KR20100074455A

KR20100074455A - Probe for detecting pathogen causing periodontal disease and assay device using thereof

Info

Publication number: KR20100074455A
Application number: KR1020080132895A
Authority: KR
Inventors: 김연수; 김이숙
Original assignee: 김연수
Priority date: 2008-12-24
Filing date: 2008-12-24
Publication date: 2010-07-02

Abstract

PURPOSE: A probe for detecting pathogens of periodontal diseases and an analysis apparatus using the same are provided to improve reproductivity and specificity. CONSTITUTION: A probe for identifying the presence of periodontal disease pathogen comprises: a nucleotide of sequence numbers 1-24; or nucleotide selected from a complementary sequence thereof. The probe is specifically hybridized with genome thereof. The pathogen is Porphyromonas gingivalis, Eikenella corrodens, Streptococcus mutans, Actinobacillus actinomycetemcomitans, Prevotella intermedia, or Treponema denticola. A DNA chip for analysis of periodontal diseases comprises a probe a nucleotide of sequence number 1-12 or complementary nucleotide sequence thereof.

Description

Probe for Detecting Pathogen Causing Periodontal Disease and Assay Device Using Thereof}

The present invention relates to a method and apparatus for detecting and analyzing periodontal disease causative organisms, and more particularly, a probe that specifically hybridizes to the genome of a causative organism causing periodontal disease, and a sample of the periodontal disease causative organism using the probe. It relates to an analysis device such as a DNA chip that can analyze whether or not infected with.

In the human oral cavity, billions of bacteria live in clusters to form plaques. The bacteria in the plaques live on sugars consumed as food. The plaque is mainly produced on the surface of the tooth and is partially removed by brushing, but the plaque formed between the tooth and between the teeth and between the tooth and the gum remains unremoved by brushing, and bacteria are multiplied in the remaining plaque at these sites. It releases toxic substances and causes inflammation of the gums. This inflammation causes the periodontal disease to invade the alveolar bone, so if the plaque is not removed quickly, the plaque will gradually turn into hard calcareous calculus, which will continue to affect the gums.

Periodontal disease is an inflammatory disease caused by bacteria in the supportive tissue of the teeth. Periodontal disease is a mild periodontal disease in which inflammation is present only in the gingival area, such as gingival bleeding, without clinically destroying the alveolar bone. It is a disease including periodontitis (gingivitis), which is a periodontal disease in which gum tissue is reduced to a normal state, and periodontitis, which is an aggressive periodontal disease in which inflammation propagates inside the alveolar bone and destroys tooth support tissue.

As such, gingivitis, which is an early stage of periodontal disease, invades only soft gum tissue and can be recovered at this stage, but if left untreated, gingivitis can cause periodontitis and periodontitis is a late stage of periodontal disease. In other words, the bones are severely injured and require special treatment at this stage, or the teeth will be lost.

In particular, as the periodontal disease progresses, teeth and tooth decay can invade gum and alveolar bone, and teeth may be lost. At least half of adults 18 years or older are in the initial stages of periodontal disease, and in some cases, 5 to 6 years. Symptoms may also be found in children. In other words, periodontal disease can occur at all ages, and periodontal disease, which is a cause of tooth loss, is affected by more than 60% of Korean adults, and the morbidity rate increases with age as one of the two major dental diseases. There is a trend.

As such, periodontal disease, which is known as a major cause of tooth loss in adults, ranks 9th in all other diseases in terms of national health insurance benefit costs, and if it includes dental care costs due to dental loss, Expenditures are expected to reach enormous levels, and this trend will become more severe as the population ages.

To date, studies have shown that the invention of periodontal disease is influenced by environmental factors, other diseases in progress, and genetic factors, but the typical pathogenesis is periodontal disease caused by bacterial infection of the periodontal tissue. In particular, periodontitis is known to be closely associated with specific gram-negative bacterial infections infecting lower gum tissue.

The greatest etiology of periodontal disease is the bacterium that causes plaque. Plaque is composed of oral bacteria and their products, and it adheres firmly to the tooth surface and cannot be removed by brushing teeth. 1 mg of plaque contains about 108 bacteria, more than 25% of which are living bacteria. . The plague is initially initiated by the attachment of bacteria to an acquired thin membrane and matures as colonies form as the amount of bacteria increases over time. In particular, Streptococcus mutans produces sticky substances such as dextran and levan from sucrose, which is a carbohydrate component ingested as food, and adheres to prag after 8 to 24 hours. Is formed. After these early stages, the kinds of bacteria that make up the plague also change. In other words, aerobic bacteria such as Streptococcus, Neisseria and Cardia predominate, but the anaerobic bacterium Actinomyces ), Veillonella, and Fusobacterim increase.

As such, gingivitis occurs after 3 to 4 days if the oral cleansing is not lived, and the gingivitis has been reported to be closely related to the increase of bacteria in the plaque, especially Actinomyces. However, the cause of periodontal disease has not yet been sufficiently identified, but it is believed that various kinds of pathogens, such as Actinomyces, Bacteroide, Baylonella, and Spirochetes, are considered to be pathogenic.

On the other hand, in periodontitis, Gram-negative bacillus is likely to be involved. Although these bacteria are rarely directly invaded into the gingiva, it is observed that the bacteria invade when the inflammation is strong. Even if the bacteria do not invade the gingiva, irritants such as enzymes (collagenase), endotoxins, and immune response substances produced by the bacteria relax the epithelial cell binding of the gingiva and pass through the epithelium to reach the periodontal connective tissue and cause inflammation. Weakens these tissues. As the symptoms of periodontitis deepen, anaerobic Gram-negative bacillus increases, especially rapid progressive periodontitis with black-pigmented bacteriodes, gingivalis, and juvenile periodontitis with actinobacillus actinos. Mycetem comitans ( Actinobacillus actinomycetem comitans ) is considered as a causative agent.

By the way, the primary local factors such as plaque in the cause of periodontal disease is very important, but the effect of systemic health should also be considered. And in advanced periodontitis, more detailed diagnosis and treatment plan should be established to predict disease prognosis and treatment outcome. To date, periodontal disease is diagnosed based on clinical and radiological results by combining changes of periodontal tissue according to patient age, for example, loss of alveolar bone, agitation, inflammation, and the like.

However, in relation to periodontal disease, in most cases, alveolar bone loss is 50% or more, so the dentist visits the hospital and requires continuous treatment. In particular, in relation to periodontal disease, according to the recent Ministry of Health and Welfare statistics, the average number of tooth decay in Korea is 3.1, the highest among OECD countries, 1.3 times higher than the OECD average of 1.3 times. The prevalence of periodontal disease among the 35-44 year-olds was 86.5%, and the age of 65-74 years was 92.1%. Based on this, the estimated labor loss date is 1.44 million days per year and the economic loss cost is estimated at 1.8 trillion won per year. It is a reminder of the importance of the oral health prevention medicine business in the future.

In other words, there is no analysis kit that detects and detects infections caused by the causative bacteria in the early stages related to periodontal disease.Therefore, it is impossible to detect the causative agent of periodontal disease that causes huge economic loss due to tooth loss. The burden on the general public is expected to increase. However, it is not preferable in terms of effective prevention of tooth loss through early detection and efficient management of periodontal disease-causing bacteria.

