KR20100066142A - Composition for preventing or treating picornavirus and coronavirus induced diseases containing 3,5-diaryl-4,5-dihydro pyrazol derivatives or pharmaceutically acceptable salts thereof as an active ingredient - Google Patents
Composition for preventing or treating picornavirus and coronavirus induced diseases containing 3,5-diaryl-4,5-dihydro pyrazol derivatives or pharmaceutically acceptable salts thereof as an active ingredient Download PDFInfo
- Publication number
- KR20100066142A KR20100066142A KR1020080124812A KR20080124812A KR20100066142A KR 20100066142 A KR20100066142 A KR 20100066142A KR 1020080124812 A KR1020080124812 A KR 1020080124812A KR 20080124812 A KR20080124812 A KR 20080124812A KR 20100066142 A KR20100066142 A KR 20100066142A
- Authority
- KR
- South Korea
- Prior art keywords
- group
- picornavirus
- coronavirus
- hydroxy
- bromo
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/415—1,2-Diazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/415—1,2-Diazoles
- A61K31/4155—1,2-Diazoles non condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/4164—1,3-Diazoles
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
본 발명은 피코르나바이러스 및/또는 코로나바이러스에 의해 유발되는 질환의 예방 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for the prevention or treatment of diseases caused by picornavirus and / or coronavirus.
본 명세서에서 사용된 몇몇 약자(abbreviation)에 대한 정의는 다음과 같다. The definitions for some abbreviations used herein are as follows.
PV, 피코르나바이러스(Picornaviruses); RV, 리노바이러스(rhinovirus); CV, 콕사키바이러스(coxsackievirus); EV, 엔테로바이러스(enterovirus); CoV. 코로나바이러스; 3CL, 3C-유사(3C-like); Dabcyl, 4-(4-디메틸아미노페닐아조)벤조산(4-(4-dimethylaminophenylazo)benzoic acid); Edans, 6-[(2-아미노에틸)아미노]나프탈렌-1 설폰산(5-[(2-aminoethyl)amino]naphthalene-1 sulfonic acid); FRET, 형광 공명에너지전이(fluorescence resonance energy transfer).PV, Picornaviruses; RV, rhinovirus; CV, coxsackievirus; EV, enteroviruses; CoV. Coronaviruses; 3CL, 3C-like; Dabcyl, 4- (4-dimethylaminophenylazo) benzoic acid (4- (4-dimethylaminophenylazo) benzoic acid); Edans, 6-[(2-aminoethyl) amino] naphthalene-1 sulfonic acid (5-[(2-aminoethyl) amino] naphthalene-1 sulfonic acid); FRET, fluorescence resonance energy transfer.
RNA 바이러스인 피코르나바이러스(picornavirus)는 감기, 구제역, 아폴로 눈병, 무균성 수막염, 심근염, A형 간염 등 호흡기질환, 소화기질환, 순환기질환, 피부질환 등의 다양한 질병을 유발하는 바이러스이다. 그러나, 현재까지 이를 치료하기 위해 개발된 치료제는 없는 실정이다. 개발 중인 약물들의 대부분은 탈외피(uncoating) 저해제이다. 피코르나바이러스는 7.2 - 8.5 Kb의 양성 단일가닥(positive single stranded) RNA 바이러스로서, 약 22 - 30 nm의 매우 작은 구형바이러스로서 외피가 없으며, 가장 오래전에 알려진 바이러스이다. 피코르나바이러스과에 속하는 바이러스들은 보건·사회·경제적 문제를 야기하는 상술한 호흡기질환 등의 다양한 질병을 유발한다. 피코르나바이러스들은 수돗물바이러스의 주축을 이루며, 매우 안정하여 소독이 용이하지 않으므로 끊임없이 관련 바이러스 질병을 유발한다. Picornavirus, an RNA virus, is a virus that causes various diseases such as colds, foot and mouth disease, Apollo eye disease, aseptic meningitis, myocarditis, hepatitis A, respiratory diseases, digestive diseases, circulatory diseases, and skin diseases. However, there is no therapeutic agent developed to treat it to date. Most of the drugs under development are uncoating inhibitors. Picornavirus is a positive single stranded RNA virus of 7.2-8.5 Kb, a very small spherical virus of about 22-30 nm, which is unenveloped and the oldest known virus. Viruses belonging to the Picornavirus family cause a variety of diseases, such as the above-mentioned respiratory diseases, which cause health, social and economic problems. Picornaviruses form the backbone of tap water viruses and are very stable and not easy to disinfect, causing persistent viral diseases.
