에틸에테르 ,생분해성 고분자, 지질 중합체, 키틴류, 히아루론산 및 이들의 조합으로 이루어진 군으로부터 선택되는 비펩타이드성 링커를 통해 연결되는 단쇄 인슐린 아날로그 결합체.
Short-chain insulin analogue and immunoglobulin Fc regions include polyethylene glycol, polypropylene glycol, ethylene glycol-propylene glycol copolymers, polyoxyethylated polyols, polyvinyl alcohol, polysaccharides, dextran, polyvinylethyl ether, biodegradable polymers, A short chain insulin analogue conjugate linked via a non-peptidyl linker selected from the group consisting of lipid polymers, chitins, hyaluronic acid and combinations thereof.
제1항에 있어서, 상기 단쇄 인슐린 아날로그는 천연형 프로인슐린, 천연형 프로인슐린에서 일부 아미노산의 치환(substitution), 추가(addition), 제거(deletion), 수식(modification) 및 배열 순서의 변환 중에서 선택되는 어느 하나의 방법 또는 이들 방법의 조합을 통해 제조된 아날로그, 변이체, 또는 이들의 단편인 단쇄 인슐린 아날로그 결합체.
The method of claim 1, wherein the short-chain insulin analogue is selected from among native proinsulin, substitution, addition, removal, modification, and transformation of some amino acids in the native proinsulin. A single chain insulin analogue conjugate, which is an analog, variant, or fragment thereof prepared by any one method or combination of these methods.
제1항에 있어서, 비펩타이드성 중합체의 각 말단이 각각 면역글로불린 Fc 영역과 단쇄 인슐린 아날로그의 아민 그룹 또는 티올 그룹(Thiol group)에 결합된 단쇄 인슐린 아날로그 결합체.
The short-chain insulin analogue conjugate according to claim 1, wherein each end of the non-peptidyl polymer is bound to an amine group or a thiol group of an immunoglobulin Fc region and a short-chain insulin analog, respectively.
제1항에 있어서, 면역글로불린 Fc 영역이 비당쇄화됨을 특징으로 하는 단쇄 인슐린 아날로그 결합체.
The short chain insulin analogue conjugate according to claim 1, wherein the immunoglobulin Fc region is deglycosylated.
제1항에 있어서, 면역글로불린 Fc 영역이 CH1, CH2, CH3 및 CH4 도메인으로 이루어진 군으로부터 1개 내지 4개 선택되는 도메인으로 이루어진 단쇄 인슐린 아날로그 결합체.
The short chain insulin analogue conjugate of claim 1, wherein the immunoglobulin Fc region consists of one to four domains selected from the group consisting of CH1, CH2, CH3 and CH4 domains.
제5항에 있어서, 면역글로불린 Fc 영역이 힌지영역을 추가로 포함하는 단쇄 인슐린 아날로그 결합체.
6. The short chain insulin analogue conjugate of claim 5, wherein the immunoglobulin Fc region further comprises a hinge region.
제1항에 있어서, 면역글로불린 Fc 영역이 IgG, IgA, IgD, IgE 또는 IgM에서 유래된 Fc 영역인 단쇄 인슐린 아날로그 결합체.
The short chain insulin analogue conjugate of claim 1, wherein the immunoglobulin Fc region is an Fc region derived from IgG, IgA, IgD, IgE or IgM.
제7항에 있어서, 면역글로불린 Fc 영역의 각각의 도메인이 IgG, IgA, IgD, IgE 및 IgM로 이루어진 군에서 선택되는 면역글로불린에서 유래된 상이한 기원을 가진 도메인의 하이브리드인 단쇄 인슐린 아날로그 결합체.
8. The short chain insulin analogue conjugate of claim 7, wherein each domain of the immunoglobulin Fc region is a hybrid of domains of different origin derived from immunoglobulins selected from the group consisting of IgG, IgA, IgD, IgE and IgM.
제7항에 있어서, 면역글로불린 Fc 영역이 동일한 기원의 도메인으로 이루어진 단쇄 면역글로불린으로 구성된 이량체 또는 다량체인 단쇄 인슐린 아날로그 결합체.
8. The short chain insulin analogue conjugate of claim 7, wherein the immunoglobulin Fc region is a dimer or multimer consisting of short chain immunoglobulins consisting of domains of the same origin.