As described above, many studies have been conducted regarding the treatment and prevention of periodontal disease, which is a very common disease in the human body. For example, Korean Patent No. 563213 proposes a periodontitis prevention and treatment composition comprising heparin or salt thereof having an inhibitory activity of aggregation of porphyromonas gingivalis and human erythrocyte cells, which is one of the causative agents of periodontal disease, as an active ingredient. Korean Patent Laid-Open Publication No. 2004-24057 proposes a periodontal disease prevention composition obtained from wild chrysanthemum essential oil components. In addition, Korean Patent No. 292304 discloses an antigenic complex used to induce an antibody response against porphyromonas gingivalis, one of the causes of periodontal disease. However, drugs such as antibiotics, vaccines, etc., which have been developed in connection with periodontal disease, including the aforementioned patents, are still limited in their use. In addition, in relation to the periodontal disease, it is necessary to find a method for diagnosing the possibility of periodontal disease in advance, rather than the condition of the periodontal disease.

In this regard, Korean Laid-Open Patent Publication No. 2007-0001984 analyzes virulence products such as arg-ginzipain, 48 KDa protease and leukotoxin derived from periodontal disease-causing bacteria and components derived from an immune or inflammatory system derived from the human body. Test kits for the detection of periodontal disease have also been proposed, but assays for assaying virulence products are cumbersome and have the potential for poor sensitivity and accuracy.

Accordingly, there is a need to develop a rapid, efficient and highly sensitive detection system for whether or not cells in the oral cavity have been infected by periodontal disease-causing bacteria prior to the full-scale onset of periodontal disease such as inflammation of oral tissue in relation to periodontal disease. have.

The present invention has been proposed to solve the above problems, an object of the present invention is an oligo which can quickly and simply detect and detect the infection of periodontal tissue in the oral cavity by various bacteria closely related to the periodontal disease It is intended to provide probes and / or primers consisting of nucleotides.

Another object of the present invention is an analysis device capable of selectively detecting periodontal disease causative bacteria using the above-described probe and primer, for example, polymerase chain reaction (PCR) kit, DNA chip (microarray), DNA chip It is to provide a periodontal disease diagnostic kit comprising.

Another object of the present invention is to determine whether the periodontal disease-causing bacteria of the target sample is infected by the hybridization and / or amplification reaction between the probe and / or primer and the target sample, so as to diagnose the presence of periodontal disease-causing bacteria. It provides a method and a method of manufacturing the above-described diagnostic kit.

Other advantages and objects of the present invention will become more apparent from the following detailed description of the invention and the accompanying drawings.

According to one aspect of the present invention having the above object, as a probe for confirming the presence of periodontal disease-causing bacteria, consisting of the base sequence of SEQ ID NO: 1 to SEQ ID NO: 24 or a base sequence complementary to these base sequences, respectively There is provided a probe consisting of at least one nucleotide selected from the group.

At this time, the probe is characterized in that the hybridization (specific hybridization) with the genome of the periodontal disease-causing bacteria, the base sequence of SEQ ID NO: 1, 2, 13 and 14 or base sequence complementary to these base sequences, respectively Nucleotides are specifically hybridized to the genome of Porphyromonas gingivalis , and the base sequences of SEQ ID NOS: 3, 4, 15, and 16, or base sequences complementary to these base sequences, respectively, wherein the nucleotides are Ekenella Nucleotide that specifically hybridizes to the genome of Eikenella corrodens , and consists of the base sequences of SEQ ID NOs: 5, 6, 17, and 18 or complementary to these base sequences, respectively, Streptococcus mutans) and hybridization of the genome and specific, respectively, complementary to the nucleotide sequence or those nucleotide sequences of the SEQ ID NO: 7, 8, 19 and 20 Oligonucleotide consisting of the base sequence is bad Martino Bacillus evil Martino Mai setem Cormier Tansu (Actinobacillus actinomycetemcomitans) of the genome and specific to the hybridization, each complementary to a nucleotide sequence or those nucleotide sequences of the SEQ ID NO: 9, 10, 21 and 22 Nucleotide consisting of the base sequence is specifically hybridized to the genome of the Prevotella intermedia , consisting of the base sequence of SEQ ID NO: 11, 12, 23 and 24 or the base sequence complementary to these base sequence, respectively The nucleotides are characterized in that they specifically hybridize with the genome of Treponema denticola .

On the other hand, according to another aspect of the invention there is provided an analysis device and a manufacturing method that can detect and detect the presence of periodontal disease-causing bacteria using the probe described above.

For example, in another aspect of the present invention, there is provided a DNA chip for periodontal disease causative organism analysis, comprising a probe consisting of the base sequence of SEQ ID NO: 1 to SEQ ID NO: 12 or a base sequence complementary to each of these base sequences.

In this case, the DNA chip is an oligonucleotide DNA chip that is bonded through a covalent bond with the glass, and the guanine base is added to the end of the probe, and the modified probe is fixed through a hydrogen bond with a derivative arranged on the glass. It is characterized in that, the probe can be fixed on the glass at a concentration of 50 ~ 150 ㎍ / ㎖.

According to a preferred embodiment, it may further include a positive control for indicating the position of the probe in a region independent of the region to which the probe is fixed on the DNA chip.

On the other hand, according to another aspect of the present invention the above-described periodontal disease causative bacteria analysis DNA chip; It provides a kit for analyzing periodontal disease causative bacteria comprising a label means for detecting a hybridization reaction between the probe and the sample DNA contained in the DNA chip.

In this case, the labeling means may be a fluorescent material, preferably selected from the group consisting of Cy3, Cy5, biotin binding compound, tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC) and x-rhodamine Can be.

The kit for analyzing the periodontal disease cause of the present invention may further include amplification means for amplifying the sample DNA, wherein the amplification means is complementary to the nucleotide sequence of SEQ ID NO: 13 to SEQ ID NO: 24 or these nucleotide sequences Primers which are oligonucleotides consisting of a base sequence.

Further, according to another aspect of the invention, the step of modifying the probe by binding a guanine base to the 5 'end of the probe consisting of the base sequence of SEQ ID NO: 1 to 12 or a base sequence complementary to each of these base sequences; It provides a method for producing a periodontal disease causative organism diagnostic kit comprising the step of fixing the modified probe on a glass to prepare a DNA chip.

At this time, the probe is characterized in that fixed to the glass phase at a concentration of 50 ~ 150 ㎍ / ㎖.

In addition, according to another aspect of the invention using a nucleotide selected from the group consisting of the base sequence of SEQ ID NO: 13 to SEQ ID NO: 24 or a base sequence complementary to each of these base sequences as a primer, and target the nucleic acid obtained from the biological sample A method of amplifying a nucleic acid of a periodontal disease causing bacterium by performing a polymerase chain reaction (PCR) using DNA.

At this time, the primer is a first primer set consisting of the nucleotides having a base sequence of SEQ ID NO: 13 and SEQ ID NO: 14 or a base sequence complementary to these base sequences, respectively; A second primer set consisting of the nucleotide sequences of SEQ ID NO: 15 and SEQ ID NO: 16 or nucleotides each having a nucleotide sequence complementary to these nucleotide sequences; A third primer set consisting of the nucleotide sequences of SEQ ID NO: 17 and SEQ ID NO: 18 or nucleotides each having a nucleotide sequence complementary to these nucleotide sequences; A fourth primer set consisting of the nucleotide sequences of SEQ ID NO: 19 and SEQ ID NO: 20 or nucleotides each having a nucleotide sequence complementary to these nucleotide sequences; A fifth primer set consisting of the nucleotide sequences of SEQ ID NO: 21 and SEQ ID NO: 22 or nucleotides each having a nucleotide sequence complementary to these nucleotide sequences; At least one set of primers comprising a nucleotide sequence of SEQ ID NO: 23 and SEQ ID NO: 24 or a sixth primer set consisting of nucleotides each having a nucleotide sequence complementary to these nucleotide sequences; The primer set to the sixth primer set are Porphyromonas gingivalis , Eikenella corrodens , Streptococcus mutans , Actinobacillus actinomycetem comitans, respectively. ( Actinobacillus actinomycetemcomitans ), Prevotella intermedia ( Prevotella intermedia ), It is characterized by amplifying the nucleic acid of Treponema denticola ( Treponema denticola ).

