KR20110050219A - Gene enconding hyal 5 isolated from bovine and method for discriminating fertility of bovine sperm using thereof - Google Patents

Gene enconding hyal 5 isolated from bovine and method for discriminating fertility of bovine sperm using thereof Download PDF

Info

Publication number
KR20110050219A
KR20110050219A KR1020090107101A KR20090107101A KR20110050219A KR 20110050219 A KR20110050219 A KR 20110050219A KR 1020090107101 A KR1020090107101 A KR 1020090107101A KR 20090107101 A KR20090107101 A KR 20090107101A KR 20110050219 A KR20110050219 A KR 20110050219A
Authority
KR
South Korea
Prior art keywords
hyal
bovine
gene
leu
lys
Prior art date
Application number
KR1020090107101A
Other languages
Korean (ko)
Other versions
KR101135648B1 (en
Inventor
장규태
김익균
김상현
이상래
김명수
허재원
이영전
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to KR1020090107101A priority Critical patent/KR101135648B1/en
Publication of KR20110050219A publication Critical patent/KR20110050219A/en
Application granted granted Critical
Publication of KR101135648B1 publication Critical patent/KR101135648B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6804Nucleic acid analysis using immunogens
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

PURPOSE: A gene encoding Hyal 5 derived from cow is provided to prepare a recombinant microorganism by a recombinant vector. CONSTITUTION: A method for manufacturing an antibody against Hyal 5 comprises: a step of culturing a recombinant microorganism to express and purify Hyal 5; a step of injecting purified Hyal5 to an animal(except for human) to induce immune response; and a step of isolating the antibody from an animal serum.

Description

소 유래 신규 Hyal 5 유전자 및 이를 이용한 소 정자의 수정능 판별방법{Gene Enconding Hyal 5 Isolated from Bovine and Method for Discriminating Fertility of Bovine Sperm Using Thereof}Gene Enconding Hyal 5 Isolated from Bovine and Method for Discriminating Fertility of Bovine Sperm Using Thereof}

본 발명은 정소세포에서 특이적으로 발현하는 소 유래 신규 Hyal 5 (Hyaluronidase 5) 유전자 및 이를 이용한 소 정자의 수정능 판별방법에 관한 것으로, 더욱 상세하게는 소 정소에서 발현되는 Hyal 5를 코딩하는 신규 유전자 및 상기 Hyal 5에 대한 항체를 이용하여 Hyal 5 유전자(hyal 5)의 발현 여부를 확인함으로써 소 정자의 수정능 판별하는 방법에 관한 것이다.The present invention relates to a novel bovine-derived Hyal 5 (Hyaluronidase 5) gene expressing specifically in testis cells and a method for determining fertility of bovine sperm using the same, and more specifically, a novel coding for Hyal 5 expressed in bovine testes. It relates to a method for determining the fertility of the sperm by confirming the expression of the hyal 5 gene ( hyal 5) using a gene and the antibody to the hyal 5.

수란관으로 배란된 난자는 큐물러스 세포군(cumulus cells)에 의하여 둘러 싸여져 있다. 마우스에서는 약 3000개의 큐물러스 세포들이 하나의 난자를 싸고 있는데 이러한 세포들은 배란 직전에 hyaluronic acide(HA)를 분비한다. HA는 glucoronurate와 N-acetyl glucosamine으로 구성된 이당(disaccharide)이 250-25000개로 연결된 구조이다. 이러한 HA의 분비와 함께 큐물러스 세포들 사이는 공간이 형성되어 확장된다. 수정이 일어나기 위해서 정자는 HA와 함께 난자를 둘러싸 고 있는 큐물러스 세포사이를 통과하여야 하는데, 정자는 세포간 물질인 hyaluronic acide와 결합조직간의 glucosaminic bond를 가수분해하여 용해시킴으로써 조직간 장벽을 없애주는 작용을 하는 것으로 알려진 Hyaluronidase를 방출하여 HA와 함께 싸여져있는 큐물러스 세포사이를 통과하게 된다. 상기 내용과 같이 Hyaluronidase는 정자의 수정능에 있어서 중요한 인자로 작용하게 된다. Ovulation in the oviduct is surrounded by cumulus cells. In mice, about 3000 cumulus cells surround an egg, which secretes hyaluronic acide (HA) just before ovulation. HA is composed of 250-25000 disaccharides composed of glucoronurate and N-acetyl glucosamine. With the secretion of HA, spaces between the cumulus cells form and expand. In order for fertilization to occur, the sperm must pass between HA and the cumulus cells surrounding the egg. The sperm removes the inter-organ barrier by hydrolyzing and dissolving the glucosaminic bond between the intercellular substance hyaluronic acide and connective tissue. It releases Hyaluronidase, which is known to function, and passes between the cumulus cells enclosed with HA. As described above, Hyaluronidase acts as an important factor in sperm fertility.

Hyaluronidase는 PH-20가 대표적으로 알려져 있으며 생쥐, 원숭이, 사람을 포함하는 다양한 종의 정자에서 발현된다고 알려져 있다. PH-20는 큐물러스 세포가 세포군 구조를 이루지 못하고 분산되게 하는 작용을 하며 HA 분해 효소활성도를 나타냄으로써 수정능에 직접적으로 영향을 미치는 것으로 알려졌다(Lin Y, et.al., J Cell Biol., 125; 1157-1163, 1994). Hyaluronidase is known to represent PH-20 and is expressed in sperm of various species including mice, monkeys and humans. PH-20 is known to directly affect fertility by acting to disperse cumulus cells without forming a cell structure and exhibit HA degrading enzyme activity (Lin Y, et.al., J Cell Biol., 125; 1157-1163, 1994).

그러나 PH-20이 큐물러스 세포군을 분해하는 것에 필수가 아닌 것임이 밝혀졌으며 PH-20 이외의 다른 Hyaluronidase가 존재하여 수정능에 관여한다는 것이 본 연구자들에 의하여 밝혀졌다(Kim E, et. al., Proc. Natl. Acad. Sci. U.S.A., 102(50); 18028-18033, 2005). 밝혀진 새로운 Hyaluronidase는 Hyal 5로써 생식세포에서만 발현되는 막 단백질로서, Hyaluronidase domain과 투명대 결합도메인 및 GPI anker domain 으로 구성되어 있으며, 분자량은 약 60 kDa으로 알려졌다. However, it has been found that PH-20 is not essential for the degradation of cumulus cell populations, and it was found by the researchers that Hyaluronidase other than PH-20 is involved in fertility (Kim E, et. Al. Proc. Natl. Acad. Sci. USA, 102 (50); 18028-18033, 2005). The new Hyaluronidase is a membrane protein expressed only in germ cells as Hyal 5, and is composed of Hyaluronidase domain, zona pellucida binding domain and GPI anker domain, and has a molecular weight of about 60 kDa.

이러한 수정능에 관여하는 정자 특이적 마커들은 동물의 인공 수정시 사용되며, 돼지나 소의 번식 성적 향상, 경영비용 절감, 노동력 감소, 질병전파 방지의 목적을 가지며 개량의 촉진을 위한 수단으로써 활용되고 있다. 하지만 이러한 정자 특이적 마커들은 현재까지 Izumo, ADAM2, PH-20이 알려져 있으나 대부분 마우스 정 자의 특성을 연구하는데 사용되고 있다. 반면에 소과 동물에서는 수정능을 확인할 수 있는 소 정자에 있어서는 그 특성을 판별하기 위한 특별한 마커 단백질 및 그에 대한 항체가 확인되지 않고 있으며, 때문에 소 정자의 특성을 파악하는데 어려움이 있다. Sperm-specific markers involved in fertility are used in artificial fertilization of animals, and are used as a means for improving the breeding performance of pigs or cattle, reducing operating costs, reducing labor force, preventing disease spread, and promoting improvement. However, these sperm-specific markers are known to date Izumo, ADAM2, PH-20, but most are used to study the characteristics of mouse sperm. On the other hand, in bovine sperm that can confirm fertility, there are no specific marker proteins and antibodies for determining the characteristics thereof, and thus, it is difficult to identify the characteristics of bovine sperm.

이에, 본 발명자들은 상기 문제점을 해결하기 위하여 예의 노력한 결과, 소의 정소에서 발현되는 Hyal 5의 신규 유전자 및 이에 대한 항체를 이용하여 Hyal 5의 발현 여부를 확인함으로써, 정자 수정 능력을 판별할 수 있다는 것을 확인하고 본 발명을 완성하게 되었다.Accordingly, the present inventors have made diligent efforts to solve the above problems, and as a result, by confirming whether Hyal 5 is expressed using a novel gene of Hyal 5 expressed in bovine testes and an antibody thereto, sperm fertilization ability can be determined. It confirmed and completed this invention.

