KR20100130168A - Primer set for amplifying target sequences of grass pathogens and use thereof - Google Patents

Abstract

PURPOSE: A primer for amplifying a target sequence to detect lawn grass pathogen is provided to accurately identify pathogen and to reduce the use of agricultural chemical. CONSTITUTION: A primer for detecting Pythium aphanidermatum comprises a primer set having sequence numbers 1 and 2. A primer for detecting Rhizoctonia solani contains a primer set of sequence numbers 3 and 4. A primer for detecting Magnaporthe grisea contains a primer set of sequence numbers 5 and 6. A primer for detecting Curvularia trifolii contains a primer set for sequence numbers 7 and 8. A method for detecting Pythium pathogen comprises: a step of obtaining a grass sample and isolating DNA form the sample; a step of amplifying a target sequence by PCR; and a step of detecting the PCR product.

Description

Primer Set for Amplifying Target Sequences of Grass Pathogens and Use Thereof}

The present invention relates to primers for target sequence amplification for the detection of turf pathogens and their use.

In Jeju Island, 34 places (10% of 314 golf courses nationwide) are operated as membership and public golf courses, and these golf courses are used as important tourist resources. However, these golf courses use 16.8kg / ha of pesticides, 31% more than the national average pesticide use in 2007 (Ministry of Environment, 2007, National Park Golf Pesticide Application), which promotes environmental tourism based on cleanliness. This has a negative impact on the image, and concerns about pesticide contamination in groundwater and soil. Pesticides used in golf courses in Jeju Island are used in the order of fungicides, insecticides, herbicides, electrodeposition agents, and growth regulators, and the rate of fungicides for controlling grass diseases is more than half of the total pesticide use. , 2008, A Study on the Establishment of Pesticide and Fertilizer Use Guidelines for Golf Courses in Jeju, Jeju Special Self-Governing Province, Vol. 18).

In-depth study of the disease caused grass golf course is in Tokyo but a bar made so far, when determining, based on the control Pesticides used Pitti help fungi (Phytium spp . Pitium and Rhizoctonia solani cause large patches, etc., and estradiol, iprodione, and tebuconazole are most commonly used. 2008).

 There are various methods for the detection and diagnosis of plant pathogens by visual diagnosis, pathogen cultivation and various methods using antiserum. However, as molecular biological technologies have been developed recently, specific gene amplification methods using PCR are widely used. This gene amplification method is known as the best method in specificity, sensitivity, rapidity among other disease diagnosis and pathogen detection methods currently developed, and is used as an important disease diagnosis method of animals and plants.

In the field of plant diseases, most diagnostic methods for viral diseases have been developed, and many diagnostic methods for fungal and bacterial diseases that damage plants have been developed (Henson et al, 1993). Phytophtora spp . ) ( Murillo I. et al, 1998), Santomonas spp ) (Gaelle T. et al, 2001) have also been developed PCR diagnostic methods for the detection and early diagnosis of fungal and bacterial diseases.

In the case of turf disease, molecular diagnostics for major turf pathogens such as Sclerotinia homoeocarpa and Pythium spp have been reported in the United States and Japan (Raina K. et al 1997, Scott et al 2003). Nomices graminis graminis ) (Elaine W. 1995 ) and Ophiosphaerella agrostis (Kaminski JE et al 2005), the detection of grass pathogens that are less frequent and difficult to visually diagnose, and among pathogens such as Rhizoctonia solani AG 2-2 (Grosch R. 2007). PCR diagnostics have been used in a variety of ways, including selectively classifying specific pathogenic strains. However, there have been no reported cases in Korea.

In order to reduce the amount of pesticides used in golf courses, early diagnosis of grass disease and identification of accurate pathogens are made, and it is best to control them with the correct medicine at the beginning of grass disease. To this end, it is necessary to introduce molecular diagnostics such as PCR, gene sequencing, etc. into the diagnosis of turf disease, thereby developing molecular diagnostic methods for major diseases of grass such as phytium, large patch, turbulent plaque, and foliar disease.

