KR20100125742A - Cosmetic composition containing extract of magnolia officinalis for reducing accumulation of lipid - Google Patents

Abstract

PURPOSE: A cosmetic composition containing Magnolia officinalis extract for suppressing fat accumulation is provided to reduce triglyceride and lipid and to reduce mRNA expression of leptin, PPAR-alpha and LPL(lipoprotein lipase). CONSTITUTION: A cosmetic composition for suppressing fat accumulation contains 10-100 ug/ml of Magnolia officinalis extract as an active ingredient. The Magnolia officinalis extract is isolated by adding 10-20 weight parts of water to 1 weight part of dried Magnolia officinalis, performing hot water extraction, filtering, centrifuging at 4200-4800rpm for 50-70 minutes, and decompressing supernatant. The cosmetic composition is manufactured in the form of gel, soluble liquid, cream, essence, oil-in-water(O/W) and water-in-oil(W/O) type basic cosmetic, ointment, foundation, cleansing foam, cleansing water, soap, pack, and spray.

Description

Cosmetic composition for inhibiting fat accumulation containing thick pepper extract {Cosmetic composition containing extract of Magnolia officinalis for reducing accumulation of lipid}

The present invention relates to a cosmetic composition for inhibiting fat accumulation, and more particularly, to a cosmetic composition for inhibiting fat accumulation containing thick extract.

Obesity is recognized as a serious health problem that is on the rise in many countries around the world, and Korea is also affected by high industrial growth and globalization. In addition, circulatory disease, cancer, diabetes, etc., which are the major causes of death in Korea, are closely related to obesity.

Adipose tissue is an organ that stores energy, and forms triglycerides using energy excessively ingested due to food intake. Triglycerides travel through 'chylomicrons' and very low-density lipoprotein (VLDL) particles and are hydrolyzed by 'extracellular lipoprotein lipase' to produce glycerol and free fatty acids (FFAs). . In addition, FFA is converted into 'fatty acyl-CoA' by adipocytes and circulated in the process of forming triglyceride in the cell together with glycerol-3-phosphate (PB). Snyder, JM Esselstyn, K. Loughney, SL Wolda, and VA Florio, The. role of cyclic nucleotide phosphodiesterases in the regulation of adipocyte lipolysis. J. LipidRes, 46, 494 (2005)). These adipose tissues account for 15-20% of the total weight of normal adults and are widely distributed in the body (DS Gray. Diagnosis and prevalence of obesity. Med . Clin . North Am ., 73 , 1 (1989)).

Recently, many studies on expression changes of numerous genes and proteins in adipocytes have been conducted. Representative transcription factors involved in promoting fat differentiation are PPAR-γ (peroxisome proliferator activated receptor γ) and C / EBP α (CCAAT-enhancer). There are such α binding protein), which stimulates the gene involved in lipid metabolism and mature fat cells involved in fat accumulation (X. Guo, L. Kan. Analysis gene expression profile during 3T3-L1 preadipocyte differentiation. gene 251, 45 (2000)).

PPARs belong to the nuclear hormone receptor superfamily, in particular PPAR-γ consists of two isoforms, PPAR-γ1 and PPAR-γ2, and PPAR-γ2 is a 'N' as compared to PPAR-γ1. The term 'terminal' contains 30 more amino acids. Adipose cells mainly contain more PPAR-γ2, and PPAR-γ1 is present in a small amount in various cells such as adipocytes, macrophages, and colonic epithelial cells. In adipocytes, PPAR-γ induces the expression of many genes as well as aP2, a fat cell-specific fatty acid binding protein.