본 발명의 주된 목적은 소 유래 Hyal 5 및 이를 코딩하는 유전자(hyal 5)를 제공하는 데 있다.It is a main object of the present invention to provide a bovine-derived Hyal 5 and a gene encoding the same ( hyal 5).

본 발명의 다른 목적은 상기 유전자를 함유하는 재조합 벡터 및 상기 유전자 또는 재조합 벡터로 재조합 미생물을 제공하는 데 있다.Another object of the present invention is to provide a recombinant vector containing the gene and a recombinant microorganism with the gene or the recombinant vector.

본 발명의 다른 목적은 상기 유전자의 발현 여부를 확인하는 것을 특징으로 하는 소 정자의 수정능 판별방법을 제공하는 데 있다. Another object of the present invention is to provide a method for determining fertility of sperm, characterized in that whether the expression of the gene.

상기 목적을 달성하기 위하여, 본 발명은 서열번호 1의 아미노산 서열로 표시되는 소 유래 Hyal 5, 이를 코딩하는 유전자(hyal 5), 상기 유전자를 함유하는 재조합 벡터 및 상기 유전자 또는 재조합 벡터로 형질전환된 재조합 미생물을 제공한다.In order to achieve the above object, the present invention is a cow-derived Hyal 5 represented by the amino acid sequence of SEQ ID NO: 1, the gene encoding it ( hyal 5), the recombinant vector containing the gene and transformed with the gene or recombinant vector Provide a recombinant microorganism.

본 발명은 또한, 상기 Hyal 5에 특이적으로 결합하는 항체 및 그 제조방법을 제공한다. The present invention also provides an antibody that specifically binds to Hyal 5 and a method of preparing the same.

본 발명에 있어서, 상기 항체의 제조방법은 (a) 상기 재조합 미생물을 배양하여 Hyal 5 를 발현시킨 다음, 정제하는 단계; 및 (b) 상기 정제된 Hyal 5를 동물(단, 인간은 제외)에 주사하여 면역반응을 유도하는 단계 ; 및 (c) 상기 면역반응이 유도된 동물의 혈청으로부터 Hyal 5에 대한 항체를 분리하는 단계를 포함할 수 있다.In the present invention, the method for producing an antibody comprises the steps of: (a) culturing the recombinant microorganism to express Hyal 5 and then purifying; And (b) injecting the purified Hyal 5 into an animal (except human) to induce an immune response; And (c) separating the antibody against Hyal 5 from the serum of the animal from which the immune response was induced.

본 발명은 또한, 소 정소에서 상기 유전자의 발현 여부를 확인하는 것을 특징으로 하는 소 정자의 수정능 판별 방법을 제공한다.The present invention also provides a method for determining fertility of sperm, characterized in that whether the gene is expressed in bovine testes.

본 발명에 따른 정소세포에서 특이적으로 발현하는 소 유래 신규 Hyal 5 유전자 및 여기에 특이적으로 결합하는 항체를 이용하여 소 정자의 수정능을 효과적으로 판별할 수 있다. Fertility can be effectively determined using bovine-derived novel Hyal 5 genes specifically expressed in testis cells according to the present invention and antibodies specifically binding thereto.

일 관점에서, 본 발명은 서열번호 1의 유전자의 아미노산 서열로 표시되는 Hyal 5 및 이를 코딩하는 유전자(Hyal 5)에 관한 것이다. In one aspect, the present invention relates to Hyal 5 and a gene encoding the same ( Hyal 5) represented by the amino acid sequence of the gene of SEQ ID NO: 1.

Hyaluronidase는 정자에서 발현된다고 알려져 있으며 세포간 물질을 용해 시킴으로써 수정을 용이하게 한다고 알려져 있다. 상기 Hyal 5는 hyaluronic acide와 결합조직간의 glucosaminic bond를 가수분해하여 용해시키는 Hyaluronidase의 하나로서, 마우스의 정자에서 수정능에 영향을 미치는 요인으로 알려져 있으나 소과 동물에서의 연구는 아직 이루어지지 않고 있었다.Hyaluronidase is known to be expressed in sperm and is known to facilitate fertilization by dissolving intercellular substances. Hyal 5 is one of the hyaluronidases that hydrolyzes and dissolves glucosaminic bonds between hyaluronic acid and connective tissues. Hyal 5 is known as a factor affecting fertility in sperm of mice, but studies have not been made in bovine animals.

본 발명에서는 소의 정소 조직으로부터 전체 RNA를 추출하여 cDNA를 합성한 후, Hyal 5 cDNA를 분리하였고, 상기 cDNA를 벡터에 클로닝하여 Hyal 5 유전자의 서열을 확인하였다. 상기 클로닝된 소 Hyal 5 유전자를 바탕으로 Hyal 5 유전자에 특이적인 프라이머를 제작한 후, PCR을 수행하여 Hyal 5 유전자를 클로닝한 결과, 소에서 유래된 신규 Hyal 5 유전자를 얻었다.In the present invention, after extracting the total RNA from bovine testis tissue to synthesize cDNA, Hyal 5 cDNA was isolated, the cDNA was cloned into a vector to confirm the sequence of the Hyal 5 gene. Based on the cloned bovine Hyal 5 gene, a primer specific for the Hyal 5 gene was prepared, followed by PCR to clone the Hyal 5 gene, thereby obtaining a new Hyal 5 gene derived from bovine.

본 발명에 있어서, 상기 hyal 5는 서열번호 1의 아미노산으로 표시된다. 하지만 Hyal 5의 활성을 갖는 범위에서, 일부 아미노산이 변이된 유사 아미노산 서열, 다시 말해, 상기 아미노산 서열과 70%, 바람직하게는 80%, 90%, 또는 95% 이상의 서열 동일성을 갖는 실질적으로 동일한 아미노산 서열 또는 그 단편으로 본 발명에 포함될 수 있다.In the present invention, hyal 5 is represented by the amino acid of SEQ ID NO: 1. However, in the range having the activity of Hyal 5, some amino acids are substantially similar amino acid sequences, that is, substantially identical amino acids having at least 70%, preferably 80%, 90%, or 95% sequence identity with the amino acid sequence. Sequences or fragments thereof may be included in the present invention.

코돈의 축퇴성으로 인해서 또는 상기 Hyal 5를 코딩하는 유전자를 발현시키고자하는 생물에서 선호되는 코돈을 고려하여, 본 발명의 유전자는 코딩영역으로부터 발현되는 Hyal 5의 기능이 변화되지 않는 범위 내에서 코딩영역의 다양한 변형이 이루어질 수 있고 코딩영역을 제외한 부분에서 유전자의 발현에 미치지 않는 범위 내에서 다양한 변형 또는 수식이 이루어질 수 있으며, 그러한 변형 유전자 역시 본 발명의 범위에 포함된다. Due to the degeneracy of the codon or in consideration of the codon preferred in the organism to express the gene encoding Hyal 5, the gene of the present invention is encoded within the range that the function of Hyal 5 expressed from the coding region is not changed. Various modifications of the region may be made and various modifications or modifications may be made within a range not falling short of the expression of the gene except for the coding region, and such modified genes are also included in the scope of the present invention.

따라서, 상기 유전자는 서열번호 2의 유전자와 실질적으로 동일한 염기서열을 갖는 폴리뉴클레오티드 및 유전자의 단편을 포함한다. 여기서 실질적으로 동일한 폴리뉴클레오테드란, 80%, 90%, 또는 95% 이상의 서열 동일성을 갖는 실질적으로 동일한 아미노산 서열 또는 그 단편으로 본 발명에 포함될 수 있다.Thus, the gene includes a polynucleotide having a nucleotide sequence substantially the same as the gene of SEQ ID NO: 2 and fragments of the gene. Polynucleotides substantially identical herein may be included in the present invention as substantially identical amino acid sequences or fragments thereof having at least 80%, 90%, or 95% sequence identity.

다른 관점에서, 본 발명은 상기 Hyal 5를 코딩하는 유전자를 포함하는 재조합 벡터에 관한 것이다.In another aspect, the present invention relates to a recombinant vector comprising the gene encoding Hyal 5.

