KR20110007981A - New alcohol dehydrogenase hpadh1 and a method for preparing bioethanol using it - Google Patents

New alcohol dehydrogenase hpadh1 and a method for preparing bioethanol using it Download PDF

Info

Publication number
KR20110007981A
KR20110007981A KR1020100069048A KR20100069048A KR20110007981A KR 20110007981 A KR20110007981 A KR 20110007981A KR 1020100069048 A KR1020100069048 A KR 1020100069048A KR 20100069048 A KR20100069048 A KR 20100069048A KR 20110007981 A KR20110007981 A KR 20110007981A
Authority
KR
South Korea
Prior art keywords
polynucleotide
ethanol
hpadh1
seq
genus
Prior art date
Application number
KR1020100069048A
Other languages
Korean (ko)
Other versions
KR101240507B1 (en
Inventor
권오석
수완나랑시 수리사
오두병
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of KR20110007981A publication Critical patent/KR20110007981A/en
Application granted granted Critical
Publication of KR101240507B1 publication Critical patent/KR101240507B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01001—Alcohol dehydrogenase (1.1.1.1)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

PURPOSE: A novel ethanol dehydrogenase and a method for producing bioethanol using the same are provided to ensure high yield of bioethanol. CONSTITUTION: A polypeptide with alcohol dehydrogenase activity comprise: a polypeptide having an amino acid sequence of sequence number 1; a polypeptide having 90% of more of homology with the amino acid sequence; a polypeptide encoded by a polynucleotide sequence of sequence number 2; and a step of polypeptide encoded by a polypeptide hybridized with the polynucleotide of sequence number 2. A method for producing ethanol comprises: a step of transforming a host cell with a vector containing HpADH1 polynucleotide; a step of culturing the transformant in a medium containing carbon source; and a step of collecting ethanol. The host cell is Hansenula polymorpha yeast.

Description

신규 알콜 탈수소효소 ＨｐＡＤＨ１ 및 이를 이용한 바이오에탄올의 제조 방법{New alcohol dehydrogenase HpADH1 and a method for preparing bioethanol using it}New alcohol dehydrogenase HpADH1 and a method for preparing bioethanol using it}

본 발명은 신규 에탄올 탈수소효소 및 이를 이용한 바이오에탄올의 생산방법에 관한 것이다.The present invention relates to a novel ethanol dehydrogenase and a method for producing bioethanol using the same.

현재 바이오연료에 대한 연구가 전세계적으로 활발하게 이루어지고 있으며, 바이오연료들 중 대표적인 것이 바이오에탄올 및 바이오디젤이다.　Currently, research on biofuels is being actively conducted worldwide, and representative examples of biofuels are bioethanol and biodiesel.

브라질, 미국, 서유럽, 일본 등에서는 공업용 알콜의 90% 이상이 곡물 발효로 제조되는 반면, 국내에서는 전량이 합성알콜이다. In Brazil, the United States, Western Europe, Japan, etc., more than 90% of industrial alcohol is produced by grain fermentation, while in Korea, all of them are synthetic alcohols.

현재 바이오에탄올 생산에 사용되는 원료, 즉 바이오매스는 대부분이 곡류 유래의 전분이나 열대작물에서 얻어지는 당류이다. 미국의 경우는 대부분이 옥수수 전분의 가수분해 시 얻어지는 포도당을 원료로 하여 바이오에탄올을 생산하고 있고 브라질의 경우에는 사탕수수에서 얻어지는 설탕을 원료로 하여 바이오에탄올을 생산하고 있다. 하지만 사람이 식량으로 먹을 수 있는 농작물을 에너지원으로 쓰는 것은, 아직도 상당수의 인류가 식량난으로 허덕이고 있는 시점에서 비판을 받고 있을 뿐만 아니라 현재 기술로는 인류가 필요로 하는 양만큼의 에탄올을 공급하기에 기술이 충분히 발전하지 못한 문제점이 있다. The raw materials used in bioethanol production, ie, biomass, are mostly sugars obtained from starch or tropical crops derived from cereals. In the United States, most of them produce bioethanol using glucose obtained from hydrolysis of corn starch, and in Brazil, bioethanol is produced using sugar obtained from sugar cane. But the use of crops for human consumption as energy sources is not only criticized at the time when a large number of humans are suffering from food shortages, but current technology can provide the amount of ethanol that humanity needs. There is a problem that the technology is not sufficiently developed.

현재, 연료 에탄올은 사카로마이세스 세레비지애 (Saccharomyces cerevisiae) 또는 자이모모나스 모빌리스 (Zymomonas mobilis) (제트. 모빌리스 (Z. mobilis))를 이용하여 옥수수 전분 또는 등나무 시럽으로부터 생산한다. 그러나, 상기 당 공급원 둘 다는 석유계 자동차 연료의 대체를 실현하는 데 필요한 양을 공급하지 못하며, 현재까지 발효 속도 수율, 에탄올 내성 측면에서 만족할 만한 수준에 도달하지는 못한 실정이다. Currently, fuel ethanol is either Saccharomyces cerevisiae or Zymomonas mobilis ( Zymomonas). mobilis ) ( Z. mobilis ) to produce from corn starch or rattan syrup. However, both of these sugar sources do not supply the amounts necessary to realize the replacement of petroleum-based automotive fuels and have not reached satisfactory levels in terms of fermentation rate yield and ethanol resistance to date.

자일로스 발효능이 없는 Z. mobilis에 대사공학적으로 자일로스 발효 경로를 도입하여 포도당과 자일로스를 모두 발효하여 에탄올을 생산하는 재조합 균주의 개발이 미국의 NREL(National Renewable Energy Laboratory)의 연구진에서 의해 시도되었으나, 재조합 Z. mobilis가 당가수분해를 위한 전처리 과정에서 상당량 발생하는 아세트산(acetic acid)에 대한 저항성이 매우 약하다는 치명적인 단점을 지니고 있어 상용화되지 못하고 있다.
The development of a recombinant strain that ferments both glucose and xylose to produce ethanol by metabolically introducing the xylose fermentation pathway into Z. mobilis , which has no xylose fermentation capacity, was carried out by researchers at the National Renewable Energy Laboratory (NREL) in the United States. Although attempted, the recombinant Z. mobilis has a fatal disadvantage that the resistance to acetic acid generated in the pretreatment process for sugar hydrolysis is very weak and is not commercialized.

S. cerevisiae는 전분 및 당류 유래 자원을 이용한 바이오에탄올 생산에 이용되어 상업적인 가능성을 검증받은 균주이나, 하지만, S. cerevisiae는 자일로스를 발효하지 못하는 약점을 지니고 있다. S. cerevisiae가 자일로스를 발효하지 못하지만, 그 이성체인 자일룰로스(xylulose)를 발효하여 에탄올을 생산할 수 있다는 사실에 근거하여 자일로스를 자일룰로스로 전환시키는 효소인 자일로스 이성질화 효소(xylose isomerase)를 도입하여 자일로스를 발효하려는 많은 연구가 이루어졌지만, 세균 유래의 자일로스 이성질화 효소가 S. cerevisiae에서 활성발현이 되지 않으므로 성공하지 못하였다. 또 다른 접근방법으로 자일로스를 자일룰로스로 전환시키는 효소인 자일로스 환원효소(xylose reductase, XR), 자일리톨탈수소효소(xylitoldehydrogenase, XDH) 및 자일룰로키나제(xylulokinase, XK)의 유전자들(XYL1, XYL2 및 XYL3)을 S. cerevisiae에 도입하는 연구가 이루어졌으나 그 속도가 포도당에 비해서 매우 느리고 다량의 자일리톨(xylitol)이 부산물로 생산됨으로 인하여 에탄올 수율이 현저히 낮아 바이오에탄올 생산에 이용되기는 어렵다.
S. cerevisiae is a commercially validated strain that has been used to produce bioethanol using starch and sugar-derived resources. However, S. cerevisiae has a weak point of failing to ferment xylose. Xylose, an enzyme that converts xylose to xylose based on the fact that S. cerevisiae cannot ferment xylose, but can ferment its isomer xylulose to produce ethanol Many studies have been conducted to ferment xylose by introducing isomerase, but it has not been successful because xylose isomerase derived from bacteria is not active in S. cerevisiae . Another approach is the genes of xylose reductase (XR), xylitoldehydrogenase (XDH) and xylulokinase (XK), enzymes that convert xylose to xylulose. Although XYL2 and XYL3) were introduced into S. cerevisiae , its rate is very slow compared to glucose, and because of the large amount of xylitol produced as a by-product, the yield of ethanol is significantly low, making it difficult to use for bioethanol production.

그 외, 야생형 E. coli을 이용하려는 시도가 있었는데, 이는 소량의 에탄올을 생산하고 다량의 유기산을 생성하는 문제점이 있다. 따라서 유전자 재조합 기법을 이용하여 대장균의 유기산 생성 대사 경로를 제거하고 에탄올 생성 경로의 활성화가 시도되었으나, E. coli의 특성상 발효조 내에 생산되는 에탄올에 저항성을 가지지 못하기 때문에 고농도 에탄올 생산공정(>60 g/L)의 구현이 어렵다는 단점과 재조합 대장균의 생육이 전처리 후에 생성되는 알데하이드(aldehyde) 및 유기산(organic acid)과 같은 억제(inhibitory) 물질에 매우 민감하다는 단점이 있다.
In addition, there has been an attempt to use wild type E. coli , which has a problem of producing a small amount of ethanol and a large amount of organic acid. Therefore, by using genetic recombination techniques, the organic acid production metabolism pathway of E. coli was removed and the ethanol production pathway was activated. However, due to the characteristics of E. coli , it is not resistant to ethanol produced in fermenter. / L) is difficult to implement, and the growth of recombinant E. coli is very sensitive to inhibitors (inhibitory) such as aldehyde (aldehyde) and organic acid (organic acid) produced after the pretreatment.

본 발명자들은 1) 바이오매스의 가수분해 과정에서 생산되는 미생물 생육 저해 물질에 저항성을 가지며, 2) 에탄올 수율의 향상을 위하여 부산물이 최소로 생산되며 3) 에탄올을 특이적으로 생산하고 4) 생성된 에탄올에 의하여 생육 및 발효 저해를 받지 않고 5) 육탄당 뿐만 아니라 오탄당인 자일로스 등을 발효할 수 있으며 6) 40℃ 이상의 고온에서 발효가 가능하며, 7) 대량생산 공정이 가능한 균주를 찾던 중 메탄올 자화효모인 H. polymorpha가 40℃ 이상의 고온에서 발효가 가능하며, 자일로스 발효능이 있고, 각종 독성물질에 대한 내성이 강한 특성을 갖고 있음을 주지하여 전체 유전체 서열을 해독하였다. 나아가 한세눌라의 유전체 서열을 바탕으로 에탄올 발효에 관련된 유전자를 탐색하던 전통효모 S. cerevisiae의 알코올 탈수소 효소 ADH1 단백질과 유사한 아미노산 서열을 갖는 단백질을 코딩하는 유전자 HpADH1의 존재를 확인하였다. 이 유전자를 과발현하여 그 생화학적 효소반응 특성을 규명하고, 한세눌라 폴리모파의 유전체로부터 해당 유전자를 결실하거나 과발현하여 그 생리학적 기능을 검증하였으며 나아가 과발현 균주의 에탄올 발효 수율이 현격하게 향상됨을 확인함으로써 본 발명을 완성하였다.
The present inventors 1) resistant to microbial growth inhibitory substances produced during the hydrolysis of biomass, 2) minimal by-products are produced to improve ethanol yield, 3) ethanol specific production and 4) produced 5) It is possible to ferment not only hexadecimal sugar but also pentose xylose without being inhibited by ethanol growth and fermentation. 6) It is possible to ferment at high temperature above 40 ℃. H. polymorpha , a magnetized yeast, was able to ferment at a high temperature of 40 ° C or higher, has a characteristic of being capable of fermenting xylose, and having strong resistance to various toxic substances. Furthermore, the presence of the gene HpADH1 encoding a protein having an amino acid sequence similar to that of the alcohol dehydrogenase ADH1 protein of traditional yeast S. cerevisiae , which was searching for a gene related to ethanol fermentation, based on the genome sequence of Hansenula. By overexpressing this gene, we identified its biochemical enzymatic reaction characteristics, and confirmed its physiological function by deleting or overexpressing the gene from the genome of Hanshenula polymorpha, and further confirming that the ethanol fermentation yield of the overexpressing strain is significantly improved. The present invention has been completed.

본 발명의 목적은 신규한 에탄올 탈수소효소를 제공하는 것이다. It is an object of the present invention to provide a novel ethanol dehydrogenase.

본 발명의 목적은 상기 신규한 에탄올 탈수소효소를 코드하는 폴리뉴클레오티드, 상기 신규한 에탄올 탈수소효소의 유전자를 구성하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드들 중 어느 하나와 엄격한 조건 하에서 혼성화하며 에탄올 탈수소효소 활성을 갖는 단백질을 코드하는 폴리뉴클레오티드를 제공한다. SUMMARY OF THE INVENTION An object of the present invention is to hybridize under strict conditions with any one of the polynucleotides encoding the novel ethanol dehydrogenase, the polynucleotide constituting the gene of the novel ethanol dehydrogenase, and the polynucleotides, thereby enhancing ethanol dehydrogenase activity. Provided is a polynucleotide encoding a protein having.

본 발명의 목적은 또한 상기 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다. It is also an object of the present invention to provide a vector comprising said polynucleotide.

본 발명의 목적은 상기 폴리뉴클레오티드를 포함하는 벡터로 숙주세포를 형질전환한 형질전환체를 제공하는 것이다. An object of the present invention is to provide a transformant transformed into a host cell with a vector containing the polynucleotide.

본 발명의 목적은 1) 상기 폴리뉴클레오티드를 포함하는 벡터로 숙주세포를 형질전환시켜 형질전환체를 제조하는 단계; 2) 단계 1)의 형질전환체를 탄소원을 포함하는 배지에서 배양하는 단계; 및 3) 단계 2)의 배지로부터 에탄올을 회수하는 단계를 포함하는 에탄올의 제조 방법을 제공하는 것이다.
An object of the present invention is to prepare a transformant by transforming a host cell with a vector comprising the polynucleotide; 2) culturing the transformant of step 1) in a medium containing a carbon source; And 3) to provide a method for producing ethanol comprising the step of recovering ethanol from the medium of step 2).

상기 목적을 달성하기 위하여, 본 발명은 알코올 탈수소효소 활성을 갖는, 하기 (ⅰ) 내지 (ⅳ) 중 어느 하나의 폴리펩티드: In order to achieve the above object, the present invention has a polypeptide of any one of (i) to (iii) having an alcohol dehydrogenase activity:

(ⅰ) 서열번호 1로 구성되는 폴리펩티드; (Iii) a polypeptide consisting of SEQ ID NO: 1;

(ⅱ) 서열번호 1로 구성되는 아미노산 서열과 90% 이상의 상동성을 갖는 폴리펩티드; (Ii) a polypeptide having at least 90% homology with the amino acid sequence consisting of SEQ ID NO: 1;

(ⅲ) 서열번호 2로 구성되는 폴리뉴클레오티드 서열에 의하여 코드되는 폴리펩티드; 및 (Iii) a polypeptide encoded by a polynucleotide sequence consisting of SEQ ID NO: 2; And

(ⅳ) 서열번호 2로 구성되는 폴리뉴클레오티드와 엄격한 조건 하에서 혼성화하는 폴리뉴클레오티드에 의하여 코드되는 폴리펩티드를 제공한다. (Iii) Provides a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of SEQ ID NO: 2.

상기 목적을 달성하기 위하여, 본 발명은 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드, 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드를 제공한다. In order to achieve the above object, the present invention provides a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1, a polynucleotide consisting of the DNA sequence of SEQ ID NO: 2.

