KR20110095611A - Pharmaceutical compositions for wound healing comprising mic-1 gene or protein - Google Patents

Abstract

PURPOSE: A pharmaceutical composition containing MIC-1 gene or expression protein thereof is provided to be used for wound healing as a therapeutic agent. CONSTITUTION: A pharmaceutical composition for wound healing contains MIC-1(macrophage inhibitory cytokine-1) gene or expression protein thereof as an active ingredient. The MIC-1 gene encodes an amino acid of sequence number 2 or 7. The MIC-1 gene is inserted to a recombinant vector. The MIC-1 protein has an amino acid sequence of sequence number 2 or 7. The MIC-1 protein is expressed from the expression vector.

Description

Pharmaceutical compositions for wound healing containing MIC-1 gene or protein}

The present invention relates to a pharmaceutical composition for treating wounds containing MIC-1, more specifically, containing as an active ingredient MIC-1 (macrophage inhibitory cytokine-1) gene or its expression protein, which exhibits an acute or chronic wound healing effect. It relates to a pharmaceutical composition for wound treatment.

Skin acts as a shield to protect the body. If the skin is damaged, the damaged areas may be exposed and foreign bacteria may be invaded. Therefore, rapid wound treatment can be used to prevent infection and to prevent excessive inflammation. Excessive inflammatory reactions not only prolong healing, but can also cause scarring.

Wound healing refers to the complete closure of the skin clinically. Normal wounds that are not chronic wounds heal completely within approximately 3-14 days. Wound healing is a complex process that interacts and regulates many different types of cells, including keratinocytes, fibroblasts, endothelial cells, macrophages, and platelets. It consists of phases: the inflammation phase, the proliferation phase and the remodeling phase. Each process is controlled by a complex signaling network regulated by many growth factors, cytokines and chemokines.

Inflammatory phase: When a wound occurs, the epithelial layer is damaged and secretes IL-1 (interleukin-1) in which keratinocytes are stored. This is the first signal that the shield has been compromised. In addition, the blood escaped through the wound promotes blood clotting. Platelet-secreted granules contain epidermal growth factor (EGF), platelet-derived growth factor (PDGF), and transforming gtowth. factor-β) and the like. PDGF and IL-1 induce neutrophils to the wound site. Monocytes are converted to macrophage by TGF-β and macrophages play an important role in enhancing the inflammatory response by releasing proinflammatory cytokine such as IL-1 and IL-6. do. The hallmark of the inflammatory phase is to break down existing damaged tissues and remove cellular, extracellular and pathogen debris.

Proliferative phase: Proliferation of vascular endothelial cells is promoted by vascular endothelial growth factor (VEGF) and fibroblast growth factor (FGF). In addition, EGF, TGF-α (transforming growth factor-α), and FGF promote the proliferation and mobility of epithelial cells, and re-epithelialization begins. This process covers the surface of the wound with a layer of keratinocytes. Keratinocytes undergo a process of stratification and differentiation to reconstruct the barrier.

Remodeling: Tissue reconstruction occurs after re-epithelialization. This process involves the synthesis of new collagen (collagen) by TGF-β and the degradation of existing collagen by PDGF. The result of this process is a scar. This process also reduces the number of fibroblasts and keratinocytes and reduces the flow of blood to the scar. Severe scarring may occur if extracellular matrix synthesis and degradation of existing substrates are not normal.

Wounds need to be treated quickly to reduce the risk of secondary infection. In addition, if the inflammatory response persists during wound healing, normal wound healing is delayed because the progression from the inflammatory phase to the proliferative phase is not made. For this reason, the development of wound treatments that do not induce an inflammatory response is actively progressing.

The level of inflammation can be determined by measuring the density of inflammatory cells, monocytes, astrocytes, neutrophils, mast cells, basophils. Factors such as neutrophil activity, mast cell degranulation, histamine concentration or the level of reactive oxygen species may also be used as a measure of inflammation level. Levels of inflammation are inflammatory cytokines IFN-α (interferon-α), IFN-β (interferon-γ), TNF-α (tumor necrosis factor-α) in wound tissue or plasma , IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8, IL-12, IL-18, IL-23, IL-27, CD4, CD28, CD80, CD86, MHC11 And indirectly by measuring iNOS levels.

Chronic wounds remain in a chronic inflammation state, resulting in higher levels of the inflammatory cytokines IL-1β, TNF-α, and a greater chance of infection, leading to further inflammation. It is believed that these cytokines increase the synthesis of matrix metalloproteinases (MMPs), resulting in degradation of extracellular matrix, resulting in inhibition of cell mobility and collagen accumulation. MMPs also delay wound healing by breaking down growth factors and their receptors.

MIC-1 (also called macrophage inhibitory cytokine-1, or GDF-15, PLAB, PDF, NAG-1 and PTGFB) is a member of the TGF-β superfamily and is known to increase its expression by macrophage activation. . In a normal living environment, it is expressed in placenta, and in addition, it is known to be expressed in epithelial cells of the prostate and central nervous system, but it is not known to express in most epithelial cells. However, it has been reported that its expression is promoted by surgery, chemotherapy, inflammation, cancer and the like.

The function of MIC-1 has been studied in association with cancer. The most studied function is anti-tumorigenic activity. Artificially expressing MIC-1 in cancer cells induced apoptosis and inhibited cancer cell growth, both in vitro and in vivo. It has also been reported to inhibit angiogenesis. In contrast, it has been reported that MIC-1 expression promotes cancer cell growth. It is also known that the expression of MIC-1 increases as the cancer progresses. The opposite function associated with this cancer is well known in other TGF-β families. In addition, MIC-1 has been reported to increase expression in very low oxygen conditions.

On the other hand, the success of wound healing depends on how biologically active polypeptides such as growth factors, cytokines, and chemokines integrate complex signals to coordinate cellular responses. These polypeptides bind to receptors on the cell surface or extracellular matrix to transmit signals, which in turn promote gene transcription, which is involved in cell division, mobility, and differentiation, thus affecting wound healing.

Therefore, the possibility of various growth factors and cytokines as wound healing agents is very high. Chronic wounds, however, are not successful in clinical practice because they involve complex disorders or are affected by age. However, growth factor therapy (along with general wound healing) is still the most effective treatment for chronic wounds.

