KR20110130274A - Multi-block biopolymer - Google Patents

Abstract

PURPOSE: A multi-block biopolymer is provided to ensure cell recognition functionality and temperature sensitivity. CONSTITUTION: A block biopolymer(100) has m blocks(m is 1-100 integer) which are serially linked. The blocks are one among: peptide I which recognizes cell surface antigen; peptide II with PGX(P is 19 L- or D-amino acids except for L-proline, G is glycine, X is L- or D-proline); peptide III with PGXX; peptide IV with PGXXX; peptide V with PGXGXX; and peptide VI. The peptide I is Arginine-Glycine-Aspartate(RDG) or Arginine-Glycine-Aspartate-Serine(RGDS). The peptide VI which enhances interconnection of the multi-block biopolymers contains PAAAAKAAKZG or PAAAAKAAAKAG.

Description

Multi-block Biopolymer

The present invention relates to multiblock biopolymers based on mimetic peptides of human tropotin elastin in nature, genes that designate these biopolymer structures, production and purification of biopolymers, biopolymers to antibiotics, anticancer agents, and cell therapeutics. It relates to the use of the drug as a carrier and a substrate for tissue engineering.

There has been a lot of information on the preparation of simple elastin biopolymers having a single repeating structure. For example, conventionally simple elastin biopolymers with a single repeating structure are polypeptides with simply repeated amino acid chains of Valine-Glycine-Valine-Alanine-Proline-Glycine, or tropoelastins with human cDNA genes, or L-proline. Four or five amino acids comprising were simply repeated polypeptides.

By the way, they exhibit a heat transfer phenomenon similar to that of the living elastin and exhibit the property of generating fibrous tissue, but there is a problem that the adhesion and interconnection of the cells are inferior to those of the living elastin. In addition, when expressing tropoelastin using a human cDNA gene, there was a problem that the genetic manipulation for producing elastin polypeptides suitable for use and purpose by containing an amino acid content of a desired component is not easy.

SUMMARY OF THE INVENTION An object of the present invention is to provide a method of forming a multiblock biopolymer based on elastin protein, thereby providing genetic engineering and cell adhesion for producing elastin polypeptides suitable for use as drug carriers and tissue engineering substrates. The purpose is to secure interconnectivity.

 The present invention is directed to providing for the formation and utilization of multiblock biopolymers having repeating structures more similar to human elastin structures, but including cell recognition functionality and mutual binding blocks.

In one aspect, the invention is repeated m blocks (m is an integer from 1 to 100) of n (n is an integer from 1 to 5,000) are connected in a row, each of the m blocks to recognize the cell surface antigen Peptide I (peptide II) with the structure of PGX (P is L-proline, G is of glycine, X is 19 L- or D-amino acids except L- or D-proline), and PGXX It is possible to provide a block biopolymer, characterized in that it is one of peptides III, peptides IV having a structure of PGXXX, peptides V having a structure of PGXGXX, and peptides VI which serve to enhance the mutual binding of multiblock biopolymers.

In this case, the peptide I which functions to recognize the cell surface antigen may be one or more of Arginine-Glycine-Aspartate (RDG) or Arginine-Glycine-Aspartate-Serine (RGDS), which are cell adhesion peptides.

In addition, the peptide VI, which functions to promote cross-linking of the multiblock biopolymer, may include a binding site PAAAAKAAKZG or PAAAAKAAAKAG of human tropo elastin.

In addition, each of the m blocks may select a different peptide from the peptides I to VI.

In addition, m may be two to six.

In addition, the peptide I having a binding ability to recognize a cell surface antigen in the multiblock biopolymer may have a function of detecting or isolating a disease-causing pathogen.

In addition, a drug or anticancer agent may bind to some of the multiblock biopolymers, and may be delivered to a site of onset to act as a drug carrier.

In addition, single biopolymer strands can be linked to each other to multiblock biopolymers using chemical or enzymatic methods to serve as substrates for cell and tissue culture.

In addition, it can function as a cell carrier to bind specific cells cultured to some of the multiblock biopolymers and move them to a target position in vivo.

Multiblock biopolymers according to embodiments of the present invention are endowed with cell recognition functionality and temperature sensitivity, and thus are used for detection of disease-causing pathogens and separation of pathogens using binding peptides, or cultured cells or drugs in vivo. There is an effect that can be used as a cell carrier or drug carrier to move to the target position, or to connect the single biopolymer strands to each other using chemical or enzymatic methods and then to use as a substrate for cell and tissue culture.

