KR20110018118A - Method for production of 3-hydroxypropionic acid from glycerol by cultivating recombinant e. coli - Google Patents

Abstract

PURPOSE: A method for efficiently preparing 3-hydroxypropinoic acid from glycerol using recombinant E.coli is provided. CONSTITUTION: A method for preparing 3-hydroxyproionic acid from glycerol comprises a step of culturing recombinant E.coli in a medium containing glycerol and rich glucose. A method for preparing the recombinant E.coli comprises: a step of transforming E.Coli to express Lactobacillus brevis-derived glycerol dehydratase and Lactobacillus brevis-derived glycerol dehydratase reactivase; and a step of expressing an enzyme which converts 3-hydroxypropin aldehyde to 3-hydroxypropionic acid.

Description

Method for production of 3-hydroxypropionic acid from glycerol by cultivating recombinant E. coli}

The present invention relates to a method for producing 3-hydroxypropionic acid from glycerol, and more particularly to a method for producing 3-hydroxypropionic acid from glycerol using recombinant E. coli.

Glycerol is used not only for industrial purposes, such as cosmetics, soaps, food, medicines and lubricants, but also as a raw material in the fermentation industry. 3-Glycerol 3-hydroxypropionaldehyde (3-HPA) It is used to produce 3-hydroxypropionic acid (see reference 1).

[Reference Figure 1]

3-hydroxypropionic acid or its salts are known to be important building blocks in organic synthesis, and play a key role as intermediates in metabolic pathways.

3-hydroxypropionic acid (3-HP) is important enough to occupy the third position among 12 platform compounds related to renewable biomass products currently on the US DOE list.

3-HP is mainly used as an antistatic agent for crosslinking agents, metal lubricants and fabrics of polymer coatings, and is a compound that has been utilized in many fields.

3-HP has two functional groups that play an important role in the synthesis of optically active materials, which makes 3-HP an important precursor in the chemical industry. Core compounds synthesized with 3-HP as precursors include 1,3-propanediol, acrylic acid, methyl acrylate, acrylamide, ethyl 3-HP, and malonic acid ( malonic acid), propiolactone and acrylonitrile.

As described above, 3-HP is used as a precursor for the synthesis of various materials and has a variety of applications, with an estimated global market size of 3.63 million tonnes per year.

However, much of the biosynthetic pathway for 3-HP, which plays such an important and useful role, has not been studied much, and in particular, there has not been much research on the technique of biosynthesis of 3-HP from glycerol.

Accordingly, an object of the present invention is to develop and provide a method for producing 3-hydroxypropionic acid from glycerol using recombinant E. coli.

In order to achieve the above object, the present invention, in order to convert glycerol into 3-hydroxypropionaldehyde (3-HPA), which is a precursor of 3-hydroxypropionic acid, Lactobacillus brevis ( Lactobacillus glycerol dehydratase from Lactobacillus brevis derived from the start codons TTG and GTG of the open reading frame encoding DHAB1 and DHAB2 in the subunits DHAB1, DHAB2 and DHAB3 constituting the glycerol dehydratase derived from brevis ), respectively. (glycerol dehydratase; DHAB) and glycerol dehydratase reactivase from Lactobacillus brevis is transformed to be expressed; Transformed to express an enzyme that converts 3-hydroxypropionaldehyde to 3-hydroxypropionic acid; Provided is a method for producing 3-hydroxypropionic acid from glycerol, wherein the recombinant E. coli is cultured in a medium sufficient to which glycerol is added and glucose is not depleted during culture.

Hereinafter, the content of the present invention will be described in more detail below.

In the present invention, glycerol dehydratase (DHAB) to convert glycerol to 3-hydroxypropionaldehyde (3-HPA), glycerol dehydratase Li to reactivate the inactivated glycerol dehydratase E. coli is transformed to express activase (glycerol dehydratase reactivase) and an enzyme that converts 3-hydroxypropionaldehyde to 3-hydroxypropionic acid, and the method of transformation can be carried out through known methods known in the genetic engineering field. have.

Glycerol dehydratase is an enzyme that converts glycerol to 3-hydroxypropionaldehyde, and in the present invention, Lactobacillus brevis ( Lactobacillus) brevis ) is used. Glycerol dehydratase is B ₁₂ -dependent and requires B ₁₂ for the reaction.

Coenzyme B ₁₂ -dependent dehydratase consists of three subunits: a large or "α" subunit, a medium or "β" subunit and a small or "γ" subunit. These subunits assemble into α ₂ β ₂ γ ₂ structures to form apoenzymes.

