KR20100067277A - A method for transdifferentiating stem cells isolated from skin into osteocyte - Google Patents

Abstract

PURPOSE: A method for differentiating mammalian skin stem cells to osteocytes is provided to prevent complications of collected site and to use in operation of bone defect part. CONSTITUTION: A method for differentiating mammal skin-derived adult stem cells to osteoclytes comprises: a step of isolating adult stem cells from mammal skin; a step of culturing the stem cells; and a step of culturing stem cells in a DMEM(Dulbecco's Modified Eagle Medium) containing dexamethanole, sodium beta-glycerophosphate, and ascorbic acid to induce osteocytes differentiation. A method for removing hair from skin surface; a step of washing with DPBS(Dulbecco's Phosphate Buffered Saline) containing penicillin and streptomycin; and a step of separating dermal layer and epidermal layer.

Description

METHODS FOR TRANSDIFFERENTIATING STEM CELLS ISOLATED FROM SKIN INTO OSTEOCYTE

Tissue engineering aims to integrate the basic concepts and techniques of bioscience and engineering to understand the correlation between structure and function of living tissues, and to maintain, improve or restore the functions of our bodies by creating and transplanting substitutes of living tissues. This is an applied research.

Among tissue engineering, a series of techniques for forming a new parenchymal tissue by implanting a polymer carrier that is completely absorbed in a living body and has affinity with cells in living tissue is called biotissue engineering. Biotissue engineering is a multidisciplinary combination in the fields of cell culture, materials engineering and transplantation. Such biotissue engineering has been studied in various fields today and has been usefully used in the treatment of patients injured in specific parts of the human body.

Recently, histological treatment methods for collecting stem cells from patient's autologous cells and regenerating them into damaged tissues have been in the spotlight. It is useful because there is no transplant rejection reaction when culturing stem cells collected from patient's autologous cells and inducing differentiation into specific tissues and transplanting them into the defect tissue of patient.

The first successful organ transplant between humans was a kidney transplant between identical twins, who was attempted by Joseph Murray in 1954. After many developments, the transplantation of human organs has been extended to all human organs such as heart, liver, pancreas and lungs since the late 1970s with the development of new immunosuppressants and the development of anesthesia and surgical techniques.

The development of transplant surgery has played a very important role in promoting the health of human beings, but the number of organs donated is far shorter than the number of organs that are needed. Although there have been studies of the so-called xenograft, which has been used for a long time, problems such as rejection and infection have occurred and it has to be replaced frequently. there was.

In order to solve this problem, a biotissue engineering approach is being developed to develop biocompatible materials having excellent rejection reactions in the human body or to replace damaged organs from patients' own cells.

First, artificial biomaterials having excellent biocompatibility include natural materials that exist in the human body or can be obtained from nature, and artificial materials represented by various polymers. Natural materials include chitin and chitosan, and artificial materials include synthetic polymers such as polyurethane and silicone rubber. These materials have the advantage of varying physical and chemical surface properties or mechanical properties. This has the disadvantage that it can not be used permanently in the human body due to coagulation. Therefore, in order to compensate for this, many bioengineering methods for replacing damaged organs from patients' own cells have been studied.

The most ideal healing aspect of bone graft is the complete host ossification of the implant. However, the healing pattern of bone is known to be different according to the origin and processing of the implant. For this reason, there is interest in the use of adult stem cells that are capable of differentiating to specific tissues and organs after transplantation in vivo during tissue regeneration, and are capable of metastatic differentiation into cells of other tissues, unlike the original cellular characteristics. ought.

Stem cells (Stem cells) are a kind of blast cells that grow different cells or organs that make up the human body, also called hepatocytes. Stem cells include adult stem cells, such as embryonic stem cells that can be made from human embryos, and bone marrow cells that constantly make blood cells. Embryonic stem cells can differentiate into all the cells and tissues that make up the human body, but their use is limited for ethical reasons, while adult stem cells are derived from umbilical cord blood or bone marrow and blood of mature adults. It exists as a cell. Adult stem cells are cells that have differentiation flexibility that can differentiate into specific tissues and organs after transplantation in vivo, and can metastasize to cells of other tissues different from the characteristics of the original cells. It is widely used in.

