KR20100096567A - Novel gram-positive bacteria expression system - Google Patents

Abstract

PURPOSE: A gram positive bacteria expression system using a recombinant vector having a promoter is provided to massively produce target proteins by overexpressing the target protein without specific inducing agent. CONSTITUTION: A Bacillus subtilis-derived novel promoter contains base sequences of 24th to 68th among sequence number 1 or 2. A recombinant vector contains a novel promoter and a gene encoding a target protein. The target protein is GFP, catalase, or chloramphenicol acetyltransferase. A method for producing the target protein comprises: a step of culturing the transformed recombinant microorganism to express the target protein; and a step of collecting the expressed target protein.

Description

Novel Gram-positive Bacteria Expression System

The present invention relates to a novel Gram-positive bacteria bacterial expression system, and more particularly, to a novel promoter derived from Bacillus subtilis, a recombinant vector comprising the promoter, a recombinant microorganism into which the promoter or the recombinant vector is inserted, and the recombinant microorganism. It relates to a method for preparing the protein of interest.

Coryneform microorganisms are not only amino acids and nucleic acids produced by Corynebacterium , but also produce chemicals that are widely used in fields such as cheese production, steroid convertors, antibiotics, anticancer agents and hydrocarbons. It is a microorganism. In addition, with the development of host-vector systems for these strains, a case of using Corynebacterium as a host cell for foreign gene expression has been reported.

Development of host-vector systems for these coryneform microorganisms is a prerequisite for applying recombinant DNA technology to these strains. Host-vector systems include transformation methods for introducing DNA into cells, development of vectors as gene carriers, development of host cells as DNA receptors, and the like.

To express genes in coryneform bacteria, it was common to use promoters originally possessed by their genes (Vasicova, P., et al., J. Bacteriol., 181: 6188-6191, 1999, etc.). On the other hand, the promoter sequence for gene expression in coryneform bacteria, unlike other industrial microorganisms such as Escherichia coli and Bacillus subtilis, the general structure is unknown. The development of expression vectors using a promoter of pAM330, a plasmid of Brevibacterium lactofermentum , and a promoter of an antibiotic resistance gene such as trimetoprim has been developed to date and is an inducible promoter of E. coli. The incidence of lacUV5, tac, P _R P _L promoters has been reported. There are also reports on cosmid vectors incorporating cos sites derived from B. lactofermentum phage, but their use is opaque.

In particular, inducible promoters of E. coli are not suitable for use due to cost and safety verification problems in industrial mass production systems, since they require the addition of specific expression inducing factors for the expression of the gene of interest. Therefore, previously developed promoter sequences still have room for improvement in terms of selectivity and expression efficiency of gene expression.

Accordingly, the present inventors are searching for a strong promoter capable of overexpressing a gene of interest in Corynebacterium, and a new promoter derived from Bacillus subtilis can express a gene of interest in Corynebacterium, In the transformed transformant, it was confirmed that the genes of interest were overexpressed without the addition of a specific inducer, thereby completing the present invention.

It is an object of the present invention to provide a promoter having a nucleotide sequence having at least 70% identity with a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and a recombinant vector comprising the gene encoding the promoter and the protein of interest.

Another object of the present invention is to provide a recombinant microorganism into which the promoter or the recombinant vector is inserted, and a method for producing a target protein by culturing the recombinant microorganism.

In order to achieve the above object, the present invention contains the nucleotide sequence of Nos. 24 to 68 of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, more than 70% of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 It provides a promoter having a nucleotide sequence having identity.

The present invention also provides a recombinant vector comprising a gene encoding the promoter and the protein of interest, and operably linked thereto.

The present invention also provides a recombinant microorganism into which the promoter or recombinant vector is inserted, and a method for producing the protein of interest, wherein the recombinant microorganism is cultured.

The recombinant microorganism into which the promoter according to the present invention or the recombinant vector containing the same is inserted is useful for mass production of the target protein by overexpressing the target protein without the addition of a specific inducer.

In one aspect, the present invention includes a base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 from base No. 24 to No. 68 and having at least 70% identity with the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 Regarding a promoter having a sequence, preferably Bacillus subtilis ( Bacillus acetyltransferase related promoter from subtilis ), a promoter for gene expression in Bacillus and Coryneform bacteria.

"Promoter" as used herein means a non-ready nucleic acid sequence upstream of a coding region that contains a binding site for polymerase and has a transcription initiation activity to mRNA of a promoter lower gene. Specifically, a "promoter" is a region of the TATA box or TATA box-like region that is upstream about 20-30 bases from the start of transcription (+1) and is responsible for initiating transcription to RNA polymerase from the correct position. Although this is included, it is not necessarily limited to before and after these areas, and in addition to this area, the area required for association of proteins other than RNA polymerase for expression control may be included.