제7항에 있어서, 면역글로불린 Fc 영역이 IgG4 Fc 영역인 단쇄 인슐린 아날로그 결합체.
8. The short chain insulin analogue conjugate of claim 7, wherein the immunoglobulin Fc region is an IgG4 Fc region.
제10항에 있어서, 면역글로불린 Fc 영역이 인간 비당쇄화 IgG4 Fc 영역인 단쇄 인슐린 아날로그 결합체.
The single chain insulin analogue conjugate of claim 10, wherein the immunoglobulin Fc region is a human nonglycosylated IgG4 Fc region.
제1항에 있어서, 비펩타이드성 중합체의 반응기가 알데히드 그룹, 프로피온알데히드 그룹, 부틸 알데히드 그룹, 말레이미드 그룹 및 석시니미드 유도체로 이루어진 군으로부터 선택되는 단쇄 인슐린 아날로그 결합체.
The short chain insulin analogue conjugate according to claim 1, wherein the reactor of the non-peptidyl polymer is selected from the group consisting of aldehyde group, propionaldehyde group, butyl aldehyde group, maleimide group and succinimide derivative.
제12항에 있어서, 석시니미드 유도체가 석시니미딜 프로피오네이트, 석시니미딜 카르복시메틸, 하이드록시 석시니미딜 또는 석시니미딜 카보네이트인 단쇄 인슐린 아날로그 결합체.
13. The short-chain insulin analogue conjugate according to claim 12, wherein the succinimide derivative is succinimidyl propionate, succinimidyl carboxymethyl, hydroxy succinimidyl or succinimidyl carbonate.
제12항에 있어서, 비펩타이드성 중합체가 양 말단에 반응 알데히드 그룹의 반응기를 갖는 단쇄 인슐린 아날로그 결합체.
13. The short chain insulin analogue conjugate of claim 12, wherein the non-peptidyl polymer has a reactor of reactive aldehyde groups at both ends.
제1항 내지 제14항 중 어느 한 항의 단쇄 인슐린 결합체를 포함하는 생체 내 지속성 및 안정성이 증가된 단쇄 인슐린 지속성 제제.
15. A short-chain insulin sustained preparation having increased in vivo persistence and stability, comprising the short chain insulin conjugate of any one of claims 1-14.
제15항에 있어서, 당뇨병 치료용인 지속성 제제.
The long-acting formulation of claim 15, which is for treating diabetes.
(1) 각 말단에 알데히드, 말레이미드, 또는 석시니미드 유도체 반응기를 갖는 비펩타이드성 중합체를 사용하여 면역글로불린 Fc 영역의 아민 그룹 또는 티올 그룹에 공유결합으로 연결하는 단계;
(2) 상기 (1)의 반응 혼합물로부터 비펩타이드성 중합체가 공유결합된 면역 글로불린 Fc 영역을 포함하는 연결체를 분리하는 단계; 및
(3) 분리된 연결체의 비펩타이드성 중합체의 다른 쪽 말단에 프로인슐린을 공유결합으로 연결하여 비펩타이드성 중합체의 양쪽 말단이 각각 면역글로불린 Fc 영역 및 프로인슐린과 결합된 펩타이드 결합체를 생성하는 단계를 포함하는, 제1항의 단쇄 인슐린 아날로그 결합체의 제조방법.
(1) covalently linking an amine group or a thiol group of an immunoglobulin Fc region using a non-peptidyl polymer having an aldehyde, maleimide, or succinimide derivative reactor at each end;
(2) separating the linker comprising an immunoglobulin Fc region covalently bonded to the non-peptidyl polymer from the reaction mixture of (1); And
(3) covalently linking the proinsulin to the other end of the non-peptidyl polymer of the isolated linker to produce a peptide conjugate wherein both ends of the non-peptidyl polymer are bound to the immunoglobulin Fc region and proinsulin, respectively. A method for producing a single chain insulin analogue conjugate according to claim 1.
(1) 각 말단에 알데히드 반응기를 갖는 비펩타이드성 중합체를 사용하여 면역글로불린 Fc의 N-말단에 pH6.0에서 공유결합으로 연결하는 단계;
(2) 상기 (1)의 반응 혼합물로부터 N-말단에 비펩타이드성 중합체가 공유결합된 면역글로불린 Fc 영역을 포함하는 연결체를 분리하는 단계; 및
(3) 분리된 연결체의 비펩타이드성 중합체의 다른 쪽 말단에 프로인슐린을 공유결합으로 연결하여 비펩타이드성 중합체의 양쪽 말단이 각각 면역글로불린 Fc 영역 및 프로인슐린과 결합된 펩타이드 결합체를 생성하는 단계를 포함하는, 제1항의 단쇄 인슐린 아날로그 결합체의 제조방법.