On the other hand, coenzyme B ₁₂ is necessary for catalytic activity because it is involved in the radical mechanism causing the catalytic reaction, coenzyme B ₁₂ binds to the main enzyme to form a catalytically active enzyme (holoenzyme). Biochemically, it is known that coenzyme B ₁₂ -dependent glycerol dehydratase undergoes inactivation by glycerol (Daniel et al., Supra); Seifert, et al., Eur. J. Biochem 268: 2369-2378 (2001)].

Inactivation of glycerol dehydratase involves the step of cleaving cobalt-carbon (Co-C) bonds of the coenzyme B ₁₂ cofactor to form 5'-deoxyadenosine and inert cobalamin species, the inactive cobalamin species being dehydra It remains tightly bound to the other agent and does not separate without the intervention of the dehydratase reactivation factor. Reactivation is a fairly important consideration because inactivation significantly reduces the rate of reaction associated with 3-HPA formation, and thus involves the problem of indirectly reducing the production of 3-HP.

On the other hand, reactivation of dehydratase activity can be solved in two aspects.

In a first approach, reactivation of dehydratase activity can be overcome by the protein responsible for it. Reactivation occurs in multiple stages, where the inactivated coenzyme B ₁₂ -dependent dehydratase and dehydratase reactivation factor can interact in an ATP-dependent process, releasing tightly bound inert cobalamin species to produce a principal enzyme. It is. Dehydratase main enzymes can then bind to coenzyme B ₁₂ to regenerate catalytically active enzymes and inactive cobalamin species can be regenerated to coenzyme B ₁₂ in a separate ATP-dependent process by enzymatic action.

Dehydratase reactivation factors are described in WO 98/21341 (US 6,013,494), Daniel et al., Supra, Toraya and Mori, J. Biol. Chem. 274: 3372 (1999) and Tobimatsu et al., J. Bacteriol. 181: 4110 (1999).

However, since both dehydratase reactivation and coenzyme B ₁₂ regeneration process require ATP, the conversion of glycerol to 3-HPA is a significant energy burden.

Thus, as a second approach to reactivation of dehydratase activity, microorganisms may be increased by increasing the amount of coenzyme B ₁₂ added to the medium or supplementing the culture medium with vitamin B ₁₂ (converted to coenzyme B ₁₂ in vivo). Additional coenzyme B ₁₂ may be considered.

On the other hand, the recombinant E. coli of the present invention is transformed to express an enzyme that converts 3-hydroxypropionaldehyde to 3-hydroxypropionic acid, 3-HPA produced by glycerol dehydratase 3- Switch to HP.

According to the preliminary experiments of the present invention, when only glycerol dehydratase and glycerol dehydratase reactivase were expressed, 3-HPA was produced smoothly, but 3-HPA produced was not smoothly converted to 3-HP. I could confirm it.

However, according to the present experiment, when co-expressing an enzyme (for example, aldehyde dehydrogenase) which converts 3-hydroxypropionaldehyde to 3-hydroxypropionic acid, and adding glucose to the medium, 3- It can be seen that HPA is significantly converted to 3-HP. However, even if co-expression of an enzyme that converts 3-hydroxypropionaldehyde to 3-hydroxypropionic acid (eg, aldehyde dehydrogenase), 3-HP is not produced if there is no excess glucose supply. It was confirmed from Example 2 of the invention.

[Reference Figure 2]

According to the reference figure 2, in order to convert 3-HPA produced from glycerol to 3-HP, an enzyme for converting 3-hydroxypropionaldehyde to 3-hydroxypropionic acid is required, and NAD ⁺ is required as a cofactor. It can be seen. At this time, if the cofactor is not properly supplied, only 3-HPA is accumulated, it is not converted to 3-HP.

However, when glucose is supplied sufficiently to prevent depletion of the medium as in the present invention, the NAD ⁺ is produced through the route, it is used in the production of NAD ⁺ is produced from 3-HP, 3-HPA is 3- It was confirmed that the transition to HP is rapid.

Therefore, when culturing Escherichia coli, glucose is not specifically added in the medium, but as in the present invention, in the process of producing 3-HP from glycerol, glucose must be added in the medium, especially glucose throughout fermentation. This should be added to avoid exhaustion.

If the culture method is batch culture, it is better to add glucose to the medium when glucose is consumed so that glucose is not depleted during the culture, and the oil price which continuously supplies glycerol and glucose when the culture method is a fed-batch culture. It is better to carry out a diet.

As described above, the present invention is a glycerol dehydratase (DHAB) derived from Lactobacillus brevis (glycerol dehydratase; DHAB), glycerol dehydratase reactivase derived from Lactobacillus brevis (glycerol dehydratase reactivase) and 3-hydroxypropion Efficient production of 3-hydroxypropionic acid from glycerol can be achieved by using recombinant E. coli transformed to express an enzyme that converts aldehyde to 3-hydroxypropionic acid and feeding glucose to the medium for regeneration of NAD ⁺ . Can be.