1 is a schematic diagram of a multiblock biopolymer according to one embodiment.
FIG. 2 is a drug carrier using the multiblock biopolymer of FIG. 1.
3 is a schematic diagram of a cell culture substrate or cell carrier using the multiblock biopolymer of FIG. 1.

Hereinafter, some embodiments of the present invention will be described in detail through exemplary drawings. In adding reference numerals to the components of each drawing, it should be noted that the same reference numerals are assigned to the same components as much as possible even though they are shown in different drawings. In the following description of the present invention, a detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear.

In describing the components of the present invention, terms such as first, second, A, B, (a), and (b) may be used. These terms are only for distinguishing the components from other components, and the nature, order or order of the components are not limited by the terms. If a component is described as being "connected", "coupled" or "connected" to another component, that component may be directly connected to or connected to that other component, but there may be another configuration between each component. It should be understood that the elements may be "connected", "coupled" or "connected".

In the present invention, m blocks (m is an integer of 1 to 100) connected in a row are repeated n n (n is an integer of 1 to 5,000). In this case, each of the m blocks is peptide I having a function of recognizing cell surface antigens, peptide II having a structure of PGX (P is L-proline, G is of glycine, and X is L- or D-proline except 19). L- or D-amino acids), peptide III having the structure of PGXX, peptide IV having the structure of PGXXX, peptide V having the structure of PGXGXX, peptide VI having the function of promoting the mutual binding of the multiblock biopolymer. .

Hereinafter, an exemplary embodiment in which six blocks connected in a row are repeated n (n is an integer of 1 to 5,000) will be described with reference to FIG. 1. Explain. Examples or experimental examples in which m blocks connected in series are n repeated (n is an integer of 1 to 5,000), which provides the same or substantially the same structural and physicochemical properties and experimental results as the above examples and experimental examples. It is apparent to those skilled in the art.

1 is a schematic diagram of a multiblock biopolymer according to one embodiment.

Referring to FIG. 1, the multiblock biopolymer 100 according to an embodiment is a multiblock biopolymer based on a mimic peptide of human tropoelastin present in nature.

The core of the elastin fibers of the vascular wall, skin, lungs, or ligament is derived from a single protein called human tropoelastin. The multiblock biopolymer 100 includes cell recognition functionality and cross-linking blocks while having a repeat structure that is more similar to the human tropoelastin structure.

Multiblock biopolymer 100 according to an embodiment of the present invention includes blocks 1 to 6 (110 to 160), blocks 1 to 6 (110 to 160) n times (n is an integer of 1 to 5,000) Can be repeated. Blocks 1 to 6 (110 to 160) may have a structure arranged in a row by selecting six different peptides from peptides I to VI.

Peptide I is a peptide that functions as a cell binding recognition function (1) Arginine-Glycine-Aspartate (RGD), (2) Arginine-Glycine-Aspartate-Serine (RGDS), (3) Cell and spore surface antigens of disease-causing microorganisms Recognition peptides for (4) one or more of peptides that recognize cell surface antigens that are specifically expressed in normal or abnormal higher cells (eg cancer cells).

 Peptide II may have the structure of PGX. P represents L-proline, G represents glycine, and X represents 19 L- or D-amino acids except L- or D-proline.

Peptide III may have the structure of PGXX, peptide IV may have the structure of PGXXX, and peptide V may have the structure of PGXGXX. P, G, and X are identical to peptide II.

 Peptide VI has the structure of an elastin interaction site PAAAAKAAKZG or PAAAAKAAAKAG.

Each of blocks 1 to 6 (110 to 160) may be selected independently from each other and may be different peptides selected from peptides I to VI, but is not limited thereto. That is, block 1 (110) is a peptide of one of peptides I to VI, block 2 (120) is a peptide not selected as block 1 (110) of peptides I to VI, and block 3 (130) is a peptide I to VI. The peptide is not selected as block 1 (110) or block 2 (120) of the VI, and block 4 (140) is selected as block 1 (110), block 2 (120) or block 3 (130) of the peptides I to VI. Unblocked peptide, block 5 (150) is a peptide not selected as block 1 (110), block 2 (120), block 3 (130) or block 4 (140) of the peptides I to VI, block 6 (160) ) Is a peptide not selected as Block 1 (110), Block 2 (120), Block 3 (130), Block 4 (140) or Block 5 (150) of the peptides I to VI.