피코르나 바이러스과는 가장 작은 동물 RNA 바이러스로 알려져 있으며, 이는 7개의 속, 즉 리노바이러스속, 엔테로바이러스속, 아프토바이러스속, 카르티오바이러스속, 헤파토바이러스속 및 이중 에코바이러스속이 있다. 그 외 분류되지 않은 약간의 피코르나 바이러스가 있다. 피코르나 바이러스는 호흡기질병, 수족구질병, 뇌막염/뇌염, 급성척수회백질염, 심장혈관질병, 출혈성결막염, 간염 등 여러 가지 질병을 일으킨다.The Picornavirus family is the smallest known animal RNA virus, and there are seven genera, namely the genus Reinovirus, Enterovirus, Aptovirus, Carthiovirus, Hepatovirus and Dual Ecovirus. There are some other unclassified picor and viruses. Picorna virus causes various diseases such as respiratory disease, hand and foot disease, meningitis / encephalitis, acute myelitis, cardiovascular disease, hemorrhagic conjunctivitis and hepatitis.
현재, 다양한 피코르나바이러스들 중 폴리바이러스(poliovirus, 소아마비 유발)에 대한 예방백신이 사용되고 있고, 치료용 A형 간염 백신만이 개발되어있을 뿐 공인된 화학 치료제는 아직 보고된 바 없어 이의 개발이 시급하다. 피코르나바이러스는 대부분 급성질환을 일으키기 때문에, 부작용 등의 문제가 상대적으로 적은 단기 복용제 또는 국소치료제로 개발하는 것이 바람직하다.Currently, a variety of picornaviruses are used to prevent vaccines against polyviruses (polioviruses), and only therapeutic hepatitis A vaccines have been developed. It's urgent. Since most picornaviruses cause acute diseases, it is desirable to develop them as short-term or topical treatments with relatively few side effects.
한편, 코로나 바이러스는 코감기 등 호흡기 질환을 일으키는 바이러스로, 1937년 닭에서 처음 발견된 뒤 개·돼지·조류 등의 동물을 거쳐 1965년에는 사람에게서도 발견된 바 있다. 코로나 바이러스는 사람에게는 거의 감염되지 않고 주로 개·돼지·소 등의 가축에 감염되는 병원균으로 인식되어 왔다. 사람에게 감염되는 경우에도 호흡기 증상을 유발하는 여러 바이러스 가운데 하나로 단순한 감기를 유발하거나, 어린이의 설사 등 장질환을 일으키는 경우가 있기는 하지만 위험성이 높지 않았다. 그러던 중, 2003년 3월 중순 처음으로 발생하여 세계적으로 100명이 넘는 사망자와 3,000여 명의 환자를 발생시킨 중증 급성 호흡기 증후군의 원인균이 신종(변종) 코로나 바이러스인 것으로 알려지면서 주목받기 시작하였다.On the other hand, the corona virus is a virus that causes respiratory diseases such as nasal cold. It was first discovered in chickens in 1937, and then in humans in 1965 through animals such as dogs, pigs, and birds. Corona virus has been recognized as a pathogen that is hardly infected by humans but mainly by livestock such as dogs, pigs and cattle. Even when infected with humans, one of several viruses that cause respiratory symptoms may cause a simple cold or a bowel disease such as diarrhea in children. In the middle of March 2003, the first strain of severe acute respiratory syndrome, which first occurred in the world, causing more than 100 deaths and 3,000 patients, became known as the new (variant) coronavirus.