In general, a promoter includes a portion in which RNA polymerase binds to induce transcription initiation. Since the degree of RNA synthesis is determined according to the nucleotide sequence of the promoter, the expression strength of the gene may be different depending on the promoter. In addition, promoters can be classified into two groups, one of which is an "inducible promoter" that, when inducibles are present, will promote expression of the gene under control of the promoter. In this case, when the gene is expressed using the inducible promoter, an expensive inducer should be used, and in some cases, the inducer has a problem of causing toxicity to the human body or a specific host cell. In addition, there is a drawback that there are many things to consider during the culturing process, such as the time to introduce the inducer and the concentration of the inducer in the medium. In contrast, a "constitutive promoter" can promote the transcription of a gene under its control without any specific conditions, ie without an inducible substance.

As used herein, "promoter activity" refers to having the ability to initiate and regulate the expression of a gene located upstream of the open reading frame (ORF) of the gene. In other words, when a construct obtained by arranging a gene in a state expressable downstream of a promoter is introduced into a host, the construct has the ability and function to produce an expression product of the gene in or outside the host. Such promoter activity is linked upstream of a gene (or also referred to as a reporter gene) that encodes a protein that is easy to identify, e. This can be carried out by confirming the expression of the gene product of the gene, and if expression is observed here, the promoter is an indicator of having promoter activity in the introduced host.

The promoter of the present invention also has a nucleotide sequence having substitution, deletion or addition of at least one base, specifically one or more bases, in the nucleotide sequence of SEQ ID NO: 1 or 2, and also DNA having constitutive promoter activity is also included. In general, in a DNA having a short sequence, DNA having a mutation (substitution, deletion or addition) in at least one base may change its activity, but promoter activity may be determined by a method of confirming the promoter activity described above. This observed “dna with variation” is also included in the present invention.

Specifically, a promoter having a nucleotide sequence of SEQ ID NO: 1 among the promoters according to the present invention is a promoter of a portion of a cloned acetyltransferase related gene fragment from a Bacillus subtilis chromosome, and a promoter having a nucleotide sequence of SEQ ID NO: 2 It is a more powerful improved promoter that attaches the up element (sequence of -40 to -60 region) of the rrnBP1 promoter of Escherichia coli upstream of the promoter sequence of SEQ ID NO: 1. Thus, the common sequence of SEQ ID NO: 1 and SEQ ID NO: 2 (from base 24 to base 68 of SEQ ID NOs: 1 and 2) is an important factor in promoter activity, and the sequence identity of SEQ ID NO: 1 and SEQ ID NO: 2 is 68% to be.

From this, the promoter of the present invention is only a part of the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, preferably, when containing the common sequence as a promoter consisting of the nucleotide sequence shown in SEQ ID NO: 1 or 2 Can function. That is, at least 70% or more sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, preferably with at least 80% sequence identity, more preferably with 90% sequence identity, even more preferably 95% sequence It may be composed of base sequences having identity. Such a promoter may be chemically synthesized with reference to the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a promoter comprising a genomic DNA of Corynebacterium as a template and complementary to a portion of SEQ ID NO: 1 or 2 It may also be prepared by performing PCR.

The "sequence identity" refers to sequence similarity of two polynucleotide residues. The "sequence identity" can be determined by comparing two nucleotide sequences aligned optimally over a region of the base sequence to be compared. Here, the polynucleotide to be compared may have additions or deletions (for example, gaps, overhangs, etc.) as compared with reference sequences (for example, consensus sequences, etc.) for optimal alignment of two sequences. The numerical value of sequence identity determines the same nucleic acid base which exists in both sequences, determines the number of suitable sites, and then divides the number of suitable sites by the total number of bases in the sequence region to be compared, By multiplying 100, it can be calculated. Sequence identity between nucleic acids is measured using, for example, sequence analysis software, specifically BLASTN, FASTA, and the like. The BLASTN is http: //www.ncbi.nlm.nih. Generally available at gov / BLAST /.

Promoters of the invention can be isolated or prepared using standard molecular biology techniques. For example, it can be isolated by PCR using an appropriate primer sequence, it can also be prepared using standard synthetic techniques using an automated DNA synthesizer.