It is an object of the present invention to provide a primer for amplifying target sequences for the detection of grass pathogens, in particular, phytium, large patches, grass blast or foliar pathogens.

Another object of the present invention to provide a method for detecting grass pathogens from a grass sample using the primer.

Another object of the present invention to provide a kit that can detect grass pathogens from grass samples using the primer.

In one aspect, the present invention is grass pathogens, in particular Pythium aphanidermatum, large patch pathogens ( Rhizoctonia solani ), grass blast pathogen ( Magnaporthe grisea ) or foliar pathogen ( Curvularia) trifolii ) relates to a primer for target sequence amplification for detection.

Specifically, a primer for gene amplification for detection of P. pellucida pathogens comprising primer sets of SEQ ID NOs: 1 and 2, a primer for gene amplification for detection of large patch pathogens comprising primer sets of SEQ ID NOs: 3 and 4, and SEQ ID NO: 5 And it relates to a primer for gene amplification for the detection of grass blast pathogens comprising a primer set of 6, and a primer for gene amplification for the detection of foliar disease pathogens comprising the primer sets of SEQ ID NO: 7 and 8.

Wherein SEQ ID NOs 1, 3, 5 and 7 are forward primers, and SEQ ID NOs 2, 4, 6 and 8 are reverse primers.

As described below, the primer of the present invention amplifies the gene of rRNA, ie, rDNA, which is the basis of its design, and the amplified product is 180 bp for phytium pathogens, 530 bp for large patch pathogens, and grass blast pathogens. It is 466bp in size and 476bp in foliar pathogen.

We select several microorganisms of the same genus but different species from each pathogen, collect the base sequence of the rRNA of the microorganism from the Gene Bank of the National Institute of Biological Information, and compare the sequence homology. However, the primers are designed by selecting only those regions that are not homologous to other similar microorganisms, and whether the primers are specific to the pathogens only. Kentucky bluegrass ( Agrostis) Peniophora spp. , a by-product fungus isolated from palustris ), and Cladosporium spp. and soil fungi, which are distributed in the air and are pathogenic to some plants such as tomatoes . In vitro Trichoderma atroviride as a control group was examined, it does not respond to the pheniophora fungus, the Cladosporium tenusum and Trichoderma atroviride only for each of the four pathogens It was confirmed that the specific reaction.

Primers of the present invention may include nucleotide analogs such as 2-amino purine, phosphorothioate, alkyl phosphorothioate, and the like, and intercalating agent).

In another aspect, the present invention is a Pythium pathogen ( Pythium) from a grass sample using the primer aphanidermatum ), Rhizoctonia solani ), grass blast pathogen ( Magnaporthe grisea ) or foliar pathogen ( Curvularia trifolii ).

Specifically, the detection method of the present invention comprises the steps of obtaining a turf sample, extracting DNA from the turf sample, amplifying a target sequence using the primer of the present invention from the extracted DNA, and detecting the amplification product thereof. It consists of steps.

In the present invention, the grass sample is meant to include all grass samples that require the detection of the pathogen, and the target sequence means rDNA as described above.

Extracting DNA from the grass sample in the present invention may be made by any method known in the art. For example, a DNA extraction kit manufactured or distributed to a method or a biotechnology company disclosed in the following examples can be used.

In addition, the step of amplifying the target sequence in the present invention may be made by methods known in the art, such as polymerase chain reaction (PCR), ligase chain reaction (ligase chain reaction), nucleic acid sequence-based amplification method (nucleic acid) a sequence-based amplification method, a transcription-based amplification system, a strand displacement amplification method, or an amplification method using a Qβ replication enzyme. Typically, nucleic acid sequences (DNA) will be amplified by PCR. The amplification method using such a PCR can also use a commercially available kit. PCR can be used for all heat resistant enzymes such as Taq enzyme, Tth enzyme, Pwo enzyme, Pfu enzyme.