중증 급성 호흡기 증후군(Severe Acute Respiratory Syndrome, SARS)은 인간을 감염시키는 신규 코로나바이러스에 의해 유발되어 출현한 신규 감염성 질병이 다(T. G. Ksiazek, et al., N. Eng. J. Med. 348(2003), 1953-1966; C. Drosten, et al., N. Eng. J. Med. 348(2003), 1967-1976; R. A. Fouchier, et al., Nature 423(2003), 240). 중증 급성 호흡기 증후군은 지금까지 보고된 사례의 약 4-10%가 치명적인 것으로 분류되었다. 2003년 2월 중순에 비전형성 폐렴(atypical pneumonia)으로 중국의 구앙동 지방에서 처음으로 발견되었다. 2003년 4월 중순까지 중증 급성 호흡기 증후군 증상을 나타내는 것으로 진단된 환자 263명의 죽음과 함께, 4400 사례 이상이 캐나다, 중국, 홍콩, 인도네시아, 필리핀, 싱가폴, 태국, 베트남, 미국 등으로부터 보고되었다. 짧은 시간 동안에 여러 나라에서 상기 질환의 급속한 전파로 인해, 세계보건기구는 전세계에 경계 경보를 발령하였고 여행자 및 항공기에 긴급 공보를 발령하였다. 감염 후 수 개월만에 처음 인지된 중증 급성 호흡기 증후군은 세계 건강 및 세계 경제를 위협하였다.Severe Acute Respiratory Syndrome (SARS) is a new infectious disease caused by a new coronavirus that infects humans (TG Ksiazek, et al., N. Eng. J. Med. 348 (2003). ), 1953-1966; C. Drosten, et al., N. Eng. J. Med. 348 (2003), 1967-1976; RA Fouchier, et al., Nature 423 (2003), 240). Severe acute respiratory syndrome was classified as fatal in about 4-10% of cases reported so far. In mid-February 2003, atypical pneumonia was first discovered in Guangdong, China. With the death of 263 patients diagnosed with severe acute respiratory syndrome symptoms by mid-April 2003, more than 4400 cases have been reported from Canada, China, Hong Kong, Indonesia, Philippines, Singapore, Thailand, Vietnam, and the United States. Due to the rapid spread of the disease in many countries in a short time, the WHO issued alerts around the world and issued emergency bulletins to travelers and aircraft. Severe acute respiratory syndrome, first perceived months after infection, threatened global health and the global economy.
현재 이에 대하여 효과가 있는 치료법이 알려져 있지 않으며, 백신을 사용할 수도 없다. 따라서, 감염된 개체에서 중증 급성 호흡기 증후군을 조절 또는 예방할 수 있고, 전파를 막을 수 있는 항바이러스 제제들의 개발이 시급하다. 그럼에도 불구하고, 현재까지 피코르나바이러스와 코로나 바이러스를 모두 또는 동시에 저해시킬 수 있는 약물에 대한 개발은 별다른 진전을 보이지 않고 있는 실정이다. There is no known cure for this and no vaccine is available. Therefore, there is an urgent need to develop antiviral agents that can control or prevent severe acute respiratory syndromes in infected individuals and prevent their transmission. Nevertheless, the development of drugs capable of inhibiting both or at the same time picornavirus and coronavirus has not made much progress.
이에, 본 발명자들은 피코르나바이러스 및 코로나바이러스를 동시에 저해시킬 수 있는 약물을 개발하던 중, 3,5-디아릴-4,5-디히드로 피라졸 유도체가 이들 바이러스를 강력하게 저해할 수 있음을 확인하고, 상기 바이러스들로부터 유발되는 감기, 구제역, 아폴로눈병, 무균성 수막염, 심근염, A형 간염, 중증 급성 호흡기 증후군(SARS) 등의 질환을 예방 또는 치료하는데 유용하게 사용할 수 있음을 알아내고 본 발명을 완성하였다.Accordingly, the present inventors are developing drugs capable of simultaneously inhibiting picornavirus and coronavirus, and 3,5-diaryl-4,5-dihydropyrazole derivatives can strongly inhibit these viruses. Find out that it can be useful for preventing or treating diseases such as colds, foot and mouth disease, apollo eye disease, aseptic meningitis, myocarditis, hepatitis A, severe acute respiratory syndrome (SARS), etc. The present invention has been completed.
본 발명의 목적은 피코르나바이러스 및 코로나바이러스에 의해 유발되는 질환의 예방 또는 치료용 조성물을 제공하는데 있다.An object of the present invention to provide a composition for the prevention or treatment of diseases caused by picornavirus and coronavirus.