또한 본 발명은 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드 또는 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드와 엄격한 조건 하에서 혼성화되며, 알콜 탈수소효소, 바람직하게는 에탄올 탈수소효소 활성을 갖는 단백질을 코드하는 것을 특징으로 하는 폴리뉴클레오티드를 제공한다. The present invention also hybridizes under strict conditions with a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1 or a polynucleotide consisting of the DNA sequence of SEQ ID NO: 2, and codes for a protein having alcohol dehydrogenase, preferably ethanol dehydrogenase activity. It provides a polynucleotide characterized in that.

아울러 본 발명은 상기 목적을 달성하기 위하여 상기 폴리뉴클레오티드를 포함하는 벡터를 제공한다. In addition, the present invention provides a vector comprising the polynucleotide to achieve the above object.

또한 본 발명은 상기 벡터로 숙주세포를 형질전환한 형질전환체를 제공한다. In another aspect, the present invention provides a transformant transformed host cells with the vector.

또한 본 발명은 상기 벡터로 숙주세포를 형질전환시켜 형질전환체를 제조하는 단계; 2) 단계 1)의 형질전환체를 상기 탄소원을 포함하는 배지에서 배양하는 단계; 및 3) 단계 2)의 배지로부터 에탄올을 회수하는 단계를 포함하는 에탄올의 제조 방법을 제공한다.
In another aspect, the present invention comprises the steps of preparing a transformant by transforming the host cell with the vector; 2) culturing the transformant of step 1) in a medium containing the carbon source; And 3) recovering ethanol from the medium of step 2).

H. polymorpha은 오랫동안 에탄올 생산의 표적 미생물로 주목받아 왔으나, 아직까지 H. polymorpha 유래의 ADH에 대한 유전학적 또는 생리학적 특성은 보고된 바 없다. 본 발명자들은 샷건 방식과 포스미드클론 말단 시퀀싱을 이용하여 H. polymorpha DL1균주의 전체 게놈을 확인하였다. S. cerevisiae ADH1(ScADH1)의 아미노산 서열을 이용하여, H. polymorpha 게놈 서열상에서 ScADH1과 74.8%의 아미노산 서열 상동성(identity)을 갖는 폴리펩티드를 코딩할 수 있는 유전자를 확인하였다. H. polymorpha is wateuna take long to notice signs of microbial ethanol production still from H. polymorpha Genetic or physiological properties of the derived ADH have not been reported. We have identified the entire genome of the H. polymorpha DL1 strain using shotgun method and phosmidclonal sequencing. H. polymorpha using the amino acid sequence of S. cerevisiae ADH1 (Sc ADH1 ) A gene capable of encoding a polypeptide having an amino acid sequence identity of 74.8% with ScADH1 on the genomic sequence was identified.

효모의 알콜 탈수소효소(yeast alcohol dehydrogenase)(이하, ADH라 한다)는 NADH 또는 NADPH의 환원 및 그 역반응에 수반하여 알데하이드의 에탄올로의 환원을 촉매화하는 산화환원효소(oxidoreductase)이다. ADH 유전자의 서열은 몇몇 효모에서 잘 보전되어 있으나, 유전자의 수, 생리학적 작용 및 조절은 서로 다르다. 현재까지 ADH를 코드하는 유전자들은 S. cerevisiae 및 P. stipitis의 경우 각각 7 종류(ADH1 내지 ADH7) 이상이 Genbank에 제출된 반면,　K. lactis의 경우 4 종류의 유전자들(ADH1 내지 ADH4)이 제출되었다. Yeast alcohol dehydrogenase (hereinafter referred to as ADH) is an oxidoreductase that catalyzes the reduction of aldehyde to ethanol following the reduction of NADH or NADPH and its reverse reaction. The sequence of the ADH gene is well preserved in some yeasts, but the number, physiological action and regulation of the genes are different. To date, genes encoding ADH have been submitted to Genbank in the case of S. cerevisiae and P. stipitis , respectively, ( ADH1 to ADH7 ), whereas for K. lactis , four genes ( ADH1 to ADH4 ) have been submitted. It became.

현재까지 H. polymorpha 유래 ADH의 유전적 또는 생리학적 특성이 보고된 바는 없으나, H. polymorpha의 ADH 시스템을 이해하는 것은 단순히 상기 유전자에 대한 기초적인 정보를 제공하는 것뿐만 아니라 상기 균주에서 에탄올 발효를 증가시킬 수 있는 기회를 제공하는 것이기도 하다. To date, no genetic or physiological properties of H. polymorpha- derived ADH have been reported, but understanding H. polymorpha 's ADH system not only provides basic information about the gene, but also ethanol fermentation in the strain. It also provides an opportunity to increase.

본 발명자들은 H. polymorpha의 ADH1 유전자를 분리하고, 그 아미노산 서열을 분석하였으며(서열번호 1), 상기 단백질이 에탄올 탈수소효소 활성을 가지는 것을 확인하였다.
The present inventors isolated the H. polymorpha ADH1 gene, analyzed its amino acid sequence (SEQ ID NO: 1), and confirmed that the protein had ethanol dehydrogenase activity.

서열번호 1: SEQ ID NO 1:

mtsipktqka vvfetnggpl lykdipvpqp kpneilvnvk ysgvchtdlh awkgdwpldt klplvggheg agvvvakgan vtnfeigdya gikwlngscm gcefcqqgae pncpeadlsg ythdgsfqqy atadavqaak ipkgtnladv apilcagvtv ykalktaels pgqwvaisga ggglgslavq yavamglrvl gidggdekak lfeslggevf idftkekdiv gavqkatngg phgvinvsvs paaisqscqy vrtlgkvvlv glpagavces pvfehviksi qirgsyvgnr qdtaesidff rgkvkapik vglselpkv felmeqgkia gryvldtsk
mtsipktqka vvfetnggpl lykdipvpqp kpneilvnvk ysgvchtdlh awkgdwpldt klplvggheg agvvvakgan vtnfeigdya gikwlngscm gcefcqqgae pncpeadlsg ythdgsfqqy atadavqaak ipkgtnladv apilcagvtv ykalktaels pgqwvaisga ggglgslavq yavamglrvl gidggdekak lfeslggevf idftkekdiv gavqkatngg phgvinvsvs paaisqscqy vrtlgkvvlv glpagavces pvfehviksi qirgsyvgnr qdtaesidff rgkvkapik vglselpkv felmeqgkia gryvldtsk

본 발명은 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드, 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드를 제공한다. 또한 본 발명은 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드 또는 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드와 엄격한 조건 하에서 혼성화되며, 에탄올 탈수소효소 활성을 갖는 단백질을 코드하는 것을 특징으로 하는 폴리뉴클레오티드를 제공한다. The present invention provides a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1, a polynucleotide consisting of the DNA sequence of SEQ ID NO: 2. The present invention also hybridizes under strict conditions with a polynucleotide encoding an amino acid sequence of SEQ ID NO: 1 or a polynucleotide consisting of a DNA sequence of SEQ ID NO: 2, and a polynucleotide characterized by encoding a protein having ethanol dehydrogenase activity. To provide.

이때, "엄격한 혼성화 조건"이란, 예를 들면 65℃ 4x SSC에서 혼성화, 다음 65℃로 1시간, 0.1x SSC에서 세척을 의미한다. 다른 엄격한 조건은 50% 포름아미드 중 42℃ 4x SSC에서 혼성화이다. 또 다른 엄격한 조건은 PerfectHybTM(TOYOBO) 용액 중 65℃ 2.5시간 혼성화, 그 다음에 (1) 0.05% SDS를 포함하는 2 xSSC로 25℃ 5분, (2) 0.05% SDS를 포함하는 2 xSSC로 25℃ 15분 및 (3) 0.1% SDS를 포함하는 0.1 xSSC로 50℃ 20분의 세척이다. 이렇게 분리된 폴리뉴클레오티드는 아미노산 수준에서 서열 번호 2의 아미노산 서열과 높은 상동성을 가지거나, 에탄올 탈수소효소 활성을 갖는 단백질, 즉 폴리펩티드를 코드한다고 생각된다. In this context, "strict hybridization conditions" means, for example, hybridization at 65 ° C 4x SSC, followed by 1 hour at 65 ° C, washing at 0.1x SSC. Another stringent condition is hybridization at 42 ° C. 4 × SSC in 50% formamide. Another stringent condition is 65 ° C. 2.5 h hybridization in PerfectHyb ™ (TOYOBO) solution, followed by (1) 2 × SSC with 0.05% SDS at 25 ° C. 5 min, and (2) 2 × SSC with 0.05% SDS. Wash at 50 ° C. 20 minutes with 0.1 × SSC containing 25 ° C. 15 minutes and (3) 0.1% SDS. The polynucleotides thus separated are thought to encode proteins, ie polypeptides, having high homology with the amino acid sequence of SEQ ID NO: 2 at the amino acid level or having ethanol dehydrogenase activity.

본 명세서에서 "에탄올 탈수소효소 활성"이란 자일로스(xylose), 글루코스(glucose), 아라비노스, 만노스 및 갈락토스와 같은 당, 녹말(전분), 셀룰로스, 글리세롤 등과 같은 바이오매스로부터 에탄올을 생산하는 활성을 말한다. 그러나 상기 바이오매스가 이들에 제한되는 것은 아니다.
As used herein, "ethanol dehydrogenase activity" refers to the activity of producing ethanol from biomass such as sugars such as xylose, glucose, arabinose, mannose and galactose, starch (starch), cellulose, glycerol and the like. Say. However, the biomass is not limited thereto.

서열번호 2: SEQ ID NO 2:

atgacttccattccaaagactcaaaaggccgttgttttcgagaccaacggtggtcctcttctctacaaggacatccctgttccacaaccaaagccaaatgagattcttgtcaacgtcaagtactccggtgtttgccacaccgatctccacgcttggaagggtgactggccattggacaccaaacttccactggtcggtggtcacgagggtgctggtgttgttgttgctaagggtgccaacgttaccaactttgaaatcggtgactacgctggtatcaaatggttgaacggctcgtgcatgggttgtgagttctgtcaacaaggtgcagagccaaactgtcctgaggccgacctttccggttacacgcacgacggttctttccaacaatacgccactgctgatgctgtccaggctgccaagattccaaagggaactaacctggctgacgttgctccaattctctgtgctggtgtcactgtgtacaaggcattgaagactgccgaattgagcccaggccaatgggttgctatctctggtgctggtggaggattgggttctcttgccgttcaatacgctgtcgccatgggcctgagagtcctgggtatcgatggtggtgacgaaaaggctaagctcttcgagagcttgggcggagaagtcttcatcgatttcaccaaggaaaaggacattgtcggagccgtccagaaggcaaccaacggtggtccacacggtgttatcaacgtttctgtgtctccagcagctatctctcaatcctgccaatacgtgagaactcttggtaaggttgttcttgttggtcttccagccggtgctgtttgcgagtctccagttttcgagcacgttatcaagtctatccagattagaggttcctacgttggtaacagacaggacactgccgagtcgattgacttcttcgtcagaggcaaggttaaggctccaatcaaggttgttggcctttctgagctgccaaaggtgttcgagttgatggagcaaggaaagattgctggaagatacgttcttgacacttccaaatag
atgacttccattccaaagactcaaaaggccgttgttttcgagaccaacggtggtcctcttctctacaaggacatccctgttccacaaccaaagccaaatgagattcttgtcaacgtcaagtactccggtgtttgccacaccgatctccacgcttggaagggtgactggccattggacaccaaacttccactggtcggtggtcacgagggtgctggtgttgttgttgctaagggtgccaacgttaccaactttgaaatcggtgactacgctggtatcaaatggttgaacggctcgtgcatgggttgtgagttctgtcaacaaggtgcagagccaaactgtcctgaggccgacctttccggttacacgcacgacggttctttccaacaatacgccactgctgatgctgtccaggctgccaagattccaaagggaactaacctggctgacgttgctccaattctctgtgctggtgtcactgtgtacaaggcattgaagactgccgaattgagcccaggccaatgggttgctatctctggtgctggtggaggattgggttctcttgccgttcaatacgctgtcgccatgggcctgagagtcctgggtatcgatggtggtgacgaaaaggctaagctcttcgagagcttgggcggagaagtcttcatcgatttcaccaaggaaaaggacattgtcggagccgtccagaaggcaaccaacggtggtccacacggtgttatcaacgtttctgtgtctccagcagctatctctcaatcctgccaatacgtgagaactcttggtaaggttgttcttgttggtcttccagccggtgctgtttgcgagtctccagttttcgagcacgttatcaagtctatccagattagaggttcctacgttggtaacagacaggacactgccgagtcgattgacttcttcgtcagaggcaaggttaaggctccaatcaaggttgttggcctttctgagctgccaaaggtgttcgagttgatggagcaaggaaagattgctggaagatacgttcttgacacttccaaatag

또한 본 발명은 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드, 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드, 또는 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드 또는 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드와 엄격한 조건 하에서 혼성화되며, 에탄올 탈수소효소 활성을 갖는 단백질을 코드하는 것을 특징으로 하는 폴리뉴클레오티드를 포함하는 벡터를 제공한다. The present invention also comprises a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1, a polynucleotide consisting of the DNA sequence of SEQ ID NO: 2, or a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1 or a DNA sequence of SEQ ID NO: 2 Provided are vectors comprising polynucleotides that hybridize under polynucleotides with stringent conditions and that encode proteins having ethanol dehydrogenase activity.

이때, 벡터는 pESC 벡터, pESC-HIS 벡터, pESC-LEU 벡터, pESC-TRP 벡터, pESC-URA 벡터, Gateway pYES-DEST52 벡터, pAO815 벡터, pGAPZ A B & C 벡터, pGAPZAlpha A B & C 벡터, pPIC3.5K 벡터, pPIC6 A B & C 벡터, pPIC6Alpha A B & C 벡터, pPIC9K 벡터, pYC2/CT 벡터, pYD1 효모 발현 벡터, pYES2 벡터, pYES2/CT 벡터, pYES2/NT A B & C 벡터, pYES3/CT 벡터, p427-TEF 벡터, p417-CYC 벡터, pTEF-MF 벡터 및 pGAL-MF 벡터, pDLG, pDLMOX 로 구성되는 군으로부터 선택되는 것이 바람직하나 상기 폴리뉴클레오티드를 유전학적으로 안정하게 도입할 수 있는 것이라면 어느 것이든 무방하다.
At this time, the vector is a pESC vector, pESC-HIS vector, pESC-LEU vector, pESC-TRP vector, pESC-URA vector, Gateway pYES-DEST52 vector, pAO815 vector, pGAPZ AB & C vector, pGAPZAlpha AB & C vector, pPIC3. 5K vector, pPIC6 AB & C vector, pPIC6AlB AB & C vector, pPIC9K vector, pYC2 / CT vector, pYD1 yeast expression vector, pYES2 vector, pYES2 / CT vector, pYES2 / NT AB & C vector, pYES3 / CT vector, p427 Preferably, it is selected from the group consisting of -TEF vector, p417-CYC vector, pTEF-MF vector, and pGAL-MF vector, pDLG, pDLMOX, but any polynucleotide can be introduced genetically stably. Do.

또한 본 발명은 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드, 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드, 또는 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드 또는 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드와 엄격한 조건 하에서 혼성화되며, 에탄올 탈수소효소 활성을 갖는 단백질을 코드하는 것을 특징으로 하는 폴리뉴클레오티드를 포함하는 벡터로 숙주세포를 형질전환한 형질전환체를 제공한다. The present invention also comprises a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1, a polynucleotide consisting of the DNA sequence of SEQ ID NO: 2, or a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1 or a DNA sequence of SEQ ID NO: 2 Provided is a transformant transformed into a host cell with a vector comprising a polynucleotide hybridized under a strict condition with a polynucleotide and encoding a protein having ethanol dehydrogenase activity.