In the present invention, in the detecting step, a method of labeling a target sequence with a detectable labeling material may be used to facilitate the detection. Such labeling materials may be fluorescent, phosphorescent or radioactive materials. Preferably, they are Cy2, Cy3, Cy5, etc.

In addition, the detection step in the present invention may be made through DNA chip, electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

According to another aspect of the present invention, a Pythium pathogen ( Pythium) from the grass sample using the primer aphanidermatum ), Rhizoctonia solani ), grass blast pathogen ( Magnaporthe grisea ) or foliar pathogen ( Curvularia trifolii ).

The kit of the present invention comprises the primer set of the present invention and a reagent for carrying out an amplification reaction, and may further include an instruction manual for the convenience of the user as needed.

Reagents for carrying out the amplification reaction will include polymerases, dNTPs, buffers, and the like.

As described above, Pythium pathogen of the present invention ( Pythium) aphanidermatum ), Rhizoctonia solani ), grass blast pathogen ( Magnaporthe It is possible to provide a primer set capable of specifically detecting grisea ) or a foliar pathogen ( Curvularia trifolii ), and the above-described detection method and detection kit using the primer set.

1 is a primer set of grass pathogens of the present invention, Pythium aphanidermatum, large patch pathogens ( Rhizoctonia solani ), grass blast pathogen ( Magnaporthe grisea ) and foliar pathogen ( Curvularia) electrophoresis photograph showing the specificity of detection of trifolii ).

Hereinafter, the present invention will be described with reference to Examples. However, the scope of the present invention is not limited to these examples.

Example 1 Securing Lawn Pathogens

Pythium , a grass pathogen aphanidermatum ) (KACC 40156 ), large patch pathogen ( Rhizoctonia solani ) (KACC 40119), foliar pathogen ( Curvularia trifolii ) (KACC 42614) and grass blast pathogen ( Magnaporthe grisea ) (KACC 40417) was used by the Korea Agricultural Microbial Resources Center (KACC).

Example 2 PCR Design of the primer

Pythium Pathogen aphanidermatum) Pythium aphanidermatum (GeneBank Accession No. AB355599.1) from the genus Pythium to produce a primer for the detection, Pythium arrhenomanes (GeneBank Accession No. EU162759) , Pythium catenulatum (GeneBank Accession No. EU240147) , Pythium graminicola (GeneBank Accession No. AB217664) , Pythium myriotylum (GeneBank Accession No. GU902976) Five types of rRNA and ITS sequences (rRNA and ITS sequences of each microorganism can be obtained from Acession No. above) are available from the National Institute of Biological Information NCBI Gene Bank (http: // www. ncbi.nlm.nih.gov), and collect the collected genetic information using the Genedoc program (http://www.psc.edu/biomed/genedoc/) to distinguish between conserved and non-conserved sites on each sequence Sites common to Pythium but not homologous to other fungi were determined as primer sequences. Rhizoctonia solani (GeneBank Accession No. FJ467490) , Magnaporthe Grisea (GeneBank Accession No. AB269937) and Curvularia Specific primers were prepared on the basis of rRNA and ITS sequences in the same manner as above for trifolii (GeneBank Accession No. EF600959.1).

Primer sequences prepared for each pathogen are shown in Table 1 below.