On the other hand, according to another aspect of the present invention, the aforementioned primer; dNTP mixtures (dATP, dCTP, dGTP, dTTP); Heat resistant polymerase; And it provides a kit for detecting periodontal disease-causing bacteria comprising a PCR buffer solution.

In the present invention, probes and / or primers of oligonucleotides that can specifically hybridize or amplify with the genome of the causative organism which are closely related to periodontal disease were identified.

Accordingly, by using these probes and / or primers to detect and detect the presence of periodontal disease-causing bacteria present in the oral cavity, an analytical device capable of rapidly diagnosing whether target cells have been infected by the periodontal disease-causing bacteria, the polymerase Accurately and quickly diagnose large quantities of infection and presence of periodontal disease-causing bacteria through DNA kits, oligonucleotide-type microarrays, as well as kits for labeling reactions, as well as assay kits containing labeling means on the DNA chip. can do.

In addition, by improving the coupling and bonding process between the probe and the slide glass, the manufacturing process is shortened and the error is reduced, thereby accurately detecting the presence of the causative agent of periodontal disease and rapidly predicting the association with tooth loss due to periodontitis and caries disease. There is an effect that can be diagnosed.

In addition, the multi-PCR chip of the present invention is more than 98% confidence level, sensitivity, specificity, and reproducibility of diagnosis of the cause bacteria of periodontal disease, complex infections can be accurately diagnosed, the method of examination is simple, and the results are easy to interpret In addition, it is superior to existing methods and economical in that a large number of samples can be analyzed quickly and accurately in a short time.

Therefore, the kit for testing periodontal disease-causing bacteria of the present invention is considered to be widely used for the primary search or confirmation and treatment policy determination, it is expected to replace the existing methods such as culture or staining.

As described above, there is a need for a method for detecting and detecting the presence of periodontal disease-causing bacteria in advance, rather than post-treatment of periodontal disease, and in the present invention, a probe and / or capable of specifically hybridizing with periodontal disease-causing bacteria. The use of primers to identify the exact DNA of the causative organism, for example through polymerase chain reaction (PCR) analysis, together with a system to accurately read the type of bacteria causing the periodontal disease and accompany appropriate treatment. have. To this end, it is urgent to develop multiple PCR analysis DNA chips (or DNA microarrays) capable of simultaneously analyzing various periodontal disease-causing bacteria and establishing a therapeutic system. Accordingly, in the present invention, the multiple PCR method for the above six periodontal disease-causing bacteria and DNA chips capable of analyzing the presence or absence of the six kinds of causal bacteria were studied.

That is, the present inventors proceed with research to quickly and accurately diagnose the presence of a causative agent of periodontal disease (PED), and a probe and / or composed of oligonucleotides that can specifically bind to the causative agent of periodontal disease. The present invention has been completed based on the fact that the presence or absence of periodontal disease-causing bacteria can be detected quickly and accurately in a target cell using a primer. Hereinafter, the technical configuration of the present invention will be described in detail.

1. Screening for Nucleotide Specific Hybridization with Periodontal Disease-causing Bacteria

As mentioned above, periodontal disease is usually caused by the formation of plaque by bacteria present in the oral cavity, in particular gingivitis and periodontitis occur when gram-positive bacteria in the oral cavity are replaced with gram-negative bacteria. In the present invention, among the bacteria causing periodontal disease, the genome of six periodontal disease causative organisms is typically selected and synthesized oligonucleotides capable of specifically hybridizing with the nucleic acids of the periodontal disease causative organisms, and the selected oligonucleotides are probed and It was confirmed that it can be used as a primer to detect the presence of periodontal disease-causing bacteria in the target sample. A total of six bacteria analyzed as periodontal disease causative organisms will be briefly described in connection with the present invention.

As described above, various bacteria exist in the oral cavity, and gram-positive bacteria in the oral cavity are replaced with gram negative and basic bacteria, and it is known that periodontal diseases such as gingivitis and periodontitis are caused. Porphyromonas gingivalis is a Gram-negative, anaerobic, rod-shaped bacterium, which is one of the representative periodontal disease causing bacteria, including chronic severe periodontitis in the oral cavity. Porphyromonas gingivalis, which causes periodontitis, has a genome of approximately 2.3 million base pairs and binds to collagen and fibronectin, surface matrix proteins present on the surface of mucosal epithelial cells in the mouth, It has been reported to cleave these proteins by cleaving the C-terminus (M Kontani, H Ono, H Shibata, Y Okamura, T Tanaka, T Fujiwara, S Kimura and S Hamada, (1996), Cysteine protease of Porphyromonas gingivalis 381 enhances binding of fimbriae to cultured human fibroblasts and matrix proteins, Infection and Immunity 64 (3): 756-762), especially N-acetylneuraminic acid and glucuronic acid present in epithelial cells Has been reported to be associated with adsorption of porphyromonas to host cells (G Agnani, S Tricot-Doleux, S Houalet, M Bonnaure-Mallet, (2003), Enzymatic treatments of the epithelial membran) es and sugar competition studies showed that N-acetylneuraminic acid and glucuronic acid were involved in binding, Infection and Immunity , 71 (2): 991-996). In particular, porphyromonas gingivalis relies on amino acids and peptides, not carbohydrates, to make carbon and nitrogen components necessary for the growth of bacteria, using cysteine protease, a proteolytic enzyme that is released out of cells. It is known to rely on the iron in the form of hemin (haemin), which is an oxidation product of heme or Fe (III), by breaking down proteins existing outside the cell and ingesting nutrients necessary for growth.

Eikenella corrodens is a Gram-negative bacillus that can live in the presence of oxygen as well as anaerobic conditions (facultative anaerobe), and parasites in the oral cavity and airways. Akenella corodens is generally infected with bacteria of the genus Streptococcus, which is found to be associated with periodontal disease at high levels in the oral cavity of patients with periodontal disease. Cultivation in oxygen conditions requires hemin, but anaerobic conditions do not require hemin and are known to inhabit well in approximately 3-10% carbon dioxide.

Streptococcus mutans are Gram-positive, anaerobic bacteria that primarily live in the oral cavity and cause oral diseases such as caries and periodontal disease. In other words, Streptococcus mutans absorb nutrients while fermenting sucrose, a saccharide contained in food, and decay of the tooth surface by lactic acid (lactic acid) produced in this process causes dental plaque to cause tooth decay. In addition, Streptococcus mutans produces dextran-based polysaccharides using sucrose contained in the ingested food, which causes the periodontal disease by agglomerating and forming plaques.

Actinobacillus actinomycetemcomitans is an anaerobic spherical or rodent bacterium that can live in Gram-negative and oxygen conditions, causing serious diseases in the oral cavity such as periodontitis in addition to endocarditis. The virulence factors of Actinobacillus actinomycetemcomitans are known as leukotoxin, collagenase, chemotaxis inhibitors, and lipo-polysaccharide (LPS). have.

Prevotella intermedia is a Gram-negative, anaerobic, rod-like bacterium involved in periodontal disease, including damage to the periodontal bone, clustered together with P. gingivalis , described above. In particular, it is mainly found in periodontal of adult periodontitis, and it is reported to be associated with gestational gingivitis and acute necrotic gingivitis.

Treponema denticola is a gram negative, helical shaped, kinetic proteolytic bacterium. It has a double helix DNA consisting of approximately 2.8 million base pairs in its genome and, together with Porphyromonas gingivalis, forms plaque in the gums that causes periodontal disease. In particular, liposaccharide, peptidoglyan, and chemotrypsin-like enzymes caused by treponema dentichola lost binding of periodontal epithelial cells and penetrated into tissues. It is related.