이때, 숙주세포는 박테리아 또는 효모인 것이 바람직하다. 더욱 바람직하게는 상기 박테리아는 스타필로코코스 에우리우스(Staphylococcus aureus), 대장균(E. coli), 바실러스 세레우스(B. cereus), 살모넬라 타이피뮤림(Salmonella typimurium), 살모넬라 콜레라수이스(Salmonella choleraesuis), 여시니아 엔테로콜리티카(Yersinia enterocolitica) 및 리스테리아 모노사이토게네스(Listeria monocytogenes)로 이루어진 군으로부터 선택되는 어느 하나이며, 더욱더 바람직하게는 대장균, 바실러스 세레우스이고, 더더욱 바람직하게는 대장균이다. At this time, the host cell is preferably bacteria or yeast. More preferably, the bacteria are Staphylococcus aureus, E. coli, B. cereus, Salmonella typimurium, Salmonella choleraesuis. It is any one selected from the group consisting of Yersinia enterocolitica and Listeria monocytogenes, even more preferably E. coli, Bacillus cereus, even more preferably E. coli.

또한 상기 효모는 사카로미세스(Saccharomyces)속, 사카로미코시스(Saccharomycopsis) 속, 사카로미코데스(Saccharomycodes)속, 시조사카로미세스(Schizosaccharomyces)속, 이카하미아(Wickerhamia) 속, 데바리오미세스(Debaryomyces)속, 한세눌라 (Hansenula)속. 한세니아스포라(Hanseniaspora)속, 리포미세스(Lypomyces)속, 피키아(Pichia)속, 클로케라(Kloeckera) 속, 칸디다(Candida) 속, 자이고사카로미세스(Zygosaccharomyces) 속, 오가타에아(Ogataea) 속, 쿠라이시아(Kuraishia) 속, 코마가텔라 (Komagataella) 속, 야로위아(Yarrowia) 속, 윌리옵시스(Williopsis) 속, 나카자와에아(Nakazawaea )속, 클루이베로미시스(Kluyveromyces)속, 토루라스포라(Torulaspora)속, 시테로마이세스(Citeromyces) 속, 왈토미세스(Waltomyces)속, 크립토코쿠스(Cryptococcus)속, 마이크로코쿠스(Micrococcus)속, 엑시구오박테리움(Exiguobacterium) 속, 노카르디아(Nocardia) 속, 무코르(Mucor)속, 암브로시오지마(Ambrosiozyma)속, 시스토필로바시지움(Cystofilobasidium)속, 메토슈니코 이아(Metschnikowia)속, 트리코스포론(Trichosporon)속, 산토필로미세스(Xanthophyllomyces)속, 부렐라(Bullera)속, 펠로미세스(Fellomyces)속, 필로바시듐(Filobasidium)속, 홀터마니아(Holtermannia)속, 파피아(Phaffia)속,로도토룰라(Rhodotorula)속, 스포리디오보루스(Sporidiobolus)속, 스포로보로미세스(Sporobolomyces)속, 윌롭시스(Willopsis)속, 지고아스쿠스(Zygoascus)속, 할로페락스(Haloferax)속, 브레비박테리움(Brevibacterium)속, 류코스포리디움(leucosporidium)속, 미소지마(Myxozyma)속, 트리코스포리엘라(Trichosporiella)속, 알칼리제네스(Alcaligenes)속인 것이 바람직하다. 더욱 바람직하게는 상기 효모는 피키아(Pichia), 한세눌라(Hansenula)또는 캔디다(Candida)속에 속하며, 더더욱 바람직하게는 피키아 파스토리스(Pichia pastoris), 한세눌라 폴리모파(Hansenula polymorpha) 또는 캔디다 보이디니이(Candida boidinii) 종이다. 매우 바람직하게는 상기 효모는 한세눌라 폴리모파(Hansenula polymorpha)이다.
In addition, the yeast is Saccharomyces (Saccharomyces), Saccharomycopsis (Saccharomycopsis), Saccharomycodes (Saccharomycodes), Schizosaccharomyces (Schizosaccharomyces), Icahamia (Wickerhamia), Debariomises Genus Debaryomyces, genus Hansenula. Genus Hansenia spora, genus Lipomyces, genus Pichia, genus Kloeckera, Candida, genus Zygosaccharomyces, genus Ogataea ) Genus, Kuraisia genus, Komagataella genus, Yarrowia genus, Williopsis genus, Nakazawaea genus, Kluyveromyces genus, Torulaspora genus, Citromyces genus, Waltomyces genus, Cryptococcus genus Micrococcus genus Exiguobacterium genus Genus Cardia, Mucor, Ambrosiozyma, Cystofilobasidium, Metschnikowia, Tricosporon, Santophylo Genus Xanthophyllomyces, Burella, Fellomyces, Filova The genus Filobasidium, the genus Holtermannia, the genus Phaffia, the genus Rhodotorula, the genus Sporidiobolus, the genus Sporolomolos, the genus Willopsis Genus, genus Zygoascus, genus Halopeferax, genus Brevibacterium, genus leucosporidium, genus Myxozyma, genus Trichosporiella The genus is preferably genus Alcaligenes. More preferably the yeast belongs to Pichia, Hansenula or Candida, and even more preferably Pichia pastoris, Hansenula polymorpha or Candida It is a species of Candida boidinii. Very preferably the yeast is Hansenula polymorpha.

또한 본 발명은 Also,

1) 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드, 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드, 또는 서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드 또는 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드와 엄격한 조건 하에서 혼성화되며, 에탄올 탈수소효소 활성을 갖는 단백질을 코드하는 것을 특징으로 하는 폴리뉴클레오티드를 포함하는 벡터로 숙주세포를 형질전환시켜 형질전환체를 제조하는 단계; 1) a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1, a polynucleotide consisting of the DNA sequence of SEQ ID NO: 2, or a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1 or a polynucleotide consisting of the DNA sequence of SEQ ID NO: 2 Preparing a transformant by transforming the host cell with a vector comprising a polynucleotide hybridized under stringent conditions and encoding a protein having ethanol dehydrogenase activity;

2) 단계 1)의 형질전환체를 탄소원을 포함하는 배지에서 배양하는 단계; 및 2) culturing the transformant of step 1) in a medium containing a carbon source; And

3) 단계 2)의 배지로부터 에탄올을 회수하는 단계를 포함하는 에탄올의 제조 방법을 제공한다. 3) It provides a method for producing ethanol comprising the step of recovering ethanol from the medium of step 2).

이때, 숙주세포는 박테리아 또는 효모인 것이 바람직하다. 더욱 바람직하게는 상기 박테리아는 스타필로코코스 에우리우스(Staphylococcus aureus), 대장균(E. coli), 바실러스 세레우스(B. cereus), 살모넬라 타이피뮤림(Salmonella typimurium), 살모넬라 콜레라수이스(Salmonella choleraesuis), 여시니아 엔테로콜리티카(Yersinia enterocolitica) 및 리스테리아 모노사이토게네스(Listeria monocytogenes)로 이루어진 군으로부터 선택되는 어느 하나이며, 더욱더 바람직하게는 대장균, 바실러스 세레우스이고, 더더욱 바람직하게는 대장균이다. At this time, the host cell is preferably bacteria or yeast. More preferably, the bacteria are Staphylococcus aureus, E. coli, B. cereus, Salmonella typimurium, Salmonella choleraesuis. It is any one selected from the group consisting of Yersinia enterocolitica and Listeria monocytogenes, even more preferably E. coli, Bacillus cereus, even more preferably E. coli.

또한 상기 효모는 사카로미세스(Saccharomyces)속, 사카로미코시스(Saccharomycopsis) 속, 사카로미코데스(Saccharomycodes)속, 시조사카로미세스(Schizosaccharomyces)속, 이카하미아(Wickerhamia) 속, 데바리오미세스(Debaryomyces)속, 한세눌라 (Hansenula)속. 한세니아스포라(Hanseniaspora)속, 리포미세스(Lypomyces)속, 피키아(Pichia)속, 클로케라(Kloeckera) 속, 칸디다(Candida) 속, 자이고사카로미세스(Zygosaccharomyces) 속, 오가타에아(Ogataea) 속, 쿠라이시아(Kuraishia) 속, 코마가텔라 (Komagataella) 속, 야로위아(Yarrowia) 속, 윌리옵시스(Williopsis) 속, 나카자와에아(Nakazawaea )속, 클루이베로미시스(Kluyveromyces)속, 토루라스포라(Torulaspora)속, 시테로마이세스(Citeromyces) 속, 왈토미세스(Waltomyces)속, 크립토코쿠스(Cryptococcus)속, 마이크로코쿠스(Micrococcus)속, 엑시구오박테리움(Exiguobacterium) 속, 노카르디아(Nocardia) 속, 무코르(Mucor)속, 암브로시오지마(Ambrosiozyma)속, 시스토필로바시지움(Cystofilobasidium)속, 메토슈니코 이아(Metschnikowia)속, 트리코스포론(Trichosporon)속, 산토필로미세스(Xanthophyllomyces)속, 부렐라(Bullera)속, 펠로미세스(Fellomyces)속, 필로바시듐(Filobasidium)속, 홀터마니아(Holtermannia)속, 파피아(Phaffia)속,로도토룰라(Rhodotorula)속, 스포리디오보루스(Sporidiobolus)속, 스포로보로미세스(Sporobolomyces)속, 윌롭시스(Willopsis)속, 지고아스쿠스(Zygoascus)속, 할로페락스(Haloferax)속, 브레비박테리움(Brevibacterium)속, 류코스포리디움(leucosporidium)속, 미소지마(Myxozyma)속, 트리코스포리엘라(Trichosporiella)속, 알칼리제네스(Alcaligenes)속인 것이 바람직하다. 더욱 바람직하게는 상기 효모는 피키아(Pichia), 한세눌라(Hansenula)또는 캔디다(Candida)속에 속하며, 더더욱 바람직하게는 피키아 파스토리스(Pichia pastoris), 한세눌라 폴리모파(Hansenula polymorpha) 또는 캔디다 보이디니이(Candida boidinii) 종이다. 매우 바람직하게는 상기 효모는 한세눌라 폴리모파(Hansenula polymorpha)이다. In addition, the yeast is Saccharomyces (Saccharomyces), Saccharomycopsis (Saccharomycopsis), Saccharomycodes (Saccharomycodes), Schizosaccharomyces (Schizosaccharomyces), Icahamia (Wickerhamia), Debariomises Genus Debaryomyces, genus Hansenula. Genus Hansenia spora, genus Lipomyces, genus Pichia, genus Kloeckera, Candida, genus Zygosaccharomyces, genus Ogataea ) Genus, Kuraisia genus, Komagataella genus, Yarrowia genus, Williopsis genus, Nakazawaea genus, Kluyveromyces genus, Torulaspora genus, Citromyces genus, Waltomyces genus, Cryptococcus genus Micrococcus genus Exiguobacterium genus Genus Cardia, Mucor, Ambrosiozyma, Cystofilobasidium, Metschnikowia, Tricosporon, Santophylo Genus Xanthophyllomyces, Burella, Fellomyces, Filova The genus Filobasidium, the genus Holtermannia, the genus Phaffia, the genus Rhodotorula, the genus Sporidiobolus, the genus Sporolomolos, the genus Willopsis Genus, genus Zygoascus, genus Halopeferax, genus Brevibacterium, genus leucosporidium, genus Myxozyma, genus Trichosporiella The genus is preferably genus Alcaligenes. More preferably the yeast belongs to Pichia, Hansenula or Candida, and even more preferably Pichia pastoris, Hansenula polymorpha or Candida It is a species of Candida boidinii. Very preferably the yeast is Hansenula polymorpha.

상기 단계 2)에서 탄소원은 녹말, 셀룰로스, 오탄당, 육탄당 또는 글리세롤인 것이 바람직하다. 더욱 바람직하게는 상기 탄소원은 자일로스(xylose), 글루코스(glucose), 포도당, 아라비노스, 크실로스, 만노스 또는 갈락토스인 것이 바람직하며, 더더욱 바람직하게는 상기 탄소원은 글루코스 또는 글리세롤이다.　
In step 2), the carbon source is preferably starch, cellulose, pentose sugar, hexose sugar or glycerol. More preferably the carbon source is xylose, glucose, glucose, arabinose, xylose, mannose or galactose, even more preferably the carbon source is glucose or glycerol.

본 발명의 에탄올 탈수소효소는 바이오매스로부터 바이오에탄올을 고수율로 생산할 수 있다. 또한, 본 탈수소효소는 바이오디젤 생산의 부산물인 글리세롤을 이용함으로써 본 발명 단독으로는 물론 기존의 바이오디젤 생산방법과도 효율적으로 이용될 수 있다.
Ethanol dehydrogenase of the present invention can produce bioethanol in high yield from biomass. In addition, the dehydrogenase may be efficiently used not only with the present invention but also with the existing biodiesel production method by using glycerol which is a by-product of biodiesel production.

도 1은 ClustalW2 프로그램을 이용하여 다른 세포질 ADH들(Sc=S. cerevisiae; Kl=Kluyveromyces lactis; Ps= Pichia stipitis )과 HpADH1의 아미노산 서열을 정렬한 것을 나타낸 그림이다. 밑줄 그은 것은 NAD(P+)-결합 모이에티(moiety)를 표시하는 것이다. 굵은 글씨는 NAD(H)-의존성 ADH 중 보존되는 Lys 잔기를 가리킨다. 회색 및 검은색 하이라이트는 각각 촉매적(catalytic) 및 구조적 Zn2+ 결합 잔기를 의미한다.
도 2 (왼쪽)는 H. polymorpha DL1-L 및 HpADH1 결실 주의 AHD 이소자임 분석을 나타낸 그림이다. 도 2 (오른쪽)는 YPD-성장 세포의 단백질 추출물의 에탄올 산화 활성을 나타낸 그림이다.
도 3은 pDLG-HpADH1 벡터의 제조(A) 및 DL1-L과 비교한 pDLG-HpADH1/△HpADH1주의 ADH 활성을 나타내는 그림이다(B). 상기 세포는 mid-log기까지 YPD 배지에서 배양하였으며, 물질 및 방법에 기재한 것과 같이, 무세포 추출액의 인 비트로 ADH 활성을 측정하였다.
도 4는 H. polymorpha DL1-L, ADH-결실주 및 ADH-과발현주의 YPD(검은색 기호) 또는 YPE(백색 기호) 배지에서 성장을 나타내는 그림이다. 사각형, 삼각형, 및 원은 각기 DL1-L, △HpADH1, pDLG-HpADH1/△HpADH1 균주를 가리킨다.
도 5는 HpADH1의 결실 및 과발현 효과를 나타내는 그림이다. A. 글루코스 배지에서의 세포 생물량, B. 글루코스 배지에서의 에탄올 생산량, C. 글리세롤 배지에서의 세포 생물량, D. 글리세롤 배지에서의 에탄올 생산량을 가리킨다. 사각형, 삼각형, 및 원은 각각 DL1-L, △HpADH1, pDLG-HpADH1/△HpADH1 균주를 가리킨다. Figure 1 shows the different cytoplasmic ADHs (Sc = S. cerevisiae ; Kl = Kluyveromyces lactis ; Ps = Pichia) using the ClustalW2 program. stipitis ) and the sequence of amino acid sequence of HpADH1 . Underlined indicates the NAD (P +)-binding moiety. Bold letters indicate Lys residues that are conserved in NAD (H) -dependent ADH. Gray and black highlights refer to catalytic and structural Zn 2+ binding residues, respectively.
Figure 2 (left) shows the analysis of AHD isozymes of H. polymorpha DL1-L and HpADH1 deletion strains. Figure 2 (right) shows the ethanol oxidation activity of the protein extract of YPD-growing cells.
3 is a diagram showing the preparation of pDLG-HpADH1 vector (A) and the ADH activity of pDLG-HpADH1 / ΔHpADH1 strain compared to DL1-L (B). The cells were cultured in YPD medium until mid-log and ADH activity was measured in vitro of cell-free extracts, as described in Materials and Methods.
4 is a diagram showing growth in H. polymorpha DL1-L, ADH-deleted and ADH-overexpressed YPD (black symbols) or YPE (white symbols) media. Squares, triangles, and circles indicate the DL1-L, ΔHpADH1, pDLG-HpADH1 / ΔHpADH1 strains, respectively.
5 is a diagram showing the effect of deletion and overexpression of HpADH1. Cell biomass in A. glucose medium, ethanol production in B. glucose medium, cell biomass in C. glycerol medium, and ethanol production in D. glycerol medium. Squares, triangles, and circles indicate the DL1-L, ΔHpADH1, pDLG-HpADH1 / ΔHpADH1 strains, respectively.

