KR20110127982A - Petal-specific promoter - Google Patents

Abstract

PURPOSE: A promoter which petal-specifically induces expression of a foreign gene in a plant is provided to be used for transformation of various crops in a genetic engineering method. CONSTITUTION: A petal-specific promoter is a promoter of Nicotiana tabacum ANS(anthocyanidin synthase) gene of sequence number 1 or 2. The promoter induces the expression of petal-specific gene. The promoter has a base sequence of sequence number 3. A primer set for amplifying the promoter contains a primer of sequence number 4 and a primer of sequence number 5. A pBGWFS7-PNtANS expression vector contains the promoter. A method for petal-specifically expressing a foreign gene comprises: a step of preparing an expression vector containing the promoter and the foreign gene; and a step of transducing the expression vector to a plant.

Description

Petal-specific promoter

The present invention relates to a promoter, and more particularly, to a promoter that specifically induces the expression site of a foreign useful gene in a plant.

Promoters can achieve the purpose of transformation by confining the expression of foreign genes only to systemic or special tissues of plants, and can be classified as follows according to their function.

First, systemic expression induction promoters can be cited. The promoter of the 35S RNA gene of CaMV: cauliflower mosaic virus (CaMV) is used as a representative dicotyledonous promoter. Rice actin and corn ubiquithin gene promoters have been mainly used as the systemic expression inducing promoters for monocotyledonous plants such as rice, and recently, a promoter of rice cytochrome C gene (OsOc1) has been developed and used by domestic researchers. (See Reg. No. 10-0429335). These are already inherent to induce the expression of antibiotic or herbicide resistance genes and reporter genes used as selection markers in the plant transformation basic carriers. Promoters are considered.

Second, seed specific promoters can be mentioned. As a representative example, the rice gluten promoter used to develop golden rice as a promoter of the major storage protein gene of rice has been widely used to induce seed-specific expression of monocotyledonous plants. Promoters mainly used to induce seed specific expression include soybean-derived lectin promoters, cabbage-derived napin promoters, and gamma-tocopherol methyl transferase (γ-TMT) in seedlings of Arabidopsis. Induction of seed specific expression of carrot-derived DC-3 promoter and perilla-derived oleosin promoter used in studies that enhanced gene E production by inducing gene expression (see patent application No. 10-2006-0000783) There is. The seed specific promoters are mainly used for the purpose of accumulating useful proteins and producing useful substances in major crops in which the seeds themselves are used as food, food or food ingredients.

Third is the root specific expression promoter. Although there is no commercialized case, Arabidopsis peroxidase (peroxidase, prxEa) was isolated and confirmed root-specific expression. Recently, the sweet potato-derived Maz gene (ibMADS) and sugar-induced ADP-glucose pyrophosphatase (ADP-glucose pyrophosphatase) , AGPase) gene is isolated to confirm that the promoter induces specific expression in the roots, and induces root-specific transient expression in carrots and radishes (patent registration No. 10-0604186, 10-0604191) There is a bar.

Fourth, other tissue specific promoters, such as a leaf, can be mentioned. Rice and corn-derived albics (rbcS) promoters that induce potent gene expression only in photosynthetic tissues such as leaves, RolD promoters that induce plant root expression from Agrobacterium, and tubers from potato Specific expression-induced patatin promoters, tomato-derived fruit mature specific expression-induced phytoene synthase (PDS) promoters, and the like.

Other developments are currently underway, but new promoters that can precisely regulate the location of gene expression according to the developer's intention, such as genes that need to be expressed only in certain organs (eg, medicine, petals, roots, etc.) In the case of transforming, infertility, burning, certain metabolic substances, and defenses, there is a need for further development of promoters that work only at specific organs or periods.

Accordingly, the present invention has been made to solve the problems of the prior art, an object of the present invention to provide a promoter for inducing the expression of genes specifically to the petals.

Another object of the present invention is to provide a primer set for amplifying a promoter that induces expression of a gene specifically in petals.

Still another object of the present invention is to provide an expression vector comprising a promoter for inducing the expression of genes specifically in petals.

Still another object of the present invention is to provide a transformant transformed with an expression vector comprising a promoter for inducing the expression of genes specifically in petals.

Still another object of the present invention is to provide a method for specifically expressing a foreign gene in a petal.

Still another object of the present invention is to provide a novel tobacco (Nicotiana tabacum) anthocyanidin synthase (ANS) gene that is specifically expressed in petals.

In order to achieve the above object, the present inventors can find promoters capable of regulating tissue or organ specific gene expression of plants, thereby limiting to specific tissues or organs of plants to specifically express or inhibit target genes. Attempted to establish an existing system. In this process, it was confirmed that the ANS (anthocyanidin synthase) gene of tobacco is not expressed in tobacco leaves, stems, roots, surgery, pistils, seeds, but specifically in petals and perilla. Thus, the promoter of the ANS gene The present invention was completed by confirming that the reporter gene was specifically expressed in the transformant transformed by preparing the expression vector including the same and then introducing the same into plants.

The present invention provides a petal-specific promoter characterized by inducing expression of genes specifically to petals as a promoter of tobacco (Nicotiana tabacum) anthocyanidin synthase (ANS) gene.

In another aspect, the present invention provides a primer set for amplifying the promoter, comprising a primer having a nucleotide sequence of SEQ ID NO: 4 and a primer having a nucleotide sequence of SEQ ID NO: 5.

In another aspect, the present invention provides an expression vector comprising the promoter.

In another aspect, the present invention provides a transformant transformed with the expression vector.