Accordingly, the present invention is designed to design a primer and a probe that can detect whether the infection caused by the above-mentioned causative bacteria closely related to periodontal disease is very sensitive and high specificity, and a plurality of present in oral cells using the primer and probe It is possible to detect the causative agent of periodontal disease. To this end, in the present invention, specific probes and / or primers are designed using a computer program based on six PED causative bacteria DNA sequences closely related to periodontal disease, and the designed probes are various periodontal using other computer programs. After confirming the binding ability to the disease-causing bacteria, 12 primers and 12 probes were finally selected.

2. Analysis device

In the present invention, it has been found that the present invention can be applied to a molecular biological analysis apparatus by using a total of 24 probes capable of specifically hybridizing with the nucleotide sequence of the nucleic acid constituting the genome of the periodontal disease causative organism described above. Probes and / or primers selected in accordance with the present invention can be applied, for example, to PCR kits and / or DNA chips.

end. Polymerase Chain Reaction Kit

Polymerase chain reaction is a technique that can amplify small DNA fragments (target regions) through repeated replication cycles by DNA polymerase. For PCR, heat-stable DNA polymerase (such as Taq polymerase) capable of rapidly copying template DNA, template DNA containing amplified DNA regions (target regions), and base sequences complementary to both end regions of the target region Primers which are oligonucleotides having; There is a need for a buffer solution that provides an appropriate chemical environment with respect to the optimal activity and stability of dNTP and DNA polymerase that can be synthesized by these DNA polymerases.

In the present invention, as described above, 12 primers capable of specifically hybridizing with the genome of the periodontal disease-causing bacterium are selected, and polymerase chain reaction is performed using these primers. At this time, when a labeling means such as a fluorescent material such as Cy3 or Cy5 is added to the PCR reaction solution, the presence of the amplification product can be confirmed by electrophoresis. Of course, one or more sets of primers can be used that can be specifically hybridized to the genome of periodontal disease-causing organisms, but if possible, primers that can produce different sizes of amplification products for each periodontal disease-causing organism can be generated in one PCR kit. The multiplex PCR method can be used to confirm the size of the amplified product in a single PCR analysis to identify the target sample specifically caused by which periodontal disease-causing organisms. It is preferable because it can reduce. Therefore, it is preferable to design the amplification products of different sizes for each periodontal disease-causing bacterium during the screening of the primers.

I. Microarrays (DNA Chips) and Analysis Kits Containing the Same

DNA chips, also called DNA microarrays, are made up of an array containing thousands or more DNA oligonucleotide spots (also called features) that contain a specific DNA sequence at the level of picomoles. This spot is infused with a target that is capable of hybridizing under high-stringent conditions, and the hybridization reaction between the probe and target is analyzed by labeling means such as fluorescent material.

In standard microarrays, probes are attached to a chemical matrix (epoxy-silane, amino-silane, lysine, polyacrylamide, etc.) on a solid substrate surface, such as glass, plastic, or silicon chip, with thousands of probes in an array It is very efficient for testing at the molecular biology level because it can be injected into the.

In particular, a DNA chip that can be used in connection with the present invention attaches a hydrogen bondable functional group to a designed probe, and the probe with the functional group is attached to the surface of the solid substrate formed on the DNA chip in a site-assembled manner by hydrogen bonding. Can be modified to As a material capable of modifying a solid substrate, for example, an aminocalixarene derivative disclosed in Korean Patent Publication No. 2002-0031734 may be mentioned.

On the other hand, it is preferable that the probe used according to the present invention is modified by, for example, 6-10, preferably 9, guanine bases before being immobilized onto a DNA chip. As such a DNA chip, for example, 'BMT guanine chip' manufactured and sold by Biometrics Technology Co., Ltd. may be mentioned.

According to the present invention, in order to prepare a DNA chip (microarray) for detecting whether a target sample is infected with periodontal disease, a probe capable of specifically hybridizing with the periodontal disease causative organism should be synthesized and immobilized on the base DNA chip. . By the way, the DNA chip of the present invention is free from other functional groups, unlike the terminal of the DNA microarray-based technology, which is developed by many companies, by modifying the terminal of the probe with an amine group and then fixing the probe according to the Schiff-base reaction with the aldehyde group on the glass. When the solution containing the oligonucleotide (probe) in which one end is modified by 6-10, preferably 9, guanine bases is applied onto the chip base, the guanine base is spontaneously immobilized on the chip.

In this case, modification was performed to add a plurality of guanine bases to the 5 'end of the probe so that the probe could be spontaneously fixed to a glass slide formed on the surface of the DNA chip. In this regard, probes fixed to be hybridized with causative organisms related to periodontal disease may be spotted at a concentration of 50 to 150 μg / ml.

This DNA chip modified from the existing chip base iii) is a technology for recognizing guanine bound to the terminal and immobilizing the biomolecule on the surface, so that no other functional groups are required, so that the probe can be fixed at low cost. Ii) Compared to the conventional DNA chip, shorter hybridization time of 10-30 minutes and simple washing process are required, so the SNP discrimination process of 30 steps can be adjusted in 5 steps. The DNA chip according to the present invention can easily identify SNP (single nucleotide polymorphism) even at a temperature difference of 5 ° C. or more. Have used cDNAs of more than a few tens of ng / ml for reading the results, while BMT Guanine Chip ™ has used SNP plates at concentrations of tens of pg / ml to tens of ng / ml. Not only is this possible, i.e., if there is a lot of background fluorescence around the measuring point, there are many problems with reading, but BMT Guanine Chip ™ provides a special surface treatment and blocking solution to prevent cDNA from attaching to the surface to maximize background fluorescence. By removing, only the fluorescence of the clear measuring point can be observed.

On the other hand, the modified periodontal disease-causing bacteria-specific probe as described above has a label means separate from the DNA chip to detect whether the infection of the periodontal disease-causing bacteria by detecting the hybridization reaction of the sample DNA on the immobilized DNA chip Kits can be made. In this case, the sample DNA capable of hybridizing with the probe may be a PCR product amplified by a primer capable of amplifying the nucleic acid of the periodontal disease-causing bacterium according to the present invention, and the labeling means may be a substance detectable to the PCR product. have. In connection with the present invention, a fluorescent substance may be used as a labeling substance attached to the DNA amplification product of the periodontal disease-causing bacterium. Labeling means that may be used in connection with the present invention include, but are not limited to, Cy3, Cy5, biotin binding compounds, tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC), x-rhodamine, and the like. It is not.

Twelve periodontal disease-causing bacteria-specific probes identified in the present invention after PCR using the primers used in the present invention using 6 kinds of bacteria as target DNA using a diagnostic kit using the DNA microarray technology configured as described above. Hybridization with and confirmed that it selectively binds to the periodontal disease causative DNA of the corresponding specific causative bacteria.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following examples are only examples for demonstrating the constitution and effects of the present invention, and the present invention is not limited to the following examples.

Example 1: Design of probes capable of hybridizing with periodontal disease-causing bacteria

In this example, oligonucleotides have been designed that can be used as probes and / or primers that can be selectively hybridized to nucleic acids of periodontal disease (PED) causative bacteria that cause severe side effects such as tooth loss.