상기 목적을 달성하기 위해, 본 발명은 하기 화학식 1로 표시되는 3,5-디아릴-4,5-디히드로 피라졸 유도체 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 피코르나바이러스 및 코로나바이러스에 의해 유발되는 질환의 예방 또는 치료용 조성물을 제공한다:In order to achieve the above object, the present invention is picornavirus containing a 3,5-diaryl-4,5-dihydropyrazole derivative represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient And compositions for the prevention or treatment of diseases caused by coronaviruses:
[화학식 1][Formula 1]
(상기 식에서, X, Y 및 Z는 명세서에서 정의한 바와 같다).Wherein X, Y and Z are as defined in the specification.
본 발명에 따른 화학식 1의 3,5-디아릴-4,5-디히드로 피라졸 유도체는 피코르나바이러스의 활성과 코로나바이러스의 활성을 동시에 강력하게 저해할 수 있는 화합물로서, 단일 적용으로 상기 바이러스들에 의해 유발되는 감기, 구제역, 아폴로눈병, 무균성 수막염, 심근염, A형 간염, 중증 급성 호흡기 증후군(SARS) 등의 질환을 예방 또는 치료하는데 유용하게 사용할 수 있다.The 3,5-diaryl-4,5-dihydropyrazole derivatives of the general formula (1) according to the present invention are compounds which can strongly inhibit the activity of picornavirus and the activity of coronavirus at the same time. It can be usefully used to prevent or treat diseases such as colds, foot and mouth disease, apollo eye disease, aseptic meningitis, myocarditis, hepatitis A and severe acute respiratory syndrome (SARS) caused by viruses.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 하기 화학식 1로 표시되는 3,5-디아릴-4,5-디히드로 피라졸 유도체 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 피코르나바이러 스 및 코로나바이러스에 의해 유발되는 질환의 예방 또는 치료용 조성물을 제공한다:The present invention is induced by picornaviruses and coronaviruses containing 3,5-diaryl-4,5-dihydropyrazole derivatives represented by the following general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient: Provided are compositions for the prophylaxis or treatment of the disease being:
상기 식에서,Where
X는 독립적으로 또는 선택적으로, 수소, 할로겐, 히드록시, C1-C4의 직쇄 또는 측쇄 알킬, C1-C4의 직쇄 또는 측쇄 알콕시, 시아노, 아미노 및 니트로로 이루어지는 군으로부터 선택되는 어느 하나이고, X is independently or optionally selected from the group consisting of hydrogen, halogen, hydroxy, C 1 -C 4 straight or branched chain alkyl, C 1 -C 4 straight or branched chain alkoxy, cyano, amino and nitro One,
Y는 수소; C1-C4의 직쇄 또는 측쇄 알킬; 비치환 또는 할로겐, 히드록시, C1-C4의 직쇄 또는 측쇄 알킬로 이루어지는 군으로부터 선택되는 1 이상의 치환기로 치환된 C5-C7의 아릴; 및 비치환 또는 할로겐, 히드록시 및 C1-C4의 직쇄 또는 측쇄 알킬로 이루어지는 군으로부터 선택되는 1 이상의 치환기로 치환되되, 질소, 산소 및 황으로 이루어지는 군으로부터 독립적으로 또는 선택적으로 선택되는 1 이상의 헤테로 원자를 포함하는 5원자 또는 6원자의 헤테로사이클로아릴로 이루어지는 군으 로부터 선택되는 어느 하나이고, Y is hydrogen; C 1 -C 4 straight or branched alkyl; C 5 -C 7 aryl unsubstituted or substituted with one or more substituents selected from the group consisting of halogen, hydroxy, C 1 -C 4 straight or branched alkyl; And unsubstituted or substituted with one or more substituents selected from the group consisting of halogen, hydroxy and C 1 -C 4 linear or branched alkyl, one or more independently or optionally selected from the group consisting of nitrogen, oxygen and sulfur Any one selected from the group consisting of 5- or 6-membered heterocycloaryl including a hetero atom,
Z는 수소 또는 할로겐이고,Z is hydrogen or halogen,