EGF (epidermal growth factor) is secreted by platelets, macrophages, and fibroblasts and promotes re-epithelialization by increasing the mobility of keratinocytes (Rheinwald JG et al. Nature 1997: 265: 421). EGF has also been reported to increase the expression of keratin K6, K16 associated with cell proliferation signals (Jiang CK et al Proc. Natl. Acad. Sci. USA 1993: 90: 6786). EGF promotes epithelialization when used as an external agent in chronic wound clinical trials, shortening the treatment period after skin transplantation, and shortening the treatment period in venous ulcer and diabetic foot ulcer. (Martin P. Science 1997: 276: 75; Rheinwald JG et al. Nature 1997: 265: 421; McCawley LJ et al. J. Cell Physiol 1998: 176: 255). However, in chronic ulcers, it is known that EGF and EGF receptors are degraded as MMP increases, so it is believed that these wounds have a problem of easily degraded EGF (Mast BA et al. Wound Repair Regen 1996: 4 : 411; Robson MC Wound Repiar Regen 1997: 5:12).

FGF (fibroblast growth factor) is secreted from keratinocytes, fibroblasts, vascular endothelial cells, smooth muscle cells, chondrocytes, mast cells, among which FGF-2 and bFGF (basic Fibroblast growth factor increases in acute wounds and plays a role in granulation tissue formation, re-epithelialization and tissue remodeling. In chronic wounds, the level of FGF-2 is lowered. FGF-2 has not been shown to be effective in clinical trials for diabetic foot ulcers, presumably because FGF-2 did not maintain activity (Grellner W et al. Foresic Sci Int 2000: 113: 251). However, pressure ulcers have been shown to increase wound healing rates (Robson MC et al. Ann Surg 1992: 216: 401).

The transforming frowth factor-β family includes several proteins such as TGF-β1-3, bone morphogenic proteins (BMP), activin, and MIC-1 and is secreted from macrophages, fibroblasts, keratinocytes, and platelets. . TGF-β1-3 predominates, but TGF-β1 is known to be the most involved in skin wound treatment in mammals. TGF-β1 is important for inflammation, re-epithelialization, connective tissue reconstruction, and expression increases immediately after wounding (Kane CJ et al. J Cell Physiol 1991: 148: 157). However, TGF-β1 has a problem of inducing collagen synthesis so strongly that it may cause fibrosis by promoting and maintaining keloid fibroblast activation (Wang Z et al. J Plast Reconstr Aesthet Surg 2007 : 60: 1193). It has been reported that re-epithelialization was inhibited and fibrosis increased when TGF-β1 was activated and allowed to continue to be burned (Yang L et al. Am J Pathol 2001: 159: 2147). Therefore, it is necessary to search for growth factors or cytokines that can be effectively used in the actual wound healing without this problem.

Platelet derived growth factor (PDGF) is secreted by platelets, macrophages, vascular endothelial cells, fibroblasts, keratinocytes and acts at each stage of wound healing. When wounded, PDGF is released from degranulated platelets and is present in wound fluid (Trengove NJ et al. Wound Repair Regen 2000: 8: 13), which in turn causes neutrophils, macrophage fibroblasts, and smooth muscle cells to the wound site. (Heldin CH et al. Physiol Rev 1999: 79: 1283). It also stimulates macrophages to synthesize growth factors such as TGF-β. PDGF also plays a role in the re-epithelialization process by inducing IGF-1 and thrombospondin-1 synthesis (Rabhi-Sabile S et al. FEBS Lett 1996: 386: 82), which promotes fibroblast proliferation and promotes the synthesis of extracellular matrix. (Lin H et al. Biomateials 2006: 27: 5708). The tissue remodeling phase increases MMPs to help break down existing collagen. In chronic wounds, the level of PDGF is lowered due to degradation by MMP (Mast BA et al. Wound Repair Regen 1996: 4: 411; Robson MC Wound Repair Regen 1997: 5: 12). PDGF-BB, a recombinant variant of human PDGF, is the only FDA approved drug for chronic wounds and has been successfully used in diabetic ulcers and compression ulcers (Margolis DJ et al. Hum Gene Ther 2004: 15: 1003; Margolis DJ et al. Wound Repair Regen 2000: 8: 480).

GM-CSF (granulocyte macrophage-colony stimulating factor) increases in the epidermis of wounded skin and increases neutrophils in the wound, which is important for the inflammatory phase of wound treatment. GM-CSF also induces proliferation of keratinocytes, promotes re-epithelialization, and increases vascular endothelial cell proliferation and mobility. Subcutaneous injection of GM-CSF in diabetic foot ulcers resulted in rapid dissolution of cellulite (Gough A et al. Lancet 1997: 350: 855), and a pronounced effect when administered locally to chronic wounds ( Bianchi L et al. J Eur Acad Dermatol Venereol 2002: 16: 595).

The vascular endothelial growth factor (VEGF) family includes VEGF-A, VEGF-B, VEGF-C, VEGF-D, VEGF-E, and PLGF (placental growth factor). VEGF-A is made from vascular endothelial cells, keratinocytes, fibroblasts, smooth muscle cells, platelets, neutrophils, and macrophages. , Regulates mobility (Senger DR et al. Am J Pathol 1996: 149: 293; Morbidelli L et al. Am J Pathol 1996: 270: H411). In particular VEGF-A is induced in hypoxic conditions (Silver IA Prog Repair Res 1969: 3: 124). Animal studies have shown that VEGF-A promotes re-epithelialization of diabetic wounds (Galiano RD et al. Am J Pathol 2004: 164: 1935). Nevertheless, the use of VEGF as an external agent has shown problems such as persistent vascular leakage, disordered angiogenesis, and dysfunctional lymphatic vessel formation (Nagy JA et al. J Exp Med 2002: 196: 1497). .

Accordingly, the present inventors have diligently studied to overcome the problems of the prior art, MIC-1 is a problem such as causing excessive inflammatory reactions and vascular leakage compared to the growth factors or cytokines known to be effective in conventional wound healing It was confirmed that the present invention can be effectively used for wound healing, and completed the present invention.

Accordingly, the main object of the present invention is to provide a pharmaceutical composition for treating wounds containing the MIC-1 gene or its expressed protein which is effective in the treatment of acute or chronic wounds without inducing an inflammatory response and vascular leakage. have.

According to an aspect of the present invention, the present invention provides a pharmaceutical composition for wound treatment containing a macrophage inhibitory cytokine-1 (MIC-1) gene or an expression protein thereof as an active ingredient.