본 발명에서, "벡터(vector)"는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동가능하게 연결된 DNA 서열을 함유하는 DNA 제조물을 의미한다. 벡터는 플라스미드, 파지 입자 또는 간단하게 잠재적 게놈 삽입물일 수 있다. 적당한 숙주로 형질 전환되면, 벡터는 숙주 게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부 경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드(plasmid)" 및 "벡터(vector)"는 때로 상호 교환적으로 사용된다. 본 발명의 목적상, 플라스미드 벡터를 이용하는 게 바람직하다. 이러한 목적에 사용될 수 있는 전형적인 플라스미드 벡터는 (a) 숙주 세포당 수백 개의 플라스미드 벡터를 포함하도록 복제가 효율적으로 이루어지도록 하는 복제 개시점, (b) 플라스미드 벡터로 형질전환된 숙주세포가 선발될 수 있도록 하는 항생제 내성 유전자 및 (c) 외래 DNA 절편이 삽입될 수 있는 제한효소 절단부위를 포함하는 구조를 지니고 있다. 적절한 제한효소 절단부위가 존재하지 않을지라도, 통상의 방법에 따른 합성 올리고뉴클레오타이드 어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용하면 벡터와 외래 DNA를 용이하게 라이게이션(ligation)할 수 있다. In the present invention, "vector" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising an antibiotic resistance gene and (c) a restriction enzyme cleavage site into which foreign DNA fragments can be inserted. Although no appropriate restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods facilitates ligation of the vector and foreign DNA.

라이게이션 후에, 벡터는 적절한 숙주세포로 형질전환되어야 한다. 형질전환은 Sambrook, et. al., supra의 1.82 섹션에 기술된 칼슘 클로라이드 방법을 사용해서 용이하게 달성될 수 있다. 선택적으로, 전기천공법(electroporation)(Neumann, et. al., EMB., 1; 841, 1982) 또한 이러한 세포들의 형질전환에 사용될 수 있다. After ligation, the vector should be transformed into the appropriate host cell. Transformation is described by Sambrook, et. al., easily achieved using the calcium chloride method described in section 1.82 of supra . Alternatively, electroporation (Neumann, et. Al., EMB ., 1; 841, 1982) can also be used for transformation of these cells.

아울러, 상기 유전자는 다른 핵산 서열과 기능적 관계로 배치될 때 "작동가 능하게 연결(operably linked)" 된다. 이것은 적절한 분자(예를 들면, 전사 활성화 단백질)가 조절 서열(들)에 결합될 때 유전자 발현을 가능하게 하는 방식으로 연결된 유전자 및 조절 서열(들) 일 수 있다. 예를 들면, 전서열(pre-sequence) 또는 분비리더(leader)에 대한 DNA는 폴리펩타이드의 분비에 참여하는 전단백질로서 발현되는 경우 폴리펩타이드에 대한 DNA에 작동가능하게 연결되고; 프로모터 또는 인핸서는 서열의 전사에 영향을 끼치는 경우 코딩서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 서열의 전사에 영향을 끼치는 경우 코딩 서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 번역을 용이하게 하도록 배치되는 경우 코딩 서열에 작동가능하게 연결된다. 일반적으로 "작동가능하게 연결된"은 연결된 DNA 서열이 접촉하고, 또한 분비 리더의 경우 접촉하고 리딩 프레임 내에 존재하는 것을 의미한다. 그러나, 인핸서(enhancer)는 접촉할 필요가 없다. 이들 서열의 연결은 편리한 제한 효소 부위에서 라이게이션 (연결)에 의해 수행된다. 그러한 부위가 존재하지 않는 경우, 통상의 방법에 따른 합성 올리고뉴클레오티드 어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용한다.In addition, the genes are "operably linked" when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to enable gene expression when appropriate molecules (eg, transcriptional activating proteins) are bound to regulatory sequence (s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation. In general, "operably linked" means that the linked DNA sequences are in contact, and in the case of a secretory leader, are in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.

또 다른 관점에서, 본 발명은 상기 유전자 또는 재조합 벡터가 삽입된, 다시말해, 상기 Hyal 5를 코딩하는 유전자가 염색체 상에 삽입되거나, 상기 재조합 벡터로 형질전환된 재조합 미생물에 관한 것이다. In another aspect, the present invention relates to a recombinant microorganism into which the gene or the recombinant vector is inserted, that is, the gene encoding Hyal 5 is inserted on a chromosome or transformed with the recombinant vector.

상기 형질전환된 재조합 미생물은, DNA의 도입효율이 높고, 도입된 DNA의 발현 효율이 높은 숙주세포가 통상 사용되며, 원핵 및 진핵 세포를 포함하는 모든 미생물로서, 박테리아, 효모, 곰팡이 등이 이용가능하고, 본 발명의 실시예에서는 E. coli를 사용하였으나, 이에 한정되지 않고, 상기 Hyal 5가 충분히 발현될 수 있는 것이라면 어떠한 종류의 미생물이라도 무방하다. 예컨대 박테리아, 곰팡이 및 효모로 구성된 군에서 선택되는 미생물을 사용할 수 있다.As the transformed recombinant microorganism, host cells having high DNA introduction efficiency and high expression efficiency of introduced DNA are commonly used, and all microorganisms including prokaryotic and eukaryotic cells can be used such as bacteria, yeast, and fungi. In the embodiment of the present invention, E. coli is used, but the present invention is not limited thereto, and any type of microorganism may be used as long as Hyal 5 can be sufficiently expressed. For example, microorganisms selected from the group consisting of bacteria, fungi and yeasts can be used.

상기 형질전환된 재조합 미생물은 임의의 형질전환 방법에 따라 제조할 수 있다. 본 발명의 "형질전환(transformation)"은 DNA를 숙주로 도입하여 DNA가 염색체의 인자로서 또는 염색체 통합완성에 의해 복제 가능하게 되는 것으로 외부의 DNA를 세포 내로 도입하여 인위적으로 유전적인 변화를 일으키는 현상을 의미한다. 일반적으로 형질전환방법에는 전기천공법(electroporaton), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2)침전, 미세주입법(microinjection), 초산 리튬-DMSO법 등이 있다.The transformed recombinant microorganism may be prepared according to any transformation method. In the present invention, "transformation" refers to a phenomenon in which DNA is introduced into a host so that DNA can be reproduced as a factor of a chromosome or by completion of chromosome integration, thereby causing an artificial genetic change by introducing external DNA into a cell. Means. In general, transformation methods include electroporaton, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, lithium acetate-DMSO method, and the like.

또 다른 관점에서, 본 발명은 소 유래 Hyal 5에 대한 항체 및 이의 제조 방법에 관한 것이다. In another aspect, the present invention relates to an antibody against bovine-derived Hyal 5 and a method for producing the same.

본 발명에서, “항체”란 항원성 부위에 대해서 지시되는 특이적인 단백질 분자를 의미한다. 본 발명의 목적상, 항체는 소 유래 Hyal 5 대해 특이적으로 결합하는 항체를 의미하며, 다클론 항체, 단클론 항체 및 재조합 항체를 모두 포함한다. In the present invention, "antibody" refers to a specific protein molecule directed against an antigenic site. For the purposes of the present invention, an antibody means an antibody that specifically binds to bovine derived Hyal 5 and includes both polyclonal antibodies, monoclonal antibodies and recombinant antibodies.

상기한 바와 같이 소 유래 Hyal 5이 규명되었으므로, 이를 이용하여 항체를 생성하는 것은 당업계에 널리 공지된 기술을 이용하여 용이하게 제조할 수 있다.Since bovine-derived Hyal 5 has been identified as described above, the production of antibodies using the same can be readily prepared using techniques well known in the art.

다클론 항체는 상기한 소 유래 Hyal 5을 동물에 주사하고 동물로부터 채혈하여 항체를 포함하는 혈청을 수득하는 당업계에 널리 공지된 방법에 의해 생산할 수 있 다. 이러한 다클론 항체는 염소, 토끼, 양, 원숭이, 말, 돼지, 소 개 등의 임의의 동물 종 숙주로부터 제조 가능하다. 본 발명의 실시예에서는 토끼를 사용하였으나, 이에 한정되지 않고, 상기 Hyal 5의 항체가 형성되는 어떠한 종류의 동물이라도 무방하다. 예컨대 염소, 양, 원숭이, 말, 돼지, 개, 마우스로 구성된 군에서 선택되는 동물을 사용 할 수 있다.Polyclonal antibodies can be produced by methods well known in the art for injecting the bovine derived Hyal 5 described above into an animal and collecting blood from the animal to obtain serum comprising the antibody. Such polyclonal antibodies can be prepared from any animal species host such as goat, rabbit, sheep, monkey, horse, pig, bovine dog. In the embodiment of the present invention, a rabbit was used, but the present invention is not limited thereto, and any kind of animal in which the antibody of Hyal 5 is formed may be used. For example, animals selected from the group consisting of goats, sheep, monkeys, horses, pigs, dogs, and mice can be used.

또 다른 관점에서, 본 발명은 상기 Hyal 5에 결합하는 항체를 이용한 소 정자의 수정능 판별방법에 관한 것이다. In another aspect, the present invention relates to a method for determining fertility of sperm using the antibody that binds to Hyal 5.