As described above, each of blocks 1 to 6 (110 to 160) may be one independently selected from peptides I to VI. For example, each of blocks 1 to 6 (110 to 160) may be identical to each other of I to VI. For example, block 1 110 and block 3 130 may be identical to each other. In this case, one of the blocks 1 to 6 (110 to 160) may be a peptide I including the cell adhesion peptide RGD or RGDS to enhance the adhesion of the cell and the biopolymer. One of the blocks 1-6 (110-160) may be a peptite VI comprising a binding site PAAAAKAAKZG or PAAAAKAAAKAG of human tropo elastin to enhance multiblock biopolymer 100 cross-linking.

Meanwhile, the multiblock biopolymer 100 according to an embodiment has been described as including blocks 1 to 6 (110 to 160), but is not limited thereto. The multiblock biopolymer 100 according to one embodiment mimics the cell binding recognition peptide Arginine-Glycine-Aspartate (RGD) tripeptide or Arginine-Glycine-Aspartate-Serine (RGDS) tetrapeptide and elastin that are present in multicellular outer wall proteins. Three, four, five, six amino tetrapeptides, pentapeptides, nucleopeptides, and elastin cross-linking sites, including L-proline of structure, may all be included simultaneously.

As described above, by manufacturing the protein-based multiblock biopolymer 100 provided with cell recognition functionality and temperature sensitivity, the following functions can be performed.

(1) By using the multiblock biopolymer 100, disease-causing pathogens (eg, microorganisms, viruses, food toxins, carcinogens, environmental pollutants, etc.) may be detected or separated. For example, multiblock biopolymers can be combined with mechanisms capable of detecting or isolating disease-causing pathogens, and can be made to recognize and bind cell surface antigens through peptide I, which is part of the multiblock biopolymer.

(2) After combining or collecting synthetic drugs and protein drugs such as antibiotics, anticancer drugs, and inflammatory drugs to some of the multi-block biopolymers 100 and administering them in vivo, the drug carriers by binding peptide I and the site of disease It is available.

(3) Through the method of connecting single biopolymer strands to each other using a chemical or enzymatic method to the multiblock biopolymer 100, it can be used as a substrate for cell and tissue culture.

(4) After the cultured cells are bound or collected to a part of the multiblock biopolymer 100 to be administered in vivo, the peptide I can be combined with a target position in vivo to be used as a cell carrier for delivering the cells.

Hereinafter, the use of the drug carrier using the multiblock biopolymer or the cell culture substrate or the cell carrier will be described with reference to FIGS. 2 and 3.

The multiblock biopolymer 100 is easy to genetically manipulate since a simple structure is repeated. That is, the manufacturing method of the multiblock biopolymer 100 has not been described in detail, but the multiblock biopolymer 100 having a simple structure is repeated by sequentially combining blocks included in the multiblock biopolymer 100 according to a general peptide synthesis method. ) Can be prepared.

FIG. 2 is a drug carrier using the multiblock biopolymer of FIG. 1.

Referring to FIG. 2, the drug carrier 200 using the multiblock biopolymer has four multiblock biopolymer monomers 200a to 200d arranged in a row and connected to each other. In this case, each of the multiblock biopolymer monomers 200a to 200d includes blocks 1 to 5 (210 to 250). In particular, block 1 is a peptide I, ie, a cell binding recognition function, which binds to the site of disease. (3) one or more of: a peptide that recognizes a cell causing spore surface antigen of a disease-causing microorganism and (4) a peptide that recognizes a cell surface antigen specifically expressed in normal or abnormal higher cells (e.g., cancer cells). Can be.

Block 4 240 of each of the multiblock biopolymer monomers 200a to 200d is bound to drug 260. The drug 260 may be synthetic drugs and protein drugs, such as antibiotics, anticancer drugs, and inflammatory drugs, but is not limited thereto. In this case, although blocks 4 (240) of each of the multiblock biopolymer monomers (200a to 200d) described that the drug 260 is coupled, the drug is bound to at least one of the multiblock biopolymer monomers (200a to 200d). The drug may be bound to a block other than block 4 240. Meanwhile, although the multiblock biopolymer monomers 200a to 200d are described as including the same blocks, the types of the multiblock biopolymer monomers 200a to 200d may not be the same or may be different in order.