In the present invention, specifically, a search vector is used to obtain fragments primarily showing promoter activity from the chromosomal DNA derived from Bacillus subtilis. The promoter search vector usable in the present invention is not particularly limited, and a shuttle vector including a known antibiotic resistance gene but not including the promoter of the antibiotic resistance gene may be used. Known antibiotic resistance genes include ampicillin resistance genes (Amp), erythromycin resistance genes (Em), kanamycin resistance genes (Km), and the like, and the vectors comprising them are commercially available from promega, NEB, RoChe, TAKARA, etc. You can easily purchase it. Removal of a promoter located upstream of the antibiotic resistance gene in a vector comprising the antibiotic resistance gene can be easily performed by treatment with an appropriate restriction enzyme, to determine whether there is promoter activity at the site where the promoter has been removed. Insertion of DNA fragments can also be readily performed by treatment with appropriate restriction and linking enzymes.

In one embodiment of the present invention, a pACE (Xenofocus Inc.) vector, which is a commercially available Escherichia coli vector, is used as a search vector. In addition, by using the X-gal reaction by beta galactosidase activity by amplifying and inserting the beta-galactosidase gene derived from Bacillus circus, removing the promoter, and inserting the candidate fragments in place. To select a promoter according to the present invention.

The promoter according to the present invention can be usefully used for preparing a target protein because it strongly expresses a gene operably linked to the promoter without an inducible substance as described above.

In order to prepare a protein of interest, preparation of a recombinant expression vector comprising a nucleotide sequence of a promoter and a protein of interest operably linked thereto must be preceded. Such recombinant expression vectors constitute one aspect of the present invention. The recombinant expression vector can be prepared using a known or commercially available vector, for this purpose it can be prepared by substituting the promoter originally included in the vector and the promoter according to the present invention. It may also be prepared by combining a promoter according to the present invention with a regulatory sequence conventionally contained in a vector.

In another aspect, the present invention relates to a recombinant vector comprising the promoter, specifically, a recombinant vector including a gene encoding the promoter and the protein of interest, and operably linked thereto.

The recombinant vector may be an expression vector, that is, a promoter that enables transcription to express a target protein in a suitable host cell, a gene expressing a target protein downstream of the promoter, a gene capable of self-replicating in a microorganism, and a target vector. It means a gene product containing an antibiotic gene for screening. The genes other than the gene of interest may vary depending on the backbone of the vector and the host selected. The minimally necessary genes are well known to those skilled in the art because of the production of the vector, and can be easily selected according to gene expression conditions and purposes. have. Although not limited thereto, plasmid vectors, phage vectors, or viral vectors are available, and in one embodiment, pUC19 may be used as the backbone of the vector.

In addition, the recombinant vector may include a regulatory sequence that controls the expression of the protein of interest. An "expression control sequence" refers to a DNA sequence that controls the expression of a nucleic acid sequence operably linked in a particular host cell. Such expression control sequences include a promoter for carrying out transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence that controls the termination of transcription and translation.

In addition, the promoter is operably linked to induce the expression of the gene of interest and the vector may be in the form of being integrated into the genome of the host cell. Here, "operably linked" refers to a functional link between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function. Operative linkage with recombinant vectors can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation uses enzymes commonly known in the art and the like.

In addition, when the vector is a replicable expression vector, it may include a replication origin, which is a specific nucleic acid sequence from which replication is initiated. The vector may include a selection marker. The selection marker is for selecting cells transformed with the vector, and markers conferring a selectable phenotype such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins can be used. Since only cells expressing a selection marker survive in an environment treated with a selective agent, transformed cells can be selected.

The gene encoding the target protein insertable into the vector is not particularly limited, but includes all genes of the same origin as the promoter of the present invention or other genes, heterologous to the promoter or host cell of the present invention. Genes encoding the protein of interest may include, but are not limited to, nucleic acids encoding proteins such as, for example, enzymes, cytokines or antibodies. Preferably, beta-galactosidase, catalase, green fluorescent protein, chloramphenicol acetyltransferase and the like, in addition to beta-glucuronidase and dihydrofolate Reductase, neomycin phosphotransferase, hygromycin phosphotransferase, luciferase gene, interleukin 1-12 gene, interferon α, β and γ gene, immunoglobulin gene, blood pressure lowering peptide, anticancer peptide, platelet aggregation Inhibitory peptides;

Here, beta galactosidase, also called lactase, is an enzyme that acts on lactose in addition to allyl and aryl-D-galactoside to produce galactose. Beta-galactosidase hydrolyzes non-reducing terminal beta-D-galactose from beta-D-galactopyranoside, such as lactose, catalyzes the transfer reaction of galactose, and is widely used in plants and animals, including various microorganisms. Is found. Both hydrolytic and sugar transfer activities of this enzyme have industrial applications. Hydrolytic activity hydrolyzes lactose in milk and dairy products, prevents lactose intolerance and enhances sweetness, while sugar transfer activity is used to prepare galactooligosaccharides that promote the growth of Bifidobacteria, an intestinal useful microorganism. do.