본 발명에 있어서, 소 정소세포에서 Hyal 5 유전자의 발현 여부를 확인하여 기 위하여 소 정자를 채취하고 단백질을 추출하여 전기영동한 후, 상기에서 제조된 소 유래 Hyal 5에 대한 항체를 이용하여 Hyal 5의 발현 여부를 확인함으로써 소의 수정능을 확인할 수 있다. 본 발명의 실시예에서는 유전자 발현을 확인하기 위해서 상기와 같이 면역 블롯법(Immunoblot)을 사용하였으나, 이것에 한정되지 않고, 면역조직화학법(Immunohistology), 효소면역측정법(ELISA) 등의 일반적으로 사용되고 있는 유전자 확인 방법을 사용할 수 있다.In the present invention, in order to confirm the expression of Hyal 5 gene in bovine seminal cells, bovine sperm is collected and the protein is extracted and subjected to electrophoresis, and then the hyal 5 using the antibody against bovine-derived Hyal 5 prepared above. By confirming the expression of the bovine fertility can be confirmed. In the embodiment of the present invention, the immunoblot (Immunoblot) was used as above to confirm gene expression, but is not limited thereto, and is generally used such as immunohistochemistry and enzyme immunoassay (ELISA). Gene identification methods can be used.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

실시예 1: 소 Hyal 5 유전자의 클로닝Example 1: Cloning of Bovine Hyal 5 Gene

소 Hyal 5 cDNA를 제조하기 위하여, 소의 정소 조직을 적출하여 각 조직의 10배 부피로 이소젠(isogen, Nippongene)을 넣고, 초음파 파쇄기를 이용하여 조직을 분쇄한 후, 이소프로파놀(isopropanol)을 이용하여 분리된 상층액으로부터 전체 RNA를 추출하였다. In order to prepare bovine Hyal 5 cDNA, bovine testis tissues were extracted, 10 times the volume of isogen (isogen, Nippongene), and the tissues were crushed using an ultrasonic crusher, followed by isopropanol (isopropanol). Total RNA was extracted from the separated supernatant.

상기에서 수득된 전체 RNA 5㎍/㎕ 농도를 취해서 Superscript III RT kit(Invitrogen, USA) 시약을 이용하여 cDNA를 제작하였다. 즉, 50 ℃에서 1시간 동안 역전사효소에 의해 제1 가닥 cDNA를 합성한 후, 80 ℃에서 5분 동안 반응시킨 다음, RNaseH 효소를 처리하여 37 ℃에서 20분 동안 배양하여 최종적으로 cDNA를 수득하였다. 5 g / μl of the total RNA obtained above was taken and cDNA was prepared using the Superscript III RT kit (Invitrogen, USA) reagent. That is, the first strand cDNA was synthesized by reverse transcriptase at 50 ° C. for 1 hour, and then reacted at 80 ° C. for 5 minutes, and then treated with RNaseH enzyme for 20 minutes at 37 ° C. to finally obtain cDNA. .

상기 획득한 cDNA를 0.8% 아가로오스겔 전기영동으로 확인한 후, 2.0 kb 부근의 밴드들을 잘라서 DNA만을 순수분리하여, pGEM T-벡터(Promega)에 클로닝한 다음, 염기서열을 결정하였다. After confirming the obtained cDNA by 0.8% agarose gel electrophoresis, the bands around 2.0 kb were cut and purely separated by DNA, cloned into pGEM T-vector (Promega), and the base sequence was determined.

그 결과, 상기 방법에서 확인한 소 유래의 신규 Hyal 5 유전자는 서열번호 1의 아미노산 서열을 가지는 것으로 확인되었다.As a result, it was confirmed that the novel Hyal 5 gene derived from bovine confirmed in the above method has the amino acid sequence of SEQ ID NO: 1.

상기에서 클로닝한 소 hyal 5의 서열을 바탕으로 소 Hyal 5 유전자에 특이적인 프라이머를 제작(서열번호 3, 4)하여 AdvatageTM cDNA PCR Kit & Polymerase Mix(Clontech)를 이용하여 PCR를 수행하고, 상기 PCR 산물을 0.8% 아가로오스 겔에 전기영동한 후, 밴드를 잘라내어 pBS 벡터(Stratagene)에 클로닝하였다.Based on the cloned bovine hyal 5 sequence, a primer specific for the bovine hyal 5 gene was prepared (SEQ ID NOs: 3 and 4), and PCR was performed using an Advatage TM cDNA PCR Kit & Polymerase Mix (Clontech). The PCR product was electrophoresed on 0.8% agarose gel, and then the bands were cut and cloned into pBS vector (Stratagene).

그 결과, 본 발명에 따른 소 hyal 5는 마우스 hyal 5와 59.6%의 상동성을 가지고 있는 것으로 확인되었다.As a result, it was confirmed that bovine hyal 5 according to the present invention has a homology of 59.6% with mouse hyal 5.

hyal 5 센스 프라이머 (서열번호 3) : hyal 5 sense primer (SEQ ID NO: 3):

5'- atgcctcgctggggccgcgactgccccctt -3'            5'- atgcctcgctggggccgcgactgccccctt -3 '

hyal 5 안티센스 프라이머 (서열번호 4): hyal 5 antisense primer (SEQ ID NO: 4):

5'- taatcactgaatttatattttaatag -3'            5'- taatcactgaatttatattttaatag -3 '

실시예 2: 정소에서의 Example 2: At Testis hyalhyal 5의 발현  Expression of 5

상기에서 합성된 cDNA를 주형으로 사용하여 서열번호 5-10에 명시한 프라이머를 사용하여 94 ℃ 60 초, 60 ℃ 60 초, 72 ℃ 90 초를 35번 반복하는 조건으로 RT-PCR을 수행하고, 반응이 종료된 혼합액을 1.0% TAE 아가로스 겔에 전기영동한 후, 에티디엄 브로마이드(ethidium bromide)로 염색하여 유전자의 발현 패턴을 조사하였다.Using the cDNA synthesized above as a template, RT-PCR was carried out under the conditions of repeating 94 ℃ 60 seconds, 60 ℃ 60 seconds, 72 ℃ 90 seconds 35 times using the primers specified in SEQ ID NOs: 5-10, and reaction. The finished mixture was electrophoresed on 1.0% TAE agarose gel, and then stained with ethidium bromide to investigate gene expression patterns.

PH-20 센스 프라이머(서열번호 5): PH-20 Sense Primer (SEQ ID NO: 5):

5'- TATTTTATGYTRAMGACTTGG -3'            5'- TATTTTATGYTRAMGACTTGG -3 '

PH-20 안티센스 프라이머(서열번호 6): PH-20 antisense primer (SEQ ID NO: 6):

5'- CTCCAKTYTTCCCAGTCAAT -3' 5'- CTCCAKTYTTCCCAGTCAAT -3 '

Hyal 5 센스 프라이머 (서열번호 7) : Hyal 5 sense primer (SEQ ID NO 7):

5'- TAYATGCCAATAGACAATGTG -3'            5'- TAYATGCCAATAGACAATGTG -3 '

Hyal 5 안티센스 프라이머 (서열번호 8): Hyal 5 antisense primer (SEQ ID NO: 8):

5'- CAATTGTATTCACAAGGTCATC -3' 5 '- CAATTGTATTCACAAGGTCATC - 3'

Vps35 센스 프라이머(서열번호 9): Vps35 sense primer (SEQ ID NO: 9):

5'- AGTGAAGAGAATCATGAACCCT -3'            5'- AGTGAAGAGAATCATGAACCCT -3 '

Vps35 안티센스 프라이머(서열번호 10): Vps35 antisense primer (SEQ ID NO: 10):

5'- TTAAAGGATGAGACCTTCATAG -3'             5'- TTAAAGGATGAGACCTTCATAG -3 '

그 결과, 도 1에서 나타난 바와 같이, PH-20는 마우스, 렛, 소, 돼지, 원숭이에서 발현하였으나 hyal 5의 경우, 설치류와 소의 정소에서만 발현하고 돼지와 원숭이에서는 발현하지 않는 것을 확인할 수 있었다. 이것으로 신규 hyal 5가 소의 정소에서 발현하는 것을 확인하였다. As a result, as shown in Figure 1, PH- 20 was expressed in mice, rats , cows, pigs, monkeys, but hyal 5, it was confirmed that only expressed in the testis of rodents and cattle, not in pigs and monkeys. This confirms that new hyal 5 is expressed in bovine testes.

실시예 3: 소 유래Example 3: Bovine Origin Hyal 5의 항체 제작Antibody Construction of Hyal 5

소 유래 Hyal 5의 항체를 생산하기 위하여, Hyal 5의 288~383 아미노산 영역을 프라이머(서열번호 11, 12)를 이용하여 PCR 법에 의해 증폭하였다. In order to produce bovine-derived Hyal 5 antibody, 288-383 amino acid regions of Hyal 5 were amplified by PCR using primers (SEQ ID NOs: 11, 12).