After administering the drug carrier 200 using the multiblock biopolymer described with reference to FIG. 2 in vivo, the drug carrier can be used as the drug carrier by binding the peptide I and the diseased site.

3 is a schematic diagram of a cell culture substrate or cell carrier using the multiblock biopolymer of FIG. 1.

Referring to FIG. 3, the cell culture substrate or cell carrier 300 using the multiblock biopolymer has four multiblock biopolymer monomers 300a connected in series and four multiblock biopolymer monomers 300a connected in series. 4 can be connected in parallel.

In this case, the multiblock biopolymer monomer 300a includes blocks 1 to 5 (310 to 350). In particular, block 1 (310) is a peptide I, ie, a cell binding recognition function described above, to bind the affected area (1) Arginine-Glycine-Aspartate (RGD), (2) Arginine-Glycine-Aspartate-Serine ( RGDS), (3) a recognition peptide for cell and spore surface antigens of disease-causing microorganisms, and (4) a peptide that recognizes cell surface antigens that are specifically expressed in normal or abnormal higher cells (eg cancer cells). Or one or more.

When the cell culture substrate or the cell carrier 300 using the multiblock biopolymer described with reference to FIG. 3 is administered in vivo, the peptide I may bind to the cell or the cell culture to be used as the cell culture substrate or the cell carrier. That is, after the cells cultured in the cell culture substrate or the cell carrier 300 using the multiblock biopolymer are combined or collected and administered in vivo, the cell carriers which deliver the cells by binding the peptide I with a target position in vivo. Can be used as

Experimental Example

Twenty RGD motifs biosynthesized TGPG [VGRGD (VGVPG) ₆ ] ₂₀ WPC (hereinafter referred to as "[VGRGD (VGVPG) ₆ ] ₂₀ ") uniformly dispersed throughout the entire molecular structure. VGRGD of one of the seven peptides was inserted to maximize RGD density. Biological relevance was assessed by comparison with fibronectin, RGD, and TGPG (VGVPG) ₁₄₀ WPCR (hereinafter referred to as "(VGVPG) ₁₄₀ ").

Monomer gene construction and oligomerization

Table 1 shows the sequences of oligonucleotides for VGRGD (VGVPG) ₆ and (VGVPG) ₇ with Eco RI, Nde I, Pfl MI, Bgl I and Hin DIII restriction enzyme sites (NEB).

Oligomer Direction Sequence (5 '→ 3') One Forward AATTCATATGGGCCACGGCGTGGGTCGTGGCGATGTAGGTGTCCCAGGTGTGGGCGTACCGGGCGTTGGTGTTCCT 2 Reverse GCCCGGTACGCCCACACCTGGGACACCTACATCGCCACGACCCACGCCGTGGCCCATATG 3 Forward GGTGTCGGCGTGCCGGGCGTAGGTGTCCCAGGTGTGGGCGTGCCGGGCTGGCA 4 Reverse AGCTTGCCAGCCCGGTACGCCCACACCTGGGACACCTACGCCCGGCACGCCCACACCAGGAACACCAAC 5 Forward AATTCATATGGGCCACGGCGTGGGTGTTCCGGGCGTAGGTGTCCCAGGTGTGGGCGTACCGGGCGTTGGTGTTCCT 6 Reverse GCCCGGTACGCCCACACCTGGGACACCTACGCCCGGAACACCCACGCCGTGGCCCATATG

The double helix DNA cassette was formed by heating a mixture of oligonucleotides 1 and 2, 3, 4 at 95 ° C. for 5 minutes and then cooling at room temperature at a rate of 1 ^o C / min. Cloning vector pUC19 (NEB) was digested dually with Eco RI, Hin DIII, and dephosphorylated using CIP (Promega). pUC19 (linearized pUC19) was purified by gel extraction kits (QIAGEN) and then ligated by double helix DNA cassette of VGRGD (VGVPG) ₆ gene. After ligation, the E. coli Top 10 cells (Invitrogen) were modified with the ligation product by the heat shock method and a recombinant plasmid with correct insert was inserted. The containing clones were isolated by analytical digest using Eco RI, Pfl MI, Hin DIII.