In another aspect, the present invention comprises the steps of preparing an expression vector comprising the promoter and a foreign gene operably linked to the promoter and introducing the produced expression vector into a plant to transform the foreign gene, petal-specific It provides a method of expression.

In another aspect, the present invention provides a novel tobacco (Nicotiana tabacum) ANS (anthocyanidin synthase) gene consisting specifically of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

Hereinafter, the present invention will be described in detail.

A promoter is an essential element for regulating the environmental, temporal and histological expression of a gene. The petal specific promoter according to the present invention can be used to specifically induce the expression site of a foreign useful gene in a plant.

The present invention provides a promoter of the tobacco (Nicotiana tabacum) anthocyanidin synthase (ANS) gene, which provides a petal specific promoter (hereinafter referred to as the 'promoter of the present invention') that induces the expression of a foreign gene to be specific to the petal.

Preferably, the promoter has the nucleotide sequence of SEQ ID NO: 3 or FIG.

The invention also provides a primer set for amplifying the promoter of the invention. Preferably, the primer set comprises a primer having a nucleotide sequence of SEQ ID NO: 4 (PANS-F: 5'-CCGGTCAACTCAAGACAACCTACCTATTTAA-3 ') and a primer having a nucleotide sequence of SEQ ID NO: 5 (PANS-R: 5'-CTCTGTATTATTCTTGCTTTTTCTTTCTTTCCC-3). Contains').

The present invention also provides an expression vector comprising the promoter of the present invention.

Preferably, the expression vector may include useful foreign genes to be specifically expressed in petals.

The foreign gene may be anything related to the characteristics of the flower, such as the color, development and fragrance of the flower. Preferably, the foreign gene is an anthocyanin biosynthetic gene (DFR (dihydroflavonol reductase), which is known as the main pigment of the petal. ; AAN63056, ABY81885, AAZ57436, CAA70345, AAD26204, AAS46256, ABF74722, LOC100286107, AB011667), F3'5'H (flavonoid 3'5 'hydroxylase; AAX51796, AAB17562, ABQ96219, AAZ79451, ABH065194, AC002467809 XP00 GQ891056, U72654), ANS (anthocyanidin synthase; ABM66367, ACC66093, AAK52455, AAV88087, AAT02642, BAF81268 ABM53758, ABM63373, BAB71811, BAE54520, AAY15743, AK226417, GU598212, DQ884194, Synthetic Carrogene) ;, CAA85775, YP_003506175, NP_217914, AAA34187, CAA85775, FJ971176, DQ335097, BAE45299, CAC19567, ACP27623, ABB72444, AAT38474, ABW80612, AAL82578), Crt (phytoene desaturase; AAA20109, YP_ 08479, YP_003136107, YP_002566545, YP_001990702, ACM57475, ACL36586, ACQ71086, ACI64605, NC_013946.1), etc.), as genes related to the development of flowers, for example, MADS box-related TF genes (CAL07982, ABM67697, AAF66690, BAG48168, NPA19810332) CAC13148, AAC27353, CAC86184, AAQ83834, AAN15183, AAF22139, AAD02250, AAB05559, BAD15367, BAD12462, ACY71503, AAG43855, AAG43854, AAC27145, NP_001078745, NP_199999, BT035373, AAQ11687, AB92105332, BD00110597, BD Any one or more selected from the group consisting of genes (XM_002509543, AY705977, CBI41085.3, XP_002329899.1, ACU24041.1, Q50EX6.1, CBI24555.3, AAS10075.1) and the like can be used.

The expression vector may be a promoter of the present invention introduced into a conventional vector, the preparation of the expression vector by introducing the promoter of the present invention is easily carried out according to a known method to those skilled in the art to which the present invention pertains. It is possible.

The conventional vector may be any one capable of introducing the promoter of the present invention, but preferably, a vector of the pUC family, such as pBR322, pBI121, pBGWFS7, pCAMBIA, Gateway vector, Ti-plasmid, and a vector derived therefrom. It may be any one selected from the group consisting of.

Preferably, the expression vector is pBGWFS7-PNtANS represented by the cleavage map of FIG. 3 in which the promoter of the present invention is introduced into the pBGWFS7 vector.

The present invention also provides a transformant transformed with the expression vector comprising the promoter of the present invention.

The 'transformer' is transformed using the expression vector of the present invention, and includes all transformed protoplasts, cells, tissues or organs of plants, and those regenerated into complete plants according to known methods.

Transformation methods include protoplast transformation using calcium / polyethylene glycol, electroporation, microinjection, (coated) particle bombardment, electrophration, and Agrobacterium. Rohan method, gene gun and physical introduction, etc., but is not limited thereto, it can be appropriately adjusted according to the type of plant.

In addition to such direct gene transformation methods, transformation systems comprising vectors such as viral vectors (eg, obtained from Cauliflower Mosaic Virus (CaMV)) and bacterial vectors (eg, from the genus Agrobacterium) are also provided. Widely available. After selection and / or screening of the resulting transgenic plants, the transformed protoplasts, cells or tissues or organs of the plants can be regenerated into complete plants according to known methods. The choice of transformation and / or regeneration techniques is apparent to those skilled in the art.

Plants subject to transformation according to the present invention is a food crop selected from the group consisting of rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, oats and sorghum; Vegetable crops selected from the group consisting of Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion, and carrot; Special crops selected from the group consisting of ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut and rapeseed; Fruit trees selected from the group consisting of apple trees, pear trees, jujube trees, peaches, lambs, grapes, citrus fruits, persimmons, plums, apricots and bananas; Flowers selected from the group consisting of roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And fodder crops selected from the group consisting of lygragrass, red clover, orchardgrass, alpha alpha, tolsque cue and perennial lygragrass, preferably tobacco.