The macrophage inhibitory cytokine-1 (MIC-1) is a member of the TGF-β superfamily and is known to increase its expression by macrophage activation. It is known to be expressed in the placenta in a normal living environment, and in addition to the expression in the epithelial cells of the prostate and the central nervous system, but not in most epithelial cells. However, it is reported that the expression is promoted by surgery, anticancer agent treatment, inflammation, cancer and the like.

MIC-1 of the present invention is known in the related art for inhibiting cancer, but has not been studied for wound healing ability. The present inventors were studying the various functions of such MIC-1 protein, among which the MIC-1 protein was found to be effective in the healing of acute wounds or chronic upper body, and verified using wound-induced mice.

In the pharmaceutical composition of the present invention, the MIC-1 gene may be any nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 7, but is preferably the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 6. SEQ ID NO: 2 is an amino acid sequence of a pro-form MIC-1 protein, and SEQ ID NO: 7 is an amino acid sequence of a mature-form MIC-1 protein. In addition, the "gene" may generally be DNA or RNA.

In the pharmaceutical composition of the present invention, the MIC-1 gene may be inserted into an animal cell expression vector. The MIC-1 gene is a plasmid or virus that can be expressed in a retroviral vector, adenovirus vector, adeno-associated virus vector, lentiviral vector, herpes-simplex virus vector or animal cell for continuous and local supply to the wound site. It may be provided in the form contained in, or in the form of a recombinant cell line obtained by transfecting or transducing a cell line with a recombinant vector comprising the gene. Examples of vector or virus production systems for recombinant gene production, commercially available for expression in animal cells, are as follows: pCR3.1 (Invitrogen), AdEasy Adenoviral Vector System (Stratagene), pSMPUW-IRES-GFP Lentivirus Expression Vector (Cell Biolabs), pMXs-IRES-GFP Retroviral Vector (Cell Biolabs).

The pharmaceutical composition of the invention relates to the therapeutic use of the MIC-1 gene. The MIC-1 gene can be obtained by standard cloning methods known to those skilled in the art. The MIC-1 gene can also be cloned into DNA form by chemical synthesis techniques. DNA may be single stranded or double stranded. Single-stranded DNA may be coding strand or sense strand, or non-coding or antisense strand. For therapeutic use, the gene is in a form capable of expressing functional MIC-1 protein at the wound site of the patient to be treated. The gene may also be used for laboratory production of MIC-1 protein for administration, in another therapeutic aspect.

Genes for application in the gene therapeutic aspects of the invention may be provided by themselves or as part of a vector such as an expression vector that is well known in the art. MIC-1 gene is a method of gene therapy in which the gene is administered to a wound site or other tissue in need of healing in a form that can direct the production of the MIC-1 protein or in itself a biologically active fragment. It can be used therapeutically through.

Preferably, the gene is administered so that it is expressed in a patient to be treated in a form operably linked to a nucleic acid sequence that regulates expression, eg, in the form of an expression vector, in a recombinant DNA molecule comprising a MIC-1 gene. do. The vector thus contains a suitable transcriptional control signal comprising a promoter site capable of expressing the coding sequence, which promoter will be operable in the patient to be treated. Thus, for human gene therapy, a promoter, which is a term that includes not only the sequences needed to direct RNA polymerase to a transcription initiation site, but also other operational or regulatory sequences, including an enhancer, as appropriate, is preferably from a human gene. Human promoter sequences or human promoter sequences from genes generally expressed in humans, for example, promoters from human cytomegalovirus (CMV). Among the known eukaryotic promoters suitable in this respect are the retroviral LTR promoters, such as those of the CMV early promoter, HSV thymidine kinase promoter, early and late SV40 promoters, Lu sarcoma virus (RSV), and the mouse metallothionein-1 promoter. The same metallothionein promoter is suitable.

The vector will also include a transcriptional regulatory sequence located 3 ′ of the MIC-1 coding sequence, and a polyadenylation sequence recognizable in the patient to be treated, such as the corresponding sequence from a virus such as the SV40 virus when used in human therapy. Can be. Other transcriptional regulatory sequences are well known and available in the art. The expression vector may also include selectable markers such as antibiotic resistance such that the vector can be propagated. Expression vectors capable of synthesizing MIC-1 by themselves can be introduced directly to the wound site by physical methods. Examples of these include, for example, local application of a “naked” nucleic acid vector in a suitable vehicle in a solution in a pharmaceutically acceptable excipient such as phosphate buffered saline (PBS), or according to methods known in the art. Gun ”technique, which involves administering the vector in a physical manner such as particle bullet.

The “gene gun” technique is a method of releasing under high pressure from a propulsion device, as described in US Pat. No. 5371015, in which inert particles such as gold beads coated with a vector are applied to the wound site, eg the surface of a skin cell Accelerate at a speed sufficient to pass through.

In addition, other physical methods of administering genes directly to receptors include ultrasound, electrical stimulation, electrotransmission, and microseeding. Particularly preferred is the microseeding type of transport. It is a system that delivers genetic material itself into the patient's cells. The method is described in US Pat. No. 5,697,901.

MIC-1 genes for therapeutic use of the invention may also be administered by means of a transport vector. Examples include viral transport vectors known in the art such as adenovirus or retrovirus transport vectors. Other nonviral transport vectors include lipid transport vectors, including liposome transport vectors known in the art.

MIC genes can also be administered to the wound site by means of transformed host cells. The cells include cells harvested from the patient, and the gene is introduced into the cell by a gene introduction method known in the art, whereby the transformed cells are grown in culture and transplanted into the patient.

Expression constructs as described above can be used in various ways in the treatment of the present invention. Thus, the expression constructs may be administered directly to the wound site of the patient, or may be used to produce a protein itself that may be administered to the wound site.

In the pharmaceutical composition of the present invention, the MIC-1 protein may be a pro-form having an amino acid sequence of SEQ ID NO: 2 or a mature-form having an amino acid sequence of SEQ ID NO: 7 have.

In the pharmaceutical composition of the present invention, the MIC-1 protein may be expressed from an expression vector into which the MIC-1 is inserted, and preferably, the expression vector may have a cleavage map of FIG. 9. In an embodiment of the present invention, a Pichia (yeast) system is used to isolate the MIC-1 protein, which is transduced by introducing a mature MIC-1 gene into the pPIC9 vector using EcoRI and NotI restriction enzymes. MIC-1 secreted from the colonies could be obtained.