(1) covalently linking at pH6.0 to the N-terminus of the immunoglobulin Fc using a non-peptidyl polymer having an aldehyde reactor at each end;
(2) separating the linker comprising an immunoglobulin Fc region covalently bonded to a non-peptidyl polymer at the N-terminus from the reaction mixture of (1); And
(3) covalently linking the proinsulin to the other end of the non-peptidyl polymer of the isolated linker to produce a peptide conjugate wherein both ends of the non-peptidyl polymer are bound to the immunoglobulin Fc region and proinsulin, respectively. A method for producing a single chain insulin analogue conjugate according to claim 1.
(1) 각 말단에 알데히드, 말레이미드, 또는 석시니미드 유도체 반응기를 갖는 비펩타이드성 중합체를 사용하여 프로인슐린의 아민 그룹 또는 티올 그룹에 공유결합으로 연결하는 단계;
(2) 상기 (1)의 반응 혼합물로부터 비펩타이드성 중합체가 공유결합된 프로인슐린을 포함하는 연결체를 분리하는 단계; 및
(3) 분리된 연결체의 비펩타이드성 중합체의 다른 쪽 말단에 면역글로불린 Fc 영역을 공유결합으로 연결하여 비펩타이드성 중합체의 양쪽 말단이 각각 면역글로불린 Fc 영역 및 프로인슐린과 결합된 펩타이드 결합체를 생성하는 단계를 포함하는, 제1항의 단쇄 인슐린 아날로그 결합체의 제조방법.
(1) covalently linking to an amine group or thiol group of proinsulin using a non-peptidyl polymer having an aldehyde, maleimide, or succinimide derivative reactor at each end;
(2) separating the linker comprising the proinsulin covalently bonded to the non-peptidyl polymer from the reaction mixture of (1); And
(3) covalently linking an immunoglobulin Fc region to the other end of the non-peptidyl polymer of the isolated linker to generate a peptide conjugate wherein both ends of the non-peptidyl polymer are bound to the immunoglobulin Fc region and proinsulin, respectively. The method of claim 1, comprising the steps of preparing a short-chain insulin analogue conjugate.
(1) 각 말단에 알데히드 반응기를 갖는 비펩타이드성 중합체를 사용하여 프로인슐린의 아민 그룹에 공유결합으로 연결하는 단계;
(2) 상기 (1)의 반응 혼합물로부터 비펩타이드성 중합체가 공유결합된 프로인슐린을 포함하는 연결체를 분리하는 단계; 및
(3) 분리된 연결체의 비펩타이드성 중합체의 다른 쪽 말단에 면역글로불린 Fc 영역을 공유결합으로 연결하여 비펩타이드성 중합체의 양쪽 말단이 각각 면역글로불린 Fc 영역 및 프로인슐린과 결합된 펩타이드 결합체를 생성하는 단계를 포함하는, 제1항의 단쇄 인슐린 아날로그 결합체의 제조방법.(1) covalently linking an amine group of proinsulin using a non-peptidyl polymer having an aldehyde reactor at each end;
(2) separating the linker comprising the proinsulin covalently bonded to the non-peptidyl polymer from the reaction mixture of (1); And
(3) covalently linking an immunoglobulin Fc region to the other end of the non-peptidyl polymer of the isolated linker to generate a peptide conjugate wherein both ends of the non-peptidyl polymer are bound to the immunoglobulin Fc region and proinsulin, respectively. The method of claim 1, comprising the steps of preparing a short-chain insulin analogue conjugate.
KR1020100054067A 2010-06-08 2010-06-08 An single chain-insulin analog complex using an immunoglobulin fragment KR101324828B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020100054067A KR101324828B1 (en) 2010-06-08 2010-06-08 An single chain-insulin analog complex using an immunoglobulin fragment