A는 수소; 할로겐; 비치환 또는 할로겐, 히드록시, C1-C4의 직쇄 또는 측쇄 알킬로 이루어지는 군으로부터 선택되는 1 이상의 치환기로 치환된 C5-C7의 아릴; 및 비치환 또는 할로겐, 히드록시, C1-C4의 직쇄 또는 측쇄 알킬로 이루어지는 군으로부터 선택되는 1 이상의 치환기로 치환되되, 질소, 산소 및 황으로 이루어지는 군으로부터 독립적으로 또는 선택적으로 선택되는 1 이상의 헤테로원자를 포함하는 9원자 또는 10원자의 헤테로사이클로아릴아미노 C1-C4의 알킬로 이루어지는 군으로부터 선택되는 어느 하나이다A is hydrogen; halogen; C 5 -C 7 aryl unsubstituted or substituted with one or more substituents selected from the group consisting of halogen, hydroxy, C 1 -C 4 straight or branched alkyl; And unsubstituted or substituted with one or more substituents selected from the group consisting of halogen, hydroxy, C 1 -C 4 straight or branched alkyl, one or more independently or selectively selected from the group consisting of nitrogen, oxygen and sulfur Is selected from the group consisting of 9 or 10-membered heterocycloarylamino C 1 -C 4 alkyl including heteroatoms
바람직하게는, Preferably,
상기 X는 독립적으로 또는 선택적으로, 수소, 플루오로, 클로로, 브로모, 히드록시, 메틸, 에틸, 프로필, 이소프로필, 부틸, 메톡시, 에톡시, 시아노, 아미노 및 니트로로 이루어지는 군으로부터 선택되는 어느 하나이고, X is independently or optionally selected from the group consisting of hydrogen, fluoro, chloro, bromo, hydroxy, methyl, ethyl, propyl, isopropyl, butyl, methoxy, ethoxy, cyano, amino and nitro Which one is
Y는 수소; 메틸, 에틸, 프로필, 이소프로필, 부틸; 비치환 또는 플루오로, 클로로, 브로모, 히드록시, 메틸, 에틸, 프로필, 이소프로필, 부틸로 이루어지는 군으로부터 선택되는 1 이상의 치환기로 치환되는 페닐; 및 비치환 또는 플루오로, 클로로, 브로모, 히드록시, 메틸, 에틸, 프로필, 이소프로필, 부틸로 이루어지는 군으로부터 선택되는 1 이상의 치환기로 치환되되, 질소, 산소 및 황으로 이루어지 는 군으로부터 독립적으로 또는 선택적으로 선택되는 1 이상의 헤테로원자를 포함하는 5원자 또는 6원자의 헤테로사이클로아릴로 이루어지는 군으로부터 선택되는 어느 하나이고,Y is hydrogen; Methyl, ethyl, propyl, isopropyl, butyl; Phenyl unsubstituted or substituted with one or more substituents selected from the group consisting of fluoro, chloro, bromo, hydroxy, methyl, ethyl, propyl, isopropyl, butyl; And unsubstituted or substituted with one or more substituents selected from the group consisting of fluoro, chloro, bromo, hydroxy, methyl, ethyl, propyl, isopropyl, butyl, independent of the group consisting of nitrogen, oxygen and sulfur Any one selected from the group consisting of 5 or 6-membered heterocycloaryl including one or more selected heteroatoms, or
Z는 수소, 플루오로, 클로로 또는 브로모이고,Z is hydrogen, fluoro, chloro or bromo,
A는 수소; 플루오로, 클로로, 브로모; 비치환 또는 플루오로, 클로로, 브로모, 히드록시, 메틸, 에틸, 프로필, 이소프로필, 부틸로 이루어지는 군으로부터 선택되는 1 이상의 치환기로 치환된 페닐; 및 비치환 또는 플루오로, 클로로, 브로모, 히드록시, 메틸, 에틸, 프로필, 이소프로필, 부틸로 이루어지는 군으로부터 선택되는 1 이상의 치환기로 치환되되, 질소, 산소 및 황으로 이루어지는 군으로부터 독립적으로 또는 선택적으로 선택되는 1 이상의 헤테로원자를 포함하는 9원자 또는 10원자의 헤테로사이클로아릴아미노 C1-C4의 알킬로 이루어지는 군으로부터 선택되는 어느 하나이다.A is hydrogen; Fluoro, chloro, bromo; Phenyl unsubstituted or substituted with one or more substituents selected from the group consisting of fluoro, chloro, bromo, hydroxy, methyl, ethyl, propyl, isopropyl, butyl; And unsubstituted or substituted with one or more substituents selected from the group consisting of fluoro, chloro, bromo, hydroxy, methyl, ethyl, propyl, isopropyl, butyl, independently from the group consisting of nitrogen, oxygen and sulfur or It is any one selected from the group consisting of 9 or 10 membered heterocycloarylamino C 1 -C 4 alkyl including one or more heteroatoms optionally selected.