3T3-L1 adipocytes were cultured by treatment with 1-methyl-3-isobutyl-xanthine, desamethasone and insulin (MDI). Differentiation is initiated by entering the S phase, and Rb (retinoblastoma protein) acts as a regulator and binds to C / EBPs. C / EBPs have a 'leucine-zipper' binding site and a DNA binding site, which are important transcription factors for differentiation of adipocytes (D. Mosmann, Rapid colorimetric assay for the cellular growth and survival: application to proliferation and cytotoxic assay, J. Immun . Methods ., 65 , 55 (1983). When MDI was added to the medium to induce differentiation into adipocytes, C / EBP and C / EBPa were induced within 4 hours to form a heterodimer, resulting in PPAR-γ (peroxisome proliferator-activated receptor γ) and C / EBPa. Activation of adipocyte-specific genes such as adipsine, adipocyte-specific fatty acid binding protein (aP2), leptin (Z. Cao, RM Umek, and SL McKnight, Regulated expression of three C / EBP isoforms during aipose conversion of 3T3-L1 cells.Genes Dev ., 5 (9), 1538 (1991), WC Yeh, Z. Cao, M. Classon, and SL McKnight, Cascade regulation of terminal adipocyte differentiation by three members of the .. C / EBP familly of leucine zipper proteins GenesDev, 9 (2), 168 (1995), QQ Tang, MS Jiang, and MD Lane, Repressive effect of Sp1 on the C / EBPα gene promoter:. Role in adipocyte differentiation Mol . Cell. Biol., 19 ( 7), 4855 (1999)).

On the other hand, Magnolia officinalis ) is a dicotyledonous plant, an evergreen broad-leaved tree of the genus Asteraceae, inhabiting Korea, Japan, Taiwan and southern China. For medicinal purposes, stem and branch bark has been used for the treatment of asthma and gastrointestinal diseases and contains components such as magnolol, isomagnolol, honokiol and machiol. Among these, honokiol (honokiol) is a polyphenol (polyphenol) belonging to a useful substance that exhibits antidepressant, antithrombotic inhibition, nerve stability, antibacterial effect. Recently, honokiol has been shown to induce cell necrosis through induction of 'mitochondrial permeability transition pore' of various cancer cells, cytochrome c release, and caspase activation. (JY Yang, MA DellaFera, S. Rayalam and CA Baile, Enhanced effects of xanthohumol plus honokiol on apoptosis in 3T3-L1 adipocytes. Obesity , 16 (6), 1232 (2008)).

However, studies on the inhibitory effect on the intracellular fat accumulation of the bakbak extract is still insignificant.

Accordingly, an object of the present invention is to provide a cosmetic composition for inhibiting fat accumulation, containing a thick extract extract having an effect of effectively inhibiting fat accumulation as an active ingredient.

In order to achieve the above object, the present invention provides a cosmetic composition for inhibiting fat accumulation, comprising a thick extract.

Hereinafter, the problem solving means of the present invention will be described in detail.

The present invention necessarily contains a thick leaf extract as an active ingredient to provide a cosmetic composition for inhibiting fat accumulation.

In the present experimental example, first, in order to confirm the substantial fat accumulation inhibitory effect of the extract of the pear extract contained as an active ingredient, the cell viability, intracellular fat accumulation degree and triglyceride content by the pear extract were measured. Without toxicity, it was confirmed that the degree of intracellular fat accumulation was reduced, and the triglyceride content was reduced in a concentration-dependent manner to the thick extract.

Based on the above results, the extract of habakkuk reduces the production of fat by inhibiting the differentiation into fat cells, or breaks down the fat produced in the fat cells to form glycerol and free fatty acid. In order to determine whether the effect, the protein expression level of the lipolytic enzyme (hormone sensitive lipase) HSL (hormone sensitive lipase) was measured, it was confirmed that the concentration-dependent increase in the extract. In addition, PPAR-γ, a factor involved in adipocyte differentiation, was confirmed to reduce protein expression in cells after differentiation into adipocytes treated with pleated extract.

The mRNA expression level of genes involved in the differentiation of adipocytes was confirmed to confirm the actual fat accumulation inhibitory effect. When the differentiation into adipocytes, leptin, PPAR-α, and LPL were compared to adipocytes. MRNA expression of, but when the thick extract extracts were treated to cells induced differentiation, the expression level was shown to be the level of adipocytes, it can be inferred that the differentiation into adipocytes is suppressed.