Hereinafter, the present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited only to the following examples.

Example  1: Preparation of Recombinant E. Coli

Lactobacillus brevis ) After cloning of glycerol dehydratase from ATCC 367, start codons TTG and GTG of open reading frames encoding DHAB1 and DHAB2 in the subunits DHAB1, DHAB2 and DHAB3 constituting the same were site-directed mutagenesis. the through -directed mutagenesis) each substituted by ATG, and introduced into the pET29b (+) vector (Novagen sale) was constructed pET29- dha B (pELD) vector (reference to Fig. 4 and see required).

[Reference Figure 3]

[Reference Figure 4]

Cloning of glycerol dehydratase and site-directed mutagenesis were performed through overlap extension PCR. PCR was performed using oligonucleotides described in Table 1 below as primers.

Usage name Oligonucleotides
dha B mutation and amplification
LBF1bX (Xba Ⅰ ) 5'-GC TCTAGA TAAAGGGGGATTTTTAA A TG LbR (BamH Ⅰ ) 5'-CG GGATCC CTAGTTATCACCCTTCAG LbOF 5'-GTTAACACT A TGGCTCAAGAA LbOR 5'-TTCTTGAGCCA T AGTGTTAAC

First, two DNA fragments were amplified by performing the first PCR using a combination of two primers, LbF1bX-LbOR and LbOF-LbR. Then, a second PCR was performed using these two DNA fragments. At this time, it was performed without adding a separate primer, but even if the two DNA fragments have a sequence overlapping with each other, there is no problem in PCR, and a second PCR product was obtained as a result of PCR.

Thereafter, the second PCR product was used as a template to perform a third PCR by adding primers of LbF1bX and LbR to finally obtain a modeled DNA fragment at the bottom of Reference Figure 5, and then introduced into the pET29b (+) vector to obtain pET29 - it was built dha B (pELD) vector.

On the other hand, after cloning a glycerol hydratase Li aektiba claim (glycerol dehydratase reactivase) having from Lactobacillus brevis ATCC 367, was introduced into the pELD vector was constructed pELD- dha R (pELDRR) vector. Subsequently, the recombinant E. coli was prepared by introducing the above-described pELDRR vector into the E. coli BL21 star (DE3) strain (Invitrogen) and transforming it (refer to FIGS. 5 and 6 below).

[Reference Figure 5]

[Reference Figure 6]

Primers used in the above process were as described in Table 2 below.

Usage name Oligonucleotides Remarks
dha R amplification
LbReF ( Bam HⅠ) 5'-CG GGATCC TTAGGAGTCTTCGTATGCAA Forward LbReR1 ( Sal I) 5'-ACGC GTCGAC GCCGGCTTATCCATTGTG Reverse LbReR2 ( Not Ⅰ) 5'-ATAAGAAT GCGGCCGC CCACCTAATCTAATGTCTTAA Reverse

On the other hand, E. coli (E. coli) pCDF1b- ald H ( pCEa) containing the kinase through to the aldehyde dehydrogenase cloned from the K12 vector (Raj SM, C Rathnasingh, JE Jo, Park SH. 2008. Production of 3-hydroxypropionic acid from glycerol by a novel recombinant Escherichia coli BL21 strain.Process Biochemistry 43 (12): 1440 to 1446) was constructed, followed by additional transformation of the recombinant E. coli transformed in Example 1, thereby finally in Example 1 Recombinant Escherichia coli was prepared (see FIG. 7).

[Reference Figure 7]

Example  2: above Example  Of recombinant E. coli prepared in 1 Batch  culture

Batch culture was performed using the recombinant Escherichia coli prepared in Example 1.

Cultivation was performed in a 500 mL flask at a volume of 100 mL. LB medium was used as the medium, and expression induction of the introduced enzyme was performed when the concentration of the cells became 0.183 g / L. After induction, 20 μM of coenzyme B ₁₂ and glycerol were supplemented in the medium.

Cultivation was initially performed at 37 ° C., followed by induction, followed by culturing while varying the temperature to 20 ° C. (FIG. 1) and 25 ° C. (FIG. 2), respectively. On the other hand, the light was blocked at the time of incubation to prevent degradation of B ₁₂ .

Culture results were the same as in Figures 1 and 2, as shown in Figure 1, the production of 3-HPA was confirmed, but the production of 3-HP was not confirmed. On the other hand, the production of 3-HPA was higher when cultured at 20 ℃ than incubated at 25 ℃.

Example  3: the above under excessive glucose supply environment Example  Manufactured in 1 Manufacturing Sum of coliform Batch  culture

In Example 2, production of 3-HP was not confirmed, and the reason was predicted to be due to insufficient supply of NAD ⁺ required for the conversion from 3-HPA to 3-HP.