Here, catalase is an enzyme that catalyzes a reaction in which hydrogen peroxide is decomposed to produce water and oxygen. Catalase captures the hydrogen peroxide produced during photorespiration and oxidation of fatty acids in plants and plays an important defense against physiological oxidative stress as well as environmental factors. Hydrogen peroxide is a chemical widely used in the manufacture of bleaches, oxidants, inducers, and the like. Recently, catalase is used for enzymatic removal of hydrogen peroxide, which is used for etching substrates and manufacturing semiconductors. In addition, the catalase gene has been suggested as an indicator gene for various stresses.

Here, the green fluorescent protein (GFP) is a 238-residue polypeptide consisting of three exons of 2.6 kb. It is a protein that does not lose its activity even under harsh stimulus such as heat, extreme pH, chemical denaturant, and fluoresces continuously after being fixed in formaldehyde. Because green fluorescent proteins emit bright green fluorescence, adding green fluorescent proteins to specific protein molecules can shine like a target, giving you an idea of how cells move and grow. It is widely used for research in medicine and biotechnology, and has become a basic indicator that is indispensable for drug development.

Here, chloramphenicolacetyltransferase is a bacterial enzyme that is resistant to the antibiotic chloramphenicol. This enzyme is used as an antibiotic resistance marker in the construction of various vectors in biotechnology, and in medicine, it binds to the 50S subunit of microbial ribosomes and inhibits bacterial protein synthesis when administered to microbial infections. .

Origin of the gene encoding the protein of interest is not limited to this, but include microorganisms, plants, insects and animals, in addition to artificially synthesized genes may be included.

In another aspect, the present invention relates to a recombinant microorganism into which the new promoter or the recombinant vector is inserted, that is, the new promoter is inserted on a chromosome or transformed with the recombinant vector. As the transformed recombinant microorganism, host cells having high DNA introduction efficiency and high expression efficiency of introduced DNA are commonly used, and all microorganisms including prokaryotic and eukaryotic cells can be used such as bacteria, yeast, and fungi. and, preferably, microorganisms belonging to the genus Corynebacterium (Corynebacterium), and more preferably Corynebacterium glutamicum (Corynebacterium glutamicum ) ATCC 13032 and Corynebacterium ammoniagenes ATCC 6872. As a specific aspect of the present invention, as long as the target gene to be overexpressed can be sufficiently expressed, it is not limited to the microorganism as described above.

The transformed recombinant microorganism may be prepared according to any transformation method. In the present invention, "transformation" refers to a phenomenon in which DNA is introduced into a host so that DNA can be reproduced as a factor of a chromosome or by completion of chromosome integration. Means. In general, transformation methods include electroporaton, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, lithium acetate-DMSO method, and the like. Use the drilling method.

In another aspect, the present invention relates to a method for producing a target protein using the transformed recombinant microorganism, specifically, culturing the recombinant microorganism to express the target protein; And it relates to a method for producing a protein of interest comprising the step of recovering the expressed protein of interest.

Cultivation of the transformed recombinant microorganism can be carried out according to well-known methods, and cultured in a nutrient medium suitable for the production of the protein of interest. For example, the cells may be cultured by small or large scale fermentation, shake flask culture in a laboratory or industrial fermentor performed under conditions that allow the appropriate medium and the desired protein to be expressed and / or isolated. The cultivation is carried out in a suitable nutrient medium containing carbon, nitrogen sources and inorganic salts using known techniques. Suitable media are available from commercial suppliers and may be made, for example, according to the ingredients and proportions thereof as described in the catalog of the American Type Culture Collection. Conditions such as the incubation temperature and time, the pH of the medium can be appropriately adjusted.

The recombinant microorganism of the present invention can be cultured in batch or fed-batch culture.

"Batch culture" means one of the culture modes in which all nutrients are added at the beginning of fermentation. In batch culture, host cells are allowed to proliferate until one of the essential nutrients in the medium is depleted, or until a condition that is no longer desirable for fermentation (eg, when the pH is reduced to a value that inhibits microbial growth) is formed. Can be.

"Federated cultivation" means a culture in which one or more nutrients are fed into the culture continuously immediately after the start of fermentation or after the culture has reached some stage, or when the supplied nutrient is depleted from the culture. In fed-batch cultures, for example, pH adjustment is generally used to maintain the desired growth conditions, and the essential nutrients are fed to the culture to prevent the depletion of one or more essential nutrients. Yeast host cells will continue to proliferate at a growth rate determined by the nutrient supply rate. In general, a single nutrient, a carbon source, is the limiting factor for growth. Other kinds of nutrient limitations may be used, for example, by nitrogen sources, by oxygen, by certain nutrients such as vitamins or amino acids (if the microorganism is a nutrient for the compound), by sulfur. And restriction by phosphorus.