On the other hand, the thick extract of the active ingredient of the present invention preferably contains 10 to 100 µg / mL in the fat accumulation inhibitory cosmetic composition, because it exhibits a fat accumulation inhibitory effect without cytotoxicity.

On the other hand, after extracting hot water by adding 10 to 20 parts by weight of water to 1 part by weight of dried flakes preferably dried, filtered and then the supernatant obtained by centrifugation at 4200 ~ 4800rpm for 50 to 70 minutes It is preferably obtained by filtration under reduced pressure up to a size of 1 μm.

On the other hand, the formulation of the cosmetic composition for inhibiting fat accumulation of the present invention is not limited to a specific kind, and is generally used as long as it is a formulation used in the cosmetic composition industry, but preferably a lotion, gel, water-soluble liquid, cream, essence, Basic cosmetic formulation consisting of oil-in-water (O / W) and oil-in-water (W / O) type, ointment, oil-in-water and water-in-oil makeup base, foundation, skin cover, face powder, two-way cake formulation, cleansing It may be any one selected from foam, cleansing cream, cleansing water, soap, pack, and spray.

As described above, the fat accumulation inhibitory cosmetic composition of the present invention reduces the fat accumulated in cells and triglycerides, and increases the protein expression of HSL, an enzyme that breaks down fat, while PPAR- which is a factor related to fat cell differentiation. Not only reduces the expression of γ, but also contains a thick extract that reduces the expression of leptin, mRNA of PPAR-α and LPL as an active ingredient, thereby suppressing substantial fat accumulation.

In addition, the present invention can reduce the consumer's rejection of chemicals by containing natural substances.

Hereinafter, the configuration and operation of the present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited to the following examples, and includes modifications of equivalent technical spirit.

Example  1: thick pepper extract manufacturer

200 g of dried thick foil was pulverized and powdered, and then 3 L of distilled water was added to perform hot water extraction. After the extraction was completed, primary filtration was performed using a nonwoven fabric and centrifuged at 4,500 rpm for 60 minutes. The supernatant was recovered and filtered under reduced pressure using a 1 μm filter paper. The recovered filtrate was concentrated under reduced pressure to obtain a thick extract powder.

Experimental Example  1: Determination of Cell Viability by Thick Extract

In Experimental Example 1, the cell viability of the thick extract powder obtained in Example 1 was measured.

The cells used in the experiment were 'Human keratinocyte (HaCaT)' and 3T3-L1 (mouse embryonic fibroblast (preadipocyte), adipose progenitor cells, and 10% FBS, penicillin (100 unit / ml), and Cultured at 5% CO ₂ , 37 ° C in DMEM (Dulbecco's modified Egale's medium) with strictomycin (100 unit / ml), 3T3-L1 cells were treated with 10% bovine calf serum, penicillin; 100 unit / ml. ml) and streptomycin (100 units / ml) were added to DMEM (Dulbecco's modified Egale's medium) at 5% CO ₂ at 37 ° C. Differentiation of 3T3-L1 into adipocytes was achieved with 100μM 3-isobutyl-1-methylxanthine, 250nM dexamethasone, 3.3μM D-biotin, 1% bovine serum albumin), 10 μg / ml insulin solution (insulin solution from bovine pancreas (MDI) and 10% FBS-containing medium, and 10% FBS and 10 μg / ml insulin (insulin) The degree of differentiation was observed while giving. 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide; MTT )) Quantification was performed by modifying the method of Mosmann [11]. The cells used in the experiment were 'Human keratinocyte (HaCaT)' and 3T3-L1 adipocytes. HaCaT and 3T3-L1 were prepared in a 96-well plate prepared at a concentration of 1 × 10 ⁴ cells / well, followed by incubation for 24 hours in a CO ₂ incubator. After 4 hours of adding MTT solution (5 mg / mL), the culture medium was removed, and 100 μl acid-isopropanol (0.04 N HCl in isopropanol) was added, followed by 'ELISA reader (VICTOR3, PerkinElmer) at 570 nm. , USA) 'was measured for absorption. HaCaT cells and 3T3-L1 cells were treated with thick extracts at different concentrations, and the effects on cell viability with increasing concentrations were measured.