The present invention also includes the steps of preparing an expression vector comprising a promoter of the present invention, and a foreign gene operably linked to the promoter, and introducing and transforming the produced expression vector into a plant. It provides a method for expressing the petals specifically.

In addition, the petal specific promoter of the present invention can be used to search for promoters having tissue specificity through methods such as search using a genetic database, Southern blot analysis, PCR, genomic library search, and shotgun. Genes and proteins whose expression is regulated by the retrieved promoters can be selected as genes and proteins having tissue specific expression.

Promoters are essential factors for regulating the environmental, temporal and histological expression of genes. Petal specific promoters according to the present invention can be used to specifically induce the expression of foreign useful genes in plants without affecting plant growth. Can be. Accordingly, when you want to transform a variety of crops including tobacco for genetic transformation by genetic engineering method, the petal specific promoter of the present invention can be usefully used.

1 is a photograph showing the number of ANS genes in the tobacco genome using the ANS gene as a probe after digesting the tobacco genomic DNA with respective restriction enzymes. As a result, two or more bands were observed, revealing that the ANS gene is present in two copies in the genome.
Figure 2 after separating the RNA from each tissue of the tobacco, using the ANS gene as a probe to confirm the expression pattern by tissue, the band is observed only in the petals and periphery revealed that the ANS gene is specifically expressed.
3 is a schematic diagram of an expression vector for confirming the promoter activity of the ANS gene. Bar represents herbicide resistance gene, NtANS-P represents NtANS promoter, Egfp represents green fluorescent protein gene, Gus represents ß-glucuronidase gene, and T35S represents cauliflower virus 35S terminator.
Figure 4 shows the blue color reaction in seedlings, leaves and flowers of tobacco transformed with pBGWFS7-PNtANS and pBGWFS7-P35S, respectively.
Figure 5 is extracted from the petals of tobacco transformed with pBGWFS7-PNtANS and pBGWFS7-P35S and quantified the expression of blue chromogenic protein compared with the expression of blue chromogenic protein in a nontransformed Arabidopsis, a positive control. .
Figure 6 shows the specific amplification of the blue chromogenic protein gene GUS and the tobacco intrinsic gene actin gene, respectively, after reverse transcription using total RNA extracted from each tissue of tobacco transformed with pBGWFS7-PNtANS and pBGWFS7-P35S. Electrophoresis picture showing gene band amplified with primers.
Figure 7 shows the full-length ANS gene sequence in accordance with Example 1 of the present invention.
Figure 8 shows the genomic base sequence of the ANS gene according to Example 2 of the present invention.
Figure 9 shows the nucleotide sequence of the petal specific promoter according to the present invention.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the scope of the present invention is not limited to the following examples. In addition, molecular biology experimental techniques not specifically mentioned in the following examples were referred to Samle et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, second edition, 1989).

Example  1. Tobacco Plants ANS  Isolation of genes

To isolate the tobacco ANS gene, total RNA (total RNA) was first isolated from tobacco petals, and reverse transcriptase-polymerase (RT-PCR) analysis was performed using reverse transcriptase. In detail, the entire RNA isolation procedure is described. Approximately 1 g of each sample is frozen with liquid nitrogen, then pulverized with a mortar and transferred to a 1.5 ml tube, followed by 500 µl of RNA extraction buffer (50 mM sodium acetate pH 5.5). , 150 mM LiCl, 5 mM EDTA, 0.5% SDS) and 500 µl phenol were added and mixed. The mixed solution was treated at 65 ° C. for 10 minutes and then mixed using a stirrer (rotary shaker) at room temperature for 15 minutes. After centrifugation at 4 ° C. (10000 rpm, 10 minutes), the supernatant layer was carefully transferred to a new tube, 500 μl of chloroform was added thereto, mixed well, and centrifuged again (14,000 rpm, 20 minutes) to obtain a supernatant. 0.6M volume of 8M lithium chloride (LiCl) was added thereto and then stored at -20 ° C for at least 2 hours. After centrifugation at 4 ° C. and 12,000 rpm for 20 minutes, the RNA precipitate was washed once with 4M LiCl and 80% ethanol, and the final RNA precipitate was dissolved in 50 μl of distilled water. RNA eluate was quantified by measuring the A260 / A280 using a UV spectrophotometer, and then 50 μM oligo dT primer and reverse transcriptase (invitrogen) were used as the template for 5 μg of total RNA 5 μg. After 5 minutes of cooling in ice and 1μl of RNase H (invitrogen) was added thereto again and treated with DNA polymerase (invitrogen) for 20 minutes at 37 ℃ to synthesize cDNA (10X RT buffer, 25mM MgCl2, 0.1 M DTT, RNase OUT, SuperScriptTM RT, invitrogen) and a primer set that amplifies the conserved portion of the ANS gene using the synthesized cDNA as a template, that is, a forward primer of SEQ ID NO: 6 (ANS-F: 5'-GAAAAGGAGAAGTATGCTAATGACC-3 '). And a reverse primer having a SEQ ID NO: 7 (ANS-R: 5'-CCCACTGGCCTTCATAGAAGAGTTG-3 '). PCR amplification was performed using pre-denaturation at 94 ° C for 3 minutes, denaturation at 94 ° C for 45 seconds, annealing at 57 ° C for 45 seconds, and extension at 72 ° C for 30 seconds. Cycle and final extension at 72 ° C. for 5 minutes. The amplified PCR product was cloned into the pGEM-T Easy vector (Promega, USA) and the nucleotide sequence was confirmed. In order to obtain a full length ANS sequence based on the analyzed nucleotide sequence, Rapid Amplification of cDNA Ends (RACE) PCR (SMART ™ RACE cDNA Amplification Kit, Clontech) was performed. Experimental method was carried out according to the manufacturer (Clontech) method, using 5'-GGAGAAGATCATCCTTAAGCCCCTA-3 'primer and SEQ ID NO: 5'-GTCCTCAAGGAGGATGAACAGGATGCC-3' primer to perform 3 'RACE, PCR was performed using the primer of 5'-CCAGGGGATGCACAAAAACTGG-3 'of SEQ ID NO: 10 to perform 5' RACE. Each amplified PCR product was cloned into a pGEM-T Easy vector (Promega, USA) and then sequenced. The full length ANS gene was obtained by PCR using the following primers (SEQ ID NO: 11 and SEQ ID NO: 12), and the cDNA base sequences of the full length ANS gene are shown in SEQ ID NO: 1 and FIG.