Primer sequence Grass pathogen Primer-1 (SEQ ID NO) Primer-2 (SEQ ID NO :) Pitium Pathogen CCACGTGAACCGTTGTTATG (1) GAGCCTAGACATCCACTTG (2) Large Patch GTGCACACCTTTTGCTCTTT (3) TTTACCTTGGCCACCTTTTT (4) Turf AAAACTCCAACCCCTGTGAA (5) CGTTTTACCGCGAGCTACT (6) Leaf disease CATACCTAACCGTTGCTTCG (7) TCCGAGGTCAACCTGTAAA (8)

Example 3 Specificity Test of Grass Pathogen of Primer Using PCR

In order to confirm whether each of the prepared primers specifically works with each pathogen without causing cross reactions against other fungi, the by-product fungi isolated from each pathogen and Kentucky Bluegrass. Peniophora spp . Cladosporium that is pathogenic to some plants such as tomatoes tenuissimum with soil fungus Trichoderma DNA was isolated from the atroviride and PCR was performed using the primers prepared in <Example 2> as follows. The Peniophora spp . (KACC 43366) and Cladosporium spp . (KACC 42842) and Trichoderma atroviride (KACC 40775) was distributed from Korea Agricultural Microbial Resources Center (KACC).

First, in order to separate DNA from each microorganism, each microorganism purely separated on a solid medium was scraped off using a scraper and transferred to a mortar frozen in -20 ° C. Pour liquid nitrogen into the mortar, grind each microorganism finely, and transfer a tablespoon into a 2 ml tube. Add 1 ml of extraction buffer (CTAB 2%, PEG 8000 1%, Tris-HCl 0.1M, NaCl 1.5M, EDTA 20mM, Sodium Lauryl Sarcosine 0.3%), mix well with a vibrating mixer, and react at 65 ° C for 30 minutes. I was. Since chloroform 700μL was added well mixed, and centrifuged for 5 minutes at 8,000rpm. After separating the layers, the upper layer was transferred to a new tube, 70 μl of 3M Sodium Acetate, 700 μl of isopropanol, and then turned upside down to be mixed well. After centrifugation at 7,500 rpm for 5 minutes at room temperature, the supernatant was discarded, and 700 μl of 70% ethanol was added and centrifuged at 12,000 rpm for 15 minutes. After the tube was completely dried for 1 hour in a 55 ° C. dryer, DNA was dissolved in an appropriate amount of distilled water and used for a PCR reaction.

The following PCR reaction was carried out by PCR reaction with 1 μl of the isolated DNA and dNTP, the primer of <Table 1>, Taq polymerase, and a large patch, grass fever, and foliar pathogen at 94 ° C for 5 minutes, 1 cycle, After 1 minute 29 cycles of 94 ° C 1 minute, 54 ° C 1 minute, 72 ° C 1 minute, the reaction was carried out at 72 ° C for 5 minutes. For the remaining microorganisms, 94 ° C 5 minutes 1 cycle, 94 ° C 30 seconds, 54 ° C 30 seconds, 72 After 30 cycles of 29 seconds, the reaction was carried out at 72 ° C for 5 minutes. After PCR, the reaction product was subjected to electrophoresis on 1.5% agarose gel, and the results are shown in FIG. 1.

Referring to Figure 1, the primers for each turf pathogen of <Table 1> specifically react with each of the corresponding turf pathogens without cross-reaction with other fungi, and thus each 180bp, 530bp, 466bp and 476bp sized bands. Formed. The primers of Table 1 are P. aphanidermatum , R. solani , M. grisea and Curvularia. trifolii . It can be said that it is possible to specifically detect each grass pathogen.

Example 4 Investigation of Infection Conditions of Pathogens Using PCR in Lawn Samples of Golf Courses and Turfgrasses

After the grass sample was put in a mortar and pestle, the liquid nitrogen was poured and crushed. Then, DNA was extracted in the same manner as in the same extraction procedure as in <Example 3>.

In order to confirm that complex infection and misdiagnosis of grass pathogens of golf courses and lawns can cause misuse of pesticides, grass samples that are not completely cured after control are taken from each golf course and lawn in the province. Isolated, and from these DNA large patch pathogens (Rhizoctonia solani), Pythium Pathogen (Pythium spp), Turbulent pathogen (Magnaporthe grisea), Foliar pathogen (Curvularia trifolii), The infection status was investigated.