이하, 본 발명을 다음의 실시예 및 실험예에 의해 보다 상세하게 설명한다.Hereinafter, the present invention will be described in more detail by the following examples and experimental examples.

단, 하기 실시예 및 실험예는 본 발명의 내용을 예시하는 것일 뿐 발명의 범위가 실시예 및 실험예에 의해 한정되는 것은 아니다.
However, the following Examples and Experimental Examples are only illustrative of the contents of the present invention and the scope of the invention is not limited by the Examples and Experimental Examples.

<< 실시예Example 1>  1> HpADH1HpADH1 의 서열 분석Sequence analysis

본 발명자들은 샷건 방식과 포스미드클론 말단 시퀀싱을 이용하여 H. polymorpha DL1 균주의 전체 게놈을 확보하였다. We secured the entire genome of H. polymorpha DL1 strain using shotgun method and phosmidclonal sequencing.

H. polymorpha DL1　균주의 유전체 서열 정보를 대상으로 S. cerevisiae ADH1 단백질과 유사한 단백질을 코딩할 수 있는 유전자를 검색하였다. 그 결과 찾아낸 유전자는 HpADH1로 나타내었으며, 이 유전자는 총 349개의 아미노산으로 구성되었으며 아미노산 서열상 ScADH1과 74.8%의 상동성(identity)을 갖는 폴리펩타이드를 코드하는 것으로 분석되었다. 표 1은 효모 ADH들 및 HpADH1과의 아미노산 서열 비교 리스트이다. HpADH1은 이들 효모 ADH들 중에서, C. albicans ADH2 및 C. utilis ADH1에 대하여 각각 78.5.%와 78.9%의 높은 아미노산 서열 상동성을 보였다. 다른 효모 유래의 세포질 ADH와 HpADH1의 정렬한 결과 아연-결합 리간드(zinc-binding ligands) 및 NAD(P+) 결합 모이에티(binding moiety)와 같은 ADH 단백질 계통 중에 보존되는 몇몇 모티프(motif)들을 확인하였다(도 1). 다른 세포질 ADH들과 마찬가지로, 상기 HpADH1 아미노산 서열에는 N-말단 소포체 타겟팅 연장 신호를 갖고 있지 않았는바, 이는 HpADH1 단백질이 세포질 내에 위치하는 것을 의미한다.
Genes capable of encoding proteins similar to S. cerevisiae ADH1 protein were searched for genome sequence information of H. polymorpha DL1 strain. The resulting gene was identified as HpADH 1, which consists of a total of 349 amino acids and was analyzed to encode a polypeptide having 74.8% identity with ScADH1 in the amino acid sequence. Table 1 is a comparison list of amino acid sequences with yeast ADHs and HpADH1. HpADH1 showed high amino acid sequence homology of 78.5.% And 78.9% to C. albicans ADH2 and C. utilis ADH1 among these yeast ADHs, respectively. Alignment of HpADH1 with cytoplasmic ADH from other yeast results in several motifs conserved in the ADH protein lineages, such as zinc-binding ligands and NAD (P + ) binding moieties. It was confirmed (FIG. 1). Like other cytoplasmic ADHs, the HpADH1 amino acid sequence did not have an N-terminal endoplasmic reticulum targeting extension signal, indicating that the HpADH1 protein is located in the cytoplasm.

다른 균주 유래의 다른 ADH 유전자들과 HpADH1과의 아미노산 서열 상동성(Hp=Hansenula polymorpha DL1; Sc=Saccharomyces cerevisiae; Ps=Pichia stipitis CBS6054;　 Kl=Kluyveromyces lactis NRRL Y-1140; Ca=Candida albicans SC5314; Cu=C. utilis ATCC9950)Amino acid sequence homology of HpADH1 with other ADH genes from different strains (Hp = Hansenula) polymorpha DL1; Sc = Saccharomyces cerevisiae ; Ps = Pichia stipitis CBS6054; Kl = Kluyveromyces lactis NRRL Y-1140; Ca = Candida albicans SC5314; Cu = C. utilis ATCC9950) ADHADH
HpADH1 Hp ADH1 %일치성(Identities)% Identities %유사성(Similarities)% Similarities ScADH1 Sc ADH1 74.874.8 83.483.4 ScADH2 Sc ADH2 75.475.4 84.284.2 PsADH1 Ps ADH1 76.876.8 86.586.5 PsADH2 Ps ADH2 75.475.4 85.485.4 KlADH1 Kl ADH1 75.175.1 82.682.6 KlADH2 Kl ADH2 72.572.5 82.282.2 CaADH1 Ca ADH1 63.463.4 71.371.3 CaADH2 Ca ADH2 78.578.5 88.388.3 CuADH1 Cu ADH1 78.978.9 88.388.3

<< 실시예Example 2>  2> 대장균에서의In E. coli 재조합  Recombination HpADH1HpADH1 의 제조 Manufacture

<2-1> <2-1> E. E. colicoli 에서 과발현하기 위한 To overexpress pET28apET28a -- HpHp ADHADH 1One 벡터의 제조  Manufacture of vector

HpADH1 효소의 생화학적 특성을 조사하기 위하여, HpADH1를 코드하는 유전자를 pET28a+ 발현 벡터(Novagen)에 클로닝하였다. 프라이머 pETADH1F 및 pETADH1R(표 2)를 이용하여 HpADH1(1,047bp)를 PCR 증폭한 후 그 산물을 NdeI과 HindIII 제한효소로 절단한 후 동일한 제한효소로 절단한 pET28a+ 발현 벡터와 연결하여 E. coli DH5α에 형질전환하였다. 형질전환 대장균을 30 ㎍/㎖ 카나마이신(kanamycin)을 포함하는 LB 한천 배지(1% tryptone, 0.5% yeast extract, 1% NaCl, 1.5% Agar)에 도말하였다. 재조합 균주로부터 벡터를 분리하여 제한효소 절단 및 DNA 시퀀싱을 통하여 pET28a-HpADH1 발현벡터의 제작을 확인하였다. 이 재조합 발현 벡터로부터 발현되는 HpADH1 단백질은 N-말단에 6xHis 친화말단을 포함하게 되며 이 벡터를 대장균 E. coli BL21 (DE3) 발현균주에 형질전환하여 T7 RNA 합성효소에 의하여 단백질이 발현되도록 하였다.
To investigate the biochemical properties of the HpADH1 enzyme, the gene encoding HpADH1 was cloned into pET28a + expression vector (Novagen). PCR amplification of Hp ADH1 (1,047 bp) using primers pETADH1F and pETADH1R (Table 2), and the product was digested with NdeI and HindIII restriction enzymes, and then linked to pET28a + expression vector digested with the same restriction enzymes to E. coli. DH5α was transformed. Transformed E. coli was plated in LB agar medium (1% tryptone, 0.5% yeast extract, 1% NaCl, 1.5% Agar) containing 30 μg / ml kanamycin. The vector was isolated from the recombinant strain, and the production of the pET28a-Hp ADH 1 expression vector was confirmed by restriction digestion and DNA sequencing. The HpADH1 protein expressed from this recombinant expression vector will contain the 6xHis affinity terminal at the N-terminus, which is referred to as E. coli. BL21 (DE3) expression strain was transformed to express the protein by T7 RNA synthase.

프라이머 primer 이름name 서열(5'->3')Sequence (5 '-> 3') HpADH1FHpADH1F CGAGCG AAGCTT ATGACTTCCATTCCAAAGACTCAAAAGGCCCGAGCG AAGCTT ATGACTTCCATTCCAAAGACTCAAAAGGCC HpADH1RHpADH1R CGAGCT ACTAGT CTATTTGGAAGTGTCAAGAACGTATCTTCCCGAGCT ACTAGT CTATTTGGAAGTGTCAAGAACGTATCTTCC Del ADH1 NFDel ADH1 NF GTCCTTGATTTTCCGTTTGAGTACCTCGGTCCTTGATTTTCCGTTTGAGTACCTCG Del ADH1 NRDel ADH1 NR AGCTCGGTACCCGGGGATCCCTCATTTGGCTTTGGTTGTGGAACAGGAGCTCGGTACCCGGGGATCCCTCATTTGGCTTTGGTTGTGGAACAGG Del ADH1 CFDel ADH1 CF GCACATCCCCCTTTCGCCAGGCTCCAATCAAGGTTGTTGGCCTTTCTGGCACATCCCCCTTTCGCCAGGCTCCAATCAAGGTTGTTGGCCTTTCTG Del ADH1 CRDel ADH1 CR TCAGTAGCTTGTGTTTTTCTGCCGTAGTGTCAGTAGCTTGTGTTTTTCTGCCGTAGTG LacZ_NFLacZ_NF TCCCCGGGTACCGAGCTTCCCCGGGTACCGAGCT LacZ_NRLacZ_NR CACCGGTAGCTAATGATCCCCACCGGTAGCTAATGATCCC LacZ_CFLacZ_CF CGAACATCCAAGTGGGCCGACGAACATCCAAGTGGGCCGA LacZ_CRLacZ_CR CTGGCGAAAGGGGGATGTGCCTGGCGAAAGGGGGATGTGC pETADH1FpETADH1F CGAGCGCATATGACTTCCATTCCAAAGACTCAAAAGGCCCGAGCG CATATG ACTTCCATTCCAAAGACTCAAAAGGCC pETADH1RpETADH1R CGAGCTAAGCTTCTATTTGGAAGTGTCAAGAACGTATCTTCCCGAGCT AAGCTT CTATTTGGAAGTGTCAAGAACGTATCTTCC

AAGCTT:HindIII 위치, ACTAGT:SpeI 위치, CATATG:NdeI 위치
AAGCTT: Hin dIII position, ACTAGT: Spe I position, CATATG: Nde I position

<2-2> 재조합 <2-2> recombination HpADHHpADH I 단백질의 발현 및 정제  Expression and Purification of I Proteins

pET28a-HpADH1으로 형질전환(transform)된 E. coli BL21(DE3)를 밤새 배양한 후, OD600가 0.2가 되도록 LB-카나마이신(kanamycin) 배지에 재접종하였다. 3시간 동안 180 rpm, 37℃에서 배양하였다. 그 후, 1 mM의 IPTG를 첨가하여 단백질의 발현을 유도하고, 상기 세포를　16℃에서 180 rpm으로 진탕배양하였다. 24시간 유도 후, 20분간 6,500 rpm에서 원심분리하여 세포들을 수득하였다. 세포 침전물(pellet)을 용해 버퍼(50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 1 mM PMSF, pH 8.0)에 현탁한 후 음파 처리(sonication)하여 세포를 파쇄하고, 이 파쇄액을 다시 원심분리하여 상층액을 취하였다. 곧바로 제조사의 설명서에 따라 현탁액을 자연 조건(native condition) 하에서　 Ni-NTA 아가로즈 수지(agarose resin) (Qiagen)를 이용하여 단백질을 친화력 정제(affinity purification)하였다. 용해 버퍼에 당해 수지를 평형상태로 만든 후, 단백질 추출액을 수지와 함께 섞어 두 시간 동안 4℃에서 부드럽게 흔들어 주었다. 그 후, 상기 혼합물을 칼럼에 넣고 세척 버퍼(50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, 1% triton X100, 1 mM PMSF, pH 8.0)로 8회 세척하였다. 250 mM 이미다졸을 포함하는 용출(elution) 버퍼를 가하여 His-친화말단을 포함하고 있는 HpADH1 단백질을 용출(elute)시켰다. 마지막으로, 투석버퍼(pH 8.0, 50 mM NaCl, 20 mM Tris-HCl)에서 4℃에서 밤새 투석(dialysis)하여 이미다졸을 제거하였다. SDS-PAGE 및 쿠마시 브릴리언트 블루 R250 염색으로 모든 정제 분획을 분석하였다. E. coli BL21 (DE3) transformed with pET28a-Hp ADH1 was incubated overnight and then re-inoculated with LB-kanamycin medium so that the OD 600 was 0.2. Incubated for 3 hours at 180 rpm, 37 ℃. Thereafter, 1 mM of IPTG was added to induce the expression of the protein, and the cells were shaken at 16 ° C. at 180 rpm. After 24 hours induction, cells were harvested by centrifugation at 6,500 rpm for 20 minutes. Cell pellets are suspended in lysis buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 10 mM imidazole, 1 mM PMSF, pH 8.0), and then sonicated to disrupt the cells and the crushed solution is crushed. Centrifugation again to take supernatant. Immediately following the manufacturer's instructions the suspension was subjected to affinity purification using Ni-NTA agarose resin (Qiagen) under native conditions. After equilibrating the resin in the lysis buffer, the protein extract was mixed with the resin and gently shaken at 4 ° C for 2 hours. The mixture was then placed in a column and washed eight times with wash buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 20 mM imidazole, 1% triton X100, 1 mM PMSF, pH 8.0). Elution buffer containing 250 mM imidazole was added to elute the HpADH1 protein containing His-affinity ends. Finally, the imidazole was removed by dialysis overnight at 4 ° C. in a dialysis buffer (pH 8.0, 50 mM NaCl, 20 mM Tris-HCl). All purified fractions were analyzed by SDS-PAGE and Coomassie Brilliant Blue R250 staining.

재조합 단백질의 발현은 항-히스티딘(anti-his) 및 항 토끼-알칼리성 인산분해효소(anti rabbit-alkaline phosphatase)의 콘쥬게이트(conjugate) 항체를 이용하여 웨스턴블랏에 의하여 확인하였다. 상기 정제된 단백질들은 SDS-PAGE 상에서 ScADHs 및 KlADHs들과 같은 다른 효모 ADH 서브유닛들과 동일한 범위 내인 약 37 kDa의 분자량을 보였다. 나아가 자연 상태(native)-PAGE 겔의 ADH 활성 분석을 통하여 상기 His-HpADH1 단백질이 활성을 갖고 있음을 확인하였다.
Expression of the recombinant protein was confirmed by Western blot using conjugated antibodies of anti-histidine and anti rabbit-alkaline phosphatase. The purified proteins have a molecular weight of about 37 kDa that is in the same range as other yeast ADH subunits such as ScADHs and KlADHs on SDS-PAGE. Seemed. Furthermore, the His- HpADH1 protein was confirmed to have activity through the analysis of the ADH activity of the native-PAGE gel.

<2-3> <2-3> ADHADH 활성의 측정  Measurement of activity

상기와 같이 추출물을 제조하여, 하기의 과정에 따라 알콜 산화에 있어 ADH 활성을 측정하는데 사용하였다. ADH1의 동적 특성의 경우, E. coli에서 발현된 수용성 재조합 ADH1 단백질의 탈수소효소(dehydrogenase) 및 환원효소(reductase) 활성을 모두 측정하였다.
Extracts were prepared as described above and used to measure ADH activity in alcohol oxidation according to the following procedure. For the dynamic properties of ADH1, both dehydrogenase and reductase activity of water-soluble recombinant ADH1 protein expressed in E. coli were measured.