In order to convert 3-HPA produced from glycerol to 3-HP, an enzyme for converting 3-HPA to 3-HP is required, and NAD ⁺ is required as a cofactor. Only HPA will accumulate and not convert to 3-HP.

In this example, the fermentation strategy was established to supply enough glucose so as not to be depleted in the medium, so that NAD ⁺ is produced through the corresponding pathway of glucose, and the produced NAD ⁺ is used for the production of 3-HP.

As a result, as confirmed in FIGS. 3 (20 ° C.) and 4 (25 ° C.), it was confirmed that 3-HPA was rapidly converted to 3-HP under an environment in which excess glucose was sufficiently supplied in the medium. However, it could be confirmed that much more 3-HP was produced at 25 ° C.

On the other hand, in this Example, the culture was carried out in the same manner as in Example 2, except that the medium was used Reesenberg medium (Riesenberg medium) added with 18 g / L of glucose.

Example  4: above Example  Of recombinant E. coli prepared in 1 Oil price  culture

The fed-batch culture was performed using the recombinant Escherichia coli prepared in Example 1.

Cultivation was carried out in a 1.0 L volume in a 2.5 L jar fermenter. Medium was used as Riesenberg medium of pH 6.8, the expression induction of the introduced enzyme was carried out when the concentration of the cells was 35 g / L. After induction, 20 μM of coenzyme was supplemented in the medium.

Air was incubated at a rate of 1 vvm, stirring was performed at 12,000 ~ 13,000 rpm, the culture temperature was 25 ℃.

The culture was carried out in a fed-batch culture of pH-stat method, the pH was adjusted to 6.8 using 28% ammonia water.

On the other hand, the feeding solution (feeding solution) was prepared by using two types of type A and B, the type A feeding solution is a mixture of 800 g / L glucose and 20 g / L MgSO ₄ · 7H ₂ O Solution, type B feeding solution, a mixture of 400 g / L glucose, 400 g / L glycerol and 20 g / L MgSO ₄ .7H ₂ O.

On the other hand, the light was blocked at the time of incubation to prevent degradation of B ₁₂ .

The culture results were the same as in FIG. 5, as shown in FIG. 5, 3-HP production of about 15 g / L was confirmed.

1 is incubated at 20 ℃ in LB medium using the recombinant E. coli prepared in Example 1 of the present invention.

Figure 2 is incubated at 25 ℃ in LB medium using the recombinant E. coli prepared in Example 1 of the present invention.

FIG. 3 is incubated at 20 ° C. in Reesenberg medium with 18 g / L of glucose using the recombinant Escherichia coli prepared in Example 1 of the present invention.

4 is incubated at 25 ° C. in Reesenberg medium with 18 g / L of glucose using the recombinant E. coli prepared in Example 1 of the present invention.

Figure 5 is a fed-batch culture while continuously supplying glucose at 25 ℃ using the recombinant E. coli prepared in Example 1 of the present invention.

Claims (5)

Glycerol 3-hydroxy-propionic acid 3-hydroxy-propionaldehyde (3-hydroxypropionaldehyde; 3-HPA ) which is the precursor of (3-hydroxypropionic acid) in order to switch to, Lactobacillus brevis (Lactobacillus glycerol dehydratase from Lactobacillus brevis derived from the start codons TTG and GTG of the open reading frame encoding DHAB1 and DHAB2 in the subunits DHAB1, DHAB2 and DHAB3 constituting the glycerol dehydratase derived from brevis ), respectively. (glycerol dehydratase; DHAB) and glycerol dehydratase reactivase from Lactobacillus brevis is transformed to be expressed; Transformed to express an enzyme that converts 3-hydroxypropionaldehyde to 3-hydroxypropionic acid; A method for producing 3-hydroxypropionic acid from glycerol, wherein the recombinant E. coli is cultured in a medium that is sufficiently present to which glycerol is added and glucose is not depleted during the culture. The method of claim 1, The badge, Process for producing 3-hydroxypropionic acid from glycerol characterized in that coenzyme B ₁₂ is added The method of claim 1, The culture, Method for producing 3-hydroxypropionic acid from glycerol, characterized in that additional glucose is added to the medium when glucose is consumed so that glucose is not depleted during the culture as a batch culture. The method of claim 1, The culture, Method for producing 3-hydroxypropionic acid from glycerol, characterized in that the fed-batch culture of continuous supply of glycerol and glucose The method of claim 1, The enzyme for converting the 3-hydroxypropionaldehyde to 3-hydroxypropionic acid, Method for producing 3-hydroxypropionic acid from glycerol, characterized in that it is an aldehyde dehydrogenase

Images