The MIC-1 gene and expression proteins thereof used in the present invention may be used alone or in combination with other compounds such as compounds for treatment. The pharmaceutical composition can be administered by any effective and convenient method effective for targeting to the wound site, including, among other things, by topical, intravenous, intramuscular, intranasal or subcutaneous routes. Generally, the composition will be applied locally to the wound or related condition.

The pharmaceutical compositions of the present invention may be formulated for topical application in the form of solutions, creams, lotions, gels or aerosols, which are suitable conventional additives such as preservatives, solvents to aid pharmaceutical penetration, Ointments and creams may include emollients and the like. The topical preparations may also contain a commercially available carrier, eg a cream or ointment base, and ethanol or oleyl alcohol for lotion. The carrier may comprise about 1 to about 98% of the formulation, and more generally up to about 80% of the formulation.

For mammalian, especially human administration, the daily dosage of the active agent is expected to be from 0.01 mg / kg to 10 mg / kg, typically about 1 mg / kg. In any case, the physician will determine the actual dosage that is best suited to the individual, which will depend on the age, weight and response of the particular individual. The dosage is exemplary in the case of mean. Of course there will be cases where more and less dosing is good for the individual, but this is also within the scope of the present invention.

The pharmaceutical composition comprising the MIC-1 protein of the present invention may further include compounds generally used for wound treatment, such as antibiotics, anti-inflammatory agents, skin preparations, anesthetics and analgesics, in the case of external preparations used locally on wounds. It may include. In general, in order to prevent infection of the wound site or to prevent aggravation of the wound due to the infection, it is possible to supply drugs such as antibiotics and antimicrobial agents to the wound site, and also to provide local anesthetics and analgesics to alleviate pain. Anti-inflammatory agents such as antihistamines can be supplied to prevent excessive inflammatory reactions in wound healing. Examples of antibiotics that can be commonly used include neomycin sulfate, benzalkonium chloride, silver sulfate diazine, and the like and the like. In addition, functional drugs such as skin preparations may be supplied as necessary. These functional drugs can be included in the external preparations applied directly to the skin to provide convenience for use, and can further improve the wound healing effect by creating an environment conducive to efficient wound healing.

According to a preferred embodiment of the present invention, the MIC-1 gene of the present invention was demonstrated using a transgenic mouse that can be used for wound healing purposes. Example 4 of the present invention shows that transgenic mice overexpressing MIC-1 have a significantly faster wound recovery rate than wild type mice.

In addition, the MIC-1 protein of the present invention was proved to have a wound healing effect even when applied directly to the wound. Example 5 of the present invention shows that the method of smearing the MIC-1 protein directly on the skin wounds can help in wound healing.

In the pharmaceutical composition of the present invention, the MIC-1 gene or its expression protein is characterized in that it does not induce inflammatory reactions (inflammation) and vascular leakage.

In Example 4 of the present invention, it was confirmed that the MIC-1 gene-induced mouse did not induce an inflammatory response during wound healing (see FIG. 4). As a result of examining the permeability, it was confirmed that MIC-1 does not affect the vascular permeability regardless of the treated concentration (see FIG. 7). Wound healing characteristics of MIC-1, while VEGF known to be effective in wound recovery can promote wound recovery, but induces excessive inflammatory reactions, and has problems such as prolonged healing period and scar formation. 1 means that it can be used as an effective wound treatment because it does not induce an inflammatory response.

In the pharmaceutical composition of the present invention, the wound is characterized by acute wounds such as cuts, surgical wounds or chronic wounds such as diabetic lower extremity ulcers, pressure sores.

In order to confirm the effect on the acute upper body, in Example 5 of the present expression, the wound healing effect of the MIC-1 was verified using a wound-induced mouse, and wound recovery similar to VEGF and EGF, which was a positive control group of MIC-1. It was confirmed to indicate the rate (see FIG. 6).

The chronic wound remains in a chronic inflammation state, inflammatory cytokines IL-1β, TNF-α levels are high, and the chance of infection is higher, so inflammation continues. It is believed that these cytokines increase the synthesis of matrix metalloproteinases (MMPs), resulting in degradation of extracellular matrix, resulting in inhibition of cell mobility and collagen accumulation. Therefore, increasing the mobility of vascular endothelial cells may help in healing the wound.

In Example 3 of the present invention, MIC-1 treatment was confirmed to effectively increase the mobility of vascular endothelial cells (see Fig. 2). Therefore, MIC-1 of the present invention affects the mobility of vascular endothelial cells and shows that it can be effectively used for wound healing.

The pharmaceutical composition of the present invention may be administered using the above-described methods around the wound site or the wound tissue, but preferably, the wound treatment effect may be obtained by directly applying the topical application to the skin around the wound. In the embodiment of the present invention, the effect of MIC-1 as an external agent applied to the skin area was wound by removing the skin of wild-type mice and applying MIC-1 protein directly to the wound to demonstrate the wound healing effect.

As described above, according to the present invention, MIC-1 is induced in hypoxic conditions similar to VEGF and has an effect on wound healing.However, unlike VEGF, MIC-1 does not trigger an inflammatory response and does not induce blood vessel leakage. It is very likely to be used successfully as a therapeutic agent and external skin preparation for wound treatment, especially for treating chronic wounds.

FIG. 1A is a photograph of human embryonic venous vascular endothelial cells treated with hypoxic conditions or CoCl ₂ and then Western blotting method for expression levels of VEGF and MIC-1.
FIG. 1B is a photograph confirming the expression level of VEGF and MIC-1 after treatment with hypoxic conditions or CoCl ₂ in human embryonic vein endothelial cells by RT-PCR method.
Figure 1c is a graph showing the activity of the promoter of MIC-1 after treatment with hypoxic conditions or CoCl ₂ in human embryonic vein endothelial cells.
Figure 2 is a photograph and graph showing the effect of MIC-1 on the chemotactic motility (A) and tube formation (B) of human embryonic venous vascular endothelial cells.
Figure 3 is a photograph and a graph showing the wound healing rate of wounds of a certain size in MIC-1 transgenic mice and wild-type mice. WT: wild type mouse, MIC-1 TG: MIC-1 transgenic mouse.
Figure 4 shows the results of immunofluorescent staining of the markers of macrophages, monocytes, granulocytes and leukocytes after 12 days after wounding MIC-1 transgenic mice and wild-type mice. WT: wild type mouse, MIC-1 TG: MIC-1 transgenic mouse.
FIG. 5 is a result of confirming Western blotting of the expression level of inflammation-related proteins and separating the wound and surrounding tissues 12 days after wounding the MIC-1 transgenic mouse and wild-type mouse. WT: wild type mouse, MIC-1 TG: MIC-1 transgenic mouse.
Figure 6 is a picture and graph showing the wound recovery rate by wounding MIC-1 gene transfer mice and wild-type mice of a certain size, smearing MIC-1, VEGF, EGF directly on the wound site.
7 is a photograph (left) showing changes in vascular permeability caused by MIC-1 in the skin of nude mice, and a graph quantifying them (right).
8 is a result confirming the effect of MIC-1 on vascular permeability through expression level of VCAM-1 and ICAM-1 in human embryonic venous vascular endothelial cells.
9 is a cleavage map of the recombinant vector into which the MIC-1 gene for MIC-1 expression in the Pichia (yeast) system is inserted.
10 is a cleavage map of the recombinant vector used to prepare MIC-1 transgenic mice.
11 shows PCR results for discriminating between MIC-1 transgenic mice and wild-type mice.