탈수소효소 활성Dehydrogenase activity

50 mM glycine-KOH buffer pH 9.0, 1 mM NAD+ 로 구성된, ADH 활성 분석 혼합물(assay mixture)에 적절한 양의 단백질액을 첨가한 후 100 mM의 에탄올을 첨가함으로써 반응을 시작하였다(Postma, E., C. Verduyn, W. A. Scheffers, and J. P. Van Dijken. 1989. Enzymic analysis of the crabtree effect in glucose-limited chemostat cultures of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 55:468-477). 총 반응액의 부피는 1 ㎖이 되도록 하였으며 OD340에서의 흡광도 변화를 반응개시 후 15초 및 45초에서 기록하였다. 효소 활성 단위는 분당 NADH 1 μmol을 생산하기에 필요한 효소의 양으로 하였다.
The reaction was started by adding an appropriate amount of protein solution to the ADH activity assay mixture, consisting of 50 mM glycine-KOH buffer pH 9.0 and 1 mM NAD + (Postma, E. , C. Verduyn, WA Scheffers, and JP Van Dijken. 1989. Enzymic analysis of the crabtree effect in glucose-limited chemostat cultures of Saccharomyces cerevisiae.Appl. Environ.Microbiol. 55: 468-477). The volume of the total reaction solution was 1 ml and the change in absorbance at OD 340 was recorded at 15 and 45 seconds after the start of the reaction. Enzyme active units were the amount of enzyme required to produce 1 μmol of NADH per minute.

환원효소 활성Reductase activity

50 mM potassium phosphate 버퍼, pH 6.0, 0.15 mM NADH, 적당량의 단백질용액을 포함하고 있는 효소반응 혼합액에 100mM의 아세트알데하이드를 첨가함으로써 반응을 시작하였다(Cornelis Verduyn, G. J. B., W. Alexander Scheffers, Johnnes P. Van Dijken,. 1988. Substrate specificity of alcohol dehydrogenase from the yeast Hansenyls polymorpha CBS 4732 and Candida utilis CBS 621. Yeast 4:143-148). 총 반응부피는 1 ㎖로 하였으며 NADH가 산화되어　NAD+를 형성하는데 따른 OD340에서의 흡광도 감소를 반응 개시 1분 후에 기록하였다. 효소 활성 단위는 분 당 NADH 1 μmol을 소모하는 효소 양으로 정하였다. The reaction was started by adding 100 mM acetaldehyde to an enzyme reaction mixture containing 50 mM potassium phosphate buffer, pH 6.0, 0.15 mM NADH, and an appropriate amount of protein solution (Cornelis Verduyn, GJB, W. Alexander Scheffers, Johnnes P. Van Dijken ,. 1988.Substrate specificity of alcohol dehydrogenase from the yeast Hansenyls polymorpha CBS 4732 and Candida utilis CBS 621. Yeast 4: 143-148). The total reaction volume was 1 ml and the decrease in absorbance at OD 340 as NADH was oxidized to form NAD + was recorded 1 minute after the start of the reaction. Enzyme active units were determined by the amount of enzyme consuming 1 μmol NADH per minute.

다양한 종류의 알콜 및 알데하이드를 대상으로 HpADH1의 기질(substrate) 특이성을 측정하였다. 알콜 산화의 경우, 분석 조건은 2 ㎍의 정제된 HpADH1 단백질을 가한(apply) 것을 제외하고는, 상기 탈수소효소 활성 측정 방법과 동일하며 100 mM의 알콜 기질을 첨가하자 반응을 개시하였다. 환원효소활성의 기질특이성 분석을 위해서는 상기 환원효소 활성 측정 방법을 사용하였으며 100 mM의 알데하이드 또는 케톤을 기질로 사용하였고 정제된 단백질의 2 ㎍을 사용하였다.Substrate specificity of HpADH1 was measured for various kinds of alcohols and aldehydes. In the case of alcohol oxidation, the assay conditions were the same as in the above dehydrogenase activity measurement method except that 2 μg of purified HpADH1 protein was applied, and the reaction was started upon addition of 100 mM alcohol substrate. For the substrate specificity analysis of reductase activity, the reductase activity measurement method was used, 100 mM of aldehyde or ketone was used as a substrate, and 2 μg of purified protein was used.

한편 에탄올 0.1 ~ 20 mM 또는 아세트알데하이드 1 ~ 100 mM 범위의 다양한 기질에 대한 K m 및 K cat 를 측정하였다. 시그마 플롯 10.0 소프트웨어(Sigma plot 10.0 software)의 한-위치 리간드 결합 방정식(one-site ligand binding equation)을 이용하여 상기 데이터를 도표화(plot)하고 계산하였다. 각각의 실험은 최소 3번 반복하였으며 10% 미만의 표준 오차를 갖는다. 단백질 정량은 BSA를 표준으로 사용하여 Biorad 사의 단백질 분석방법에 따라 실시하였으며 정제된 단백질의 경우 OD280을 측정함으로써 정량하였다.
Meanwhile, for various substrates ranging from 0.1-20 mM ethanol or 1-100 mM acetaldehyde K m And K cat were measured. The data were plotted and calculated using the one-site ligand binding equation of Sigma plot 10.0 software. Each experiment was repeated at least three times with a standard error of less than 10%. Protein quantification was performed according to the protein analysis method of Biorad using BSA as a standard, and the purified protein was quantified by measuring the OD 280 .

<2-4> 재조합 <2-4> recombination HpADH1HpADH1 의 생화학적 특성 Biochemical Properties of

일정량의 보조인자(NAD+ 또는 NADH) 존재 하에 기질 농도를 달리하여 효소활성을 분석함으로써 HpADH1의 에탄올과 알데하이드에 대한 반응속도상수(kinetic constants)를 결정하였다(표 3). 에탄올에서 HpADH1는 에탄올에 대하여 알데하이드에 대한 것보다 8배나 낮은 K m 값을 보였다. 반면, 양쪽 기질에서 모두 비슷한 범위의 대사회전수(turnover number, K cat )와 촉매효율(catalytic efficiency, K cat /K m )를 보였다. 기존에 보고된 다른 효모 유래의 ADH1 및 ADH2와 비교할 때, HpADH1의 알데하이드에 대한 K m 은 ScADH1, KlADH1 및 KlADH2의 것과 거의 동일한 수준이었으며 ScADH1에 비해서는 21배 정도 높았다. 반면, HpADH1의 에탄올에 대한 촉매효율은 이들 효소들 경우보다 매우 높았다.
Kinetic constants of ethanol and aldehyde of HpADH1 were determined by analyzing enzyme activity by varying substrate concentration in the presence of a certain amount of cofactor (NAD + or NADH) (Table 3). HpADH1 in ethanol is eight times lower than that for aldehydes for ethanol, K m Value was shown. On the other hand, both substrates showed similar ranges of turnover number ( K cat ) and catalytic efficiency ( K cat / K m ). Compared to other previously reported yeast-derived ADH1 and ADH2, the K m for aldehydes of HpADH1 were nearly identical to those of ScADH1, KlADH1 and KlADH2, and were 21 times higher than ScADH1. On the other hand, the catalytic efficiency of HpADH1 for ethanol was much higher than for these enzymes.

HpADH1의 효소반응 속도상수 측정 및 비교Measurement and Comparison of Enzyme Reaction Rate Constants of HpADH1 　 에탄올ethanol 아세트알데하이드Acetaldehyde K m (mM) K m (mM) K cat (min-1) K cat (min -1 ) K cat / K m (min-1.mM-1) K cat / K m (min -1 .mM -1 ) K m (mM) K m (mM) K cat (min-1) K cat (min -1 ) K cat / K m (min-1.mM-1) K cat / K m (min -1 .mM -1 ) HpADH1a HpADH1 a 0.250.25 2.1 x 105 2.1 x 10 5 8.4 x 105 8.4 x 10 5 1.941.94 2.0 x 105 2.0 x 10 5 1.0 x 105 1.0 x 10 5 ScADH1b ScADH1 b 1717 2.0 x 104 2.0 x 10 4 1.2 x 103 1.2 x 10 3 1.11.1 1.0 x 105 1.0 x 10 5 9.3 x 104 9.3 x 10 4 ScADH2b ScADH2 b 0.810.81 7.8 x 103 7.8 x 10 3 9.6 x 103 9.6 x 10 3 0.090.09 6.2 x 104 6.2 x 10 4 6.9 x 105 6.9 x 10 5 KlADH1c KlADH1 c 2727 2.5 x 105 2.5 x 10 5 9.3 x 103 9.3 x 10 3 1.21.2 3.6 x 105 3.6 x 10 5 3.0 x 105 3.0 x 10 5 KlADH2c KlADH2 c 2323 2.8 x 104 2.8 x 10 4 1.2 x 103 1.2 x 10 3 1.71.7 3.3 x 104 3.3 x 10 4 2.0 x 104 2.0 x 10 4

a: 표준 오차 범위는 10% 미만임. a: The standard error range is less than 10%.

b: Ganzhorn의 방법으로 데이터를 계산함 (Ganzhorn, A., D. Green, A. Hershey, R. Gould, and B. Plapp.1987. Kinetic characterization of yeast alcohol dehydrogenases. Amino acid residue 294 and substrate specificity. J. Biol. Chem. 262:3754-3761). b: Calculated data by Ganzhorn's method (Ganzhorn, A., D. Green, A. Hershey, R. Gould, and B. Plapp. 1987. Kinetic characterization of yeast alcohol dehydrogenases.Amino acid residue 294 and substrate specificity. J. Biol. Chem. 262: 3754-3761).

c: Bozzi 등의 논문으로부터 데이터 유래 (Bozzi A, Saliola M, Falcone C, Bossa F, Martini F. 1997. Structural and biochemical studies of alcohol dehydrogenase isozymes from Kluyveromyces lactis. Biochim Biophys Acta. 1339:133-42).
c: Derived from Bozzi et al. (Bozzi A, Saliola M, Falcone C, Bossa F, Martini F. 1997. Structural and biochemical studies of alcohol dehydrogenase isozymes from Kluyveromyces lactis. Biochim Biophys Acta. 1339: 133-42).

에탄올 및 아세트알데하이드(acetaldehyde)에 대한 HpADH1 및 다른 ADH들의 반응속도상수를 실온에서 측정하였다. [NAD+] 또는 [NADH]는 0.15 mM로 일정하게 유지하였다. The rate constants of HpADH1 and other ADHs against ethanol and acetaldehyde were measured at room temperature. [NAD + ] or [NADH] remained constant at 0.15 mM.

HpADH1의 기질특이성을 다른 알콜 및 알데하이드를 사용하여 측정하였다(표 4). 에탄올에 대한 활성을 기준으로 HpADH1은 중간 사슬길이 알콜(C2 ~ C5)에 최대 3.5배에 이르는 높은 산화활성을 보였다. 반면 메탄올(C1)에 대해서는 ADH 활성을 보이지 않았다. 2차 알콜 2-프로판올(2-propanol)에 대해 HpADH1은 상대적으로 높은 활성을 보였으나, 2-옥탄올(2-octanol)을 이용하였을 때는 상대적으로 낮은 활성을 보였다. 한편 아세트알데하이드에 대해 높은 환원 활성이 관찰되었다(표 4). 이러한 결과에 기초하여 HpADH1은 환원 활성에서는 아세트알데하이드에 매우 특이적인데 반하여, 알콜 산화에 있어서는 많은 종류의 기질에 대한 특이성을 갖는 것을 확인하였다.
Substrate specificity of HpADH1 was determined using different alcohols and aldehydes (Table 4). Based on the activity against ethanol, HpADH1 showed a high oxidative activity of up to 3.5-fold for medium chain length alcohols (C2 to C5). On the other hand, it did not show ADH activity for methanol (C1). HpADH1 showed relatively high activity against secondary alcohol 2-propanol, but relatively low activity with 2-octanol. On the other hand, high reducing activity was observed for acetaldehyde (Table 4). Based on these results, it was confirmed that HpADH1 was very specific to acetaldehyde in reducing activity, while having specificity for many kinds of substrates in alcohol oxidation.

HpADH1의 기질 특이성 Substrate Specificity of HpADH1 기질temperament 상대적 특이성 a,b Relative specificity a, b 1차 Primary 알콜Alcohol 　 메탄올(methanol)Methanol 00 에탄올(ethanol)Ethanol 100100 1-프로판올(1-propanol)1-propanol 161　161 1-부탄올(1-butanol)1-butanol 188　188 1-펜탄올(1-pentanol)1-pentanol 358　358 1-옥탄올(1-octanol)1-octanol 89　89 2차 Secondary 알콜Alcohol 　 2-프로판올(2-propanol)2-propanol 190　190 2-펜탄올(2-pentanol)2-pentanol 20　20 2-옥탄올(2-octanol)2-octanol 78　78 알콜 유도체(derivatives)Alcohol derivatives 　 2-메톡시 에탄올 (2-methoxy ethanol)2-methoxy ethanol 34　34 1,2 부탄디올(1, 2butanediol)1,2 butanediol (1, 2butanediol) 14　14 알데하이드Aldehyde 및 케톤 And ketones 　 아세트알데하이드(acetaldehyde)Acetaldehyde 1,346　1,346 포름알데하이드(formaldehyde)Formaldehyde 8　8 아세톤(acetone)Acetone 00

a: 에탄올 산화 활성을 100으로 할 때, 상대적인 활성. a: Relative activity when ethanol oxidation activity is set to 100.

b: 각 기질에서의 표준 오차는 10% 미만임.
b: Standard error in each substrate is less than 10%.

<< 실시예Example 3>  3> HpADH1HpADH1 의 생리적 활성 분석 Analysis of physiological activity

<3-1> 균주 및 생장 조건 <3-1> Strains and Growth Conditions

본 발명에서는 HpADH1 유전자 제거(disruption)에 있어 우라실 영양요구성(auxotrophic) 균주인 H. polymorpha DL1-LdU(leu2 △ ura3 :: lacZ)를　수여자(recipient) 세포로 이용하였다.　 따라서 각종 활성 비교분석 실험을 위해 H. polymorpha DL1-L(leu2) 균주를 대조군 균주로 이용하였다. 일반적으로 H. polymorpha 세포는 37℃에서 YPD(1% yeast extract, 2% bactopeptone, 2% glucose) 또는 SC(0.67% YNB without amino acids, 2% glucose, drop-out mix without uracil and/or leucine)에서 배양하였다. 필요한 경우, 글루코스 대신에 에탄올을 동일한 최종 농도인 2%로 사용하였다. 발효를 위해서, 10% 글루코스 또는 글리세롤이 보충된 YNBC(0.05% yeast extract, 0.34% (NH4)2SO4, amino acids)를 이용하였으며 Ryabova(Ryabova, O. B., O. M. Chmil, and A. A. Sibirny. 2003. Xylose and cellobiose fermentation to ethanol by the thermotolerant methylotrophic yeast Hansenula polymorpha. FEMS Yeast Res 4)가 보고한 펩톤(peptone) 및 유레아(urea)에 의하여 에탄올 축적량이 감소하는 것을 방지하였다. pDLG-HpADH1 벡터의 제조 및 증식을 위해 E. coli DH5a를 숙주로 이용하였으며 형질전환 후 37℃ 조건 하, 100 ㎍/㎖ 엠피실린(ampicillin)이 첨가된 LB 배지(1% tryptone, 0.5% yeast extract, 1% NaCl)에서 배양하였다.
In the present invention, Hp ADH1 In gene disruption, H. polymorpha DL1-LdU ( leu2 ), an uraxo atrophy strain Δ ura3 :: lacZ ) was used as recipient cells. Therefore, H. polymorpha DL1-L ( leu2 ) strain was used as a control strain for the comparative experiments. In general, H. polymorpha cells were treated with YPD (1% yeast extract, 2% bactopeptone, 2% glucose) or SC (0.67% YNB without amino acids, 2% glucose, drop-out mix without uracil and / or leucine) at 37 ° C. Incubated at. If necessary, ethanol was used instead of glucose at the same final concentration of 2%. For fermentation, YNBC (0.05% yeast extract, 0.34% (NH 4 ) 2 SO 4 , amino acids) supplemented with 10% glucose or glycerol was used and Ryabova (Ryabova, OB, OM Chmil, and AA Sibirny. 2003. Xylose and cellobiose fermentation to ethanol by the thermotolerant methylotrophic yeast Hansenula polymorpha . Pepttone and urea reported by FEMS Yeast Res 4) prevented the reduction of ethanol accumulation. E. coli DH5a was used as a host for the preparation and propagation of pDLG-HpADH1 vector, and 100 μg / ml under 37 ° C after transformation. Cultured in LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl) to which ampicillin was added.