Hyal 5 센스 프라이머 (서열번호 11) : Hyal 5 sense primer (SEQ ID NO 11):

5'- AAGAATTCAAGAAGGGTCTATTCAGTTG -3'              5'- AAGAATTCAAGAAGGGTCTATTCAGTTG -3 '

Hyal 5 안티센스 프라이머 (서열번호 12): Hyal 5 Antisense Primer (SEQ ID NO: 12):

5'- TTCTCGAGTCTAGCTTGTGGAGAAG -3'              5'- TTCTCGAGTCTAGCTTGTGGAGAAG -3 '

상기 증폭된 PCR 산물을 His tag이 내재되어 있는 pET32a 벡터(Novagen, Co., USA)에 클로닝한 후, E. coli BL21(DE3)에 도입하여 형질전환 시켰다. 상기 형질전환 미생물을 배양한 후, 소 유래 Hyal 5의 발현 여부를 SDS-PAGE법으로 확인하였다. 그 결과, 도 2에서 나타나는 바와 같이 5, 6번의 재조합 단백질을 생산할 수 없는 negative control은 소 유래 Hyal 5가 발현하지 않았고 1, 2, 3, 4번의 형질전환 미생물에서만 소 유래 Hyal 5가 발현되는 것을 확인할 수 있었다. The amplified PCR product was cloned into pET32a vector (Novagen, Co., USA) in which His tag was embedded, and then transformed into E. coli BL21 (DE3). After culturing the transformed microorganism, it was confirmed whether the expression of cow-derived Hyal 5 by SDS-PAGE method. As a result, as shown in FIG. 2, the negative control that cannot produce recombinant proteins 5 and 6 did not express the cow-derived Hyal 5 and expressed only the cow-derived Hyal 5 in 1, 2, 3, and 4 transgenic microorganisms. I could confirm it.

상기 1 내지 4번의 형질전환 미생물에서 중에서 3번의 형진전환 미생물에서 발현된 소 유래 Hyal 5를 니켈 레진으로 충진된 His-친화성 크로마토그래피를 이용하여 정제한 후, 도 3에서 나타나는 것과 같이 Hyal 5가 가장 많이 검출된 2번과 3번 튜브를 PBS로 투석하였다. 상기 정제된 Hyal 5를 500 ㎍씩 10일 간격으로 토끼에게 5회 주사하고 혈액을 채취하였다. Hyal 5 항체를 정제하기 위하여 채취된 혈액을 37 ℃에서 1시간 반응 시킨 후, 혈청을 분리하기 위하여 4 ℃에서 12시간 정치한 다음, 10000 × g로 10분간 원심분리하여 상층액을 회수하였다. 상층액에서 Hyal 5 IgG를 분리하기 위하여 5 mg의 Protein G plus (Pierce)와 결합시킨후, Elution buffer (pH 2.2 20 mM Glycine)으로 정제를 한후, PBS 용액으로 투석을 하였다.After purifying the cow-derived Hyal 5 expressed in three transgenic microorganisms among the 1 to 4 transgenic microorganisms using His-affinity chromatography filled with nickel resin, Hyal 5 was shown in FIG. 3. Most detected tubes 2 and 3 were dialyzed with PBS. The purified Hyal 5 was injected into the rabbit 5 times at 10 μg intervals of 500 μg and blood was collected. The blood collected for purification of the Hyal 5 antibody was reacted at 37 ° C. for 1 hour, and then left to stand at 4 ° C. for 12 hours to separate serum, followed by centrifugation at 10000 × g for 10 minutes to recover the supernatant. In order to separate the hyal 5 IgG from the supernatant, it was combined with 5 mg of Protein G plus (Pierce), purified with Elution buffer (pH 2.2 20 mM Glycine), and dialyzed with PBS solution.

실시예 4: 소 정자에서 Hyal 5의 발현 확인Example 4: Confirmation of Hyal 5 Expression in Bovine Sperm

소의 정소조직에서에서 속출한 정자를 단백질 억제제(Sigma, Protein inhibitor Coactail)가 첨가된 추출용액(1% TX-100)에서 가용화시킨 후, 원심분리 하여 상층액을 수득하였다. 상기 상층액을 단백질 어세이에 의하여 정량하였다. 상기 정량된 4 ㎍의 정량된 소 부고환의 Caput에서 채취한 정자(Ca. Sperm)와 소 부고환의 Couda(cauda)에서 채취한 정자(Co. Sperm)에 SDS 샘플 버퍼를 넣고 3분간 열 변성시킨 후 10%의 SDS-PAGE 겔에 로딩하여 전기영동으로 분리하였다. 분리된 단백질을 폴리비닐리덴 플로라이드(polyvinylidene fluoride, PVDF)막으로 옮기고, 2% 탈지 분유(skim milk)로 블로킹하였다. 그리고 실시예 3에서 제조된 소 유래 Hyal 5의 항체를 넣어 반응시킨 후, HRP(Horse-Radish peroxidase)가 연결된 2차 항체(Jackson ImmunoResearch Laboratories)를 처리하여 발생하는 신호를 X-ray 필름에 현상하였다. Sperm derived from bovine testes was solubilized in an extract solution (1% TX-100) to which a protein inhibitor (Sigma) was added, followed by centrifugation to obtain a supernatant. The supernatant was quantified by protein assay. After SDS sample buffer was added to the sperm (Ca. Sperm) and the sperm (Co. Sperm) collected from Couda (cauda) of the bovine epididymis, the quantitative bovine epididymis caput was incubated for 3 minutes. 10% SDS-PAGE gels were loaded and separated by electrophoresis. The separated protein was transferred to a polyvinylidene fluoride (PVDF) membrane and blocked with 2% skim milk. In addition, after reacting the bovine-derived Hyal 5 antibody prepared in Example 3 and reacting with a secondary antibody (Hackson ImmunoResearch Laboratories) to which HRP (Horse-Radish peroxidase) is connected, a signal generated by X-ray film was developed. .

그 결과, 도 4에 나타난 바와 같이, 소 부고환의 caput과 couda에서 채취한 정자에서 Hyal 5가 발현되는 것을 확인하였고 이를 통해 Hyal 5가 정소 세포 및 정자의 특이 마커로 사용할 수 있다는 것을 확인하였다. As a result, as shown in Figure 4, it was confirmed that the expression of Hyal 5 in the sperm collected from the caput and couda of bovine epididymis, it was confirmed that Hyal 5 can be used as a specific marker of testis cells and sperm.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구 항들과 그것들의 등가물에 의하여 정의된다고 할 것이다. The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

도 1은 마우스, 렛, 햄스터, 소, 돼지, 원숭이의 정소에서 hyal 5, PH-20, 및 Vps35의 발현 양상을 RT-PCR로 확인한 결과를 나타낸 것이다.Figure 1 shows the results confirmed by RT-PCR expression of hyal 5 , PH- 20, and Vps 35 in the testis of mice , rats , hamsters, cattle, pigs, monkeys.

도 2는 소 유래 Hyal 5 유전자(hyal 5)의 일 부분이 클로닝된 벡터가 도입된 재조합 미생물에서 Hyal 5의 발현 여부를 확인한 것이다. (1-4: 재조합 미생물, 5-6: negative control) Figure 2 confirms the expression of Hyal 5 in a recombinant microorganism into which a vector from which a portion of a cow-derived Hyal 5 gene ( hyal 5) is cloned is introduced. (1-4: recombinant microorganism, 5-6: negative control)

도 3은 Hyal 5가 발현된 재조합 미생물을 정제하여 Hyal 5의 검출 여부를 확인한 것이다.3 is to confirm the detection of Hyal 5 by purifying recombinant microorganisms expressing Hyal 5.