full ANS-F: 5'-GAAAGAAAAAAGCAAGAATAATACAGAG-3 '(SEQ ID NO: 11)

full ANS-R: 5'-TTCTTCACATAAAACCATCAGAG-3 '(SEQ ID NO: 12)

Example  2. Tobacco ANS  Gene plant Within the genome Gene count  Confirm

Southern blot analysis was performed to confirm the number of genes in the genome of ANS genes in tobacco plants. Genomic DNA uses the method of Kim JS (Composite of a linkage map of Brassica rapa (ssp. Pekinenssis) using EST clones and comparative genome study to Arabidopsis thaliana.PhD thesis, Kyunghee University, Suwon, Republic of Korea, 2002) 20 μg DNA from tobacco leaves were treated with restriction enzymes EcoR I, Eco R V, Bgl II, Hind III, Kpn I, Xba I, BamH I (ROCHE), respectively, and electrophoresed on 0.8% agarose gel, followed by capillary transfer. (Southern, 1975) to nylon membrane. Membrane was 3 hours (65 ° C) in a solution to which 0.5 M Na-Pi (pH 7.2), 7% SDS, 1% BSA, 1 mM EDTA, 0.1 mg / ml denatured salmon sperm DNA (invitrogen) was added. Prehybirdization followed by hybridization for 12 hours by addition of the ANS cDNA obtained in Example 1 labeled with [a-32P] dCTP. Membranes were washed for 20 minutes in 2 X SSC, 0.1% SDS solution (65 ° C.) and 20 minutes in 1 X SSC, 0.1% SDS solution (65 ° C.), followed by Bio-imaging analyzer (BAS-2000; Fuji). Photo Film, Japan). As a result, it was confirmed that the ANS gene of tobacco exists in two copies in the genome (FIG. 1). The genome sequence of the ANS gene is shown in SEQ ID NO: 2 and FIG.

Example  3. Tobacco ANS  Gene expression analysis

In order to perform expression analysis of the isolated ANS gene, total RNA was extracted in the same manner as in Example 1 using Trizol (Trizol, Invitrogen) in tobacco leaves, stems, petals, pistils, stamens, calyxes, ovaries, and seeds. Extracted. 20 μg of isolated total RNA was electrophoresed on 1% formaldehyde agarose gel and then transferred to nylon membrane by capillary delivery method. Hybridization reaction and washing of the membrane was carried out in the same manner as the Southern analysis of Example 2. As a result, genes were not expressed in the leaves, stems, roots, stamens, pistils, and seeds of tobacco, but the petals and ovaries did not. Only fragments were detected and it was confirmed that the expression of the ANS gene of tobacco is specifically made of petals and lobules (FIG. 2). Therefore, it was confirmed that the ANS gene of tobacco is petal-specific, and to isolate the promoter of the ANS gene.

Example  4. Tobacco ANS  Isolate promoter regions of genes

To isolate the promoter region of the ANS gene, the genome of tobacco genome was isolated and the promoter region of the ANS gene was amplified using methods provided by the manufacturer using a genome walker (Genome walker, Invitrogen). Genomic DNA isolated according to the method of Genomic Walker was treated for 2 hours at 37 ° C. using blunt-end restriction enzyme (ROCHE) of Dra I, EcoR V, Pvu II, and Stu I, followed by electrophoresis. The cleavage was confirmed. 25 uM genomic walker adapter (SEQ ID NO: 13: 5'-GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT-3 ', SEQ ID NO: 14: 3'-H2N-CCCGACCA-PO4-5') was added to the cleaved genomic DNA for at least 8 hours. ) Was performed. After 5 minutes treatment at 70 ° C. to inhibit enzymatic reaction, ANS GW1 (SEQ ID NO: 15: 5'-AGGTGCATAACACCCCATTCTATAGCTGC-3 ') and AP1 primer (SEQ ID NO: 16: 5'-GTAATACGACTCACTATAGGGC-3') were used as template DNA. The first PCR was carried out using A, and diluted to perform a second PCR using ANS GW2 (SEQ ID NO: 17: 5'-GTGGCCTCACATACTCTTTAGGGATAGCCTGG-3 ') and AP2 primer (SEQ ID NO: 18: 5'-ACTATAGGGCACGCGTGGT-3'). It was. The first PCR and the second PCR conditions were denatured at 94 ° C. for 3 minutes, followed by 7 times in 25 seconds at 94 ° C., 3 minutes at 72 ° C., 32 seconds at 25 ° C. at 94 ° C., and 3 minutes at 68 ° C. It carried out repeatedly, and amplified for 5 minutes at 68 ° C. The amplified PCR product was subjected to electrophoresis on 1% agarose gel, purified using Qiagen Gel Extraction Kit (Qiagen), and then inserted into pGEM-T easy vector (Promega). As a result of confirming the sequence, it was confirmed that the promoter region of the ANS gene was as shown in SEQ ID NO: 3 or FIG. 9 (SEQ ID NO: 3, FIG. 9).