<3-2> <3-2> HpADH1HpADH1 유전자의 결실( Deletion of genes ( disruptiondisruption ) )

H. polymorpha DL1 균주의 전장 게놈 서열 정보상 ORF로 추정되는 서열로부터 코딩될 수 있는 단백질의 아미노산 서열을 전통효모 S. cerevisiae의 ScADH1 단백질의 아미노산 서열을 이용하여 상동성 검색을 실시한 결과 HpADH1 유전자를 선별하였으며 이 유전자의 생리적 기능을 탐색하기 위하여 아래와 같이 결손 균주를 제작하였다. 즉 Kim 등에 의해 기술된 바와 같이 two-step PCR 및 세포 내 재조합 방법(Kim, M. W., E. J. Kim, J. Y. Kim, J. S. Park, D. B. Oh, Y. Shimma, Y. Chiba, Y. Jigami, S. K. Rhee, and H. A. Kang. 2006. Functional characterization of the Hansenula polymorpha HOC1, OCH1, and OCR1 genes as members of the yeast OCH1 mannosyltransferase family involved in protein glycosylation. J Biol Chem 281:6261-6272)을 사용하여 lacZ - Ura3 - lacZ 결실 카세트(casssette)를 이용하여 HpADH1 유전자를 대체하였다. 구체적으로는, HpADH1 유전자의 업스트림 및 다운스트림 서열을 포함하는 DNA 단편들을 제조하기 위하여 H. polymorpha DL1 균주의 염색체를 주형으로 △ADH1NF//△ADH1NR 및 △ADH1CF//△ADH1CR을 각각 프라이머 쌍(표 2)으로 이용하여, 첫 번째 PCR을 수행하였다. 그 결과 HpADH1 유전자의 업스트림 DNA 단편 △ADH1N'과 다운스트림 DNA 단편 △ADH1C'을 확보하였다. 한편 타겟 유전자 결실 변이주 선별마커인 URA3 표지유전자의 서열을 포함하는 DNA 단편들을 확보하기 위하여 플라스미드 pLacUR3를 주형으로 LacZNF//LacZNR 및 LacZCF//LacZCR를 각각 프라이머 쌍으로 이용하여 PCR을 수행하여 URA3 표지 유전자 카세트의 업스트림 DNA 단편인 URA3N'과 다운스트림 DNA 단편인 URA3C'을 확보하였다. The amino acid sequence of a protein which can be encoded from the sequence a putative full-length genomic sequence jeongbosang ORF in H. polymorpha DL1 strain as a result of the homology search using the amino acid sequence of the protein ScADH1 traditional yeast S. cerevisiae ADH1 gene screening Hp In order to explore the physiological function of this gene, a defective strain was constructed as follows. Ie two-step PCR and intracellular recombination methods as described by Kim et al. (Kim, MW, EJ Kim, JY Kim, JS Park, DB Oh, Y. Shimma, Y. Chiba, Y. Jigami, SK Rhee, and HA Kang. 2006.Function characterization of the Hansenula polymorpha HOC1, OCH1, and OCR1 genes as members of the yeast OCH1 mannosyltransferase family involved in protein glycosylation. J Biol Chem 281: 6261-6272) and Hp ADH1 using a lacZ - Ura3 - lacZ deletion cassette. The gene was replaced. Specifically, Hp ADH1 To prepare DNA fragments comprising the upstream and downstream sequences of the gene, chromosomes of the H. polymorpha DL1 strain were used as the template, ΔADH1NF // ΔADH1NR and ΔADH1CF // ΔADH1CR, respectively, as primer pairs (Table 2). , The first PCR was performed. As a result, an upstream DNA fragment ΔADH1N ′ and a downstream DNA fragment ΔADH1C ′ of the HpADH1 gene were obtained. The target gene deletion mutant URA3 selection marker of the plasmid pLacUR3 mold to ensure the DNA fragment containing the sequence of the marker gene LacZNF LacZNR // and // LacZCF by performing PCR using a primer pair each LacZCR URA3 The upstream DNA fragment URA3N 'and the downstream DNA fragment URA3C' of the labeled gene cassette were obtained.

그 후 △ADH1N' 및 URA3N'을 주형으로 사용하고 △ADH1NF//LacZNR를 프라이머 쌍으로 사용하여 2차(second-round) PCR을 수행함으로써 HpADH1 및 lacZ - Ura3 - lacZ의 N-말단 융합 단편을 제조하였다. 마찬가지로 △ADH1C' 및 URA3C'을 주형으로 사용하고 LacZCF//△ADH1CR을 프라이머 쌍으로 이용하여 HpADH1 및 lacZ - Ura3 - lacZ의 C-말단 융합 단편을 제조하였다. 이들 N-말단 및 C-말단 융합 산물은 서로 중복되는 100 bp의 서열을 포함한다. 세포 내 재조합을 위하여, 양 융합 단편들을 H. polymorpha DL1-LdU균주에 형질전환(Hill, J., K. A. G. Donald, and D. E. Griffiths. 1991. DMSO-enhanced Whole cell yeast transformation. Nucl. Acids Res. 19:5791) 하였으며 형질전환주를 우라실이 결핍된 SC-Ura 플레이트(plate)에 도말하였다. 이 배지에서 성장하는 우라실 영양요구성이 제거된 형질전환균주를 YPD 배지 배양 SC-Ura 배지 배양 등을 통해 안정화시키고 선별한 후 해당 균주의 염색체 DNA를 대상으로 HpADH1 유전자에 대한 PCR을 실시하여 HpADH1 유전자 제거 여부를 확인하였다.
The N-terminal fusion fragments of Hp ADH1 and lacZ - Ura3 - lacZ were then subjected to second-round PCR using ΔADH1N 'and URA3N' as templates and performing ΔADH1NF // LacZNR as primer pairs. Prepared. Similarly, C-terminal fusion fragments of Hp ADH1 and lacZ - Ura3 - lacZ were prepared using ΔADH1C ′ and URA3C ′ as templates and LacZCF // ΔADH1CR as primer pairs. These N-terminal and C-terminal fusion products comprise 100 bp sequences that overlap each other. For intracellular recombination, both fusion fragments were transformed into strain H. polymorpha DL1-LdU (Hill, J., KAG Donald, and DE Griffiths. 1991. DMSO-enhanced Whole cell yeast transformation. Nucl. Acids Res. 19: 5791) and transformants were plated on SC-Ura plates lacking uracil. A uracil auxotrophic transformant strain the structure is removed to grow in this medium YPD medium culture SC-Ura then stabilized through the medium culture etc. and screening by carrying out PCR for HpADH1 gene targeting with the chromosomal DNA of the strain HpADH1 gene The removal was confirmed.

<3-3> <3-3> HpHp ADH1ADH1 및  And ADHADH 이소자임의Isozyme 결실 분석  Fruition analysis

HpADH1의 생리학적 역할을 확인하기 위하여, 전술한 바와 같이, 2단계 PCR 및 세포 내 재조합 방법에 의해 HpADH1 유전자를 결실시켰다(△HpADH1). 확보된 돌연변이 후보균주의 염색체 DNA를 정제한 후 주형으로 사용하여 △ADH1NF 및 △ADH1CR을 프라이머로 이용하여 PCR을 수행하여 HpADH1결실 여부를 확인하였다. 야생형의 경우 2.9 kb 단편으로 검출된 것과 달리 ADH1 결실 돌연변이(△HpADH1 )는 3.5kb 단편의 존재로 검출되었다. 그 후, ADH 이소자임의 전기영동 패턴(electrophoretic pattern)을 DL1-L 및 △HpADH1과 비교하였다. YPD(2% 글루코스) 및 YPE(2% 에탄올)에서 배양된 이들 균주의 세포 파쇄액을 Native PAGE 로 분리하였다. 겔 하나는 ADH 활성 검출을 위해 염색하였고, 동시에 다른 겔은 쿠마시 브릴리언트 블루 용액으로 염색하여 대조군 겔로 이용하였다. NAD+-의존성 에탄올 산화와 관련하여, 도 2A에서 나타난 것과 같이 글루코스 및 에탄올 배지에서 H. polymorpha DL1-L로부터 최소한 4개의 ADH 밴드가 뚜렷하게 나타난 것이 관찰되었다. 본 발명에서 관찰한 H. polymorpha DL1-L의 ADH 이소자임 발현 양상은 메탄올-배양된 H. polymorpha CBS4732의 이소자임 패턴에 상응하나, 자일로스(xylose)-배양된 NCYC495세포로부터 유래된 것과는 약간의 차이를 보였다. 그 경우, ADH 이소자임 하나가 추가적으로 나타났으며, 이는 자일로스와 같이 다른 탄소원에 대한 반응의 결과로 보인다. 본 발명에서 관찰한 바에 의하면 △ HpADH1 균주에서는 이소자임 하나가 전혀 존재하지 않았으므로, 이것이 HpADH1일 것으로 판단된다. 더구나, △HpADH1균주의 세포 파쇄액의 ADH 활성을 분석한 결과 전체 ADH 활성이 야생형 균주인 DL1-L 균주에 비해 6%만이 남아있는 것으로 확인되었다(도 2B). 한편 상기 이소자임은 글루코스 또는 에탄올 배지 양쪽 모두에서 강하게 발현되었다.
To confirm the physiological role of HpADH1, as described above, Hp ADH1 by two-step PCR and intracellular recombination methods The gene was deleted ( ΔHpADH1 ). After chromosomal DNA of the obtained mutant candidate strain was purified, PCR was performed using ΔADH1NF and ΔADH1CR as primers to confirm Hp ADH1 deletion. Unlike the wild type, which was detected as a 2.9 kb fragment, the ADH1 deletion mutant ( ΔHpADH1 ) was detected in the presence of a 3.5 kb fragment. The electrophoretic pattern of ADH isozyme was then compared with DL1-L and ΔHpADH1 . Cell lysates of these strains cultured in YPD (2% glucose) and YPE (2% ethanol) were separated by Native PAGE. One gel was stained for ADH activity detection, while the other gel was stained with Coomassie Brilliant Blue solution to serve as a control gel. Regarding NAD + -dependent ethanol oxidation, at least four ADH bands were clearly observed from H. polymorpha DL1-L in glucose and ethanol media as shown in Figure 2A. The ADH isozyme expression pattern of H. polymorpha DL1-L observed in the present invention corresponds to the isozyme pattern of methanol-cultured H. polymorpha CBS4732, but slightly from that derived from xylose-cultured NCYC495 cells. Showed a difference. In that case, one additional ADH isozyme appeared, which appears to be the result of reaction with other carbon sources such as xylose. As observed in the present invention, since there is no one isozyme in the Δ HpADH1 strain, it is determined that this is HpADH1. Moreover, the cell lysate of the ΔHpADH1 strain As a result of analyzing the ADH activity, it was confirmed that only 6% of the total ADH activity remained compared to the wild type strain DL1-L strain (FIG. 2B). On the other hand, isozyme was strongly expressed in both glucose or ethanol medium.

<3-4> <3-4> H. H. polymorphapolymorpha △ △ HpADH1HpADH1 결실 균주의 기능보완 (complementation) 및 과발현을 위한 For complementation and overexpression of deletion strains pDLGpDLG -- HpHp ADHADH 1One 의 제조 Manufacture

H. polymorpha DL1-L의 게놈 DNA로부터 전장 HpADH1 유전자를 증폭하기 위하여 프라이머 HpADH1F 및 HpADH1R(표 2)를 이용하여 PCR을 수행하였고 상기 PCR 산물을　 HindIII 및 SpeI 제한효소로 절단하고 이를 같은 종류의 제한효소로 절단된 pDLG 벡터에 삽입하여 PGAPDH 프로모터 및 GAPDH 전사종결 신호(terminator) 통제 하에 HpADH1 유전자가 전사되는 재조합벡터 pDLG-HpADH1를 확보하였다(도 3A). 확보한 벡터 내의 HpADH1유전자는 DNA 시퀀싱으로 확증하였다.
H. polymorpha In order to amplify the full-length Hp ADH1 gene from the genomic DNA of DL1-L, PCR was performed using primers HpADH1F and HpADH1R (Table 2), and the PCR product was cleaved with Hin dIII and Spe I restriction enzymes and the same type of restriction enzyme. P GAPDH by inserting into a pDLG vector digested with Promoter and GAPDH Recombinant vector pDLG-HpADH1 to which the HpADH1 gene is transcribed under the control of a terminator was obtained (FIG. 3A). The HpADH1 gene in the obtained vector was confirmed by DNA sequencing.

<3-5> <3-5> pDLGpDLG -- HpADH1HpADH1 벡터를 이용한 Vector HpADH1HpADH1 결실 균주의 기능보완 및 과발현  Complementary function and overexpression of deletion strains

상기 언급한 바와 같이 HpADH1 유전자를 HpADH1 결실 세포에 도입하여 HpADH1 과발현 주, 즉 pDLG-HpADH1/△HpADH1균주를 제조하였다. pDLG-HpADH1 벡터로 형질전환된 균주에서는 PGAPDH 프로모터를 통하여 HpADH1표적 단백질이 항시 발현(constitutive expression)되게 된다(도 3A). 이 벡터 상에는 루이신 영양요구성 균주인 △HpADH1에 형질전환한 후 형질전환 여부 확인 및 안정화를 위한 표지 유전자로 사용할 수 있는 Leu2 유전자를 포함하고 있다. 상기 플라스미드를 △HpADH1 결실 게놈으로 안정적으로 도입한 후 PCR로 HpADH1 유전자의 도입을 확인하였다. 형질전환 균주는 YPD 배지에서의 성장능이 회복되었으며 세포 파쇄액(lysate)의 ADH 활성을 측정한 결과 야생형 균주인 H. polymorpha DL1-L에 비하여 ADH 활성이 3배 이상 증가한 것으로 관찰되었다(도 3B). ADH 활성을 분석하기 위하여, H. polymorpha DL-1L, △HpADH1, 및 pDLG-HpADH1/△HpADH1 균주를 37℃, 180 rpm에서 24시간 동안 YPD 및 YPE 배지에서 배양하였다. 원심분리에 의해 세포를 회수한 후 세포파쇄 완충액(50 mM Tris-Cl, pH 8.0, 1 mM EDTA, 1 mM PMSF)에 다시 현탁하였으며 glass bead를 이용하여 세포를 파쇄하였다. 세포 파쇄액을 원심분리 후 상층액을 회수하여 효소활성 측정에 사용하였다.
As mentioned above, Hp ADH1 gene was introduced into HpADH1 deletion cells to prepare Hp ADH1 overexpressing strain, ie, pDLG-HpADH1 / ΔHpADH1 strain. In strains transformed with the pDLG-HpADH1 vector, the H GADH1 target protein is constitutively expressed through the P GAPDH promoter (FIG. 3A). The vector contains a Leu2 gene which can be used as a marker gene for transformation and confirmation of stabilization and stabilization after transformation into leucine auxotrophic strain △ HpADH1 . The plasmid was stably introduced into the ΔHpADH1 deletion genome, and then the introduction of the HpADH1 gene was confirmed by PCR. The transgenic strains recovered the growth capacity in the YPD medium and the ADH activity of the cell lysate was measured, and the ADH activity was observed to be increased more than three times compared to the wild type strain H. polymorpha DL1-L (FIG. 3B). . To analyze ADH activity, H. polymorpha DL-1L, ΔHpADH1 , and pDLG-HpADH1 / ΔHpADH1 strains were incubated in YPD and YPE media for 24 hours at 37 ° C., 180 rpm. After the cells were recovered by centrifugation, the cells were resuspended in cell disruption buffer (50 mM Tris-Cl, pH 8.0, 1 mM EDTA, 1 mM PMSF), and the cells were disrupted using glass beads. The cell lysate was centrifuged and the supernatant was collected and used for the enzyme activity measurement.