Already in human and animal studies, bone marrow-derived stem cells from adult stem cells have been differentiated into osteogenic cells (Friedenstein AJ et al., Transplantation., 6: 230-247, 1968). Advances in the differentiation and proliferation of stem cells isolated from bone marrow into osteoblasts have increased the possibility of clinical application (Ohgushi H. et al., J Biomed Mater Res., 48: 913-927, 1999 ). Recently, a method for differentiating bone cells from mesenchymal stem cells has been actively studied.

However, autologous bone graft has to be collected from patients whose basic physical strength and immunity are deteriorated. Complications such as infection, pain, and hematoma at the bone collection site may occur. Even if we consider collecting bone from a donor who does not have one, there is a problem that the number of such bone marrow donors is limited. Therefore, there is an urgent need to develop a method for differentiating stem cells taken from other parts of the patient into bone cells.

The present invention is to solve the above problems, an object of the present invention is to provide an osteoin differentiation inducing agent and method for differentiating stem cells derived from mammalian stem cells into bone cells. Unlike the bone marrow, the skin reduces the invasive factor to the patient and is a site where stem cells can be collected, and is obtained from the whole body of the patient. Therefore, if the stem cells collected from the skin can be differentiated into bone cells, the problems caused by the method of differentiating stem cells collected from the bone marrow into bone cells can be solved.

In order to achieve the above object, the present invention comprises the steps of: i) separating adult stem cells from the skin of a mammal; ii) culturing the stem cells; And iii) inducing bone cell differentiation by culturing the stem cells in DMEM (Dulbecco's Modified Eagle Medium) containing dexamethasone, dexamethasone, sodium β-glycerophosphate, and ascorbic acid. It provides a method for differentiating adult stem cells derived from mammalian skin comprising bone cells comprising a step.

The step of separating the stem cells is to remove the hair on the skin surface; Washing with Dulbecco's Phosphate Buffered Saline (DPBS) including penicillin, streptomycin; And separating the dermal and epidermal layers. The penicillin (penicillin) is preferably used as much as 100U / ㎖, the streptomycin (streptomycin) is preferably used as much as 100㎍ / ㎖.

After separating the stem cells from the skin by the above method, it should be cultured. The ii) culturing the stem cells is fetal bovine serum (FBS), endothelial growth factor (EGF), basic fibroblast growth factor (bFGF), penicillin (penicillin), It is preferable to incubate in Dulbecco's Modified Eagle Medium (DMEM) -F12 containing streptomycin, amphotericin B. The step of culturing the stem cells is preferably cultured at 38.5 ℃, 5% CO ₂ supersaturated state, Fetal Bovine Serum (FBS) is 10%, the endothelial growth factor (EGF) Is 10 ng / ml, the basic fibroblast growth factor (bFGF) is 10 ng / ml, the penicillin is 100 U / ml, the streptomycin is 100 µg / ml, the amphoteric It is preferable to use the new ratio (Amphotericin B) as much as 0.25 µg / ml.

In addition, the step of culturing the stem cells ii) is preferably passaged on the second day of culture, wherein the passage is preferably trypsin-ethylenediaminetetraacetic acid (trypsin-EDTA). Trypsin-ethylenediaminetetraacetic acid (trypsin-EDTA) is preferably used 0.25%.

In addition, the step of inducing osteoblast differentiation, in the step of culturing the stem cells, it is preferable to use the stem cells in the confluence state of 70% of the third passaging step. The dexamethasone (dexamethasone) is a substance that has been reported to have a critical influence on the differentiation of osteoblasts through the existing papers, in contrast to using 10 ^-5 M in the differentiation of osteoblasts from mesenchymal stem cells in the present invention It is characterized by using dexamethasone (dexamethasone) of 10 ~ 100 nM. Stem cells extracted from the skin tended to differentiate into fat when the dexamethasone (dexamethasone) was used at a concentration of 10 to 100 nM or more, and when used at a concentration of 10 to 100 nM or less, it was effective as an inducer of osteoblast differentiation. Could not see. Therefore, in the osteoblast induction step of the present invention, it is preferable to use dexamethasone (dexamethasone) at a concentration of 10 to 100 nM. In addition, the beta-glycerophosphate (sodium β-glycerophosphate) is 10 mM, the ascorbic acid (ascorbic acid) is preferably used by 50 uM, the step of inducing the osteoblast differentiation is made for 3 weeks, It is preferable to perform culture fluid exchange twice a week.