(1) Design of oligonucleotide probes for PED causative bacteria

First, from the US National Center for Biotechnology Information (NCBI) database, six types of periodontal diseases, Prevotella intermedia (PI), Actinobacillus actinomycetemcomitans (AA), Overall for Ikenella corrodens (EC), Porphyromonas gingivalis (PG), Streptococcus mutans (SM), Treponema denticola (TD) Genomic base sequences were obtained. Using the computer program 'DNASTAR (MegAlignTM 5, DNASTAR Inc.)', the obtained nucleotide sequence is subjected to pairwise alignment and multiple sequence alignment using the ClustalW method, and then a Phylogenetic tree is created. After selecting the type-specific sequences of each causative organism, the causal bacteria-specific primers and probes were designed using the computer program primer Premier 5 (PreMIER Biosoft International Co.). At this time, the length of the probe was set to 30 ± 3 and 40 ± 2 oligonucleotides to design 12 sets of periodontal disease-causing bacteria-specific primers and probes, respectively.

(2) Selection of designed probe

A total of 12 probes designed in this process were analyzed using a computer program (Amplify 1.2, University of Wisconsin) to analyze the virtual binding capacity of a total of 6 periodontal disease causative organisms already acquired during the design process. In this example, the priority was selected to specifically bind to the six causative bacteria related to periodontal disease, and the names, sequence numbers, and types of probes are shown in Table 1 below. For convenience of description, a total of 12 probes used in the present invention are named PED-1 to PED-12, respectively. These probes consist of the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 12, and the PC represented by SEQ ID NO: 25 is a base encoding Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as 'positive control'. It is part of the sequence.

Table 1. Probes that can hybridize with nucleic acids of PED causative organisms

designation Base sequence (5 '→ 3') Causative bacteria PED1 CGATCACAAAAATGGGCGAATTCAGCAGC (SEQ ID NO: 1) PG PED2 TTCGCCGCAACCATCATTACAAACTGGAC (SEQ ID NO: 2) PED3 CGTGTTGGAGCAAGTAGCCAAAACCAG (SEQ ID NO: 3) EC PED4 CAGCAATATCCGCGATCTGCTGCCCGT (SEQ ID NO: 4) PED5 TCATGATGAAACCATCCGTATTCTGCAACT (SEQ ID NO: 5) SM PED6 CAAACGGATTCATGATGAAACCATCCGTAT (SEQ ID NO: 6) PED7 CCAATCTATATTGAAGTAGCTCAAATTGCGC (SEQ ID NO: 7) AA PED8 TCTATATTGAAGTAGCTCAAATTGCGCAGAG (SEQ ID NO: 8) PED9 TTCTACTTATATCTATGATGGTGAGACTGG (SEQ ID NO: 9) PI PED10 TCCAATGTGTTCTACTTATATCTATGATGGTGA (SEQ ID NO: 10) PED11 CGGAAGAAGGAAGCGTACTTACACTCAAT (SEQ ID NO: 11) TD PED12 CACTATTACGGAAGAAGGAAGCGTACTTAC (SEQ ID NO: 12) PC AACCTGCCAATATGATAACATCAAGAAGG (SEQ ID NO: 25) GAPDH

Example 2: Design of a primer capable of amplifying periodontal disease-causing bacteria

In this embodiment, a primer capable of producing amplification products of a certain size was designed as a probe capable of hybridizing with a nucleic acid of a periodontal disease-causing bacterium through a procedure similar to Example 1 above. The properties of the base sequence and the like of the primers designed according to this example are shown in Table 2 below. For convenience of description, 'PED-F1' to 'PED-F6' for the forward primers among the 6 sets of selected primer sets were respectively named 'PED-R1' to 'PED-R6' for the reverse primers. On the other hand, PCs represented by SEQ ID NOs: 26 and 27 are primers capable of hybridizing with the base sequence encoding glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as 'positive control'.

With reference to the known causal nucleic acid sequences in Table 2, a sequence specific to the species of the target causative organism was discovered, and based on this, six primers for amplifying nucleic acid causative causative organisms were prepared. Porphyromonas gingivalis Porphyromonas gingivalis (PG) designed the primers using gene sequences discovered from the Fimbrilin protein, and Eikenella corrodens (EC) used the gene sequences from the CPN 60 protein. The primers were designed, and Streptococcus mutans (SM) designed primers using gene sequences discovered in formamidepyrimidine-DNA glycosylase protein, and actinobacillus actinos. My setem Komi Tansu (a ctinobacillus actinomycetemcomitans, AA) has been discovered in protein RcpB Using electronic sequences were designed primers, presentations Bo telra intermediate (Prevotella intermedia, PI) was designed primers using the gene sequence discovered in RpoB protein, Tre Four Cinema denti Cola (Treponema denticola, TD) is TdpA Primers were designed using the gene sequence found in the precusor.

Table 2. Primers that can be crossed with periodontal disease-causing bacteria

designation Primer sequence (5`-3`) Causative bacteria
(Amplification size) primer
domain PED-F1 ^* TCACCATGACGGGAATGGCTACGGCGACTCTTAATC (SEQ ID NO: 13) PG (544) Fimbrilin PED-R1 ^** TCCAAATTCTCTACTGTCCACGGAAGGACGGTGGTC (SEQ ID NO: 14) PED-F2 ^* GGCATGAAATACGTTACCGCAGGCATGAACCCGACCG (SEQ ID NO: 15) EC (474) CPN 60 PED-R2 ^** CAAGGCTTCGCCTTCCACGTCTTCAGCAATAATC (SEQ ID NO: 16) PED-F3 ^* GTGGGTCAACCTTGGTCTATCAGGATGTCCGC (SEQ ID NO: 17) SM (410) Formamidepyrimidine-DNA glycosylase PED-R3 ^** GCAATCCTGCATACTGCCATCTTCACCCAAGC (SEQ ID NO: 18) PED-F4 ^* GATACGACTGTTGCACAACCGATACAAAATAGTGC (SEQ ID NO: 19) AA (357) RcpB PED-R4 ^** AAACTACTTCTCCGGTACGATATGCACAAGGCGC (SEQ ID NO: 20) PED-F5 ^* GATGGGTGTGCCTTCTCGTATGAACCTTGGTC (SEQ ID NO: 21) PI (233) Rpob PED-R5 ^** GTAAGTAATACCCACCGTTGCTGGCTGGTCGAAGCG (SEQ ID NO: 22) PED-F6 ^* TGTAACACCGACGGGAGGAACTGCCCATCCTG (SEQ ID NO: 23) TD (186) TdpA precusor PED-R6 ^** TGTCCTGTTGATACGGGTATGAGGCTGCCGG (SEQ ID NO: 24) INC-F1 ^* GGCTAATGCCCTGGCCCACAAGTATCACTAAGCTC (SEQ ID NO: 26) GAPDH
(120 bp) INC-R1 ^** CAAGGCCCTTCATAATATCCCCCAGTTTAGTAGTTGG (SEQ ID NO: 27)

^* : Forward primer

^** : reverse primer

Example 3 Synthesis of Selected PED Causative Bacteria-Specific Primers and Probes

In this example, the probes and primers that can be specifically hybridized to the periodontal disease-causing bacteria selected through Example 1 and Example 2 were synthesized. The primers and probes were synthesized using an Expedite ™ 8909 nucleic acid synthesizer (ABI) equipped with a solid phase synthesis technique based on oligonucleotide phosphoramidite synthesis chemistry.

First, the synthesis reaction was carried out on a CPG column immobilized with nucleosides located at the 3 'end of the oligonucleotide, and basically detritylation, coupling, capping and oxidation reactions. Synthesis reaction of the selected oligonucleotide was performed by using a repetition cycle. After completion of the synthesis, 30% ammonia water was added to the CPG column to isolate the oligomer, and then deprotected at 55 ° C. for at least 12 hours, concentrated to dryness with Speed Vac., And then reversed phase liquid chromatography and anion exchange chromatography. Pure water purification was carried out. The final purified oligomer was quantified by measuring absorbance at 260 nm.