In addition, the promoter region can be isolated or amplified using the following primers (SEQ ID NO: 4 and SEQ ID NO: 5).

PANS-F: 5'-CCGGTCAACTCAAGACAACCTACCTATTTAA-3 '(SEQ ID NO: 4)

PANS-R: 5'-CTCTGTATTATTCTTGCTTTTTCTTTCTTTCCC-3 '(SEQ ID NO: 5)

Example  5. Transformation plasmid preparation

PANS-attB1 primer (SEQ ID NO: 23: 5'-) designed to further include a part of the bacterial side specific recombinant nucleic acid sequence region in each of primers (SEQ ID NO: 4 and SEQ ID NO: 5) separating the promoter region of the ANS gene of Example 4 AAAAAGCAGGCTCCGGTCAACTCAAGACAACCTACCTATTTAA -3 ') and pANS -attB2 primer (SEQ ID NO: 24: 5'-AGAAAGCTGGGTCTCTGTATTATTCTTGCTTTTTCTTTCTTTCCC-3') were prepared, and an ANS promoter site was isolated by PCR. PCR was denatured at 94 ° C. for 2 minutes, repeated 30 times at 94 ° C., 30 seconds at 60 ° C., 30 seconds at 72 ° C., 1 minute 30 seconds, and finally amplified at 72 ° C. for 5 minutes. lost.

The amplified PCR products, ie, the PCR products of the ANS promoter, are composed of adapter primer B1 (SEQ ID NO: 25: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3 ') and adapter primer B which contain the entire bacterial-specific recombinant nucleic acid sequence site when the bacteria are infected with bacteriophages. Secondary PCR was performed using 2 (SEQ ID NO: 26: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3 '). The secondary PCR was denatured at 94 ° C. for 2 minutes, then repeated 30 times at 94 ° C. for 30 seconds, at 60 ° C. for 30 seconds, at 72 ° C. for 1 minute and 30 seconds, and the final amplification at 72 ° C. for 5 minutes. Was done.

The secondary PCR products are a BP recombination reaction with a pDONR221 vector (invitrogen) containing a bacteriophage-side specific recombinant nucleic acid sequence site when bacteria are infected with bacteriophage, that is, a BP reaction buffer, 200ng of the PCR product, 150ng of pDONR221 vector, and a gateway BP. Clonal (clonase) enzyme mixture was mixed well, and then reacted overnight at 25 ° C to prepare pDONR-PNtANS, an intermediate cloning vector into which the PNtANS promoter was inserted.

The cloning vector is a pBGWFS7 vector (Plant System Biology) in which a reporter system in which the Egfp (green fluorescent protein) gene and the Gus (blue-coloring, ß-glucuronidase) gene are linked to produce a final expression vector is embedded. And LR recombination reaction, that is, LR reaction buffer, pDONR-PNtANS vector 300ng and gateway LR clonease (enzyme mixture) mixed well, and then reacted overnight at 25 ° C. PBGWFS7-PNtANS expression vector was completed. The pBGWFS7 is used as a binary vector, has a spectinomycin resistance gene for microbial selection, and includes a herbicide resistant Bar gene as a plant selection factor. In order to compare this with the activity of P35S mainly used in the transformation of dicotyledonous plants, pBGWFS7-P35S produced by the domestic researchers was used (see Application No. 10-2009-0031765).

The transformed expression vectors were transformed into Agrobacterium tumefaciens strain LBA4404 (Clontech) according to the direct Agrobacterium transformation method using liquid nitrogen (refer to the freeze-thaw method of Holster et al., 1978). Used for transformation.

Example  6. Plant Materials and Tobacco Transformation

Agrobacterium solution transformed with the expression vector pBGWFS7-PNtANS prepared in Example 5 was co-cultured with tobacco leaves (Nicotiana tabaccum cv Xanthi) to transform tobacco. The medium used for the coculture was MS medium (Kisan Biotech) to which 1 mg / l NAA, 1 mg / l BA, 20 g / l sucrose, and 8 g / l agar were added. 1 mg / l NAA, 1 mg / l BA, 300 mg / l carbenicillin, 3 mg / l phosphinothricin (PPT), 20 mg / l number to obtain transformed regenerated plants Cross, 8 mg / l agar was incubated in MS medium (Kisan Biotech) added, and then subcultured every three weeks. Regenerated shoots were transferred to MS medium supplemented with 300 mg / l carbenicillin, 3 mg / l PPT, 20 g / l sucrose, and 8 g / l agar to induce rooting. Cultivation was carried out under conditions of 26 ℃, 16 hours photoperiod / 8 hours dark cycle, rooted individuals were transplanted into pollen after growth and grown in a greenhouse at the average temperature of 26 ℃ or more when the seeds matured. The seeded seeds were sown again and selected for transformants of the T1 generation by sparging 0.3% Basta (Biel CropScience). T1 transgenic plants were grown in a greenhouse for about 4 months to seed T2 seeds.