As a result of measuring the cell viability by the extract of gourd (FIG. 1), about 75% of the cell viability was observed at 200 µg / ml of the highest sample concentration in HaCaT cells, and the highest sample treatment in the case of 3T3-L1 cells. The cell survival rate was 92.2% even at the concentration of 200 µg / ml.

From the above results, it was confirmed that when the HaCaT cells and the 3T3-L1 cells were treated with 10 ~ 100 µg / ml of the extract, the cell viability was not significantly affected.

Experimental Example  2: Determination of Fat Accumulation Inhibition Effect by Hupak Extract

In Experimental Example 2, the fat accumulation inhibitory effect of the thick gourd extract obtained in Example 1 was measured.

Oil- red O staining was performed to evaluate the degree of fat accumulation in cells. 3T3-L1 was prepared at a concentration of 1 × 10 ⁵ cells / well, treated with thick extracts by concentration, and incubated for 24 hours. Each well was washed with PBS, and 1 ml of 4% paraformaldehyde was added thereto and allowed to stand for 5 minutes. Then, the mixture was removed and 1 ml of 4% paraformaldehyde was added thereto and allowed to stand at room temperature for 1 hour. Paraformaldehyde was removed and washed with the addition of 60% isopropanol, and then allowed to stand at room temperature until each well was completely dry. 1 ml of 'Oil red O working solution' was added to each dried well for 1 hour, and then washed repeatedly with distilled water four times. After the washed wells were completely dried, 2 ml of 100% isopropanol was added and the stained reagents were eluted, and the absorbance was measured at 500 nm to evaluate the degree of fat accumulation. After treatment with the adipocyte MDI to induce differentiation, 3T3-L1 transformed into adipocytes was treated by concentration of thick thin water extract, and the amount of 'lipid droplet' formed in the cells was indirectly measured. Oil-Red O reagent is a 'fat-soluble dye'. Lipids formed in cells after treatment with 3T3-L1 cells differentiated into adipocytes at concentrations of 50 and 100 µg / ml have little effect on cell viability. ) And neutral fat (neutral tirglycerides) was stained with Oil-Red O reagent and recovered with isopropanol (isopropanol) and confirmed by absorption.

As a result of measuring fat accumulation inhibitory effect by hoobak extract (FIG. 2), it was confirmed that the inhibitory effect of intracellular fat accumulation inhibition of 76% at 50 ㎍ / ㎖, 78% at 100 ㎍ / ㎖ extract.

Experimental Example  3: intracellular by thick extract Triglyceride ( TG ) Determination of the amount of decrease in content

In Experimental Example 3, the degree of reduction of the intracellular triglyceride content by the extract of hoobac was measured.

3T3-L1 cells were collected and prepared by lysing PBS containing 1% Triton X-100, and the concentration of TG was obtained by using GPO-tinder, 'Serum Triglyceride Detection Kit (Sigma, TR0100, USA)'. Measured using. First, 10 ml of distilled water is added to TG reagent, 40 ml of distilled water is added to free glycerol reagent, respectively, to make 'reconstitute reagents', and then 0.8 ml of free glycerol reagent is used. 10 μl water (blank), 10 μl glycerol standard (2.5 mg / ml standard) and 10 μl sample were added thereto, and reacted at 37 ° C. for 5 minutes, and the initial absorbance (IA) was measured at 540 nm. Then, 10 μl water, 10 μl glycerol standard (2.5 mg / ml standard), and 10 μl sample were added to 0.2 ml of TG reagent (TG reagent) for 5 minutes at 37 ° C. And the final absorbance (FA) was measured at 540 nm. The amount of TG was calculated using a glycerol quantitative curve. Triglyceride contents produced in 3T3-L1 cells induced differentiation into adipocytes were measured by enzymatic assay.