더욱 바람직하게는, More preferably,
상기 C5-C7의 아릴은 페닐이고; The aryl of C 5 -C 7 is phenyl;
상기 5원자 또는 6원자의 헤테로사이클로알킬은 피라졸릴, 이미다졸릴, 피롤릴, 퓨릴, 싸이에닐, 피리미디닐 및 피리딜로 이루어지는 군으로부터 선택되는 어느 하나이고; The 5- or 6-membered heterocycloalkyl is any one selected from the group consisting of pyrazolyl, imidazolyl, pyrrolyl, furyl, thienyl, pyrimidinyl and pyridyl;
상기 9원자 또는 10원자의 헤테로사이클로아릴아미노 C1-C4의 알킬에서, 9원 자 또는 10원자의 헤테로사이클로아릴은 벤즈이미다졸릴 또는 인돌릴이다.In the 9- or 10-membered heterocycloarylamino C 1 -C 4 alkyl, the 9- or 10-membered heterocycloaryl is benzimidazolyl or indolyl.
본 발명에 따른 상기 화학식 1로 표시되는 3,5-디아릴-4,5-디히드로 피라졸 유도체의 구체적인 예는 다음과 같다:Specific examples of 3,5-diaryl-4,5-dihydropyrazole derivatives represented by Formula 1 according to the present invention are as follows:
1) 3-(4-브로모-페닐)-5-(4-클로로-페닐)-1-(3,4-디클로로-페닐)-4-이미다졸-1-일-4,5-디히드로-1H-피라졸;1) 3- (4-Bromo-phenyl) -5- (4-chloro-phenyl) -1- (3,4-dichloro-phenyl) -4-imidazol-1-yl-4,5-dihydro -1H-pyrazole;
2) [4-(3,5-디페닐-4,5-디히드로-피라졸-1-일)-벤질]-(1-프로필-1H-벤조이미다졸-2-일)-아민;2) [4- (3,5-diphenyl-4,5-dihydro-pyrazol-1-yl) -benzyl]-(1-propyl-1H-benzoimidazol-2-yl) -amine;
3) [4-(3,5-디페닐-4,5-디히드로-피라졸-1-일)-벤질]-(1-에틸-1H-벤조이미다졸-2-일)-아민; 및3) [4- (3,5-Diphenyl-4,5-dihydro-pyrazol-1-yl) -benzyl]-(1-ethyl-1H-benzoimidazol-2-yl) -amine; And
4) (1-부틸-1H-벤조이미다졸-2-일)-[4-(3,5-디페닐-4,5-디히드로-피라졸-1-일)-벤질]-아민.4) (1-Butyl-1H-benzoimidazol-2-yl)-[4- (3,5-diphenyl-4,5-dihydro-pyrazol-1-yl) -benzyl] -amine.
또한, 본 발명에 따른 조성물은 유효성분으로서 상기 화학식 1로 표시되는 3,5-디아릴-4,5-디히드로 피라졸 유도체 또는 이의 약학적으로 허용되는 염뿐만 아니라, 이의 이성질체 또는 이로부터 제조될 수 있는 가능한 용매화물 또는 수화물을 모두 포함한다.In addition, the composition according to the present invention as an active ingredient 3,5-diaryl-4,5-dihydropyrazole derivative represented by the formula (1) or a pharmaceutically acceptable salt thereof, as well as isomers or preparations thereof It includes all possible solvates or hydrates that may be employed.
본 발명의 화학식 1의 3,5-디아릴-4,5-디히드로 피라졸 유도체는 약학적으로 허용가능한 염의 형태로 사용할 수 있으며, 염으로는 약학적으로 허용 가능한 유리 산(free acid)에 의해 형성된 산 부가염이 유용하다. 산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산으로부터 얻는다. 이러한 약학적으로 무독한 염류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함한다.The 3,5-diaryl-4,5-dihydropyrazole derivatives of the general formula (1) of the present invention may be used in the form of a pharmaceutically acceptable salt, and the salt may be added to the pharmaceutically acceptable free acid. Acid addition salts formed by these are useful. Acid addition salts include those derived from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, and aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxyalkanoates, Dioleate, aromatic acid, aliphatic and aromatic sulfonic acids. Such pharmaceutically nontoxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, and iodide. Id, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suverate , Sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitro benzoate, hydroxybenzoate, meth Oxybenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate, chlorobenzenesul Nate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, glycolate, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1- Sulfonates, naphthalene-2-sulfonates or mandelate.