When the osteoblast differentiation inducing agent and osteoblast differentiation method according to the present invention are used, the stem cells derived from the skin can be differentiated into osteocytes. This can solve the problem of secondary wound shape and postoperative pain. In addition, unlike the bone marrow, the skin can be used more usefully because it can be obtained from the entire body of the patient.

Hereinafter, with reference to the accompanying drawings, preferred embodiments of the present invention that can specifically realize the above object will be described.

1.Materials and Methods

(1) laboratory animals

Ear skin of 25 kg mature mini pig (PWG), weighing 6 months to 1 year, was used.

(2) chemicals, reagents and media

All chemicals and reagents were purchased from Sigma and all media were purchased from Invitrogen.

2.Isolation of Stem Cells from Skin

Mini pigs were sedated with 4 mg / Kg azaferon (Strapenil ^™ JANSSEN, BELGIUM) followed by anesthesia with 10 mg / Kg tiletamine-zolazapam (Zoletil ^™ Virbac, France). Ear skin was disinfected with betadine and 70% alcohol, followed by local anesthesia with 2% lidocaine HCL with 1: 100,000 epinephrine.

Collected at room temperature as shown in FIG. 1 (A; dissecting ears, B, C; separating the upper surface of the dermis, D; slicing about ² mm ² and incubating in a 0.1% gelatin coated cell culture dish) Remove the hair on the surface of the skin and wash it with Dulbecco`s Phosphate Buffered Saline (DPBS) containing 100 U / ml penicillin and 100 ug / ml streptomycin, then separate the dermal and epidermal layers containing hair follicles and sebaceous glands, 1-3 mm ² Cut to width and attached to 35 mm or 60 mm tissue culture plates (NUNC ^™ , Denmark). 10% Fetal Bovine Serum (FBS), 10 ng / ml endothelial growth factor (EGF), 10 ng / ml basic fibroblast growth factor (bFGF), 100 U / ml penicillin ( penicillin) and 1 ml or 2 ml Dulbecco's Modified Eagle Medium (DMEM) -F12 containing 100 ug / ml streptomycin and 0.25 ug / ml amphotericin B, 38.5 ^o C, 5% CO _{2 ,} supersaturated Cultured in the state. Tissue was removed on day 2 of culture. After that, the medium was replaced twice a week. For subculture, 0.25% trypsin-ethylenediaminetetraacetic acid (EDTA) was used.

3. Bone Cell Differentiation

Differentiation into osteoblasts was performed using the third passage of stem-derived stem cells, and in the state of 70% confluence, osteoblast differentiation culture medium 10-100 nM dexamethasone, 10 mM sodium β-glycerophosphate and 50 uM 2 ml Dulbecco's Modified Eagle Medium (DMEM) with ascorbic acid was used. The medium was exchanged twice a week, and after 3 weeks the differentiated cells were confirmed by histochemical staining and RT-PCR.

4. Histochemical staining

Mineralized substrates were stained with Von Kossa staining to confirm bone formation. Tissues differentiated into osteocytes were washed with Phosphate Buffered Saline (PBS) and fixed for 30 minutes with 4% neutral buffered formaldehyde. After removing the fixed solution and washing with distilled water, it was placed in a bright place for 5 hours in a silver nitrate solution (silver nitrate solution). Observed after washing with distilled water.