도 4는 소 정자에서 소 유래 Hyal 5의 발현 여부를 확인한 것이다.Figure 4 confirms the expression of bovine-derived Hyal 5 in bovine sperm.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Gene Enconding Hyal5 Isolated from Bivine and Method for Discriminating Fertility of Bovine Sperm Using Thereof <130> P09-B211 <160> 12 <170> KopatentIn 1.71 <210> 1 <211> 657 <212> PRT <213> Bos taurus <400> 1 Met Pro Arg Trp Gly Arg Asp Cys Pro Leu Leu Ala Leu Ala Ala Leu 1 5 10 15 Ala Cys Leu Ser Ala Val Val Asp Gly Pro Val Gly Ser Arg Leu Ala 20 25 30 Leu Val Ser Pro Leu Phe Phe Thr Asp Glu Ala Thr Cys Lys Thr Leu 35 40 45 Leu Lys Gln Glu Ala Arg Arg Ile Ile Phe Lys Tyr Ile Ser Ser Leu 50 55 60 Tyr Ile Phe Ile His Gln Ser Gly Phe Ile Pro Tyr Phe Leu Phe Cys 65 70 75 80 Val Tyr Ile Leu His Gln Ile Leu Asp Lys Pro Lys Cys Val Gly Glu 85 90 95 Lys Lys Cys Lys Ser Leu Leu Phe Ala Val Gly Met Leu Arg His Gln 100 105 110 His Ile Ser Phe Arg Asn Phe Val Gly Ser Asn Gly Ala Pro Gln Ala 115 120 125 Val Phe Thr Phe Leu Leu Val Pro Cys Cys Leu Ala Leu Asn Phe Thr 130 135 140 Ala Pro Pro Leu Ile Pro Asn Ile Pro Phe Leu Trp Ala Trp Asn Ala 145 150 155 160 Pro Thr Asn His Cys Ala Glu Ile Phe Ser Met Pro Pro Asp Leu Gly 165 170 175 Leu Phe Ser Leu Val Gly Ser Pro Gln Lys Asp Val Thr Gly Gln Pro 180 185 190 Ile Thr Leu Phe Tyr Ala Asp Arg Leu Gly Tyr Tyr Pro Lys Ile Asn 195 200 205 Glu Arg Thr Gly Val His Lys Asn Gly Gly Ile Pro Gln Val Ala Ser 210 215 220 Leu Lys Lys His Leu Asp Lys Ala Glu Lys Asp Ile Ala Tyr Tyr Met 225 230 235 240 Pro Ile Asp Asn Val Gly Leu Ala Val Ile Asp Trp Glu Asn Trp Arg 245 250 255 Pro Thr Trp Val Arg Asn Trp Lys Pro Lys Asp Val Tyr Lys Lys Ala 260 265 270 Ser Ile Glu Leu Val Leu Gln Gln Asn Arg His Phe Thr Leu Lys Glu 275 280 285 Ala Thr Lys Arg Ala Lys Ala Asp Phe Glu Lys Ala Ala Lys Ser Phe 290 295 300 Met Gln Glu Thr Leu Lys Leu Gly Lys Phe Leu Arg Pro Asn His Leu 305 310 315 320 Trp Gly Tyr Tyr Leu Phe Pro Asp Cys Tyr Asn His His Tyr Asn Gln 325 330 335 Ala Asn Tyr Asn Gly Ser Cys Phe Asp Glu Glu Lys Arg Arg Asn Asp 340 345 350 Ala Leu Asn Trp Leu Trp Lys Glu Ser Thr Ala Leu Tyr Pro Ser Val 355 360 365 Tyr Leu Asn Thr Lys Leu Lys Ser Ser Pro Gln Ala Arg Leu Phe Val 370 375 380 Arg Asn Arg Val Gln Glu Ala Ile Arg Leu Ser Lys Val Ala Asn Val 385 390 395 400 Lys Ser Pro Leu Pro Val Phe Val Tyr Thr Arg Pro Val Phe Ser Asp 405 410 415 Met Ser Ser Lys Phe Leu Ser Gln Asp Asp Leu Val Ser Thr Ile Gly 420 425 430 Glu Ser Ile Ala Leu Gly Ala Ser Gly Ile Ile Met Trp Gly Ser Phe 435 440 445 Asn Leu Ser Leu Thr Lys Gln Ser Cys Met Asn Leu Ser Asn Tyr Leu 450 455 460 Asn Thr Ile Leu Asn Pro Tyr Ile Ile Asn Val Thr Leu Ala Ala Lys 465 470 475 480 Met Cys Ser Gln Val Leu Cys His Glu Glu Gly Val Cys Thr Arg Lys 485 490 495 His Trp Asn Ser Thr Asp Tyr Leu His Leu Asn Pro Met Asn Phe Ala 500 505 510 Ile Gln Arg Arg Lys Tyr Gly Lys Tyr Thr Ile His Gly Lys Pro Thr 515 520 525 Leu Glu Asp Leu Leu Gln Phe Ser Glu Asn Phe Tyr Cys Ser Cys Tyr 530 535 540 Ala Asn Ile His Cys Lys Lys Arg Asp Ile Lys Asn Ile His Thr Ile 545 550 555 560 Asn Val Cys Phe Ala Glu Asp Val Cys Ile Asn Ala Ser Leu Asn Ser 565 570 575 Asp Arg Ser Lys His Ser Ser Ser Gln Lys Asp Ile Ser Ser Thr Thr 580 585 590 Phe Ser Thr Val Ser Ser Ser Thr Pro Thr Ala Lys Val Ser Ala Arg 595 600 605 Val Pro Gly Lys Asp His Val Ser Leu Lys Ile Arg Leu Pro Gly Glu 610 615 620 Ala Leu Ser Asn Thr Ile Gln Arg Gly His Lys Ser Val Asp Trp Lys 625 630 635 640 Asn Ile Phe Arg Gln Leu Tyr Phe Gln Asn Ile Lys Asn Glu Thr Asn 645 650 655 Tyr <210> 2 <211> 1993 <212> DNA <213> Bos taurus <400> 2 atgcctcgct ggggccgcga ctgccccctt ctggctctgg ctgccctcgc ctgcctgtct 60 gctgtggtgg atggacctgt cggcagccgg ctagctctag tcagtccttt gttctttaca 120 gatgaagcaa cttgcaaaac attgctaaaa caagaagcaa gaagaataat atttaaatac 180 atatcatcat tatacatttt tatccatcaa agtggcttca ttccatactt tctcttctgt 240 gtttatatct tacatcaaat attagataaa ccaaagtgtg taggagaaaa aaagtgcaaa 300 tcattacttt ttgcagtggg aatgctaagg caccagcata tctcttttag gaactttgtt 360 gggtccaatg gagcacccca ggcagtgttc accttccttc tggttccatg ttgtttggct 420 ttgaacttta cagcaccccc tctcattcca aatattcctt tcctgtgggc ctggaatgcc 480 ccaactaacc attgtgctga aatatttagc atgcctccag atctgggcct cttctcctta 540 gtaggaagcc cccaaaaaga tgttacagga caacctatta cattatttta tgctgatagg 600 cttggctact atcctaagat aaatgaaaga acaggtgtcc ataagaatgg tggaattcct 660 caggtggctt ccttaaaaaa acatttggac aaagctgaaa aagacattgc ctattacatg 720 ccaatcgaca acgtgggctt ggcggtcatt gactgggaaa actggaggcc tacctgggta 780 agaaactgga aacctaaaga tgtttacaag aaggcgtcta ttgagttggt tctgcaacaa 840 aatagacact ttactttgaa agaggctacc aagagagcga aagcggattt tgaaaaggca 900 gcaaagagct tcatgcaaga gactttaaaa ttgggaaagt ttcttcggcc aaaccactta 960 tggggttatt atctttttcc tgattgttac aatcatcatt ataaccaagc taattacaat 1020 ggaagttgct ttgatgaaga gaaaagaaga aatgatgcac tcaattggtt gtggaaggaa 1080 agcactgccc tttacccctc tgtttatttg aataccaagc taaaatcttc tccacaagct 1140 agactctttg ttcgtaatcg tgttcaggaa gccattcgat tgtctaaagt tgccaatgtt 1200 aaaagtccac ttccggtttt tgtatatacc cgtccagttt ttagtgatat gtcttcaaaa 1260 ttcctttctc aggatgacct tgtgagtaca attggtgaga gcattgctct aggtgcttct 1320 ggaattataa tgtggggaag cttcaactta agcctaacta agcaatcttg catgaaccta 1380 agcaattact tgaatactat actgaatcct tatataatca acgtcactct agcagccaaa 1440 atgtgtagcc aagtgttgtg ccacgaggaa ggagtgtgta caaggaaaca ctggaattca 1500 accgactatc ttcacctgaa cccaatgaat tttgctattc aaaggcggaa atatggaaaa 1560 tacaccatac atgggaaacc cacacttgaa gacctgctac aattttctga aaatttttat 1620 tgcagttgtt atgccaacat ccactgtaaa aaaagagata taaaaaacat tcatactatt 1680 aatgtatgtt ttgctgaaga tgtttgtata aacgcttctc taaactcaga ccgcagtaag 1740 cactcttcta gccagaaaga tatatcttct accactttta gcactgtctc atcctccaca 1800 ccgactgcca aagtgtctgc acgtgttcct gggaaagatc atgtgtccct caaaatcagg 1860 cttccagggg aagccctctc caacaccatc caaaggggcc ataagagtgt tgactggaaa 1920 aatatattcc gtcagttata ctttcaaaac attaaaaatg aaacaaacta ttaaaatata 1980 aattcagtga tta 1993 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> hyal 5 sense primer <400> 3 atgcctcgct ggggccgcga ctgccccctt 30 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> hyal 5 antisense primer <400> 4 taatcactga atttatattt taatag 26 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PH-20 Sense primer <400> 5 tattttatgy tramgacttg g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PH-20 Antisense primer <400> 6 ctccaktytt cccagtcaat 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Hyal 5 Sense primer <400> 7 tayatgccaa tagacaatgt g 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Hyal 5 Antisense primer <400> 8 caattgtatt cacaaggtca tc 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Vps35 Sense primer <400> 9 agtgaagaga atcatgaacc ct 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Vps35 Antisense primer <400> 10 ttaaaggatg agaccttcat ag 22 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Hyal 5 sense primer <400> 11 aagaattcaa gaagggtcta ttcagttg 28 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> hyal 5 antisense primer <400> 12 ttctcgagtc tagcttgtgg agaag 25 <110> Korea Research Institute of Bioscience and Biotechnology <120> Gene Enconding Hyal5 Isolated from Bivine and Method