Protein recovery from the cultured recombinant microorganisms is conventional biochemical separation techniques, such as treatment with protein precipitants (salting), centrifugation, extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration). ), And various chromatography such as adsorption chromatography, ion exchange chromatography, affinity chromatography, and the like can be used, and these are usually used in combination to separate proteins of high purity.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example  1: securing a new promoter according to the present invention

1) Screening for Promoter Candidate Fragments on the Bacillus Subtilis Chromosome

To screen a promoter from Bacillus subtilis, LB (1% tryptone, 0.5% yeast extract, 1% NaCl) in a culture medium of Bacillus subtilis (Bacillus subtilis ) 168, the cultured cells were recovered by centrifugation, and the isolated cells were finally separated by 500 µg of chromosomal DNA using a chromosomal DNA extraction kit (RBC).

Restriction enzyme HindIII 20 units were added to 10 µg of the isolated chromosomal DNA, and electrophoresis was performed on candidate fragments having a size of less than about 500 bp among chromosomal DNA fragments randomly generated by the restriction enzyme. The agarose gel was cut and recovered with a recovery kit (RBC).

In order to screen a fragment having a promoter function of the number of the candidate fragment in the primarily, the E. coli is commercially available in the existing vector pACE (GenoFocus, Inc.) was used as a vector to a search vector for Bacillus circulator lance (Bacillus β-galactosidase (BgaC) gene from circulans ATCC31382) was amplified by PCR (polymerase chain reaction) with primers of SEQ ID NOs: 3 and 4, digested with restriction enzymes HindIII and EcoRI, and Inserted into the cut vector. The restriction enzyme treatment removes its own promoter of the pACE vector. The search vector into which the beta galactosidase was inserted was treated with restriction enzyme HindIII, and candidate fragments less than 500 bp separated by restriction enzyme HindIII were inserted into existing promoter sites, respectively, and ligated by T4 ligase treatment. .

SEQ ID NO: 5`-ATGTCACAATTAACGTATGATG-3`

SEQ ID NO: 5`- TCAAGGTGTTTTTGGTATTG-3`

The constructed search vector was introduced into E. coli JM109, which was transformed by thermal shock or the like. The transformed strain was plated in LB agar medium (1% tryptone, 0.5% yeast extract, 1% NaCl, 1.5% agar) containing 100 μg / ml of empicillin and 50 μg / ml of X-gal. Incubate overnight at ° C. The E. coli colonies, which were green in response to X-gal by beta galactosidase activity, were recognized as promoters working, and one final colony was chosen as the darkest.

2) Acquire new promoter ("200 promoter")

According to the conventionally known nucleotide sequence determination kit or crystal protocol according to the method of Sanger et al. (Proc. Natl. Acad. Sci. USA, 74, 5463-5467, 1977) from the selected colony, The nucleotide sequence was determined by pACE vector containing a novel promoter using primers having the following nucleotide sequence (SEQ ID NO: 5).

SEQ ID NO: 5`-AGCGGATAACAATTTCACACAGGA-3`

As a result, the fragment of 348 bp was identified and shown in SEQ ID NO: 6. The promoter portion was identified in the fragment of 348 bp, the nucleotide sequence of SEQ ID NO: 1 was identified and named as "200 promoter."

3) Improved promoter ("201 promoter") production

Shawn et al. (Proc. Natl. Acad. Sci. U.S.A., 95, 9761-9766, 1998) identified an UP element sequence that specifically matches E. coli promoters. The promoter sequence upstream of the promoter sequence of SEQ ID NO. A stronger and improved promoter was made and shown in SEQ ID NO: 2, which was named "201 promoter". The nucleotide sequence homology of SEQ ID NOs: 1 and 2, representing the 200 promoter and the 201 promoter, is 66%, and the common sequence of these promoters is a part showing promoter activity.

The 201 promoter was also transplanted into the pACE vector in the same manner as described above to confirm beta galactosidase activity to confirm its function as a promoter.

Example  2: Preparation of Recombinant Vectors Containing New Promoter Sequences

Example 1 Corey whose expression is induced by the 200 promoter and the 201 promoter of the Corynebacterium / E. coli shuttle vector (Corynebacterium / E. Coli shuttle vector ) , the backbone (backbone) of the vector for the production of New England (pUC19 Biolab G) was used.