5. RNA  Extraction Reverse transcription  Polymerase chain reaction Reverse transcriptase polymerase  chain reaction ; RT - PCR ) analysis

Total RNA was extracted using Rneasy Mini Kit (Qiagen, Valencia, CA, USA), and cDNA synthesis was synthesized at 55 ° C for 30 minutes using Omniscript Reverse Transcription Kit (Qiagen) and oligo-dT primer. PCR amplification was performed using Maxime PCR Premix (iNtRON Biotechnology, Korea). Primers used were osteocalcin (205 bp) F, CTGGACCAACATCTTGAGCA and R, ACCCCTTTGGTGGTGTTGTA Osteonectin (189 bp) F; TCCGGATCTTTCCTTTGCTTTCTA R; CCTTCACATCGTGGCAAGAGTTTG. GAPDH (230 bp) was used as the house keeping gene by F, 5'-GGGCATGAACCATGAGAAGT-3 'and R, 5'-AAGCAGGGATGATGTTCTGG-3'. PCR was performed for 35 to 40 cycles and the conditions were denatured at 95 ° C for 3 minutes, annealed at 60 ° C for 30 seconds, and stretched for 45 seconds at 72 ° C. elongation) and final extension at 72 ° C for 10 minutes. PCR products were loaded and separated using 1% agarose gel and 1 ug / ml ethidium bromide and measured under ultraviolet light.

6. Results

(1) histochemical staining results

As shown in Figure 2, it was confirmed that the stem cell portion separated from the ear A) is proliferating like an island, and B) the appearance of cells appearing when the cells separated from A can be continuously passaged, C) After 2 weeks of differentiation, the Von Kossa staining revealed that the mineral substrate was dyed black. (Background is contrasted with H & E.)

(2) RT-PCR analysis result

As shown in FIG. 3, it was confirmed that osteoblast differentiation genes Osteocalcin and Osteonectin were expressed when RT-PCR was performed by extracting total RNA after 2 weeks of differentiation into osteoblasts.

Figure 1 shows the process of separating stem cells from ear tissue.

Figure 2 shows the results of histochemical staining for the presence of bone formation.

Figure 3 shows the results of performing RT-PCR to confirm the bone formation.

Claims (10)

Iii) separating adult stem cells from the skin of a mammal; Ii) culturing the stem cells; And Iii) inducing bone cell differentiation by culturing the stem cells in DMEM (Dulbecco's Modified Eagle Medium) containing dexamethasone, dexamethasone, sodium β-glycerophosphate, and ascorbic acid ; Method for differentiating adult stem cells derived from mammalian skin into osteoblasts. The method of claim 1, wherein the separating the stem cells comprises removing hairs from the surface of the skin; Washing with Dulbecco's Phosphate Buffered Saline (DPBS) including penicillin, streptomycin; A method for differentiating adult stem cells derived from mammalian skin into osteocytes, comprising separating the dermal and epidermal layers. The method of claim 1, wherein the step of culturing the stem cells Fetal Bovine Serum (FBS), endothelial growth factor (EGF), basic fibroblast growth factor (bFGF), penicillin adult stem cells derived from mammalian skin, characterized in that they are cultured in Dulbecco's Modified Eagle Medium (DMEM) -F12 containing penicillin, streptomycin and amphotericin B How to let. The method of claim 1, wherein the culturing the stem cells is performed at 38.5 ° C. and 5% CO ₂ supersaturated, and differentiates adult stem cells derived from mammalian skin into bone cells. [Claim 2] The method of claim 1, wherein the culturing of stem cells is carried out on the second day of culture to differentiate adult stem cells from mammalian skin into osteoblasts. [Claim 6] The method of claim 5, wherein the passage is performed using trypsin-ethylenediaminetetraacetic acid (EDTA). The method of claim 1, wherein inducing osteoblast differentiation is performed in the step of culturing the stem cells, adult dermal derived from mammalian skin, characterized in that using the stem cells in a confluence state of 70% of the third passage step How to differentiate stem cells into bone cells. The method of claim 1, wherein the dexamethasone (dexamethasone) is used to differentiate adult stem cells derived from mammalian skin into bone cells, characterized in that used by 10 ~ 100 nM. The method of claim 1, wherein the sodium beta-glycerophosphate (sodium β-glycerophosphate) is used to differentiate adult stem cells derived from mammalian skin into bone cells, characterized in that by using 10 mM. According to claim 1, The ascorbic acid (ascorbic acid) is a method for differentiating adult stem cells derived from mammalian skin into bone cells, characterized in that the use of 50 uM.

Images