for          Discriminating Fertility of Bovine Sperm Using Thereof <130> P09-B211 <160> 12 <170> KopatentIn 1.71 <210> 1 <211> 657 <212> PRT <213> Bos taurus <400> 1 Met Pro Arg Trp Gly Arg Asp Cys Pro Leu Leu Ala Leu Ala Ala Leu   1 5 10 15 Ala Cys Leu Ser Ala Val Val Asp Gly Pro Val Gly Ser Arg Leu Ala              20 25 30 Leu Val Ser Pro Leu Phe Phe Thr Asp Glu Ala Thr Cys Lys Thr Leu          35 40 45 Leu Lys Gln Glu Ala Arg Arg Ile Ile Phe Lys Tyr Ile Ser Ser Leu      50 55 60 Tyr Ile Phe Ile His Gln Ser Gly Phe Ile Pro Tyr Phe Leu Phe Cys  65 70 75 80 Val Tyr Ile Leu His Gln Ile Leu Asp Lys Pro Lys Cys Val Gly Glu                  85 90 95 Lys Lys Cys Lys Ser Leu Leu Phe Ala Val Gly Met Leu Arg His Gln             100 105 110 His Ile Ser Phe Arg Asn Phe Val Gly Ser Asn Gly Ala Pro Gln Ala         115 120 125 Val Phe Thr Phe Leu Leu Val Pro Cys Cys Leu Ala Leu Asn Phe Thr     130 135 140 Ala Pro Pro Leu Ile Pro Asn Ile Pro Phe Leu Trp Ala Trp Asn Ala 145 150 155 160 Pro Thr Asn His Cys Ala Glu Ile Phe Ser Met Pro Pro Asp Leu Gly                 165 170 175 Leu Phe Ser Leu Val Gly Ser Pro Gln Lys Asp Val Thr Gly Gln Pro             180 185 190 Ile Thr Leu Phe Tyr Ala Asp Arg Leu Gly Tyr Tyr Pro Lys Ile Asn         195 200 205 Glu Arg Thr Gly Val His Lys Asn Gly Gly Ile Pro Gln Val Ala Ser     210 215 220 Leu Lys Lys His Leu Asp Lys Ala Glu Lys Asp Ile Ala Tyr Tyr Met 225 230 235 240 Pro Ile Asp Asn Val Gly Leu Ala Val Ile Asp Trp Glu Asn Trp Arg                 245 250 255 Pro Thr Trp Val Arg Asn Trp Lys Pro Lys Asp Val Tyr Lys Lys Ala             260 265 270 Ser Ile Glu Leu Val Leu Gln Gln Asn Arg His Phe Thr Leu Lys Glu         275 280 285 Ala Thr Lys Arg Ala Lys Ala Asp Phe Glu Lys Ala Ala Lys Ser Phe     290 295 300 Met Gln Glu Thr Leu Lys Leu Gly Lys Phe Leu Arg Pro Asn His Leu 305 310 315 320 Trp Gly Tyr Tyr Leu Phe Pro Asp Cys Tyr Asn His His Tyr Asn Gln                 325 330 335 Ala Asn Tyr Asn Gly Ser Cys Phe Asp Glu Glu Lys Arg Arg Asn Asp             340 345 350 Ala Leu Asn Trp Leu Trp Lys Glu Ser Thr Ala Leu Tyr Pro Ser Val         355 360 365 Tyr Leu Asn Thr Lys Leu Lys Ser Ser Pro Gln Ala Arg Leu Phe Val     370 375 380 Arg Asn Arg Val Gln Glu Ala Ile Arg Leu Ser Lys Val Ala Asn Val 385 390 395 400 Lys Ser Pro Leu Pro Val Phe Val Tyr Thr Arg Pro Val Phe Ser Asp                 405 410 415 Met Ser Ser Lys Phe Leu Ser Gln Asp Asp Leu Val Ser Thr Ile Gly             420 425 430 Glu Ser Ile Ala Leu Gly Ala Ser Gly Ile Ile Met Trp Gly Ser Phe         435 440 445 Asn Leu Ser Leu Thr Lys Gln Ser Cys Met Asn Leu Ser Asn Tyr Leu     450 455 460 Asn Thr Ile Leu Asn Pro Tyr Ile Ile Asn Val Thr Leu Ala Ala Lys 465 470 475 480 Met Cys Ser Gln Val Leu Cys His Glu Glu Gly Val Cys Thr Arg Lys                 485 490 495 His Trp Asn Ser Thr Asp Tyr Leu His Leu Asn Pro Met Asn Phe Ala             500 505 510 Ile Gln Arg Arg Lys Tyr Gly Lys Tyr Thr Ile His Gly Lys Pro Thr         515 520 525 Leu Glu Asp Leu Leu Gln Phe Ser Glu Asn Phe Tyr Cys Ser Cys Tyr     530 535 540 Ala Asn Ile His Cys Lys Lys Arg Asp Ile Lys Asn Ile His Thr Ile 545 550 555 560 Asn Val Cys Phe Ala Glu Asp Val Cys Ile Asn Ala Ser Leu Asn Ser                 565 570 575 Asp Arg Ser Lys His Ser Ser Ser Gln Lys Asp Ile Ser Ser Thr Thr             580 585 590 Phe Ser Thr Val Ser Ser Ser Thr Pro Thr Ala Lys Val Ser Ala Arg         595 600 605 Val Pro Gly Lys Asp His Val Ser Leu Lys Ile Arg Leu Pro Gly Glu     610 615 620 Ala Leu Ser Asn Thr Ile Gln Arg Gly His Lys Ser Val Asp Trp Lys 625 630 635 640 Asn Ile Phe Arg Gln Leu Tyr Phe Gln Asn Ile Lys Asn Glu Thr Asn                 645 650 655 Tyr     <210> 2 <211> 1993 <212> DNA <213> Bos taurus <400> 2 atgcctcgct ggggccgcga ctgccccctt ctggctctgg ctgccctcgc ctgcctgtct 60 gctgtggtgg atggacctgt cggcagccgg ctagctctag tcagtccttt gttctttaca 120 gatgaagcaa cttgcaaaac attgctaaaa caagaagcaa gaagaataat atttaaatac 180 atatcatcat tatacatttt tatccatcaa agtggcttca ttccatactt tctcttctgt 240 gtttatatct tacatcaaat attagataaa ccaaagtgtg taggagaaaa aaagtgcaaa 300 tcattacttt ttgcagtggg aatgctaagg caccagcata tctcttttag gaactttgtt 360 gggtccaatg gagcacccca ggcagtgttc accttccttc tggttccatg ttgtttggct 420 ttgaacttta cagcaccccc tctcattcca aatattcctt tcctgtgggc ctggaatgcc 480 ccaactaacc attgtgctga aatatttagc atgcctccag atctgggcct cttctcctta 540 gtaggaagcc cccaaaaaga tgttacagga caacctatta cattatttta tgctgatagg 600 cttggctact atcctaagat aaatgaaaga acaggtgtcc ataagaatgg tggaattcct 660 caggtggctt ccttaaaaaa acatttggac aaagctgaaa aagacattgc ctattacatg 720 ccaatcgaca acgtgggctt ggcggtcatt gactgggaaa actggaggcc tacctgggta 780 agaaactgga aacctaaaga tgtttacaag aaggcgtcta ttgagttggt tctgcaacaa 840 aatagacact ttactttgaa agaggctacc aagagagcga aagcggattt tgaaaaggca 900 gcaaagagct tcatgcaaga gactttaaaa ttgggaaagt ttcttcggcc aaaccactta 960 tggggttatt atctttttcc tgattgttac aatcatcatt ataaccaagc taattacaat 1020 ggaagttgct ttgatgaaga gaaaagaaga aatgatgcac tcaattggtt gtggaaggaa 1080 agcactgccc tttacccctc tgtttatttg aataccaagc taaaatcttc tccacaagct 1140 agactctttg ttcgtaatcg tgttcaggaa gccattcgat tgtctaaagt tgccaatgtt 1200 aaaagtccac ttccggtttt tgtatatacc cgtccagttt ttagtgatat gtcttcaaaa 1260 ttcctttctc aggatgacct tgtgagtaca attggtgaga gcattgctct aggtgcttct 1320 ggaattataa tgtggggaag cttcaactta agcctaacta agcaatcttg catgaaccta 1380 agcaattact tgaatactat actgaatcct tatataatca acgtcactct agcagccaaa 1440 atgtgtagcc aagtgttgtg ccacgaggaa ggagtgtgta caaggaaaca ctggaattca 1500 accgactatc ttcacctgaa cccaatgaat tttgctattc aaaggcggaa atatggaaaa 1560 tacaccatac atgggaaacc cacacttgaa gacctgctac aattttctga aaatttttat 1620 tgcagttgtt atgccaacat ccactgtaaa aaaagagata taaaaaacat tcatactatt 1680 aatgtatgtt ttgctgaaga tgtttgtata aacgcttctc taaactcaga ccgcagtaag 1740 cactcttcta gccagaaaga tatatcttct accactttta gcactgtctc atcctccaca 1800 ccgactgcca aagtgtctgc acgtgttcct gggaaagatc atgtgtccct caaaatcagg 1860 cttccagggg aagccctctc caacaccatc caaaggggcc ataagagtgt tgactggaaa 1920 aatatattcc gtcagttata ctttcaaaac attaaaaatg aaacaaacta ttaaaatata 1980 aattcagtga tta 1993 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> hyal 5 sense primer <400> 3 atgcctcgct ggggccgcga ctgccccctt 30 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> hyal 5 antisense primer <400> 4 taatcactga atttatattt taatag 26 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PH-20 Sense primer <400> 5 tattttatgy tramgacttg g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PH-20 Antisense primer <400> 6 ctccaktytt cccagtcaat 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Hyal 5 Sense primer <400> 7 tayatgccaa tagacaatgt g 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Hyal 5 Antisense primer <400> 8 caattgtatt cacaaggtca tc 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Vps35 Sense primer <400> 9 agtgaagaga atcatgaacc ct 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Vps35 Antisense primer <400> 10 ttaaaggatg agaccttcat ag 22 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Hyal 5 sense primer <400> 11 aagaattcaa gaagggtcta ttcagttg 28 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> hyal 5 antisense primer <400> 12 ttctcgagtc tagcttgtgg agaag 25  