Example 4 PCR Amplification of Strains

In this example, the polymerase is selected from E. coli strains selected through Example 2 and using the primer sets (SEQ ID NOs. 13 to 24) synthesized in Example 3, and containing plasmids of periodontal disease-causing bacteria. A chain reaction was performed. The E. E. coli strains used in this example are shown in Table 3 below.

Table 3. Strains with Plasmids Infused with DNA of Periodontal Disease-causing Bacteria

Source Organism ATCC No. Prevotella intermedia 15033 Actinobacillus actinomycetemcomitans 33384 Eikenella corrodens 51724D Porphyromonas gingivalis 33277D Streptococcus mutans 25175D Treponema denticola 33521

Each strain of E. coli was shaken for 16 hours in 37 ° C. LB liquid medium, separated and purified with Qiafilter Plasmid Maxi Kit (Cat. No. 12263, QIAGEN), and adjusted to 10 ng / μl. Utilized.

The composition of the PCR reaction solution for detecting the presence of pathogenic DNA causing periodontal disease was 2.5 μl of 10X buffer, 3.75 μl of 10 mM MgCl ₂ , 0.5 μl of 10 mM dNTP, and Hot Taq purchased from Pukyong SMS Co., Ltd. 0.5 μl (1 unit) of polymerase was used, and the following primer sets to which Cy3 (Cyanine 3) was bound as a labeling means were obtained from 1 μl (40 pmoles), 5.2 μl of distilled water, and the strains shown in Table 3, respectively. The reaction solution consisting of 8.0 µl each of the six plasmid template DNAs was adjusted to a total of 50 µl. PCR reaction conditions were initially denatured at 94 ° C. for 15 minutes, followed by a total of 35 cycles of 30 seconds at 94 ° C., 1 minute at 65 ° C., and 1 minute 30 seconds at 72 ° C., followed by heating at 72 ° C. for 5 minutes. After the completion of the reaction, 5 μl of the final reaction solution was imposed on a 2% agarose gel with a DNA size standard marker, followed by electrophoresis.

1 is a photograph measuring the results of PCR reaction and electrophoresis according to the present example, M is a marker, PG is a strain having a plasmid injected with DNA of P. gingivalis (ATCC 33227D), EC of E. corrodens A strain having a plasmid injected with DNA (ATCC 51724D), a SM having a plasmid injected with DNA of S. mutans (ATCC 25175D), a AA having a plasmid injected with DNA of A. actinomycetemcomitans (ATCC 33384) , PI means a strain having a plasmid injected with DNA of P. intermedia (ATCC 15033), TD means a strain having a plasmid injected with DNA of T. denticola (ATCC 33521) as the target DNA. It was confirmed that the results shown in FIG. 1 were consistent with the results of Table 2 shown in Example 2.

Example 5 Microarray Analysis of Strains

In this example, the DNA chip was prepared using the probe selected in Example 1 and synthesized in Example 3, and then the detection of the strain identified in Example 4 was confirmed.

(1) Fixation of Synthetic Oligonucleotides

The oligonucleotide-type probe synthesized through Example 3 (SEQ ID NO: 1 to SEQ ID NO: 12) was immobilized on a DNA chip using the following method. First, the oligonucleotide probe modified by adding 9 guanine bases to the 5 'end of the probe synthesized through Example 3 (SEQ ID NOS: 1 to 12) was 100 pmol in 2X SSC (0.05M sodium citrate, 0.45M NaCl). 1 μl (54 μg / ml) was spotted onto the glass of the DNA chip reacted with guanine base added at the 5 ′ end. On the other hand, in the present embodiment, using the oligonucleotide consisting of SEQ ID NO: 25 as a positive control (PC) in order to confirm the position of the probe and the target DNA amplification product, a guanine base is added to the 5 'terminal as described. After deformation by means of spotting on the glass following the same procedure. To this end, using the BMT Guanine chip ™ (Biometrics Technology) in which aminocalixarene derivatives are self-aligned through covalent bonds on a glass substrate, the modified probes are fixed on the chip according to the manufacturer's instructions, washed and dried. Work was performed.

Subsequently, the spotted material was placed in a wet chamber and reacted at room temperature for 2 hours to fix the spotted product. After completion of the reaction, the slides were washed vigorously in 0.2% sodium dodecyl sulfate (SDS) solution for 1 minute, then transferred to tertiary distilled water for 1 minute, and washed with NaBH ₄ solution (0.1 g NaBH ₄ , 30 ml phosphate buffered saline ( PBS), 10 ml ethanol) was reduced for 5 minutes, washed again in distilled water 3 minutes for 1 minute and dried and stored in a dark room at room temperature until use.

(2) hybridization with periodontal disease-causing strains

In the state where the probe modified by adding the guanine base at the 5 'end was fixed to the DNA chip, the hybridization was analyzed using the plasmid contained in the strain used in Example 4 as template DNA. That is, hybridization reaction was performed using a PCR amplification product obtained in Example 4 on a slide substrate on which a total of 12 oligonucleotide probes modified with guanine and template DNA were immobilized. A hybridization reaction chamber (Hybridization reaction chamber) was used for 100 μl capslips (GRACE Bio-Labs, USA).

Specifically, 5 μl of each amplification product obtained in Example 4 was denatured at 95 ° C. for 5 minutes and immediately left on ice for 3 minutes, followed by 18 μl of 20 × SSC, 50 μl of 90% glycerol, and 50 mM phosphoric acid in a hybridization reaction solution. The final dose was adjusted to 90 μl by addition of 15.65 μl of buffer and 1.35 μl of 0.1% SDS, followed by reaction for 10 minutes with the probe immobilized on the slide at 51 ° C. After the completion of the hybridization reaction, the DNA chip was immersed in 2X SSC / 0.1% SDS solution, washed for 2 minutes at 30 ° C, washed for 1 minute at room temperature with 4X SSC solution, then wells were removed, washed briefly at room temperature with EtOH, and then 0.1X. Washed once more with SSC solution and dried. The dried slides were analyzed for fluorescent signals using a confocal laser scanner (SCAN Array Express, PerkinElmer, USA). Analysis results of hybridization using a modified probe of plasmid DNA (template DNA) infected with the periodontal disease-causing bacterium according to the present embodiment are shown in FIGS. 2A to 2F. Circles in each figure indicate the position according to the type of probe, and each name indicates the type of periodontal disease causative organism that is amplified according to the type of probe to which the guanine base is added to the 5 'end used in the present invention. Is a positive control used to identify the position of the modified probe.

Figure 2a shows the ATCC 15033 strain containing Porphyromonas gingivalis (PG) DNA, Figure 2b shows the ATCC 33384 strain containing Eikenella corrodens (EC) DNA, Figure 2c shows the ATCC 51724D strain containing Streptococcus mutans (SM) DNA 2D shows ATCC 33277D strain containing Actinobacillus actinomycetemcomitans (AA) DNA, FIG. 2E shows ATCC 25175D strain containing Prevotella intermedia (PI) DNA, FIG. 2F shows ATCC 33521 containing Treponema denticola (TD) DNA DNA obtained from the strain is used as the target DNA.