Hereinafter, the present invention will be described in more detail with reference to Examples. Since these examples are only for illustrating the present invention, the scope of the present invention is not to be construed as being limited by these examples.

Example 1. Expression of MIC-1 in hypoxic conditions

1) Western blotting

To determine whether MIC-1 is induced in hypoxic conditions similar to VEGF, human umbilical vein endothelial cells are placed under hypoxic conditions that maintain 5% oxygen concentration, Alternatively, CoCl ₂ , which induces a reaction similar to hypoxic conditions, was treated with 200 nM concentration, and after 12 hours and 24 hours, respectively, cells were disrupted and proteins were extracted. Anti-MIC-1, -VEGF, and -actin antibodies (Santa Cruz Biotechnology, Thermo Scientific, Sigma-Aldrich, respectively) were used to measure the expression level of each protein. The positive control group was treated with VEGF, which is known to express vascular endothelial cells under hypoxic conditions and promote growth and mobility of vascular endothelial cells.

As a result of Western blotting, it was confirmed in FIG. 1A that MIC-1 induced expression under hypoxic conditions similar to VEGF.

2) RT-PCR

To determine if transcription of MIC-1 is promoted in hypoxic conditions, human embryonic vein endothelial cells were treated as in Western blotting and total RNA was isolated from the cells. Reverse transcriptase and oligo (dT) primers were used to reverse transcription of mRNA into a template, and the synthesized cDNA was used as a template for PCR. The primers used are as follows. The sequence of cDNA amplified with the following MIC-1 primer is shown in SEQ ID NO: 1, and the pro-form MIC-1 protein amino acid sequence encoded by the cDNA sequence is shown in SEQ ID NO: 2.

VEGF: GAGAATTCGGCCTCCGAAACCATGAACTTTCTGT (sense)

GAGCATGCCCTCCTGCCCGGCTCACCGC (antisense)

HIF-1α: CAGAAGATACAAGTAGCCTC (sense)

CTGCTGGAATACTGTAACTG (antisense)

MIC-1: GTGCTCATTCAAAAGACCGACACCG (sense: SEQ ID NO: 3)

ATACACAGTTCCATCAGACCAGCCCC (antisense: SEQ ID NO: 4)

RT-PCR results, in Figure 1b, it was confirmed that the transcription of MIC was promoted after hypoxic conditions or CoCl ₂ treatment 12 hours, 24 hours. Therefore, it can be seen that MIC-1 expression in hypoxic conditions is regulated in the transcriptional stage.

3) Promoter-reporter assay

DNA inserted with the MIC-1 promoter (1.5 kb; SEQ ID NO: 5) into the pGL3 vector (Invitrogen) was introduced into LNCaP cells, a human prostate cancer cell line, stabilized for one day, and subjected to hypoxic conditions as in western blotting. After the cells were disrupted, the activity of the MIC-1 promoter was examined by measuring the enzyme activity of luciferase, a reporter gene, (Promega luciferase assay system).

Luciferase enzyme activity measurement results, in Figure 1c, it was confirmed that the promoter of MIC-1 is activated under hypoxic conditions.

Example 2. Separation and Purification of MIC-1

To express his and flag tagged proteins at the N-terminus of mature form MIC-1 (13-15 kDa) (SEQ ID NO: 7) in Pichia pastoris, a type of yeast, His and flag-tagged mature MIC-1 gene (SEQ ID NO: 6) was digested with EcoRI and NotI restriction enzymes and introduced into the pPIC9 vector (Invitrogen) that secretes the expressed protein into the medium. A flag-MIC-1 recombinant vector was prepared. The pPIC-his.flag-MIC-1 recombinant vector was transduced into Pichia using electroporation. Pichia cells are grown in YPD (Yeast extract, Peptone, Dextrose; BD Biosciences) medium, and then made electrocompetent with 1 M sorbitol and recombined with MIC-1 expressing pPIC-his.flag-MIC-1 Vectors were linearized using PmeI restriction enzymes. Electroporation Eligible Pichia cells and DNA were mixed and placed in a 0.2 cm electroporation cuvette (cuvette) and subjected to electroporation with an electroshock of 1500 V, followed by plating on transduced Pichia colonies on MD (minimal dextrose) plates. Was separated. Cultured yeasts were inoculated in BMMY (Buffered Methanol-complex Medium Yeast extract: 1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB (Invitrogen), 0.5% methanol) medium, and 5 MIC-1 expression was induced by adding methanol (methanol; 5 ml of methanol in 1 L of medium) daily to the medium while incubating at 30 ° C. daily. The expressed MIC-1 has a his tag and was isolated by performing Nickel Affinity Chromatography. Since the expressed MIC-1 is secreted into the medium, the culture solution is centrifuged, and the supernatant is bound to nickel agarose (Ni-NTA Agarose, Invitrogen) and washed. MIC-1 was then separated from the column using 150 mM imidazole buffer. The expressed MIC-1 was confirmed in size and expression level by Western blotting using an anti-flag antibody (Sigma-Aldrich). In addition, MIC-1 was isolated through SDS-PAGE, and gels were stained with protein using a Coomassie Blue dye to confirm and purify expression levels.

In addition to using MIC-1 transgenic mice, MIC-1 cytokines are directly administered to cells or wound tissues to determine the effects of MIC-1. It is necessary to do The Pichia system was used to isolate large amounts of MIC-1. The size of expressed MIC-1 was 13-15 kd and the yield of purified MIC-1 after 5 days of induction of expression and nickel affinity chromatography was approximately 1 μg per ml of BMMY medium.