Claims (8)

서열번호 1의 아미노산 서열로 표시되는 소 유래 Hyal 5(Hyaluronidase 5).Bovine-derived Hyal 5 (Hyaluronidase 5) represented by the amino acid sequence of SEQ ID NO: 1. 제1항의 Hyal 5를 코딩하는 유전자(hyal 5).The gene encoding Hyal 5 of claim 1 ( hyal 5). 제2항의 유전자를 함유하는 재조합벡터.Recombinant vector containing the gene of claim 2. 제2항의 유전자 또는 제3항의 재조합벡터로 형질전환된 재조합 미생물.A recombinant microorganism transformed with the gene of claim 2 or the recombinant vector of claim 3. 제1항의 Hyal 5에 특이적으로 결합하는 항체.An antibody that specifically binds to Hyal 5 of claim 1. 다음 단계를 포함하는 Hyal 5에 대한 항체의 제조방법:Method for preparing an antibody against Hyal 5, comprising the following steps: (a) 제4항의 재조합 미생물을 배양하여 Hyal 5를 발현시킨 다음, 정제하는 단계;(a) culturing the recombinant microorganism of claim 4 to express Hyal 5 and then purifying; (b) 상기 정제된 Hyal 5를 동물(단, 인간은 제외)에 주사하여 면역반응을 유도하는 단계 ; 및(b) injecting the purified Hyal 5 into an animal (except human) to induce an immune response; And (c) 상기 면역반응이 유도된 동물의 혈청으로부터 Hyal 5에 대한 항체를 분리하는 단계.(c) separating the antibody against Hyal 5 from the serum of the animal from which the immune response was induced. 소 정자에서 제2항의 유전자의 발현 여부를 확인하는 것을 특징으로 하는 소 정자의 수정능 판별방법.A method for determining fertility of sperm, characterized in that whether or not the expression of the gene of claim 2 in the sperm. 제7항에 있어서, 상기 유전자의 발현 여부 확인은 제5항의 항체를 이용하는 것을 특징으로 하는 방법.The method of claim 7, wherein the expression of the gene is confirmed using the antibody of claim 5.
KR1020090107101A 2009-11-06 2009-11-06 Gene Enconding Hyal 5 Isolated from Bovine and Method for Discriminating Fertility of Bovine Sperm Using Thereof KR101135648B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020090107101A KR101135648B1 (en) 2009-11-06 2009-11-06 Gene Enconding Hyal 5 Isolated from Bovine and Method for Discriminating Fertility of Bovine Sperm Using Thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020090107101A KR101135648B1 (en) 2009-11-06 2009-11-06 Gene Enconding Hyal 5 Isolated from Bovine and Method for Discriminating Fertility of Bovine Sperm Using Thereof

Publications (2)

Publication Number Publication Date
KR20110050219A true KR20110050219A (en) 2011-05-13
KR101135648B1 KR101135648B1 (en) 2012-04-13

Family

ID=44361070

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020090107101A KR101135648B1 (en) 2009-11-06 2009-11-06 Gene Enconding Hyal 5 Isolated from Bovine and Method for Discriminating Fertility of Bovine Sperm Using Thereof

Country Status (1)

Country Link
KR (1) KR101135648B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101463124B1 (en) * 2013-01-02 2014-11-21 전북대학교산학협력단 Protein marker for predicting fertility of Hanwoo and predicting method thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101463124B1 (en) * 2013-01-02 2014-11-21 전북대학교산학협력단 Protein marker for predicting fertility of Hanwoo and predicting method thereof

Also Published As

Publication number Publication date
KR101135648B1 (en) 2012-04-13

Similar Documents

Publication Publication Date Title
US6790639B2 (en) Mammalian osteoregulins
WO2000034317A2 (en) Method for reducing immunogenicity of proteins
TW200526683A (en) Neutralizing epitope-based growth enhancing vaccine
KR20020007281A (en) Generation of antibodies using polynucleotide vaccination in avian species
Moiseeva et al. A novel dystrophin/utrophin‐associated protein is an enzymatically inactive member of the phosphoglucomutase superfamily
KR101135648B1 (en) Gene Enconding Hyal 5 Isolated from Bovine and Method for Discriminating Fertility of Bovine Sperm Using Thereof
Furlong et al. Expression of human proacrosin in Escherichia coli and binding to zona pellucida
US5747290A (en) Process for the production of recombinant polypeptides
CN109111509B (en) Mutant of alpha toxin of clostridium putrefactive bacteria, gene for expressing mutant, preparation method and vaccine of clostridium putrefactive bacteria
US7125550B2 (en) Human sperm specific lysozyme-like proteins
KR100802140B1 (en) Novel gene encoding adam3 isolated from porcine and method for discriminating fertility of porcine sperm using thereof
US20060062799A1 (en) Sperm specific lysozyme-like proteins
US6413521B1 (en) Helminth parasite antigen with aminopeptidase-like activity
KR101055333B1 (en) Specific Antibody Against Porcine Hyaluronidase PH-20 and Preparing Method Thereof
Pisani et al. Characterization of maternal antigen that embryos require (MATER/NLRP5) gene and protein in pig somatic tissues and germ cells
CN116874576B (en) Recombinant humanized silk fibroin and preparation method and application thereof
CN114196691B (en) Gene, protein, vaccine and application for preparing multi-epitope recombinant vaccine for preventing and treating echinococcosis of cattle and sheep
CN116143903B (en) Peptidoglycan recognition protein-3, preparation method and application thereof
US20060039884A1 (en) Baldness related gene and the polypeptide encoded thereby , and uses
JPH10146188A (en) Mouse gene corresponding to causative gene of human werner&#39;s syndrome and protein for which the gene codes
Middlebrook Molecular Cloning of Snake Toxins and Other Venom Components
CZ160198A3 (en) Transgenic animal, transgenic gene, process of their preparation and use for purifying transcription complexes
JPH08503601A (en) Contraceptive vaccine
MOlSEEVA et al. I Department zyxwvutsrqponmlkjih
EP1055731A1 (en) DNA which encodes trehalase and uses thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20160405

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20170802

Year of fee payment: 18