본 발명에 따른 상기 산 부가염은 통상의 방법, 예를 들면, 화학식 1의 유도체를 과량의 산 수용액 중에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들면 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다. 또한 이 혼합물에서 용매나 과량의 산을 증발시킨 후 건조시키거나 또는 석출된 염을 흡입 여과시켜 제조할 수도 있다.The acid addition salts according to the invention can be dissolved in conventional methods, for example, by dissolving a derivative of
또한, 염기를 사용하여 약학적으로 허용 가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속 염은 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고, 여액을 증발, 건조시켜 얻는다. 이때, 금속 염으로는 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하다. 또한, 이에 대응하는 은 염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 음염(예, 질산은)과 반응시켜 얻는다.In addition, bases can be used to make pharmaceutically acceptable metal salts. Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is pharmaceutically suitable to prepare sodium, potassium or calcium salt as the metal salt. Corresponding silver salts are also obtained by reacting alkali or alkaline earth metal salts with a suitable negative salt (eg, silver nitrate).
본 발명에 따른 상기 조성물은 피코르나바이러스에 의해 유발되는 질환을 예방 또는 치료하는데 유용하게 사용될 수 있으며, 이들 질환의 바람직한 예로는 감기 등의 호흡기질환, 구제역, 아폴로 눈병, 무균성 수막염 등의 피부질환 또는 소화기 질환, 심근염 등의 순환기질환, A형 간염 등의 간질환 등을 포함한다.The composition according to the present invention can be usefully used to prevent or treat diseases caused by picornavirus, and preferred examples of these diseases include respiratory diseases such as cold, foot and mouth disease, Apollo eye disease, aseptic meningitis, and the like. Diseases or digestive diseases, circulatory diseases such as myocarditis, liver diseases such as hepatitis A, and the like.
또한, 본 발명에 따른 상기 조성물은 코로나바이러스에 의해 유발되는 질환을 예방 또는 치료하는데 유용하게 사용될 수 있으며, 이들 질환의 바람직한 예로는 감기, 중증 급성 호흡기 증후군(SARS) 등을 포함한다.In addition, the composition according to the present invention can be usefully used for preventing or treating diseases caused by coronaviruses, and preferred examples of these diseases include cold, severe acute respiratory syndrome (SARS), and the like.
따라서, 본 발명은 상기 화학식 1로 표시되는 3,5-디아릴-4,5-디히드로 피라졸 유도체 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 피코르나바이러스 및 코로나바이러스에 의해 유발되는 질환을 동시에 예방 또는 치료할 수 있는 조성물을 제공한다.Accordingly, the present invention is directed to picornaviruses and coronaviruses containing 3,5-diaryl-4,5-dihydropyrazole derivatives represented by
본 발명에 따른 상기 화학식 1의 3,5-디아릴-4,5-디히드로 피라졸 유도체는 피코르나바이러스 및 코로나바이러스를 동시에 저해할 수 있다. The 3,5-diaryl-4,5-dihydropyrazole derivatives of