Example 3 Mobility of Vascular Endothelial Cells of MIC-1

1) Mobility of vascular endothelial cells

Transwell (Corning Coastar) was used to determine whether MIC-1 can promote chemotactic motility of human embryonic vein endothelial cells. The lower side of the transwell membrane is coated with gelatin and the M199 medium contains VEGF (10 ng / ml) and different concentrations of MIC-1 (5, 10, 20, 100 ng / ml) at the bottom of the transwell. Put it. Cells were injected into transwells and incubated for 4 hours and then fixed in 4% formaldehyde solution. The cells were stained with a crystal violet solution to measure the number of vascular endothelial cells that migrated through the holes of the transwell to the lower surface.

In Figure 2, MIC-1 was confirmed to effectively increase the mobility of vascular endothelial cells at a concentration of 5-20 ng / ml. VEGF used as a positive control was treated at a concentration of 10 ng / ml. These results show that in vitro, MIC-1 affects the mobility of vascular endothelial cells and can be effectively used for wound healing.

Example 4. Measurement of wound healing ability of MIC-1 transgenic mice

1) MIC-1 Gene Transfer Mouse Manufacture

An expression vector containing MIC-1 cDNA (SEQ ID NO: 1) was prepared using EcoRI and BamHI in a pCBA vector (BCCM: Belgian Co-ordinated Collections of Micro-organisms) having a systemic expression promoter (Fig. 10). And HindIII restriction enzymes were introduced into embryonic stem cells of C57BL / 6N mice, stably picked embryonic stem cells expressing MIC-1, planted in blastocyst embryos, and transplanted into the uterus of surrogate mother mice. Cubs got MIC-1 expressing mice in the pups were verified by the method of 2) below, and the expression mice were crossed to establish MIC-1 transgenic mice lines.

2) Validation of MIC-1 Gene Transfer Mice

Cut 1-2 mm tail of 3-4 week old transgenic mice and place it in DirectPCR Lysis Reagent (Viagen) containing 0.4 mg / ml of protease K. Incubate at 55 ℃ for 5-6 hours. Then, protease K inactivation was performed at 85 ° C. for 45 minutes. After centrifugation, the supernatant was collected and used as a template for PCR. PCR was performed with the following primers (1 + 2, and 2 + 3 primer combinations), and PCR products of 583 bp and 880 bp, respectively, were used to determine transgenic mice (FIG. 11). Primers # 1 and # 2 are MIC-1 specific primers, and primer # 3 is a nucleotide sequence present in the vector (FIG. 10) used to prepare MIC-1 transgenic mice. The amplified DNA is part of the MIC-1 gene, and the part amplified by primers # 2 and # 3 is the DNA between the MIC-1 gene and the vector used for the production of the transgenic mouse. In both cases, DNA of the desired size must be amplified.

Primer # 1: GCTGTCCGGATACTCAGTCC

Primer # 2: TAAGAACCACCGGGGTGTAG

Primer # 3: GTGCTGGTTGTTGTGCTGTC

3) Determination of skin wound healing ability of MIC-1 transgenic mice

After anesthetizing wild-type and MIC-1 transgenic mice, the dorsal hair was removed and the skin layer was removed to a size of 0.5 mm in diameter. The wound size was then measured every three days.

In FIG. 3, it was intended to confirm whether MIC-1 can promote wound recovery using transgenic mice overexpressing MIC-1 cytokines. In the MIC-1 transgenic mouse, the wound size of 0.5 mm decreased to half size after about 9 days, but the wild-type mouse showed no significant change in size even after 9 days, and the MIC-1 transgenic mouse was nearly 9-12 days old. Healed but wild-type mice did not completely heal the wounds even after 12 days of wound induction. These results show that MIC-1 transgenic mice have a significantly faster wound recovery rate than wild type mice.

4) Investigation of the production level of macrophages, monocytes and granulocytes

After 12 days of wounding, 3 mm of tissue adjacent to the wound of wild-type and MIC-1 transgenic mice was isolated and fixed in 4% paraformaldehyde solution. Paraffin sections were made using this tissue, and then immunofluorescent staining was performed using antibodies to marker molecules of macrophages, monocytes and granulocytes (AbD Serotec, DINona Inc., BD Biosciences, respectively). The presence of inflammatory leukocytes remaining in the tissues was examined.

In Figure 4, it was confirmed that the wound repair tissues of the MIC-1 transgenic mice do not significantly differ in the number of inflammatory cells compared to the wild type. These results indicate that MIC-1 induces an inflammatory response, whereas VEGF, which is known to be effective in wound healing, can promote wound recovery but induce excessive inflammatory response, resulting in prolonged healing period and scar formation. It does not mean that it can be used as an effective wound treatment.

5) Investigation of the level of inflammation using Western blotting

After separating the wound tissue and grinding the tissue as in 4) to produce a protein extract, anti-MIC-1, VEGF, IL-1β, iNOS antibody (Santa Cruz Biotechnology, Thermo Scientific, Santa Cruz Biotechnology, BD Biosciences, respectively) Each protein level was investigated using.

5 is a result of confirming the level of inflammatory cytokines or proteins such as IL-1β, iNOS by grinding the wound recovery tissue, which also shows that there is no significant difference compared to wild type. These results indicate that overexpression of MIC-1 does not induce an inflammatory response.

Example 5 Measurement of Wound Treatment Effect as an External Agent of MIC-1, VEGF, and EGF

To determine whether MIC-1 is effective as a topical agent for wound healing, the skin of the C57BL / 6N wild-type mouse was removed and wounded, and then MIC-1 (MIC-1 isolated and purified in Example 2) directly on the wound site. Was used). VEGF and EGF (obtained from Millipore and Promega, respectively) were used as positive controls, which are known to be effective in wound healing. MIC-1, VEGF, and EGF were applied directly onto the wound daily by diluting 10 ng in 5 μl of PBS. Negative control was only applied with PBS.

As a result, as shown in Figure 6, MIC-1 showed a wound recovery rate similar to the positive control group VEGF and EGF, and showed a faster wound recovery rate than the negative control group PBS. This suggests that MIC-1 may be applied directly to the skin wound to aid in wound healing.