The 200 promoter and the 201 promoter according to Example 1 were attached to both ends of KpnI and ClaI to prepare oligo-synthesis (BioNeer), and then treated with restriction enzymes KpnI and ClaI, Corynebacterium glutamicum (ATCC 13032). ) PCR was performed using primers of SEQ ID NO: 7 and SEQ ID NO: 8 using the genomic DNA as a template to amplify the replication origin for initiation of replication of the vector. In addition, rrnB T1 terminator was used as primers of SEQ ID NO: 9 and SEQ ID NO: 10 from pKK223-3 (Pharmacia) vector and primers of SEQ ID NO: 11 and SEQ ID NO: 12 from pUB110 (Sigma). The gene was amplified. The replication initiation sequence region was treated with restriction enzymes BglII and DraI, the vector terminator was treated with restriction enzymes Xbal and SalI, and the kanamycin resistance gene was treated with restriction enzymes AatII and SpeI. The restriction sites of the vector were processed and inserted into the pUC19 vector sequentially using T4 ligase. Among the expression vectors thus prepared, the expression vector into which the 200 promoter was inserted was named pSG200, and the expression vector into which the 201 promoter was inserted was called pSG201.

SEQ ID NO: AAAAACGGTGATCGGATTTT

SEQ ID NO: GATCTTTGGGAGCAGTCCTT

SEQ ID NO: 9: GCTTAAATAAAACGAAAGGC

SEQ ID NO: 10 AAAGAGTTTGTAGAAACGCA

SEQ ID NO: GTGAATGGACCAATAATAAT

SEQ ID NO: 12 TCAAAATGGTATGCGTTTTG

Example  3: Recombination with a New Promoter GFP  Preparation of Expression Vector

PSG200 and pSG201 vectors were digested with restriction enzymes EcoRV and NotI to express Green Fluorescent Protein (GFP) using the pSG200 vector and pSG201 vector obtained in Example 2 above. The GFP gene was amplified using primers of SEQ ID NO: 13 and SEQ ID NO: 14 using GFP as a template in a commercially available pEGFP-C1 (Clontech) vector inserted with GFP.

SEQ ID NO: 13: ATGGTGAGCAAGGGCGAGGA

SEQ ID NO: 14 TTATCTAGATCCGGTGGATC

The amplified gene was digested with restriction enzymes EcoRV and NotI, and inserted into pSG200 and pSG201 vectors digested with the same restriction enzymes to complete pSG200-GFP and pSG201-GFP.

Example  4: Recombination with a New Promoter Catalase  Preparation of Expression Vector

PSG200 and pSG201 vectors were digested with restriction enzymes XmaI and XbaI to express catalase using the pSG200 vector and pSG201 vector prepared in Example 2. Then, the catalase gene (Genbank accession number: M55161) was amplified using the primers of SEQ ID NO: 15 and SEQ ID NO: 16 using a genome derived from E. coli K12 as a template. The amplified genes were digested with restriction enzymes XmaI and XbaI and inserted into pSG200 and pSG201 vectors digested with the same restriction enzymes to complete pSG200-KatE and pSG201-KatE.

SEQ ID NO: 15: ATGTCGCAACATAACGAAAA

SEQ ID NO: 16: TCAGGCAGGAATTTTGTCAA

Example  5: Recombinant Chloramphenicol Using Novel Promoter Acetyltransferase  Preparation of Expression Vector

PSG200 and pSG201 vectors were digested with restriction enzymes XmaI and XbaI to express chloramphenicol acetyltransferase using the pSG200 vector and pSG201 vector prepared in Example 2. Then, the star, which is inserted into a commercially pHT01 (MoBiTec g) antibiotic marker on the vector, sold by Philo Lactococcus mouse fluorescein (Staphylococcus Chloramphenicol acetyltransferase gene (Genbank accession number: NC010427) derived from aureus ) was amplified using the primers of SEQ ID NO: 17 and SEQ ID NO: 18 as a template. The amplified gene was digested with restriction enzymes XmaI and XbaI and inserted into pSG200 and pSG201 vectors digested with the same restriction enzymes to complete pSG200-cat and pSG201-cat.

SEQ ID NO: 17 ATGAACTTTAATAAAATTGA

SEQ ID NO: 18: TTATAAAAGCCAGTCATTAG

Example  6: Preparation of Recombinant Microorganism Using Recombinant Expression Vector

Corynebacterium glutamicum ( Coynebacterium) using the respective recombinant expression vectors prepared in Examples 3 to 5 glutamicum ) ATCC 13032 and Corynebacterium ammoniagenes ) ATCC 6872 was transformed to prepare a recombinant microorganism.