Triglyceride is broken down into glycerol and free fatty acids by the action of lipoprotein lipase present in cells. Decomposed glycerol is quinoneimine dye which is finally produced by an enzyme reaction such as glycerol kinase (GK), glycerol phosphate oxidase (GPO) and peroxidase. The degree of reduction of intracellular triglyceride (TG) content by thick extract was measured by the method of confirming by absorption.

As a result of measuring the degree of decrease of intracellular triglyceride (TG) content by the thick gourd extract (Fig. 3), it was confirmed that the level of triglyceride content in the cell decreases as the concentration of the thick gourd extract was increased. At 100 μg / ml of phosphorus, a triglyceride content of about 35% was shown relative to the control.

From the above results, it can be inferred that the cosmetic composition for inhibiting fat accumulation of the present invention reduces fat accumulation in fat cells.

Experimental Example  4: thick pepper extract PPAR -γ and HSL  Measurement of impact on protein expression

In Experimental Example 4, the effect of the thick gourd extract obtained in Example 1 on the expression of PPAR-γ and HSL protein was measured.

From the measurement of the inhibition effect of intracellular fat accumulation and the reduction of triglyceride content in Experimental Examples 2 and 3, it could be inferred that the extract of gourd inhibits intracellular fat production or inhibits differentiation into adipocytes. Experimental Example 4 was carried out to confirm the correlation with the protein expression associated with promoting fat differentiation of cells.

In 3T3-L1 cells induced differentiation into adipocytes, the transcription factors involved in promoting the differentiation of 'peroxisome proliferator activated receptor-γ' (hereinafter referred to as' PPAR-γ ') and' Hormone sensitive lipase (hereinafter referred to as' HSL ') ), Etc. In this Experimental Example 4, the effect of the thick extract, which is the active ingredient of the present invention, on the expression of PPAR-γ and HSL protein was measured.

Samples were treated for 24 hours and 3T3-L1 cells were lysed with RIPA buffer (0.5% sodium deoxycholate, 0.1% SDS, 1% NP-40, 1 mM PMSF) and centrifuged. The recovered supernatant was electrophoresed using 12% SDS-PAGE and transferred to a nitrocellulose membrane. This was reacted with PPAR-γ (sc-7273), HSL (sc-74489), and β-actin (sc-1615) antibodies in Tris buffer solution containing 5% skim milk, respectively. Secondary HRP-antibody was added and subjected to photodevelopment on 'Kodak X-ray film' using 'WEST-ZOL western blotting detection system (chemiluminescence reagernt, Intron. Korea)'.

As a result of measuring the effect of the pear extract on the expression of PPAR-γ and HSL protein (FIGS. 4 and 5), as the concentration of the extract was increased, the protein expression of the HSL increased 8-fold compared to the control (PPAR). In the case of -γ, it was confirmed that the expression of PPAR-γ protein was reduced by 89% in cells treated with 100 μg / ml of the extract.

From the above results, it can be inferred that the cosmetic composition for inhibiting fat accumulation of the present invention exhibits substantial fat accumulation inhibitory effect by inhibiting protein expression associated with promoting cell differentiation and increasing protein expression of lipase.

Experimental Example  5: Thick Extract Leptin ( Leptin ), PPAR -α and Lipoprotein  Lipase lipase ) mRNA  Measure impact on expression

In Experimental Example 5, the effect of the extract was extracted on leptin, PPAR-α and lipoprotein lipase mRNA expression.

RNA was extracted using total RNA extract reagent (RNAiso Plus, TaKaRa, Japan) by AGPC (Acid Guanidinium-Phenol-Chloroform) method. cDNA synthesis was carried out using 'Transcriptor First Strand cDNA synthesis kit (Roche, Germany)' and cDNA was synthesized using 'High Fidelity PCR Master (Roche, Germany)' and the prepared primer (primer). . cDNA synthesis was stopped by heating 1 μg total RNA for 1 hour at 50 ° C. and 5 minutes at 85 ° C. PCR amplification was denatured at 94 ° C. for 50 seconds, annealed at 55 ° C. for 50 seconds, and extended at 72 ° C. for 50 seconds. This cycle was repeated for 30 cycles and the 'final extension' was performed at 72 ° C. for 5 minutes, and the amplified result was electrophoresed on a 2% agarose gel to express the genes in a 'chemiluminescent detection system (ChemiDoc XRS system, Bio-Rad Laboratories. USA). The oligonucleotide sequences of leptin, PPAR-α, lipoprotein lipase (LPL) are as follows.