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100054067A KR101324828B1 (en) 2010-06-08 2010-06-08 An single chain-insulin analog complex using an immunoglobulin fragment

Publications (2)

Publication Number Publication Date
KR20110134209A true KR20110134209A (en) 2011-12-14
KR101324828B1 KR101324828B1 (en) 2013-11-01

Family

ID=45501652

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100054067A KR101324828B1 (en) 2010-06-08 2010-06-08 An single chain-insulin analog complex using an immunoglobulin fragment

Country Status (1)

Country Link
KR (1) KR101324828B1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014017847A1 (en) 2012-07-25 2014-01-30 Hanmi Pharm. Co., Ltd. A liquid formulation of long-acting insulin conjugate
KR20160081035A (en) * 2014-12-30 2016-07-08 건국대학교 산학협력단 Use of proinsulin for immune system modulation
EP2963056A4 (en) * 2013-02-26 2017-06-07 Hanmi Pharm. Co., Ltd. Novel insulin analog and use thereof
US9833516B2 (en) 2012-07-25 2017-12-05 Hanmi Pharm. Co., Ltd Liquid formulation of long-acting insulin and insulinotropic peptide
US10017557B2 (en) 2015-08-28 2018-07-10 Hanmi Pharm. Co., Ltd. Insulin analogs and use thereof
WO2018143729A1 (en) * 2017-02-03 2018-08-09 한미약품 주식회사 Conjugate of bioactive material having enhanced sustainability and use thereof
US10159715B2 (en) 2014-05-29 2018-12-25 Hanmi Pharm. Co., Ltd Method for treating diabetes comprising long-acting insulin analogue conjugate and long-acting insulinotropic peptide conjugate
US10188703B2 (en) 2014-05-30 2019-01-29 Hanmi Pharm. Co., Ltd. Method for treating diabetes mellitus by a composition comprising insulin and a GLP-1/glucagon dual agonist
WO2019066570A1 (en) * 2017-09-28 2019-04-04 한미약품 주식회사 Long-acting single-chain insulin analog and conjugate thereof
US10251957B2 (en) 2011-06-02 2019-04-09 Hanmi Science Co., Ltd. Composition for treating diabetes comprising long-acting insulin conjugate and long-acting insulinotropic peptide conjugate
US10253082B2 (en) 2014-01-20 2019-04-09 Hanmi Pharm. Co., Ltd Long-acting insulin and use thereof
US10946060B2 (en) 2017-03-17 2021-03-16 Korea University Research And Business Foundation Pharmaceutical composition containing ATPIF1 for treatment of diabetes
US11396534B2 (en) 2016-09-23 2022-07-26 Hanmi Pharm. Co., Ltd. Insulin analogs with reduced affinity to insulin receptor and use thereof
US11752216B2 (en) 2017-03-23 2023-09-12 Hanmi Pharm. Co., Ltd. Insulin analog complex with reduced affinity for insulin receptor and use thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR105616A1 (en) 2015-05-07 2017-10-25 Lilly Co Eli FUSION PROTEINS

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1863840A1 (en) * 2005-03-18 2007-12-12 Novo Nordisk A/S Pegylated single-chain insulin
JP2008169195A (en) * 2007-01-05 2008-07-24 Hanmi Pharmaceutical Co Ltd Insulinotopic peptide drug combo using carrier material