Specifically, the Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC 13032 and Corynebacterium ammoniagenes ) ATCC 6872 strains were inoculated in 5 ml of LBG (1% tryptone, 1% NaCl, 0.5 yeast extract, 2% glucose) medium and incubated overnight at 30 ° C., followed by 100 ml of Epo (1% tryptone, 1 % NaCl, 0.5% yeast extract, 2.5% glycine, 0.1% Tween 80, 0.4% isonicotinic acid) was inoculated with 2 ml of the seed and incubated at 18 ° C. until the growth of the bacteria became 0.8 to OD ₆₀₀ . After centrifugation at 4 ° C. at 4,000 × g for 10 minutes, the suspension was suspended with 50 ml of cooled 10% glycerol and centrifuged under the same conditions. The same process was repeated with 50 ml of 10% glycerol, and the final volume was 200 μl. Competent cells were made.

200 μl of the competent cells and 10 μg of the recombinant vector according to Examples 3 to 5 were respectively mixed and placed in a 0.2 cm electroporation cuvette, which was allowed to stand on ice for 5 minutes, followed by electricity at 2500 volt, 600 Ω, and 25 μF. Each was transformed by electroporation. Thereafter, immediately pour 1 mL of LBHIS (0.5% tryptone, 0.5% NaCl, 0.5% yeast extract, 1.85% Brain Heart Infusion (BHI), 9.1% sorbitol) and place in a sterile microcentrifuge tube. After the transfer, heat shock was applied at 46 ° C. for 6 minutes, followed by incubation at 30 ° C. for 1 hour, and then an appropriate amount was placed on LBHIS agar medium containing 30 μg / ml of kanamycin and 50 μg / ml of X-gal.

Example  7: Determination of expression activity of novel promoters

The transformed microorganisms obtained in Example 6 were cultured in the following manner to measure the activity of the promoter sequence.

Transformed Corynebacte of Example 6 grown in LB (1% tryptone, 0.5% yeast extract, 1% NaCl) medium overnight in a 1 L corner-baffle flask containing 100 ml of 2% Brain Heart Infusion (BHI) medium 5 ml of Leeum strains were inoculated and incubated at 30 ° C for 24 hours.

After completion of the culture, the cells were recovered by centrifugation, suspended in sterile distilled water, and the cells were disrupted by ultrasonic disruption, followed by high-speed centrifugation to obtain a supernatant. Enzyme activity and protein electrophoresis were performed using this supernatant. Using the Bradford analysis, the protein amount of the cell extract obtained was measured.

(1) Determination of the expression activity of the promoter sequence using the degree of GFP expression

Using a method of Laure Gory et al. (Laure Gory, et al, FEMS Microbiology Letters, 194: 127-33, 2001), the same amount of cell extracts were irradiated with a excitation light at 400 nm and then 510 nm. By measuring the emitted light, the expression level of the gfp gene encoding the GFP protein was measured.

As a result of confirming the fluorescence intensity by the expression of the GFP gene, as shown in Figure 2, two kinds (Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC 13032 and Corynebacterium ammoniagenes ) GFP protein in Corynebacterium glutamicum with pSG201-gfp vector inserted using 201 promoter when comparing the correlation between recombinant microorganism of ATCC 6872 strain) and two types of promoters (200 promoter and 201 promoter) Its activity was found to be the best.

(2) Determination of the expression activity of promoter sequences for protein electrophoresis

SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) made the separating gel to have an acrylamide concentration of 10%, and the stacking gel had an acrylamide concentration of 8%. Made it possible. SDS-PAGE buffer was used 25 mM Tris-base, 192 mM glycine, 0.1% SDS, pH8.3, the supernatant of the cell lysate was 5 × sample buffer (60 mM Tris-HCl pH6.8, 25% glycerol, 2% SDS, 14.4 mM 2-mercaptoethanol, 0.1% bromophenol blue) were mixed and heat-treated at 100 ° C. for 5 minutes. The electrophoresis device was a Bio-Rad, Mini-Protean II apparatus.

Expression of catalase by the 200 promoter and the 201 promoter in the recombinant Corynebacterium glutamicum and the recombinant Corynebacterium ammonia gene prepared in Example 6 was confirmed by protein electrophoresis. As shown, catalase was shown as the amount corresponding to the main (indicated by the arrow) in the entire protein band and appeared to be the best when using the 201 promoter in Corynebacterium ammonia genes. A control means Corynebacterium ammonia genes or Corynebacterium glutamicum without the transformation vector.