Example  7. GUS Blue color  Reaction analysis

PNtANS transformed T2 seeds were sown and sprayed with 0.3% Basta (Biel CropScience) to observe the expression of GUS, a reporter gene in the flowers, leaves and seedlings of selected transgenic tobacco plants. A control transgenic tobacco plant was germinated without treatment with batha. The flower and leaf tissues of the seedling tobacco on the 30th day after planting and the transformed tobacco plants on the 90th day after sowing were treated with GUS-assay buffer [solution I: X-gluc (cyclohexyl ammonium salt) 20 mM, solution II: NaH2PO4 H2O 100 mM, NaEDTA 10mM, Triton-X-100 0.1%, pH7.5] and after treatment at 37 ℃ for 24 hours, and treated with 70% ethanol to remove chlorophyll (chlorophyll). Plants were observed using an optical microscope or visually (FIG. 4). Seedlings (A in FIG. 4) and leaves (B in FIG. 4) showed GUS blue coloration throughout the 35S-P transformant, while nontransformant tobacco (Control in FIG. 4) and PNtANS tobacco ( In ANS-P) of FIG. 4, GUS blue color was not observed at all. In the case of the petals (C of FIG. 4), GUS blue coloration was not observed at all in the petal and calyx of the non-transformant tobacco, and GUS blue coloration was observed in all the flowers in the 35S-P transformant. In the case of PNtANS tobacco plants, GUS blue coloration was observed only in the petals, indicating that the petal-specific expression promoter.

Example  8. GUS Blue color  Quantitative Analysis

To investigate the GUS blue color expression level of PNtANS, proteins were isolated from the petals of 35S-P transformed tobacco and non-transformed tobacco, which are tobacco T2 generation transformed with PNtANS and control. In order to separate the whole protein, liquid nitrogen was frozen and then ground with a mortar and pestle, about 50 mg of tissue-specific sample was transferred to a 1.5 ml tube, and 100 µl of protein extraction buffer (50 mM sodium phosphate, pH 7.0, 10 mM) was added to each tube. Dithiothreitol (DTT), 1 mM disodium EDTA, 0.1% SDS, 0.1% Triton X-100) were added and mixed. The mixture was centrifuged at 4 ° C. and 15,000 rpm for 5 minutes, the supernatant was transferred to a new tube, and 50 μl of this was taken. 50 μl of assay solution (1.2 mM MUGluc, 10.0 mM b-mer in 1 × reaction buffer) was adjusted to 37 ° C. Captoethanol, FluorAce b-glucuronidase reporter assay kit, Bio-Rad) was mixed and reacted for 30 minutes in a 37 ° C. water bath. 100 μl of the 1 × stop buffer was mixed well with each sample, and GUS activity was quantified by using a fluorescence photometer (excitation filter 355 nm and emission filter 460 nm). As a result, the expression level of GUS protein in the petals of tobacco transformed with PNtANS is comparable to that of tobacco transformed with 35S-P, which is one of the best expressed as representative promoters for systemic expression in dicotyledonous plants. It was confirmed, through this it was confirmed that the expression efficiency of the promoter of the present invention is very high (Fig. 5).

Example  9. Transgenic Plants RT - PCR  reaction

Total RNA extracted in the same manner as in Example 1 from various tissues such as leaves, stems, petals, surgery, pistils, and calyx of selected transgenic tobacco plants by seeding transformed T2 seed and spreading 0.3% Basta (Biel CropScience) 50 μM oligo dT primer with 50 μM oligo dT primer for 5 minutes at 50 ° C., 5 min at 85 ° C., and then cooled on ice. 10X RT buffer, 25mM MgCl2, 0.1M DTT, RNase OUT, SuperScriptTM RT), and the synthesized cDNA was used as a template for the blue chromosome gene GUS specific primer set, ie, the forward primer of SEQ ID NO: 19 (GUS-F: 5'-ACCTGCGTCAATGTAATGTTCTGC- 3 ') and a set of reverse primers (GUS-R: 5'-CTCCCTGCTGCGGTTTTTCA-3') with SEQ ID NO. 20 and a set of tobacco actin primers, SEQ ID NO. 21, to demonstrate that the relative amounts of RNA used are uniform. Inn forward plastic Denatured at 95 ° C. for 15 minutes using NtACT-F: 5′-CCCTCCCACATGCTATTCT-3 ′ and a reverse primer of SEQ ID NO: 22 (NtACT-R: 5′-AGAGCCTCCAATCCAGACA-3 ′), followed by denaturation at 95 ° C. for 30 seconds. After the reaction, PCR was performed by repeating annealing reaction at 60 ° C. for 30 seconds and a series of polymerization reactions at 72 ° C. for 30 seconds.

As a result of the reverse transcription PCR reaction, the transcript of the blue chromogenic protein gene GUS was not detected in the tissues such as leaves, stems, calyx, surgery, and pistil of PNtANS transgenic tobacco, and the transcript of the blue chromogenic protein gene GUS was detected only in the petals. Although the experiment was performed using the same amount of RNA, it was confirmed that the results are different depending on the expression of the tissue-specific ANS promoter. The uniform amount of RNA used at this time was proved using the tobacco actin gene (Fig. 6).