leptin: sense; 5'-GGAATTC A GGAAAATGTGCTGGAG-3 ', antisense; 5'-GGAATTCTCAGCATTCAGGGCT AAC -3 ',

PPAR-α: sense; 5'-CCTGTCTGTCGGGATGTCACACAATGC-3 ', antisense; 5’-GCAACTTCTCAATGTAGCCTATGTTT-3 ’

LPL: sense; 5'-GG CCGCAGCAGA CGCAGGAAGAGATTT-3 ', antisense; 5'-AAGAAGGAGTAGGT TTTATTTGTGGA A-3 '

GAPDH: sense; 5'- AAATTCAACGGCACAGTCAA -3 ', antisense; 5’- GTCTTCTGGGTGGCAGTGAT -3 ’

As a result (Fig. 6 to Fig. 8), in Figure 6 it was possible to measure the gene expression level in the fat precursor cells, the expression of PPAR-α, leptin (Lptin), LPL genes involved in differentiation into adipocytes increased From this, it was confirmed that differentiation into fat cells occurred.

After the differentiation into adipocytes, the gene expression of the thick extract extract treatment was measured (FIGS. 7 to 8), and it was confirmed that gene expression of PPAR-α, leptin, and LPL was suppressed.

From the above results, it can be inferred that the cosmetic composition for inhibiting fat accumulation of the present invention can suppress the production of fat by inhibiting the expression of genes involved in differentiation into adipocytes.

1 is a diagram showing the cell survival rate of 'Human keratinocyte (HaCaT)' and fat progenitor cells 3T3-L1 (mouse embryonic fibroblast, preadipocyte) by the extract.

Figure 2 is a diagram showing the degree of accumulation of fat formed in 3T3-L1 cells during the treatment of hakbak extract.

Figure 3 is a diagram showing the triglyceride (TG) content in 3T3-L1 cells when the treatment of the extract.

Figure 4 is a diagram showing the electrophoresis of PPAR-γ and HSL protein expression in 3T3-L1 cells during the treatment of hakbak extract.

Figure 5 is a diagram showing the expression of PPAR-γ and HSL protein in 3T3-L1 cells when the treatment of the extract.

Figure 6 is a diagram showing the expression of leptin (Leptin), PPAR-α and lipoprotein lipase (Lipoprotein lipase) mRNA in the fat precursor cells by the extract.

Figure 7 and Figure 8 is a diagram showing the expression of leptin (Leptin), PPAR-α and lipoprotein lipase (Lipoprotein lipase) mRNA after differentiation into adipocytes by hoobak extract.

Claims (4)

A cosmetic composition for inhibiting fat accumulation, comprising a thick extract as an active ingredient. The method of claim 1, Thick Extract, Cosmetic composition for inhibiting fat accumulation, characterized in that it is contained in the cosmetic composition for inhibiting fat accumulation 10 ~ 100㎍ / mL The method of claim 1, Thick Extract, 10 to 20 parts by weight of water was added to 1 part by weight of the dried thick gourd to extract hot water, followed by filtration and centrifugation at 4200 to 4800 rpm for 50 to 70 minutes under reduced pressure to a maximum size of 1 μm. A cosmetic composition for inhibiting fat accumulation, which is obtained by filtration. The method of claim 1, The cosmetic composition for fat accumulation suppression, Basic cosmetic formulation consisting of lotion, gel, water-soluble liquid, cream, essence, oil-in-water (O / W) and water-in-oil (W / O) type, ointment, oil-in-water and water-in-oil makeup base, foundation, skin cover, face Cosmetic composition for inhibiting fat accumulation, characterized in that any one selected from powder, two-way cake cosmetic formulation, cleansing foam, cleansing cream, cleansing water, soap, pack, spray

Images