Example 6 Blood Vessel Leakage Measurement

1) Measurement of vascular permeability

Evans blue dye was injected into the tail vein of 8-week-old nude mice, and 10 minutes later, MIC-1 (50, 100, 200 ng) and VEGF (20 ng) in PBS diluted 10 μl was injected subcutaneously. After 20 minutes, the dorsal skin of the mouse was separated, photographed of the injection of the drug inside the skin, cut out to a constant size, and the dye was dissolved in a formamide solution. After melting for 4 days, the absorbance was measured at a wavelength of 620 nm. If the permeability of the blood vessels increases at the site of MIC-1 or VEGF injection, more dye will escape from the blood vessels and pigment the skin.

FIG. 7 shows that MIC-1 and VEGF were injected subcutaneously in nude mice and directly examined their effects on vascular permeability. MIC-1 did not affect vascular permeability regardless of the treated concentration. However, VEGF, a positive control, was found to increase vascular permeability when injected with 20 ng.

2) Western blotting of proteins involved in intercellular adhesion of vascular endothelial cells

To determine the effect of MIC-1 on permeability of vascular endothelial cells, MIC-1 (20, 50, 100 ng / ml), VEGF (20 ng / ml), and vascular endothelial cells in human embryonic venous vascular endothelial cells TNF-α (20 ng / ml), known to strongly increase the permeability, was treated for 4 or 8 hours. Western blotting method for expression levels of vascular cell adhesion molecule-1 (VCAM-1) and inter-cellellative adhesion molecule (IMC-1) proteins known to be involved in increasing permeability of vascular endothelial cells after cell disruption It was confirmed.

As a result, in Figure 8, MIC-1 was found to be very low to induce the expression of VCAM-1 and ICAM-1 molecules compared to VEGF or TNF-α. The results of treatment of MIC-1, VEGF and TNF-α at 20 ng / ml concentrations showed that TNF-α, a potent cytokine that induces vascular leakage, markedly increased expression of both VCAM and ICAM molecules. In addition, the expression of the two molecules, but MIC-1 can be seen that does not affect the VCAM and ICAM expression at 4 or 8 hours treatment.

These results suggest that MIC-1 is induced in hypoxic conditions similar to VEGF and has an effect on wound healing.However, unlike VEGF, MIC-1 does not trigger an inflammatory response and does not induce blood vessel leakage, thereby increasing expression through gene therapy. It is very likely to be successfully used for wound treatment, especially for chronic wounds, either by squeezing or by directly smearing the wound.