[VGRGD (VGVPG) ₆ ] Genes of _n (n = 10, 12, 15, 20) were prepared by recursive directional ligation (RDL) from plasmids containing VGRGD (VGVPG) ₆ genes. The same procedure was performed using oligonucleotides 3 and 4, 5, 6 when constructing the genes for (VGVPG) ₇ peptide and [(VGVPG) ₇ ] _n .

(VGRGD (VGVPG) ₆ ] _n  And [(VGVPG) ₇ ] _n  Construction of Expression Libraries

Two oligonucleotides (forward: 5'-T ATGACCGGGCCGGGCTGGCCGTGCTGATA-3 'and reverse: 5'-AGCTTATCAGCACGGCCAGCCCGGCCCGGTCA-3') were annealed to form double DNA bearing Nde I and Sfi I, Hin DIII restriction sites. Expression vector pET-25b (+) (NEB) was digested by Nde I and Hin DIII, dephosphorylated using CIP, and pET-25b (+) (linearized pET-25b (+)) was purified by gel extraction kits. The new expression vector pET-25b (+)-1 ligated forward and reverse DNA to pET-25b (+) (linearized pET-25b (+)) and then used Nde I, Sfi I, and Hin DIII. Resulting in a diagnostic restriction.

PUC19 containing the expressed gene was selected from [VGRGD (VGVPG) ₆ ] _n and [(VGVPG) ₇ ] _n libraries and digested by Pfl MI and Bgl I. Gene cassettes were purified using gel extraction kits and ligated with pET-25b (+)-1 (linearized pET-25b (+)-1). E. coli Top10 cells were modified from the mixture and clones containing the recombinant plasmid with correct insert were isolated by analytical digest and DNA sequencing using Ava I, Nde I and Xba I.

PET-25b (+)-1 comprising the [VGRGD (VGVPG) ₆ ] _n gene or [(VGVPG) ₇ ] _n was converted into E. coli BLR (DE3) (Novagen) by heat shock.

[VGRGD (VGVPG) ₆ ] _n and [(VGVPG) ₇ ] _n genes were successfully obtained by RDL and bound to the pET25b (+)-1 expression vector. The expression protein has TGPG and WPC residues in addition to the N- and C-terminus, respectively.

Purification amounts of [VGRGD (VGVPG) ₆ ] _n and (VGVPG) _n were 27.2 and 23.6 mg from 1 L culture, respectively. The presence of monomers / dimers (B in FIG. 4), their ratios were 21:79 and 28:72 for [VGRGD (VGVPG) ₆ ] ₂₀ and (VGVPG) _140, respectively.

Protein purification

Elastin-like protein was expressed and purified from E. coli BLR (DE3) by reversible phase transition. Purified proteins were isolated in pH 7.2 PBS (phosphate buffered saline) and the purified was analyzed by visualization of 12% SDS-PAGE gel with Coomassie Blue. SDS-PAGE gel images were captured using IQuant Capture 350 and analyzed by ImageQuant TL 9 (GE Health Care).

Molecular weights of 59,545 and 58,044 Da for [VGRGD (VGVPG) ₆ ] ₂₀ and (VGVPG) ₁₄₀ , respectively, were calculated.

Cell adhesion, spreading and proliferation assays

The cell adhesion affinity of [VGRGD (VGVPG) ₆ ] ₂₀ was similar to that of natural fibronectin. Comparative experiments were performed on a polystyrene (PS) and _{(VGVPG) 140, [VGRGD (} VGVPG) 6] 20, natural fibronectin (fibronectin uncoated as). Relative adherent fibroblasts relative to PS and (VGVPG) ₁₄₀ were significantly reduced at least 10% and 35% less than the number of cells left on fibronectin.

On the other hand, [VGRGD (VGVPG) ₆ ] ₂₀ adhered to fibronectin, leaving more than 85% of the fibroblast, and the adhesion of [VGRGD (VGVPG) ₆ ] ₂₀ was 2.5 times greater than (VGVPG) ₁₄₀ .

Cell spreading and proliferation was promoted by [VGRGD (VGVPG) ₆ ] ₂₀ . Cell spreading and proliferation tests were performed using HEK293 FB and N2A NB, respectively, and the spreading index (SI) and BrdU labeling index (BLI) were measured.

Observation of the HEK293 FB morphology for PS and (VGVPG) ₁₄₀ did not reveal spherical cells with detectable stratification in culture for more than 24 hours (c and d in FIG. 6A).