As can be seen in the figure, hybridization occurred only in the area where the ATCC 15033 strain containing Porphyromonas gingivalis (PG) DNA was spotted with probes (SEQ ID NOs: 1 and 2) that specifically bind to the DNA of the strain ( Figure 2a), for the ATCC 33384 strain containing Eikenella corrodens (EC) DNA hybridization occurred only in the region where the probe (SEQ ID NO: 3, 4) that specifically binds to the DNA of the strain spotted (Fig. 2B) ), Hybridization occurred only in the area where the ATCC 51724D strain containing Streptococcus mutans (SM) DNA was spotted with probes (SEQ ID NOs: 5 and 6) that specifically bind to the DNA of the strain (Fig. 2C). For the ATCC 33277D strain containing Actinobacillus actinomycetemcomitans (AA) DNA, hybridization occurred only in the region where the probe (SEQ ID NO: 7, 8) that specifically binds to the DNA of the strain was spotted (FIG. 2D). For the ATCC 25175D strain containing Prevotella intermedia (PI) DNA, hybridization occurred only in the spotted region of the PI probe (SEQ ID NOs. 9 and 10) that specifically binds to the DNA of the strain (FIG. 2E). Treponema For ATCC 33521 strains containing denticola (TD) DNA, hybridization occurred only in the spots where the PI probes (SEQ ID NOs: 11 and 12) that specifically bind to the DNA of the strain were spotted (FIG. 2F). On the other hand, it was confirmed that no cross-bridging reaction occurred for the ATCC 45202 strain containing CT DNA as a negative strain, and this result was confirmed to be in agreement with the result of Table 1 shown in Example 1. .

Example 6 PCR Analysis of Clinical Samples

In this example, the presence of periodontal disease-causing bacteria in oral cells obtained from patients with periodontitis or tooth decay according to a conventional test method was confirmed by multiplex polymerase chain reaction. The oral cells of patients suffering from periodontal disease were washed once with Dulbecco's phosphate-buffered saline (Gibco), and the cells were washed with a genomic DNA isolation kit (Cenomic DNA isolation Kit, Cat. No. K-3032, Bioneer). After separation and purification, the solution was finally dissolved in 200 μl of distilled water (DW) and used as a template DNA solution. The basic procedure was the same as in Example 4.

Analysis results according to this example are shown in FIGS. 3A-3K. Considering the size of the resulting amplification product (see Table 2 of Example 2), Subject 1 was Porphyromonas gingivalis (FIG. 3A), Subject 2 was Porphyromonas gingivalis and Streptococcus mutans (FIG. 3B), and Subject 3 was Prevotella intermedia. and in Actinobacillus actinomycetemcomitans (Fig. 3c), the patient 4 is on Actinobacillus actinomycetemcomitans (Fig. 3d), the patient 5 in Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis (Fig. 3e), the patient 6 (Fig. 3f) in Actinobacillus actinomycetemcomitans, and Streptococcus mutans, the patient 7 Silver to Eikenella corrodens and Porphyromonas gingivalis (FIG. 3g), subject 8 to Streptococcus mutans and Treponema denticola (FIG. 3h), subject 9 to Prevotella intermedia (FIG. 3i), and subject 10 to Porphyromonas gingivalis and Treponema denticola (FIG. 3g). Was confirmed to be infected with each, and in the negative control it was found that no causative bacteria were infected (Fig. 3k).

Example 7 DNA Chip Analysis of Clinical Samples

In this example, the hybridization reaction between the amplification product identified in Example 6 and the DNA chip prepared in Example 5 was performed. Otherwise, the procedure described in Example 5 was repeated. Analysis results according to this example are shown in FIGS. 4A-4K. As shown, Subject 1 is Porphyromonas gingivalis (FIG. 4A), Subject 2 is Porphyromonas gingivalis and Streptococcus mutans (FIG. 4B), Subject 3 is Prevotella intermedia and Actinobacillus actinomycetemcomitans (FIG. 4C), and Subject 4 is Actincetemcillus ( actinobatemus ) Fig. 4d), patient 5 (Fig. 4e) in Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis, the patient 6 is in Actinobacillus actinomycetemcomitans, and Streptococcus mutans (Fig. 4f), the patient 7 (Fig. 4g) in Eikenella corrodens and Porphyromonas gingivalis, the subject 8 is Streptococcus mutans and Treponema denticola (FIG. 4H), subject 9 was infected with Prevotella intermedia (FIG. 4I), and subject 10 was infected with Porphyromonas gingivalis and Treponema denticola (FIG. 4J), respectively. It was found to be absent (FIG. 4K).

This analysis result is consistent with the PCR amplification analysis results of Example 6, the PCR amplification test of Example 6 and the results of the DNA chip test through the present example is shown in Table 4 below.

Table 4. PCR analysis and DNA chip analysis results for clinical samples

Subject PCR DNA chip Subject PCR DNA chip One PG PG 6 AA, SM AA, SM 2 PG, SM PG, SM 7 PG, EC PG, EC 3 AA, PI AA, PI 8 SM, TD SM, TD 4 AA AA 9 PI PI 5 PG, AA PG, AA 10 PG, TD PG, TD

In the above, the present invention has been described in detail based on the preferred embodiments of the present invention, but the present invention is not limited thereto. Rather, those skilled in the art will be able to easily make various modifications and changes based on the embodiments described above. However, it will be more apparent through the appended claims that such variations and modifications fall within the scope of the present invention.

1 is a bacterial strain having plasmids of various periodontal disease-causing genome genomes according to one embodiment of the present invention, and after performing multiplex PCR using 12 primers synthesized according to the present invention, the amplification products thereof The photo analyzed by electrophoresis.

2A to 2F are DNA chips obtained by hybridizing amplification products obtained by targeting strains having plasmids of various periodontal disease-causing genomes to DNA chips immobilized with 12 probes synthesized according to an embodiment of the present invention, respectively. Analytical picture.

3A to 3K show DNA obtained from oral cells of a patient suffering from periodontal disease, respectively, and subjected to multiplex PCR using 12 primers synthesized according to the present invention. It is a picture analyzed through.

4A to 4K are obtained by hybridizing an amplification product obtained by targeting DNA obtained from oral cells of a patient suffering from periodontal disease to a DNA chip immobilized with 12 probes synthesized according to an embodiment of the present invention, respectively. DNA chip analysis picture.

<110> KIM, YEON SOO <120> Probe for Detecting Pathogen Causing Periodontal Disease and Assay Device Using Thereof <160> 27 <170> KopatentIn 1.71 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Porphyromonas gingivalis <400> 1 cgatcacaaa aatgggcgaa ttcagcagc 29 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing TTCGCCGCAACCATCATTACAAACTGGAC <400> 2 ttcgccgcaa ccatcattac aaactggac 29 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Eikenella corrodens <400> 3 cgtgttggag caagtagcca aaaccag 27 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Eikenella corrodens <400> 4 cagcaatatc cgcgatctgc tgcccgt 27 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Streptococcus mutans <400> 5 tcatgatgaa accatccgta ttctgcaact 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Streptococcus mutans <400> 6 caaacggatt catgatgaaa ccatccgtat 30 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Actinobacillus actinomycetem comitans <400> 7 ccaatctata ttgaagtagc tcaaattgcg c 31 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Actinobacillus actinomycetem comitans <400> 8 tctatattga agtagctcaa attgcgcaga g 31 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Prevotella intermedia <400> 9 ttctacttat atctatgatg gtgagactgg 30 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Prevotella intermedia <400> 10 tccaatgtgt tctacttata tctatgatgg tga 33 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Treponema denticola <400> 11 cggaagaagg aagcgtactt acactcaat 29 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Probe for hybridizing Treponema denticola <400> 12 cactattacg gaagaaggaa gcgtacttac 30 <210> 13 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Porphyromonas gingivalis <400> 13 tcaccatgac gggaatggct acggcgactc ttaatc 36 <210> 14 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Porphyromonas gingivalis <400> 14 tccaaattct ctactgtcca cggaaggacg gtggtc 36 <210> 15 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Eikenella corrodens <400> 15 ggcatgaaat acgttaccgc aggcatgaac ccgaccg 37 <210> 16 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Eikenella corrodens <400> 16 caaggcttcg ccttccacgt cttcagcaat aatc 34 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Streptococcus mutans <400> 17 gtgggtcaac cttggtctat caggatgtcc gc 32 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Streptococcus mutans <400> 18 gcaatcctgc atactgccat cttcacccaa gc 32 <210> 19 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Actinobacillus actinomycetem comitans <400> 19 gatacgactg ttgcacaacc gatacaaaat agtgc 35 <210> 20 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Actinobacillus actinomycetem comitans <400> 20 aaactacttc tccggtacga tatgcacaag gcgc 34 <210> 21 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Prevotella intermedia <400> 21 gatgggtgtg ccttctcgta tgaaccttgg tc 32 <210> 22 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Prevotella intermedia <400> 22 gtaagtaata cccaccgttg ctggctggtc gaagcg 36 <210> 23 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Treponema denticola <400> 23 tgtaacaccg acgggaggaa ctgcccatcc tg 32 <210> 24 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Probe for amplifying Treponema denticola <400> 24 tgtcctgttg atacgggtat gaggctgccg g 31 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Control Probe for hybridizing GAPDH <400> 25 aacctgccaa tatgataaca tcaagaagg 29 <210> 26 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Control Probe for amplifying GAPDH <400> 26 ggctaatgcc ctggcccaca agtatcacta agctc 35 <210> 27 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Control Probe for amplifying GAPDH <400> 27 caaggccctt cataatatcc cccagtttag tagttgg 37