As shown in Table 2 below, it was confirmed that more than two species of grass pathogens were complex-infected in 17 samples out of 22 samples, and three of them were also complex-infected. In many cases, Rhizoctonia solani is a Pythium bacterium. spp ) and multiple infections, and Magnaporthe grisea ) is a foliar pathogen ( Curvularia) trifolii ) and complex infections. This means that there is an interaction between pathogens when turf disease occurs, and this interaction should be taken into consideration when selecting a medicine after diagnosis of the disease. In recent years, golf pesticides have been introduced to a wide range of antifungal agents that have a broad spectrum of applications than single agents for specific pathogens. In addition, a combination of two or more ingredients, such as erythridiazole and polyoxine-D, erythridiazole and hexaconazole, has been released to allow it to act on various pathogens. The disease is not completely controlled, and complex infection of grass pathogens is a problem in the golf course environment.

Large Patch Pathogen of Grass Samples ( Rhizoctonia) solani ), Pythium aphanidermatum , Turfgrass pathogen ( Magnaporthe grisea ), Infection patterns of foliar pathogen ( Curvularia trifolii. )
number Pitium Pathogen
( Pythium aphanidermatu m) Large Patch Pathogen
( Rhizoctonia solani ) Turbulent pathogen
( Magnaporthe grisea ) Foliar pathogen
( Curvularia trifolii ) R-1 - - - - R-2 + + - - R-3 - - + + R-4 - - + + R-5 - - + + R-6 + + - - R-7 - - - - JZ -One - - + + JZ -2 - - + + JZ -3 + + - - JZ -4 - - - - JZ -5 - - + + A-1 - - + + A-2 - - + + A-3 - - + + A-4 - - - - A-5 - - + + R9 -One + - + + R9 -2 + - + + R9 -3 + - + + R9 -4 - - - R9 -5 - - + +

<110> Bio-Agr.Co          Jeju Special Self-Governing Province <120> Primer Set for Amplifying Target Sequences of Grass Pathogens and          Use Thereof <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 1 ccacgtgaac cgttgttatg 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 2 gagcctagac atccacttg 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 3 gtgcacacct tttgctcttt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 4 tttaccttgg ccaccttttt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 5 aaaactccaa cccctgtgaa 20 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 6 cgttttaccg cgagctact 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 7 catacctaac cgttgcttcg 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 8 tccgaggtca acctgtaaa 19

Claims (8)

Primer for gene amplification for detection of pitanium pathogens comprising a primer set of SEQ ID NO: 1 and 2.
A primer for gene amplification for detection of large patch pathogens comprising a primer set of SEQ ID NO: 3 and 4.
Primer for gene amplification for the detection of grass blast pathogens comprising a primer set of SEQ ID NO: 5 and 6.
Primer for gene amplification for detection of foliar disease pathogens comprising a primer set of SEQ ID NO: 7 and 8.
Obtaining a turf sample, extracting DNA from the turf sample, amplifying the target sequence by PCR using a primer set of SEQ ID NOs: 1 and 2 from the extracted DNA, and detecting the amplification product Pitium pathogen detection method composed by.
Obtaining a turf sample, extracting DNA from the turf sample, amplifying the target sequence by PCR using a primer set of SEQ ID NOs: 3 and 4 from the extracted DNA, and detecting the amplification product Large patch pathogen detection method is configured by.
Obtaining a turf sample, extracting DNA from the turf sample, amplifying the target sequence by PCR using a primer set of SEQ ID NOs: 5 and 6 from the extracted DNA, and detecting the amplification product Lawn blast pathogen detection method is configured by.
Obtaining a turf sample, extracting DNA from the turf sample, amplifying the target sequence by PCR using a primer set of SEQ ID NOs: 7 and 8 from the extracted DNA, and detecting the amplification product Lobe disease pathogen detection method composed by.

Images