<3-6> 세포 증식에 있어 <3-6> in cell proliferation HpADH1HpADH1 의 영향 Influence of

YPD 및 YPE 액체 배지에서 야생형 및 HpADH1결실 돌연변이 세포의 성장을 분석하였다. 글루코스 배지에서, HpADH1 결실 세포는 DL1-L 세포에 비하여 성장이 훨씬 저해되었다. 그러나 이러한 성장저해 표현형은 pDLG-HpADH1/△HpADH1 형질전환 균주에서는 제거되었다. 글루코스 배지에서와는 달리, 에탄올 배지에서는 모든 균주들이 비슷한 비율로 자랐다(도4). 그러나 에탄올 배지에서 8시간 배양한 후에는 △H pAD H1 결실 균주 및 pDLG-HpADH1/△ HpADH1 형질전환 균주 모두 에탄올에 의하여 성장이 약간 느려졌다.
Wild-type and HpADH1 Deletion in YPD and YPE Liquid Medium Growth of mutant cells was analyzed. In glucose medium, HpADH1 deletion cells were much inhibited in growth compared to DL1-L cells. However, this inhibitory phenotype was eliminated in the pDLG-HpADH1 / Δ HpADH1 transgenic strains. Unlike in glucose medium, all strains grew in similar proportions in ethanol medium (FIG. 4). However, after 8 h incubation in ethanol medium △ H pAD the H1 deletion strain and pDLG-HpADH1 / △ HpADH1 transformants grown by the ethanol conversion all strains were relatively slow.

<< 실시예Example 4> 에탄올 생산  4> Ethanol Production

<4-1> 에탄올 생산 <4-1> Ethanol Production

야생형인 H. polymorpha DL1-L과 비교하여 △HpADH1 결실 변이주 및 pDLG-HpADH1/△HpADH1기능보완 형질전환균주에 대하여 에탄올 발효능을 평가하였다. 단일 탄소원으로 10% 글루코스나 10% 글리세롤 그리고 아미노산을 보충한 semisynthetic YNB(SYNB) 배지 100 ㎖이 들어있는 250 ㎖ 플라스크에 세포를 배양하였다(Ryabova, O. B., O. M. Chmil, and A. A. Sibirny. 2003. Xylose and cellobiose fermentation to ethanol by the thermotolerant methylotrophic yeast Hansenula polymorpha. FEMS Yeast Res 4:157-164). 5 일 내지 6일 동안 호흡-발효(respiro-fermentative) 조건 하(100rpm), 37℃에서 배양하였다. 생체량(biomass)은 OD660으로부터 계산하였다(Hyun Ah Kang, W. K., Won-Kyuong Hong, Moo Woong Kim, Jeong-Yoon Kim, Jung-Hoon Sohn, Eui-Sung Choi, Keun-Bum Choe, Sang Ki Rhee. 2001. Development of expression systems for the production of recombinant human serum albumin using the MOX promoter in Hansenula polymorpha DL-1. Biotechnology and Bioengineering 76:175-185). 제조업체의 메뉴얼에 따라 EnzyChromTM 에탄올 분석 키트(ECET-100, BioAssay Systems)를 이용하여 에탄올을 정량하였다.
Ethanol fermentation ability was evaluated for ΔHpADH1 deletion mutant and pDLG-HpADH1 / ΔHpADH1 functionally transformed strains compared to wild type H. polymorpha DL1-L. Cells were cultured in 250 ml flasks containing 100 ml of semisynthetic YNB (SYNB) medium supplemented with 10% glucose or 10% glycerol and amino acids as a single carbon source (Ryabova, OB, OM Chmil, and AA Sibirny. 2003. Xylose and cellobiose fermentation to ethanol by the thermotolerant methylotrophic yeast Hansenula polymorpha . FEMS Yeast Res 4: 157-164). Cultures were carried out at 37 ° C. under respiro-fermentative conditions (100 rpm) for 5-6 days. Biomass was calculated from OD 660 (Hyun Ah Kang, WK, Won-Kyuong Hong, Moo Woong Kim, Jeong-Yoon Kim, Jung-Hoon Sohn, Eui-Sung Choi, Keun-Bum Choe, Sang Ki Rhee. 2001. Development of expression systems for the production of recombinant human serum albumin using the MOX promoter in Hansenula polymorpha DL-1.Biotechnology and Bioengineering 76: 175-185). Ethanol was quantified using the EnzyChrom ™ Ethanol Assay Kit (ECET-100, BioAssay Systems) according to the manufacturer's manual.

<4-2> <4-2> 글루코스Glucose 및 글리세롤로부터 에탄올의 생산  And production of ethanol from glycerol

에탄올 형성에 있어 HpADH1의 결실 및 과발현 효과를 평가하기 위하여, 호흡-발효 조건 하, H. polymorpha DL1-L, △HpADH1, 및 pDLG-HpADH1/△HpADH1 균주의 글루코스 및 글리세롤(도 5)로부터 에탄올 생산을 측정하였다. 글루코스 배지의 경우, △HpADH1의 생장은 1~3일째에, 다른 균주들에 비하여 명백하게 저조하였다. 4~5일 사이에서는 HpADH1과 DL1-L의 생체량은 비슷해졌다. 반면, pDLG-HpADH1/△HpADH1 형질전환 균주의 경우 배양 초기 그 성장속도가 타 균주들에 비해 매우 빨랐으며 2일을 정점으로 완만하게 감소하였다. 배양 중 각 균주의 생체량 변화양상과 마찬가지로 에탄올 생산량에 있어서도 pDLG-HpADH1/△HpADH1 형질전환 균주가 배양 4일째에 36 g/l에 달하는 가장 높은 에탄올 생산량을 보인데 반하여, △HpADH1균주는 DL1-L의 30% 수준의 에탄올 생산능을 보였다.　 Deletion and Overexpression of HpADH1 in Ethanol Formation To assess, ethanol production was measured from glucose and glycerol (FIG. 5) of H. polymorpha DL1-L, ΔHpADH1, and pDLG-HpADH1 / ΔHpADH1 strains under respiratory-fermentation conditions. In the case of glucose medium, the growth of ΔHpADH1 was clearly lower than that of the other strains on the 1st to 3rd day. Between 4 and 5 days, biomass of HpADH1 and DL1-L were comparable. On the other hand, the growth rate of pDLG-HpADH1 / ΔHpADH1 transformed strain was much faster than that of other strains and gradually decreased to 2 days. As with the changes in the biomass of each strain during the cultivation, the pDLG-HpADH1 / ΔHpADH1 transgenic strain showed the highest ethanol yield of 36 g / l on the 4th day of culture, whereas the ΔHpADH1 strain was DL1-L. Showed 30% of ethanol production capacity.

글리세롤 배지에서 발효시키는 경우 모든 균주가 비슷한 성장 패턴을 보였으나, pDLG-HpADH1/△HpADH1 형질전환 균주는 4~6일 동안 여전히 완만하지만 지속적인 성장을 유지하였다. DL1-L과 pDLG-HpADH1/△HpADH1 형질전환 균주의 에탄올 생산량이 비슷한 반면, 글루코스 배지에서와 마찬가지로, △HpADH1균주는 에탄올을 거의 생산하지 못하였다. 5일째 pDLG-HpADH1/△HpADH1 형질전환 균주의 에탄올 생산 수준은 DL1-L의 생산 수준보다 약간 높았다.
When fermented in glycerol medium, all strains showed similar growth patterns, but the pDLG-HpADH1 / ΔHpADH1 transgenic strains remained gentle but sustained growth for 4-6 days. While the ethanol production of the DL1-L and pDLG-HpADH1 / ΔHpADH1 transgenic strains was similar, the ΔHpADH1 strain produced little ethanol as in the glucose medium. Day 5 Ethanol production levels of the pDLG-HpADH1 / ΔHpADH1 transgenic strains were slightly higher than the production levels of DL1-L.

본 발명은 글루코스 및 글리세롤로부터 에탄올을 생산하는 방법 및 상기 에탄올을 생산하는 재조합 효모 등을 제공한다. 고온 내성, 오탄당인 자일로스 발효능, 각종 독성물질에 대한 내성 등으로 바이오매스를 이용한 바이오에탄올을 생산하기 위한 우수한 균주로 개발될 수 있는 한세눌라 폴리모파를 이용한 에탄올 생산 방법을 제공한다. 또한 바이오디젤의 부산물인 글리세롤을 이용하여 바이오에탄올을 생산함으로써 종래 식량자원을 원료로 이용하는 한계가 있었던 바이오에탄올 생산방법의 문제점을 해결하며, 바이오연료 본래의 목적에 더욱 부합하는 방안을 제시한다. The present invention provides a method for producing ethanol from glucose and glycerol, recombinant yeast for producing the ethanol and the like. It provides an ethanol production method using Hanshenula polymorpha which can be developed as an excellent strain for producing bioethanol using biomass due to high temperature resistance, xylose fermentation ability of pentose sugar, resistance to various toxic substances and the like. In addition, by producing bioethanol using glycerol as a by-product of biodiesel, it solves the problem of the conventional method of producing a bioethanol, which has a limitation of using a conventional food resource as a raw material, and proposes a method more suitable for the purpose of biofuel.

<110> korea Research Institute of Bioscience and Biotechnology <120> New dehydrogenase HpADH1 and a method for preparing bioethanol using it <130> 9p-06-61 <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 349 <212> PRT <213> Hansenula polymorpha <400> 1 Met Thr Ser Ile Pro Lys Thr Gln Lys Ala Val Val Phe Glu Thr Asn 1 5 10 15 Gly Gly Pro Leu Leu Tyr Lys Asp Ile Pro Val Pro Gln Pro Lys Pro 20 25 30 Asn Glu Ile Leu Val Asn Val Lys Tyr Ser Gly Val Cys His Thr Asp 35 40 45 Leu His Ala Trp Lys Gly Asp Trp Pro Leu Asp Thr Lys Leu Pro Leu 50 55 60 Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala Lys Gly Ala Asn 65 70 75 80 Val Thr Asn Phe Glu Ile Gly Asp Tyr Ala Gly Ile Lys Trp Leu Asn 85 90 95 Gly Ser Cys Met Gly Cys Glu Phe Cys Gln Gln Gly Ala Glu Pro Asn 100 105 110 Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr His Asp Gly Ser Phe Gln 115 120 125 Gln Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Lys Gly 130 135 140 Thr Asn Leu Ala Asp Val Ala Pro Ile Leu Cys Ala Gly Val Thr Val 145 150 155 160 Tyr Lys Ala Leu Lys Thr Ala Glu Leu Ser Pro Gly Gln Trp Val Ala 165 170 175 Ile Ser Gly Ala Gly Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr Ala 180 185 190 Val Ala Met Gly Leu Arg Val Leu Gly Ile Asp Gly Gly Asp Glu Lys 195 200 205 Ala Lys Leu Phe Glu Ser Leu Gly Gly Glu Val Phe Ile Asp Phe Thr 210 215 220 Lys Glu Lys Asp Ile Val Gly Ala Val Gln Lys Ala Thr Asn Gly Gly 225 230 235 240 Pro His Gly Val Ile Asn Val Ser Val Ser Pro Ala Ala Ile Ser Gln 245 250 255 Ser Cys Gln Tyr Val Arg Thr Leu Gly Lys Val Val Leu Val Gly Leu 260 265 270 Pro Ala Gly Ala Val Cys Glu Ser Pro Val Phe Glu His Val Ile Lys 275 280 285 Ser Ile Gln Ile Arg Gly Ser Tyr Val Gly Asn Arg Gln Asp Thr Ala 290 295 300 Glu Ser Ile Asp Phe Phe Val Arg Gly Lys Val Lys Ala Pro Ile Lys 305 310 315 320 Val Val Gly Leu Ser Glu Leu Pro Lys Val Phe Glu Leu Met Glu Gln 325 330 335 Gly Lys Ile Ala Gly Arg Tyr Val Leu Asp Thr Ser Lys 340 345 <210> 2 <211> 1050 <212> DNA <213> Hansenula polymorpha <400> 2 atgacttcca ttccaaagac tcaaaaggcc gttgttttcg agaccaacgg tggtcctctt 60 ctctacaagg acatccctgt tccacaacca aagccaaatg agattcttgt caacgtcaag 120 tactccggtg tttgccacac cgatctccac gcttggaagg gtgactggcc attggacacc 180 aaacttccac tggtcggtgg tcacgagggt gctggtgttg ttgttgctaa gggtgccaac 240 gttaccaact ttgaaatcgg tgactacgct ggtatcaaat ggttgaacgg ctcgtgcatg 300 ggttgtgagt tctgtcaaca aggtgcagag ccaaactgtc ctgaggccga cctttccggt 360 tacacgcacg acggttcttt ccaacaatac gccactgctg atgctgtcca ggctgccaag 420 attccaaagg gaactaacct ggctgacgtt gctccaattc tctgtgctgg tgtcactgtg 480 tacaaggcat tgaagactgc cgaattgagc ccaggccaat gggttgctat ctctggtgct 540 ggtggaggat tgggttctct tgccgttcaa tacgctgtcg ccatgggcct gagagtcctg 600 ggtatcgatg gtggtgacga aaaggctaag ctcttcgaga gcttgggcgg agaagtcttc 660 atcgatttca ccaaggaaaa ggacattgtc ggagccgtcc agaaggcaac caacggtggt 720 ccacacggtg ttatcaacgt ttctgtgtct ccagcagcta tctctcaatc ctgccaatac 780 gtgagaactc ttggtaaggt tgttcttgtt ggtcttccag ccggtgctgt ttgcgagtct 840 ccagttttcg agcacgttat caagtctatc cagattagag gttcctacgt tggtaacaga 900 caggacactg ccgagtcgat tgacttcttc gtcagaggca aggttaaggc tccaatcaag 960 gttgttggcc tttctgagct gccaaaggtg ttcgagttga tggagcaagg aaagattgct 1020 ggaagatacg ttcttgacac ttccaaatag 1050 <110> korea Research Institute of Bioscience and Biotechnology <120> New dehydrogenase HpADH1 and a method for preparing bioethanol          using it <130> 9p-06-61 <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 349 <212> PRT <213> Hansenula polymorpha <400> 1 Met Thr Ser Ile Pro Lys Thr Gln Lys Ala Val Val Phe Glu Thr Asn   1 5 10 15 Gly Gly Pro Leu Leu Tyr Lys Asp Ile Pro Val Pro Gln Pro Lys Pro              20 25 30 Asn Glu Ile Leu Val Asn Val Lys Tyr Ser Gly Val Cys His Thr Asp          35 40 45 Leu His Ala Trp Lys Gly Asp Trp Pro Leu Asp Thr Lys Leu Pro Leu      50 55 60 Val Gly Gly His Glu Gly Ala Gly Val Val Val Ala Lys Gly Ala Asn  65 70 75 80 Val Thr Asn Phe Glu Ile Gly Asp Tyr Ala Gly Ile Lys Trp Leu Asn                  85 90 95 Gly Ser Cys Met Gly Cys Glu Phe Cys Gln Gln Gly Ala Glu Pro Asn             100 105 110 Cys Pro Glu Ala Asp Leu Ser Gly Tyr Thr His Asp Gly Ser Phe Gln         115 120 125 Gln Tyr Ala Thr Ala Asp Ala Val Gln Ala Ala Lys Ile Pro Lys Gly     130 135 140 Thr Asn Leu Ala Asp Val Ala Pro Ile Leu Cys Ala Gly Val Thr Val 145 150 155 160 Tyr Lys Ala Leu Lys Thr Ala Glu Leu Ser Pro Gly Gln Trp Val Ala                 165 170 175 Ile Ser Gly Ala Gly Gly Gly Leu Gly Ser Leu Ala Val Gln Tyr Ala             180 185 190 Val Ala Met Gly Leu Arg Val Leu Gly Ile Asp Gly Gly Asp Glu Lys         195 200 205 Ala Lys Leu Phe Glu Ser Leu Gly Gly Glu Val Phe Ile Asp Phe Thr     210 215 220 Lys Glu Lys Asp Ile Val Gly Ala Val Gln Lys Ala Thr Asn Gly Gly 225 230 235 240 Pro His Gly Val Ile Asn Val Ser Val Ser Pro Ala Ala Ile Ser Gln                 245 250 255 Ser Cys Gln Tyr Val Arg Thr Leu Gly Lys Val Val Leu Val Gly Leu             260 265 270 Pro Ala Gly Ala Val Cys Glu Ser Pro Val Phe Glu His Val Ile Lys         275 280 285 Ser Ile Gln Ile Arg Gly Ser Tyr Val Gly Asn Arg Gln Asp Thr Ala     290 295 300 Glu Ser Ile Asp Phe Phe Val Arg Gly Lys Val Lys Ala Pro Ile Lys 305 310 315 320 Val Val Gly Leu Ser Glu Leu Pro Lys Val Phe Glu Leu Met Glu Gln                 325 330 335 Gly Lys Ile Ala Gly Arg Tyr Val Leu Asp Thr Ser Lys             340 345 <210> 2 <211> 1050 <212> DNA <213> Hansenula polymorpha <400> 2 atgacttcca ttccaaagac tcaaaaggcc gttgttttcg agaccaacgg tggtcctctt 60 ctctacaagg acatccctgt tccacaacca aagccaaatg agattcttgt caacgtcaag 120 tactccggtg tttgccacac cgatctccac gcttggaagg gtgactggcc attggacacc 180 aaacttccac tggtcggtgg tcacgagggt gctggtgttg ttgttgctaa gggtgccaac 240 gttaccaact ttgaaatcgg tgactacgct ggtatcaaat ggttgaacgg ctcgtgcatg 300 ggttgtgagt tctgtcaaca aggtgcagag ccaaactgtc ctgaggccga cctttccggt 360 tacacgcacg acggttcttt ccaacaatac gccactgctg atgctgtcca ggctgccaag 420 attccaaagg gaactaacct ggctgacgtt gctccaattc tctgtgctgg tgtcactgtg 480 tacaaggcat tgaagactgc cgaattgagc ccaggccaat gggttgctat ctctggtgct 540 ggtggaggat tgggttctct tgccgttcaa tacgctgtcg ccatgggcct gagagtcctg 600 ggtatcgatg gtggtgacga aaaggctaag ctcttcgaga gcttgggcgg agaagtcttc 660 atcgatttca ccaaggaaaa ggacattgtc ggagccgtcc agaaggcaac caacggtggt 720 ccacacggtg ttatcaacgt ttctgtgtct ccagcagcta tctctcaatc ctgccaatac 780 gtgagaactc ttggtaaggt tgttcttgtt ggtcttccag ccggtgctgt ttgcgagtct 840 ccagttttcg agcacgttat caagtctatc cagattagag gttcctacgt tggtaacaga 900 caggacactg ccgagtcgat tgacttcttc gtcagaggca aggttaaggc tccaatcaag 960 gttgttggcc tttctgagct gccaaaggtg ttcgagttga tggagcaagg aaagattgct 1020 ggaagatacg ttcttgacac ttccaaatag 1050