Claims

A probe for confirming the presence of periodontal disease-causing bacteria, the probe consisting of at least one nucleotide selected from the group consisting of the base sequence of SEQ ID NO: 1 to SEQ ID NO: 24 or the base sequence complementary to each of these base sequences.

The method of claim 1,

The probe is characterized in that the hybridization (hybridization) with the genome of the periodontal disease causing bacteria.

The method according to claim 1 or 2,

The nucleotides consisting of the nucleotide sequences of SEQ ID NOs: 1, 2, 13, and 14 or nucleotides complementary to these nucleotide sequences are specifically hybridized with the genome of Porphyromonas gingivalis .

The nucleotides in the base sequence of SEQ ID NO: 3, 4, 15 and 16 or the base sequence complementary to these base sequence, respectively, hybridizes specifically to the genome of Eikenella corrodens ,

The nucleotides consisting of the nucleotide sequences of SEQ ID NOs: 5, 6, 17, and 18 or nucleotides complementary to these nucleotide sequences are specifically hybridized with the genome of Streptococcus mutans ,

The nucleotides consisting of the base sequences of SEQ ID NOs: 7, 8, 19, and 20 or nucleotides complementary to these base sequences are specifically hybridized with the genome of Actinobacillus actinomycetem comitans,

The nucleotides consisting of the nucleotide sequences of SEQ ID NOs: 9, 10, 21, and 22 or nucleotides complementary to these nucleotide sequences are specifically hybridized with the genome of Prevotella intermedia ,

The nucleotides consisting of the nucleotide sequences of SEQ ID NOs: 11, 12, 23, and 24 or nucleotides complementary to these nucleotide sequences, respectively, hybridize specifically to the genome of Treponema denticola . .

A DNA chip for periodontal disease causative agent analysis, comprising a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 12 described in claim 1 or a probe consisting of a nucleotide sequence complementary to these nucleotide sequences.

The method of claim 4, wherein

The DNA chip is an oligonucleotide DNA chip that is bonded to the glass through a covalent bond. The guanine base is added to the end of the probe, and the modified probe is fixed through hydrogen bonding with a derivative arranged on the glass. DNA chip for analysis of periodontal disease-causing bacteria, characterized in that there is.

The method of claim 5,

The probe is a DNA chip for periodontal disease-causing bacteria analysis, characterized in that fixed to the glass on a concentration of 50 ~ 150 ㎍ / ㎖.

The method of claim 4, wherein

The DNA chip for periodontal disease causative organism analysis further comprising a positive control for indicating the position of the probe in a region independent of the region in which the probe is fixed on the DNA chip.

DNA chip for analysis of periodontal disease causative organism according to any one of claims 4 to 7;

Label means for detecting a hybridization reaction between the probe and the sample DNA contained in the DNA chip

Periodontal disease causing bacteria analysis kit comprising a.

The method of claim 8,

The labeling means kit for analyzing periodontal disease causative bacteria, characterized in that the fluorescent material.

The method of claim 8,

The label means is a kit for analyzing periodontal disease causative bacteria selected from the group consisting of Cy3, Cy5, biotin binding compound, tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC) and x- rhodamine.

The method of claim 8,

Kit for analysis of periodontal disease causative bacteria further comprising an amplification means capable of amplifying the sample DNA.

The method of claim 11,

The amplification means is a kit for analyzing periodontal disease-causing bacteria comprising a primer which is an oligonucleotide consisting of the base sequence of SEQ ID NO: 13 to SEQ ID NO: 24 or a base sequence complementary to these base sequences.

Modifying the probe by binding a guanine base to the 5 'end of the probe consisting of the base sequences of SEQ ID NOs: 1-12 or base sequences complementary to these base sequences;

Method of manufacturing a periodontal disease causative organism diagnostic kit comprising the step of fixing the modified probe on a glass to prepare a DNA chip.

The method of claim 13,

The probe is a method of producing a periodontal disease causative organism diagnostic kit, characterized in that fixed to the glass on a concentration of 50 ~ 150 ㎍ / ㎖.

Polymerase chain reaction using a nucleotide selected from the group consisting of the nucleotide sequences of SEQ ID NO: 13 to SEQ ID NO: 24 or nucleotide sequences complementary to these nucleotide sequences, respectively, and using nucleic acid obtained from a biological sample as a target DNA. Method of amplifying nucleic acid of periodontal disease causing bacteria by performing Polymerase Chain Reaction (PCR).

The method of claim 15, wherein the primer

A first primer set consisting of the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14 or nucleotides each having a nucleotide sequence complementary to these nucleotide sequences;

A second primer set consisting of the nucleotide sequences of SEQ ID NO: 15 and SEQ ID NO: 16 or nucleotides each having a nucleotide sequence complementary to these nucleotide sequences;

A third primer set consisting of the nucleotide sequences of SEQ ID NO: 17 and SEQ ID NO: 18 or nucleotides each having a nucleotide sequence complementary to these nucleotide sequences;

A fourth primer set consisting of the nucleotide sequences of SEQ ID NO: 19 and SEQ ID NO: 20 or nucleotides each having a nucleotide sequence complementary to these nucleotide sequences;

A fifth primer set consisting of the nucleotide sequences of SEQ ID NO: 21 and SEQ ID NO: 22 or nucleotides each having a nucleotide sequence complementary to these nucleotide sequences;

A nucleic acid of a periodontal disease-causing bacterium comprising at least one set of primers comprising a nucleotide sequence of SEQ ID NO: 23 and SEQ ID NO: 24 or a sixth primer set consisting of nucleotides each having a nucleotide sequence complementary to these nucleotide sequences; How to amplify.

The method of claim 16,

The first to sixth primer sets are Porphyromonas gingivalis , Eikenella corrodens , Streptococcus mutans and Actinobacillus actinomy. A method for amplifying a nucleic acid of a periodontal disease causing bacterium, characterized by amplifying nucleic acids of Actinobacillus actinomycetemcomitans , Prevotella intermedia , Treponema denticola .

A primer according to any one of claims 15 to 17;

dNTP mixtures (dATP, dCTP, dGTP, dTTP);

Heat resistant polymerase; And

Kit for detecting periodontal disease-causing bacteria comprising a PCR buffer solution.