<110> KNU-Industry Cooperation Foundation <120> Pharmaceutical compositions for wound healing comprising MIC-1          gene or protein <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 927 <212> DNA <213> Homo sapiens <400> 1 atgcccgggc aagaactcag gacggtgaat ggctctcaga tgctcctggt gttgctggtg 60 ctctcgtggc tgccgcatgg gggcgccctg tctctggccg aggcgagccg cgcaagtttc 120 ccgggaccct cagagttgca ctccgaagac tccagattcc gagagttgcg gaaacgctac 180 gaggacctgc taaccaggct gcgggccaac cagagctggg aagattcgaa caccgacctc 240 gtcccggccc ctgcagtccg gatactcacg ccagaagtgc ggctgggatc cggcggccac 300 ctgcacctgc gtatctctcg ggccgccctt cccgaggggc tccccgaggc ctcccgcctt 360 caccgggctc tgttccggct gtccccgacg gcgtcaaggt cgtgggacgt gacacgaccg 420 ctgcggcgtc agctcagcct tgcaagaccc caggcgcccg cgctgcacct gcgactgtcg 480 ccgccgccgt cgcagtcgga ccaactgctg gcagaatctt cgtccgcacg gccccagctg 540 gagttgcact tgcggccgca agccgccagg gggcgccgca gagcgcgtgc gcgcaacggg 600 gaccactgtc cgctcgggcc cgggcgttgc tgccgtctgc acacggtccg cgcgtcgctg 660 gaagacctgg gctgggccga ttgggtgctg tcgccacggg aggtgcaagt gaccatgtgc 720 atcggcgcgt gcccgagcca gttccgggcg gcaaacatgc acgcgcagat caagacgagc 780 ctgcaccgcc tgaagcccga cacggtgcca gcgccctgct gcgtgcccgc cagctacaat 840 cccatggtgc tcattcaaaa gaccgacacc ggggtgtcgc tccagaccta tgatgacttg 900 ttagccaaag actgccactg catatga 927 <210> 2 <211> 308 <212> PRT <213> Homo sapiens <400> 2 Met Pro Gly Gln Glu Leu Arg Thr Val Asn Gly Ser Gln Met Leu Leu   1 5 10 15 Val Leu Leu Val Leu Ser Trp Leu Pro His Gly Gly Ala Leu Ser Leu              20 25 30 Ala Glu Ala Ser Arg Ala Ser Phe Pro Gly Pro Ser Glu Leu His Ser          35 40 45 Glu Asp Ser Arg Phe Arg Glu Leu Arg Lys Arg Tyr Glu Asp Leu Leu      50 55 60 Thr Arg Leu Arg Ala Asn Gln Ser Trp Glu Asp Ser Asn Thr Asp Leu  65 70 75 80 Val Pro Ala Pro Ala Val Arg Ile Leu Thr Pro Glu Val Arg Leu Gly                  85 90 95 Ser Gly Gly His Leu His Leu Arg Ile Ser Arg Ala Ala Leu Pro Glu             100 105 110 Gly Leu Pro Glu Ala Ser Arg Leu His Arg Ala Leu Phe Arg Leu Ser         115 120 125 Pro Thr Ala Ser Arg Ser Trp Asp Val Thr Arg Pro Leu Arg Arg Gln     130 135 140 Leu Ser Leu Ala Arg Pro Gln Ala Pro Ala Leu His Leu Arg Leu Ser 145 150 155 160 Pro Pro Pro Ser Gln Ser Asp Gln Leu Leu Ala Glu Ser Ser Ser Ala                 165 170 175 Arg Pro Gln Leu Glu Leu His Leu Arg Pro Gln Ala Ala Arg Gly Arg             180 185 190 Arg Arg Ala Arg Ala Arg Asn Gly Asp His Cys Pro Leu Gly Pro Gly         195 200 205 Arg Cys Cys Arg Leu His Thr Val Arg Ala Ser Leu Glu Asp Leu Gly     210 215 220 Trp Ala Asp Trp Val Leu Ser Pro Arg Glu Val Gln Val Thr Met Cys 225 230 235 240 Ile Gly Ala Cys Pro Ser Gln Phe Arg Ala Ala Asn Met His Ala Gln                 245 250 255 Ile Lys Thr Ser Leu His Arg Leu Lys Pro Asp Thr Val Pro Ala Pro             260 265 270 Cys Cys Val Pro Ala Ser Tyr Asn Pro Met Val Leu Ile Gln Lys Thr         275 280 285 Asp Thr Gly Val Ser Leu Gln Thr Tyr Asp Asp Leu Leu Ala Lys Asp     290 295 300 Cys His Cys Ile 305 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MIC-1 forward primer <400> 3 gtgctcattc aaaagaccga caccg 25 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MIC-1 reverse primer <400> 4 atacacagtt ccatcagacc agcccc 26 <210> 5 <211> 1500 <212> DNA <213> Homo sapiens <400> 5 tcacagacag taagaaactg tattctcatg cagattccgt tcctctgtgg ggtcttcaca 60 ctggtgggtg tcattggtta aggatttcaa aaacatctta agaaattctt ctaaaaagtc 120 ttatgattct aaggtcggaa atcacatcta tagcaaatgg tcggtatcag gtgctacaag 180 caacttgcgg tcacaaggaa gtgggtcaaa gtgcagcctg attagtgctt aattataact 240 aagtttctgt ccagaattct ttttttttga gacagagttt tgctcttgtt gatcaggcgg 300 aagtgcaatg gtgaaaactt ggctcactgc aacctccgcc ctctgggttc aagcgattct 360 cttgcttcag cctctcgaat agctgggatt acaggcatgt aatcccacca ccaagcccag 420 ctaattttgt atatttagta gagacagggt ttctccatgt tggtcaggct agtctagaac 480 tcttgacgtc agatgatcca cgtgcctcgg cctcccaaag tgctgggatt acaggcgaga 540 gccaccgtgc ccggcgcaga attctttttt ttagagatga ggtattgcca tcttgcccag 600 acttgtctcg aactcctggg ctcaaacaat ccacccacct cggcctccca aagtgctgag 660 attactgaca taagccacca tgcctggccc ccagaattat gaatcctgtg aggatggctt 720 caaggtgagc gctgagccag acaaaaggat ggggtttggg agcaccctgc ttagactgga 780 aagataatgt tggagaagac ttcctggaag aggggctttt tgcgtagagt tttgaagaat 840 gagtaggagt tctccagagg aggatgagta actgcaataa cacccagttt atcaagtgcc 900 tcctatgtgt ctggccctgt gctttacccc tcatttgacc acctctccag tgagagtctc 960 agtccttttt ttcctggtga ggaaacaggc atggcagaga ggcatgacac atcaaggttg 1020 cccttcctgg ctccatctag cccgttctcc tctgcttcct ttgtttttca ccatctttag 1080 cctttgaccc caaccaaaaa gagaagagag gaaatcccat gggcatagac agccacctct 1140 taaactcttg tctggaattt ttcacatagt aacaatgtct ttttttcctc caaaaagact 1200 cccaggctgg aatggtgtcc tcatatcgag gaagaggata ctgaggccca gaaatgtgcc 1260 ctagctttac taggagcgcc cccacctaaa gatcctcccc ctaaatacac ccccagaccc 1320 cgcccagctg tggtcattgg agtgtttact ctgcaggcag ggggaggagg gcgggactga 1380 gcaggcggag acggacaaag tccggggact ataaaggccg gtccggcagc atctggtcag 1440 tcccagctca gagccgcaac ctgcacagcc atgcccgggc aagaactcag gacggtgaat 1500                                                                         1500 <210> 6 <211> 345 <212> DNA <213> Homo sapiens <400> 6 gcgcgtgcgc gcaacgggga ccactgtccg ctcgggcccg ggcgttgctg ccgtctgcac 60 acggtccgcg cgtcgctgga agacctgggc tgggccgatt gggtgctgtc gccacgggag 120 gtgcaagtga ccatgtgcat cggcgcgtgc ccgagccagt tccgggcggc aaacatgcac 180 gcgcagatca agacgagcct gcaccgcctg aagcccgaca cggtgccagc gccctgctgc 240 gtgcccgcca gctacaatcc catggtgctc attcaaaaga ccgacaccgg ggtgtcgctc 300 cagacctatg atgacttgtt agccaaagac tgccactgca tatga 345 <210> 7 <211> 114 <212> PRT <213> Homo sapiens <400> 7 Ala Arg Ala Arg Asn Gly Asp His Cys Pro Leu Gly Pro Gly Arg Cys   1 5 10 15 Cys Arg Leu His Thr Val Arg Ala Ser Leu Glu Asp Leu Gly Trp Ala              20 25 30 Asp Trp Val Leu Ser Pro Arg Glu Val Gln Val Thr Met Cys Ile Gly          35 40 45 Ala Cys Pro Ser Gln Phe Arg Ala Ala Asn Met His Ala Gln Ile Lys      50 55 60 Thr Ser Leu His Arg Leu Lys Pro Asp Thr Val Pro Ala Pro Cys Cys  65 70 75 80 Val Pro Ala Ser Tyr Asn Pro Met Val Leu Ile Gln Lys Thr Asp Thr                  85 90 95 Gly Val Ser Leu Gln Thr Tyr Asp Asp Leu Leu Ala Lys Asp Cys His             100 105 110 Cys ile        

Claims (11)

A pharmaceutical composition for treating wounds comprising a macrophage inhibitory cytokine-1 gene or an expression protein thereof as an active ingredient.
The pharmaceutical composition of claim 1, wherein the MIC-1 gene encodes an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 7.
The pharmaceutical composition of claim 1, wherein the MIC-1 gene is inserted into a recombinant vector.
The pharmaceutical composition of claim 3, wherein the recombinant vector has a cleavage map of FIG. 10.
The pharmaceutical composition of claim 1, wherein the MIC-1 protein has an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 7.
The pharmaceutical composition of claim 1, wherein the MIC-1 protein is expressed in an expression vector.
The pharmaceutical composition of claim 6, wherein the expression vector has a cleavage map of FIG. 9.
The pharmaceutical composition of claim 1, wherein the MIC-1 gene or its expressed protein does not induce inflammatory reactions and vascular leakage.
The pharmaceutical composition of claim 1, wherein the wound is an acute wound such as a wound, a surgical wound or a chronic wound such as a diabetic lower extremity ulcer or a pressure sore.
The pharmaceutical composition of claim 1, wherein the composition is applied topically to the skin.
The pharmaceutical composition of claim 1, wherein the composition is a liquid, cream, lotion, gel or aerosol.

Images