Claims (17)

알코올 탈수소효소 활성을 갖는, 하기 (ⅰ) 내지 (ⅳ) 중 어느 하나의 폴리펩티드:
(ⅰ) 서열번호 1의 아미노산 서열로 구성되는 폴리펩티드;
(ⅱ) 서열번호 1로 구성되는 아미노산 서열과 90% 이상의 상동성을 갖는 폴리펩티드;
(ⅲ) 서열번호 2로 구성되는 폴리뉴클레오티드 서열에 의하여 코드되는 폴리펩티드; 및
(ⅳ) 서열번호 2로 구성되는 폴리뉴클레오티드와 엄격한 조건 하에서 혼성화하는 폴리뉴클레오티드에 의하여 코드되는 폴리펩티드.
A polypeptide of any one of (i) to (iii) having alcohol dehydrogenase activity:
(Iii) a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1;
(Ii) a polypeptide having at least 90% homology with the amino acid sequence consisting of SEQ ID NO: 1;
(Iii) a polypeptide encoded by a polynucleotide sequence consisting of SEQ ID NO: 2; And
(Iii) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of SEQ ID NO: 2.
제 1항의 폴리펩티드를 코드하는 폴리뉴클레오티드.
A polynucleotide encoding the polypeptide of claim 1.
제 2항에 있어, 서열번호 2로 기재되는 것을 특징으로 하는 폴리뉴클레오티드.
The polynucleotide of claim 2, wherein the polynucleotide is set forth in SEQ ID NO: 2. 6.
서열번호 1의 아미노산 서열을 코드하는 폴리뉴클레오티드 또는 서열번호 2의 DNA 서열로 구성되는 폴리뉴클레오티드와 엄격한 조건 하에서 혼성화되며, 에탄올 탈수소효소 활성을 갖는 단백질을 코드하는 것을 특징으로 하는 폴리뉴클레오티드.
A polynucleotide that hybridizes under strict conditions with a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1 or the DNA sequence of SEQ ID NO: 2, and encodes a protein having ethanol dehydrogenase activity.
제 2항 내지 제 4항 중 어느 한 항의 폴리뉴클레오티드를 포함하는 벡터.
A vector comprising the polynucleotide of any one of claims 2-4.
제 5항의 벡터로 숙주세포를 형질전환한 형질전환체.
The transformant transformed the host cell with the vector of claim 5.
제 6항에 있어, 상기 숙주세포는 박테리아 또는 효모인 것을 특징으로 하는 형질전환체.
The transformant of claim 6, wherein the host cell is a bacterium or a yeast.
제 7항에 있어 상기 박테리아는 스타필로코코스 에우리우스(Staphylococcus aureus), 대장균(E. coli), 바실러스 세레우스(B. cereus), 살모넬라 타이피뮤림(Salmonella typimurium), 살모넬라 콜레라수이스(Salmonella choleraesuis), 여시니아 엔테로콜리티카(Yersinia enterocolitica) 및 리스테리아 모노사이토게네스
(Listeria monocytogenes)로 이루어진 군으로부터 선택되는 것을 특징으로 하는 형질전환체.
8. The bacterium of claim 7, wherein the bacterium is Staphylococcus aureus, E. coli, B. cereus, Salmonella typimurium, Salmonella choleraesuis. ), Yersinia enterocolitica and Listeria monocytogenes
(Listeria monocytogenes), characterized in that the transformant is selected from the group consisting of.
제 7항에 있어서, 상기 효모는 피키아(Pichia), 한세눌라(Hansenula) 또는 캔디다(Candida)속에 속하는 것을 특징으로 하는 형질전환체.
The transformant of claim 7, wherein the yeast belongs to the genus Pichia, Hansenula or Candida.
제 9항에 있어서, 상기 효모는 한세눌라 폴리모파(Hansenula polymorpha)인 것을 특징으로 하는 형질전환체.
The transformant of claim 9, wherein the yeast is Hansenula polymorpha .
1) 제 5항의 벡터로 숙주세포를 형질전환시켜 형질전환체를 제조하는 단계;
2) 단계 1)의 형질전환체를 탄소원을 포함하는 배지 내에서 배양하는 단계; 및
3) 단계 2)의 배지로부터 에탄올을 회수하는 단계를 포함하는 에탄올의 제조 방법.
1) preparing a transformant by transforming the host cell with the vector of claim 5;
2) culturing the transformant of step 1) in a medium containing a carbon source; And
3) A method for producing ethanol comprising recovering ethanol from the medium of step 2).
제 11항에 있어서, 상기 단계 1)의 숙주세포는 박테리아 또는 효모인 것을 특징으로 하는 에탄올의 제조 방법.
12. The method according to claim 11, wherein the host cell of step 1) is bacteria or yeast.
제 12항에 있어서, 상기 숙주세포는 스타필로코코스 에우리우스(Staphylococcus aureus), 대장균(E. coli), 바실러스 세레우스(B. cereus), 살모넬라 타이피뮤림(Salmonella typimurium), 살모넬라 콜레라수이스(Salmonella choleraesuis), 여시니아 엔테로콜리티카(Yersinia enterocolitica) 및 리스테리아 모노사이토게네스(Listeria monocytogenes)로 이루어진 군으로부터 선택되는 것을 특징으로 하는 제조 방법.
The method of claim 12, wherein the host cell Staphylococcus aureus (E. coli), Bacillus cereus (B. cereus), Salmonella typimurium (Salmonella typimurium), Salmonella cholerasus ( Salmonella choleraesuis), Yesinia enterocolitica and Listeria monocytogenes.
제 12항에 있어서, 상기 효모는 피키아(Pichia), 한세눌라(Hansenula) 또는 캔디다(Candida)속에 속하는 것을 특징으로 하는 제조 방법.
The method of claim 12, wherein the yeast belongs to the genus Pichia, Hansenula or Candida.
제 14항에 있어서, 상기 효모는 한세눌라 폴리모파(Hansenula polymorpha)인 것을 특징으로 하는 제조 방법.
The method of claim 14, wherein the yeast is Hansenula polymorpha .
제 11항에 있어서, 상기 탄소원은 녹말, 셀룰로스, 오탄당, 육탄당 또는 글리세롤인 것을 특징으로 하는 제조 방법.
The method according to claim 11, wherein the carbon source is starch, cellulose, pentose sugar, hexose sugar or glycerol.
제 16항에 있어서, 상기 탄소원은 자일로스, 글루코스, 아라비노스, 만노스 및 갈락토스인 것을 특징으로 하는 제조 방법.The method of claim 16 wherein the carbon source is xylose, glucose, arabinose, mannose and galactose.
KR1020100069048A 2009-07-17 2010-07-16 New alcohol dehydrogenase HpADH1 and a method for preparing bioethanol using it KR101240507B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020090065575 2009-07-17
KR20090065575 2009-07-17

Publications (2)

Publication Number Publication Date
KR20110007981A true KR20110007981A (en) 2011-01-25
KR101240507B1 KR101240507B1 (en) 2013-03-11

Family

ID=43614301

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100069048A KR101240507B1 (en) 2009-07-17 2010-07-16 New alcohol dehydrogenase HpADH1 and a method for preparing bioethanol using it

Country Status (1)

Country Link
KR (1) KR101240507B1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012141547A2 (en) * 2011-04-13 2012-10-18 한국생명공학연구원 Enhanced-activity modified beta-glucosidase and a manufacturing method for bioethanol using same
WO2013081700A1 (en) * 2011-11-29 2013-06-06 Codexis, Inc. Overexpression of genes that improve fermentation in yeast using cellulosic substrates
KR20160131238A (en) 2015-05-06 2016-11-16 한양대학교 산학협력단 Novel strain having C4 and C6 organic acid producing capacity, and method for producing bio-fuel using the strain
US9567576B2 (en) 2012-10-29 2017-02-14 Sogang University Research Foundation Strain expressing FRSA and method for producing ethanol using same

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1932014B (en) * 2005-09-13 2012-05-30 三得利控股株式会社 Alcohol acetyl transferase gene and use thereof
EP1991669A1 (en) * 2006-03-01 2008-11-19 Suntory Limited Glycerol-3-phosphate dehydrogenase gene and use thereof

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012141547A2 (en) * 2011-04-13 2012-10-18 한국생명공학연구원 Enhanced-activity modified beta-glucosidase and a manufacturing method for bioethanol using same
WO2012141547A3 (en) * 2011-04-13 2013-01-10 한국생명공학연구원 Enhanced-activity modified beta-glucosidase and a manufacturing method for bioethanol using same
US9719112B2 (en) 2011-04-13 2017-08-01 Korea Research Insitute of Bioscience and Biotechnology Mutant beta-glucosidases having enhanced activity and a method for producing bioethanol using the same
WO2013081700A1 (en) * 2011-11-29 2013-06-06 Codexis, Inc. Overexpression of genes that improve fermentation in yeast using cellulosic substrates
US9567576B2 (en) 2012-10-29 2017-02-14 Sogang University Research Foundation Strain expressing FRSA and method for producing ethanol using same
KR20160131238A (en) 2015-05-06 2016-11-16 한양대학교 산학협력단 Novel strain having C4 and C6 organic acid producing capacity, and method for producing bio-fuel using the strain

Also Published As

Publication number Publication date
KR101240507B1 (en) 2013-03-11

Similar Documents

Publication Publication Date Title
US11203741B2 (en) Glycerol free ethanol production
EP2222860B1 (en) Method of modifying a yeast cell for the production of ethanol
US7833764B2 (en) DNA encoding xylitol dehydrogenase
US20090053784A1 (en) Expression of an active carrier from xylose in genetically modified saccharomyces cerevisae
CN114774477A (en) Method for producing ethanol using recombinant yeast
EP3559234B1 (en) Recombinant yeast strains for pentose fermentation
CA3077115A1 (en) Improved glycerol free ethanol production
CN110741014A (en) Yeast with improved alcohol production
KR101240507B1 (en) New alcohol dehydrogenase HpADH1 and a method for preparing bioethanol using it
KR101220430B1 (en) New alcohol dehydrogenase HpADH3 and a method for preparing bioethanol using it
Suwannarangsee et al. Characterization of alcohol dehydrogenase 3 of the thermotolerant methylotrophic yeast Hansenula polymorpha
EP3762499B1 (en) Reduction in acetate production by yeast over-expressing pab1
US8748152B1 (en) Prevotella ruminicola xylose isomerase and co-expression with xylulokinase in yeast for xylose fermentation
JP5827055B2 (en) Mutant yeast belonging to the genus Kluyveromyces and method for producing ethanol using the same
US11414683B2 (en) Acetic acid consuming strain
CN115552016A (en) Reduction of acetic acid production by yeast overexpressing MIG polypeptides
CN112752845A (en) Increased alcohol production from yeast producing increased amounts of active CRZ1 protein
CN112384609A (en) Overexpression of transcriptional activator/repressor GIS1 in yeast for increased ethanol production
CN112105726A (en) Compositions and methods for increasing ethanol production by yeast using GCY1 and DAK1
EP3034611B1 (en) Yeast cell-producing lactate with reduced activity of rim15 and igo2.
CN111201313B (en) Increasing ethanol production by yeast with constitutive transcriptional activator MAL alleles
JP2007504813A (en) NADH-dependent L-xylulose reductase
WO2023079050A1 (en) Recombinant yeast cell
CN118159649A (en) Yeast reduced production of acetic acid by reduced RSF2 or TDA9 expression
CN117396608A (en) Increasing ethanol production by overexpression of KGD2 in yeast

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20160121

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20170224

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20180105

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20181226

Year of fee payment: 18