<110> REPUBLIC OF KOREA (MANAGENENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Petal-specific promoter <130> DPP-2010-1775-KR <160> 26 <170> KopatentIn 1.71 <210> 1 <211> 1281 <212> DNA <213> Artificial Sequence <220> <223> cDNA of ANS gene of Nicotiana tabacum <400> 1 atggtggtga tcagtgcagt agttccaact ccttcaagag ttgaaagctt ggctaaaagt 60 ggaatccagg ctatccctaa agagtatgtg aggccacaag aagagttaaa tggaatagga 120 aacatatttg aggaagagaa gaaagatgaa ggacctcaag taccgacgat tgatctaaca 180 gaaatcgact cagaggacaa ggaaattcga gagaaatgcc accaagagtt gaagaaagca 240 gctatagaat ggggtgttat gcaccttgtt aaccatggca tatcagatga gctaattgat 300 cgtgtcaagg tttctggaga taccttcttt gatcaacctg ttgaagaaaa ggagaagtat 360 gctaatgacc aaccctctgg caatgtccaa ggctatggca gcaagctagc aaatagtgct 420 tgtggtcagc ttgagtggga ggattatttc ttccattgtg ttttccctga ggacaagtgc 480 aacttatcca tctggccgaa aacccctaca gactacattc cagcaacaag tgaatatgcc 540 aagcagatca ggaacctagc aacaaagatt ttggcagtgc tttctattgg gctgagacta 600 gaagaaggaa gactagagaa ggaagtcgga ggcatggagg acctgctgct tcaaatgaag 660 attaactact atcccaaatg cccccaacca gaactagcac ttggtgtcga agctcatact 720 gatgtcagtg cactgacttt tatcctccac aatatggtgc ctggcttgca actcttctac 780 gaaggacagt gggtaacggc aaagtgtgtg cctaattcca taatcatgca tattggggac 840 acccttgaaa ttctaagcaa tggaaagtac aagagcattc ttcacagagg ggttgtgaat 900 aaagagaaaa taagaatctc atgggctatt ttctgtgagc cgccgaagga gaagatcatc 960 cttaagcccc tacctgagac tataactgag gctgagccac ctcgattccc acctcgcacc 1020 tttgcacagc atatggccca taagctcttc aagaaggatg atcaggatgc tgctgctgaa 1080 cacaaagtct ccaagaagga tgacccggat tctgctgctg aacacaaacc cttcaagaag 1140 gatgatcagg atgctgttgc tcagcaaaaa gtcctcaagg aggatgaaca gaatgccgct 1200 gctgagcaca aagtcttcaa gaaggataat caggatgctg ctgctgaaga atctaaatag 1260 cttctcttgt tgtcactctg a 1281 <210> 2 <211> 1545 <212> DNA <213> Artificial Sequence <220> <223> genome DNA of ANS gene of Nicotiana tabacum <400> 2 atggtggtga tcagtgcagt agttccaact ccttcaagag ttgaaagctt ggctaaaagt 60 ggaatccagg ctatccctaa agagtatgtg aggccacaag aagagttaaa tggaatagga 120 aacatatttg aggaagagaa gaaagatgaa ggacctcaag taccgacgat tgatctgaaa 180 gaaatcgact cagaggacaa ggaaattcgc gagaaatgcc acaaagagtt gaagaaagca 240 gctatggagt ggggtgttat gtaccttgtt aaccatggca tatcagatca gctaattgat 300 cgtgtcaagg ttgctggaaa gaccttcttt gatcaacctg ttgaagaaaa ggagaagtat 360 gctaatgacc aaccctctgg caatgtccaa ggctatggca gcaagttagc aaatagtgct 420 tgtggtcagc ttgaatggga ggattatttc ttccattgcg ttttccccga ggacaagtgc 480 gacttatcca tctggcctaa aatccctact gactacatgt aagcttctta taatttcata 540 attgcagatt tttcaatctt tttttccctg taacggtggt gtctgggtca gcctgtgcac 600 accgcgacta atccaccgat aacctactac ctcccaccag cttaggtgct ggataacttt 660 gttcaccaag ggttggcaga taggaagaga tcacctaatg ttttttgttt atgctaaaat 720 ttcaaccctg gtctctagga cttttactgc ttcactgacc actaaacatt tccaacttgc 780 agtccagcaa caagtgaata tgccaaacag attaggaacc tagcaacaaa gattttggca 840 gtgctttcta ttgggctggg actagaagaa ggaagactag agaaggaagt cggaggcaag 900 gaggacctac tgcttcaaat gaagattaac tactacccca aatgtcccca accagaacta 960 gcacttggcg ttgaagctca tactgatgtg agtgcactga cttttatcct ccacaatatg 1020 gtgcctgggt tacaactttt ctatgaagga cagtgggtaa cggcaaagtg tgtgcctaat 1080 tccataatca tgcatattgg ggacaccctt gaaatcctaa gcaatggaaa gtacaaaagc 1140 attcttcaca gaggggttgt gaataaagag aaagtaagaa tctcatgggc tattttctgt 1200 gagccgccaa aggagaagat catccttaag cccctatctg agactatcac tgaggctgaa 1260 ccacctcgat tcccacctcg cacctttgca cagcatatgg cccataagct cttcaagaag 1320 gatgatcagg atgctgctgc tgaacacaaa gtctccaaga aggatgaccc ggattctgct 1380 gctggacaca aacccttcaa gaaggatgat caggatgctg ttgttcagca aaaagtcctc 1440 aaggaggatg aacaggatgc cgctgctgag cacaaagtct tcaagaagga taatcaggat 1500 gctgctgctg aagaatctaa atagcttctc ttgttgtcac tctga 1545 <210> 3 <211> 955 <212> DNA <213> Artificial Sequence <220> <223> genome DNA of ANS gene promoter of Nicotiana tabacum <400> 3 ccggtcaact caagacaacc tacctattta atttttccac ccataatata aacctcaact -896 aaatagagca caaaagtgca ataaagtggg agaaagattt aaaggcaaga gagaatttaa -836 tattcatcca gagatagtgg taagtttgca aataatggcc ttctttatta ctccataagt -776 ttttgtggtg agtttgcaaa ccaggcatca taatatattg tgaaaaatca aagacagttt -716 agttcactca catcagtatg actttcgacg ccaagtgcta gttcaagttt aggccatttt -656 taaaagtgcg tacacaaact ttacccctac cctggataga gagattgttt tcgatagatc -596 atcggctcaa aaagaagaaa agaaataata gaaccgtaac aacaacatag gttattgttc -536 ctgttctaat taatgaattg tcaattaagt gagctgtata gccagagatc aagggtagtt -476 tcgataaaaa cacatacgat taaggctatt aattttttta aggagtgcgc aagaacttta -416 aaaacatatt atgtggacct gcgatagaaa gaattaaact aaagcaagta tatatgtcaa -356 tgaaaaacgg tatagggaat aaacatggag ctgcagttcc cagccaccag tcgtttgtgt -296 ctaaagataa cctcatagaa ttgtgtccca accaccattc tagtcctggc atcgagattt -236 gagaggtaaa actaaactaa aaaccttaac caaaactagg ttagctatga gtcacgtgca -176 tgcttggttg ttgaattcta caaaacatgc atgatatatc tacaagaaat cttaagtttt -116 actttccagt caactcaaga gaacctaccc ttttttgcca tccatatata aacctcaact -56 agagcatcaa actataataa aagggaaaga aagaaaaagc aagaataata cagag -1 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> PANS-F <400> 4 ccggtcaact caagacaacc tacctattta a 31 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> PANS-R <400> 5 ctctgtatta ttcttgcttt ttctttcttt ccc 33 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ANS-F <400> 6 gaaaaggaga agtatgctaa tgacc 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ANS-R <400> 7 cccactggcc ttcatagaag agttg 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for 3 'RACE PCR in example 1 <400> 8 ggagaagatc atccttaagc cccta 25 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer for 3 'RACE PCR in example 1 <400> 9 gtcctcaagg aggatgaaca ggatgcc 27 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for 5 'RACE PCR in example 1 <400> 10 ccaggggatg cacaaaaact gg 22 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> full ANS-F <400> 11 gaaagaaaaa agcaagaata atacagag 28 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> full ANS-R <400> 12 ttcttcacat aaaaccatca gag 23 <210> 13 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 25uM genome walker adapter <400> 13 gtaatacgac tcactatagg gcacgcgtgg tcgacggccc gggctggt 48 <210> 14 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> 25 uM genome walker adapter which has amine group on the lower          strand, and phosphate group on the upper strand <400> 14 accagccc 8 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ANS GW1 <400> 15 aggtgcataa caccccattc tatagctgc 29 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AP1 primer <400> 16 gtaatacgac tcactatagg gc 22 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ANS GW2 <400> 17 gtggcctcac atactcttta gggatagcct gg 32 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AP2 primer <400> 18 actatagggc acgcgtggt 19 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GUS-F <400> 19 acctgcgtca atgtaatgtt ctgc 24 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GUS-R <400> 20 ctccctgctg cggtttttca 20 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NtACT-F <400> 21 ccctcccaca tgctattct 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NtACT-R <400> 22 agagcctcca atccagaca 19 <210> 23 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> pANS-attB1 primer <400> 23 aaaaagcagg ctccggtcaa ctcaagacaa cctacctatt taa 43 <210> 24 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> pANS -attB2 primer <400> 24 agaaagctgg gtctctgtat tattcttgct ttttctttct ttccc 45 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> adapter primer B1 <400> 25 ggggacaagt ttgtacaaaa aagcaggct 29 <210> 26 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> adapter primer B2 <400> 26 ggggaccact ttgtacaaga aagctgggt 29