In addition, in the recombinant Corynebacterium glutamicum prepared in Example 6, the expression pattern of Chloramphenicol acetyltransferase by 200 promoter and 201 promoter was indirectly confirmed by protein electrophoresis. As shown, chloramphenicolacetyltransferase showed similar expression by the 200 promoter and the 201 promoter. The control means Corynebacterium glutamicum without the recombinant vector.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

1 is a schematic diagram showing the construction of a recombinant vector inserted promoter according to the present invention.

2 is a graph confirming the expression activity of the GFP induced by the promoter according to the present invention with fluorescence.

Figure 3 is a result of protein electrophoresis of the expression pattern of catalase induced by the promoter according to the present invention (a: recombinant Corynebacterium ammonia genes and b: recombinant Corynebacterium glutamicum).

Figure 4 shows the results of protein electrophoresis of the expression of chloramphenicolacetyltransferase in the recombinant Corynebacterium glutamicum induced by the promoter according to the present invention.

<110> GenoFocus          Inje University <120> Promoter derived from Bacillus subtilis and Use <160> 18 <170> KopatentIn 1.71 <210> 1 <211> 68 <212> DNA <213> 200 promoter <400> 1 cttaacagcc catccttttt gtattgaaaa aaacagaatc atcgctataa tgggtaaaaa 60 aggaaaga 68 <210> 2 <211> 68 <212> DNA <213> 201 promoter <400> 2 agaaaattat tttaaatttc ctcttgaaaa aaacagaatc atcgctataa tgggtaaaaa 60 aggaaaga 68 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> A forward primer for PCR of beta-galactosidase gene <400> 3 atgtcacaat taacgtatga tg 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A reverse primer for PCR of beta-galactosidase gene <400> 4 tcaaggtgtt tttggtattg 20 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> A sequencing primer for putative promoter search <400> 5 agcggataac aatttcacac agga 24 <210> 6 <211> 348 <212> DNA <213> A sequence region containing 200 promoter from Bacillus subtilis <400> 6 gatccaagaa tataaggatg ggcttaacag cccatccttt ttgtattgaa aaaaacagaa 60 tcatcgctat aatgggtaaa aaaggaaaga gggcgaggca atgttcactt gcaaggtaaa 120 tgagcacatc accatccgat tattggagcc gaaggatgcg gagcggctgg ccgaactcat 180 tatccaaaat cacgcacgcg gcttggcaag tggctgtttt ttgcggaaaa tccaagcagc 240 gctgacacgt accgagaaac aatcattcca gattggcggc gccagtatgc cgacctgaac 300 ggcattgagg cgggtctcct ttatgacggc agcctatgcg gcatgatc 348 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A forward primer for PCR of Corynebacterium ori gene <400> 7 aaaaacggtg atcggatttt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A reverse primer for PCR of Corynebacterium ori gene <400> 8 gatctttggg agcagtcctt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A forward primer for PCR of rrnB T1 terminator gene <400> 9 gcttaaataa aacgaaaggc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A reverse primer for PCR of rrnB T1 terminator gene <400> 10 aaagagtttg tagaaacgca 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A forward primer for PCR of kanamycin gene <400> 11 gtgaatggac caataataat 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A reverse primer for PCR of kanamycin gene <400> 12 tcaaaatggt atgcgttttg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A forward primer for PCR of gfp gene <400> 13 atggtgagca agggcgagga 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A reverse primer for PCR of gfp gene <400> 14 ttatctagat ccggtggatc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A forward primer for PCR of catalase gene <400> 15 atgtcgcaac ataacgaaaa 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A reverse primer for PCR of catalase gene <400> 16 tcaggcagga attttgtcaa 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A forward primer for PCR of chloramphenicol acetyltransferase          gene <400> 17 atgaacttta ataaaattga 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> A reverse primer for PCR of chloramphenicol acetyltransferase          gene <400> 18 ttataaaagc cagtcattag 20  

Claims (7)

A promoter containing a nucleotide sequence of Nos. 24 to 68 in the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and having a nucleotide sequence having at least 70% identity with SEQ ID NO: 1 or SEQ ID NO: 2. The promoter of claim 1, wherein the promoter has a nucleotide sequence having 90% or more identity with a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2. A recombinant vector comprising the promoter of claim 1 and a gene encoding a protein of interest, wherein said recombinant vector is operably linked. The recombinant vector of claim 3, wherein the protein of interest is selected from the group consisting of GFP, catalase, and chloramphenicolacetyltransferase. A recombinant microorganism having the promoter of claim 1 or the recombinant vector of claim 3 inserted into a host cell selected from the group consisting of bacteria, fungi and yeasts. The recombinant microorganism according to claim 5, which is a genus Corynebacterium. Culturing the recombinant microorganism of claim 5 to express the protein of interest; And recovering the expressed protein of interest.

Images