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10251957B2 (en) 2011-06-02 2019-04-09 Hanmi Science Co., Ltd. Composition for treating diabetes comprising long-acting insulin conjugate and long-acting insulinotropic peptide conjugate
US9833516B2 (en) 2012-07-25 2017-12-05 Hanmi Pharm. Co., Ltd Liquid formulation of long-acting insulin and insulinotropic peptide
US10987424B2 (en) 2012-07-25 2021-04-27 Hanmi Pharm. Co., Ltd. Liquid formulation of long-acting insulin conjugate
WO2014017847A1 (en) 2012-07-25 2014-01-30 Hanmi Pharm. Co., Ltd. A liquid formulation of long-acting insulin conjugate
EP2963056A4 (en) * 2013-02-26 2017-06-07 Hanmi Pharm. Co., Ltd. Novel insulin analog and use thereof
CN114989289A (en) * 2013-02-26 2022-09-02 韩美药品株式会社 Novel insulin analogues and uses thereof
EP3616727A1 (en) * 2013-02-26 2020-03-04 Hanmi Pharm. Co., Ltd. Insulin analog conjugates and use thereof
US10253082B2 (en) 2014-01-20 2019-04-09 Hanmi Pharm. Co., Ltd Long-acting insulin and use thereof
US10159715B2 (en) 2014-05-29 2018-12-25 Hanmi Pharm. Co., Ltd Method for treating diabetes comprising long-acting insulin analogue conjugate and long-acting insulinotropic peptide conjugate
US10188703B2 (en) 2014-05-30 2019-01-29 Hanmi Pharm. Co., Ltd. Method for treating diabetes mellitus by a composition comprising insulin and a GLP-1/glucagon dual agonist
KR20160081035A (en) * 2014-12-30 2016-07-08 건국대학교 산학협력단 Use of proinsulin for immune system modulation
US10017557B2 (en) 2015-08-28 2018-07-10 Hanmi Pharm. Co., Ltd. Insulin analogs and use thereof
US10647753B2 (en) 2015-08-28 2020-05-12 Hanmi Pharm. Co., Ltd. Insulin analogs and use thereof
US11396534B2 (en) 2016-09-23 2022-07-26 Hanmi Pharm. Co., Ltd. Insulin analogs with reduced affinity to insulin receptor and use thereof
WO2018143729A1 (en) * 2017-02-03 2018-08-09 한미약품 주식회사 Conjugate of bioactive material having enhanced sustainability and use thereof
EP3578204A4 (en) * 2017-02-03 2021-01-06 Hanmi Pharm. Co., Ltd. Conjugate of bioactive material having enhanced sustainability and use thereof
CN110545849A (en) * 2017-02-03 2019-12-06 韩美药品株式会社 Conjugates of physiologically active substances with increased persistence and uses thereof
US10946060B2 (en) 2017-03-17 2021-03-16 Korea University Research And Business Foundation Pharmaceutical composition containing ATPIF1 for treatment of diabetes
US11752216B2 (en) 2017-03-23 2023-09-12 Hanmi Pharm. Co., Ltd. Insulin analog complex with reduced affinity for insulin receptor and use thereof
CN111386130A (en) * 2017-09-28 2020-07-07 韩美药品株式会社 Long-acting single-chain insulin analogues and conjugates thereof
EP3689382A4 (en) * 2017-09-28 2021-06-30 Hanmi Pharm. Co., Ltd. Long-acting single-chain insulin analog and conjugate thereof
WO2019066570A1 (en) * 2017-09-28 2019-04-04 한미약품 주식회사 Long-acting single-chain insulin analog and conjugate thereof

Also Published As

Publication number Publication date
KR101324828B1 (en) 2013-11-01

Similar Documents

Publication Publication Date Title
KR102413691B1 (en) Novel insulin analog and use thereof
KR101324828B1 (en) An single chain-insulin analog complex using an immunoglobulin fragment
TWI784914B (en) Composition for treating diabetes comprising long-acting insulin analogue conjugate and long-acting insulinotropic peptide conjugate
JP6749845B2 (en) Composition for treating diabetes comprising insulin and GLP-1/glucagon dual agonist
TW201323435A (en) Method for preparing physiologically active polypeptide complex

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20160929

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180927

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20190924

Year of fee payment: 7