Claims (10)

A petal-specific promoter, characterized by inducing expression of a gene specifically to petals as a promoter of the tobacco (Nicotiana tabacum) anthocyanidin synthase (ANS) gene consisting of the nucleotide sequences of SEQ ID NO: 1 or SEQ ID NO: 2. According to claim 1, wherein the promoter is a petal specific promoter, consisting of the nucleotide sequence of SEQ ID NO: 3. A primer set for promoter amplification according to claim 1 or 2, comprising a primer consisting of a nucleotide sequence of SEQ ID NO: 4 and a primer consisting of a nucleotide sequence of SEQ ID NO: 5. An expression vector comprising the promoter of claim 1 or 2. The expression vector according to claim 4, wherein the expression vector is pBGWFS7-PNtANS represented by the cleavage map below.

A transformant transformed with the expression vector of claim 4. The method of claim 6, wherein the transformant is rice, wheat, barley, corn, soybean, potato, wheat, red beans, oats, sorghum, Arabidopsis, cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, Melon, pumpkin, green onion, onion, carrot, ginseng, tobacco, cotton, sesame, sugar cane, beet, perilla, peanut, rapeseed, apple tree, pear tree, jujube tree, peach, tenderloin, grape, citrus, persimmon, plum , Apricot, banana, rose, gladiolus, gerbera, carnation, chrysanthemum, lily, tulip, lygras, redclover, orchardgrass, alphaalpha, tolskew and perennialgrass,
Transformants. (a) preparing an expression vector comprising the promoter of claim 1 or 2, and a foreign gene operably linked to said promoter; And
(b) introducing the prepared expression vector into the plant and transforming the plant;
A method of expressing petal-specific foreign genes. The method of claim 8,
The foreign genes include DFR (dihydroflavonol reductase), F3'5'H (flavonoid 3'5 'hydroxylase), ANS (anthocyanidin synthase), PSY (Phytoene synthase), CrtI (phytoene desaturase), MADS box-related TF genes and flowers At least one selected from the group consisting of fragrance related genes. Tobacco (Nicotiana tabacum) ANS (anthocyanidin synthase) gene, which is expressed specifically in petals and consists of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

Images