(VGVPG) ₁₄₀ is HEK293 FB binding was supported but did not induce spreading of the attached cell. On the other hand, HEK293 FB on [VGRGD (VGVPG) ₆ ] ₂₀ and fibronectin showed a flat polygon shape while spreading well (c and d in FIG. 6A). [VGRGD (VGVPG) ₆ ] ₂₀ had 93% of cells spread within 24 hours and the extent of spreading was similar to the SI of 95% of fibronectin.

The degree of cell proliferation was measured by measuring BrdU incorporation with N2A NB as shown in FIG. 6B. Very low or low levels of BLI (> 5 and 15%) were observed from cells cultured on PS and (VGVPG) (a and b in FIG. 6B). In contrast, average BrdU labeling activity of [VGRGD (VGVPG) ₆ ] ₂₀ and fibrone was 57 ± 5% and 51 ± 7%, respectively (c and d in FIG. 6B). This means that [VGRGD (VGVPG) ₆ ] ₂₀ is not different from fibronectin in terms of activity of cell proliferation.

Embodiments have been described above with reference to the drawings, but the present invention is not limited thereto.

The present invention relates to multiblock biopolymers based on mimetic peptides of human tropotin elastin in nature, genes that designate these biopolymer structures, production and purification of biopolymers, biopolymers to antibiotics, anticancer agents, and cell therapeutics. It can be used as a carrier of the drug containing and the substrate for tissue engineering.

In the above examples and experimental examples, a multiblock biopolymer is described in which six blocks in a row are repeated n (n is an integer of 1 to 5,000) and the two blocks in a row are 20 repeats. Although described, the present invention is not limited thereto. For example, a multiblock biopolymer in which m blocks in a line are repeated n n (n is an integer of 1 to 5,000) may have the same or substantially the same structural and physicochemical properties as the above Examples and Experimental Examples. Can provide.

While the present invention has been described with reference to exemplary embodiments, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. Accordingly, the embodiments disclosed herein are intended to be illustrative rather than limiting, and the spirit and scope of the present invention are not limited by these embodiments.

The protection scope of the present invention should be interpreted by the following claims, and all the technologies within the equivalent scope should be interpreted as being included in the scope of the present invention.

Claims (9)

M blocks (m is an integer of 1 to 100) are connected in a row is repeated n (n is an integer of 1 to 5,000), each of the m blocks is a peptide I that functions to recognize a cell surface antigen, Peptide II with PGX structure (P is L-proline, G is of glycine, X is 19 L- or D-amino acids except L- or D-proline), Peptide III with PGXX structure, PGXXX structure Peptide IV having a structure, Peptide V having a structure of PGXGXX, Block biopolymer, characterized in that one of the peptide VI functioning to promote the interaction of the multi-block biopolymer. The method of claim 1,
Peptide I, which functions to recognize cell surface antigens, is a multi-block biopolymer, characterized in that one or more of cell attachment peptides Arginine-Glycine-Aspartate (RDG) or Arginine-Glycine-Aspartate-Serine (RGDS). The method of claim 1,
Peptide VI, which functions to promote cross-linking of the multiblock biopolymer, comprises a binding site PAAAAKAAKZG or PAAAAKAAAKAG of human tropo elastin. The method of claim 1,
Wherein said m blocks are selected from different peptides from peptides I to VI. The method of claim 1,
The m is a multi-block biopolymer, characterized in that two to six. 5. The method according to any one of claims 1 to 4,
The multiblock biopolymer having a function of detecting or isolating a disease-causing pathogen by using a peptide I that recognizes a cell surface antigen and binds to the multiblock biopolymer. 5. The method according to any one of claims 1 to 4,
A multiblock biopolymer, characterized in that a drug or anticancer agent binds to a part of the multiblock biopolymer, and is delivered to a site of onset to act as a drug carrier. 5. The method according to any one of claims 1 to 4,
A multiblock biopolymer, characterized in that a single biopolymer strand is linked to a multiblock biopolymer using a chemical or enzymatic method and used as a substrate for cell and tissue culture. 5. The method according to any one of claims 1 to 4,
A multiblock biopolymer, which functions as a cell carrier for binding specific cells cultured to some of the multiblock biopolymers and moving them to a target position in vivo.

Images