본 발명에 따른 상기 화학식 1의 유도체에 해당하는 상기 화합물 1) 내지 4)의 피코르나바이러스 또는 코로나바이러스 저해활성을 측정한 실시예 1을 참조하면, 화합물 1) 내지 4)는 모두 코로나바이러스의 SARS 3CL 및 229E 3CL 단백질 분해효소와 피코르나바이러스의 CVB3 3C, EV71 3C 및 RV14 3C 단백질 분해효소를 동시에 10 μM 이하의 낮은 농도에서 효과적으로 저해함을 알 수 있다. 특히, 이들 화합물 중 화합물 1)의 저해활성이 우수하였다. 또한, 화합물 1)에 대한 저해상수를 측정한 실시예 2를 참조하면, 화합물 1)에 대한 저해상수 Ki는 0.85±0.15 mM (SARS-CoV 3CLpro, 도 1), 0.56±0.08 mM (HCoV-229E 3CLpro, 도 2), 0.82±0.13 mM (CVB3 3Cpro, 도 3), 0.3±0.05 mM (EV71 3Cpro, 도 4) 및 0.67±0.14 mM (RV14 3Cpro, 도 5)로 계산되었으며, 모든 Lineweaver-Burk 그래프는 종축에서 교차하며, 화합물의 농도(저해제의 농도)가 증가할수록 기울기가 증가하는 경향을 나타내었다. 이로 부터, 본 발명의 화합물과 각각의 단백질 분해효소는 기질에 대하여 전형적인 경쟁적 저해반응을 수행함을 알 수 있다. Referring to Example 1 in which the picornavirus or coronavirus inhibitory activity of the compounds 1) to 4) corresponding to the derivative of
따라서, 본 발명의 화합물들은 피코르나바이러스 및 코로나바이러스의 활성을 동시에 저해함으로써, 이들 바이러스로부터 유발되는 질환, 예를 들면 감기, 구제역, 아폴로눈병, 무균성 수막염, 심근염, A형 간염, 중증 급성 호흡기 증후군 등을 예방 또는 치료하는데 유용하게 사용될 수 있다. 바람직하게는 이들 중 감기 또는 중증 급성 호흡기 증후군을 치료하는데 유용하게 사용될 수 있다.Thus, the compounds of the present invention simultaneously inhibit the activity of picornaviruses and coronaviruses, such that diseases caused by these viruses, such as colds, foot and mouth disease, Apollo's eye disease, aseptic meningitis, myocarditis, hepatitis A, severe acute It can be usefully used for preventing or treating respiratory syndrome. Preferably they can be usefully used to treat cold or severe acute respiratory syndrome.
본 발명의 상기 화학식 1의 유도체 또는 약학적으로 허용되는 이의 염을 유효성분으로 함유하는 피코르나바이러스 및 코로나바이러스에 의해 유발되는 질환의 예방 또는 치료용 조성물은 하기의 다양한 경구 또는 비경구 투여 형태로 제형화할 수 있으나, 이에 한정되는 것은 아니다. The composition for the prevention or treatment of diseases caused by picornavirus and coronavirus containing the derivative of
경구 투여용 제형으로는 예를 들면 정제, 환제, 경/연질 캅셀제, 액제, 현탁제, 유화제, 시럽제, 과립제, 엘릭시르제(elixirs) 등이 있는데, 이들 제형은 상기 유효성분 이외에 통상적으로 사용되는 충진제, 증량제, 습윤제, 붕해제, 활택제, 결합제, 계면활성제 등의 희석제 또는 부형제를 1종 이상 사용할 수 있다. 붕해제로는 한천, 전분, 알긴산 또는 이의 나트륨염, 무수인산일수소 칼슘염 등이 사용될 수 있고, 활택제로는 실리카, 탈크, 스테아르산 또는 이의 마그네슘염 또는 칼슘염, 폴리에틸렌 글리콜 등이 사용될 수 있으며, 결합제로는 마그네슘 알루미늄 실 리케이트, 전분 페이스트, 젤라틴, 트라가칸스, 메틸셀룰로오스, 나트륨 카복시메틸셀룰로오스, 폴리비닐피롤리딘, 저치환도 하이드록시프로필셀룰로오스 등이 사용될 수 있다. 이외에도 락토즈, 덱스트로오스, 수크로오스, 만니톨, 소르비톨, 셀룰로오스, 글리신 등을 희석제로 사용할 수 있으며, 경우에 따라서는 일반적으로 알려진 비등 혼합물, 흡수제, 착색제, 향미제, 감미제 등을 함께 사용할 수 있다.Formulations for oral administration include, for example, tablets, pills, hard / soft capsules, solutions, suspensions, emulsifiers, syrups, granules, elixirs, and the like. One or more diluents or excipients, such as extenders, wetting agents, disintegrating agents, lubricants, binders, and surfactants may be used. As a disintegrant, agar, starch, alginic acid or its sodium salt, calcium monohydrogen phosphate anhydride, etc. may be used, and as lubricant, silica, talc, stearic acid or its magnesium salt or calcium salt, polyethylene glycol, etc. may be used. As the binder, magnesium aluminum silicate, starch paste, gelatin, tragacanth, methyl cellulose, sodium carboxymethyl cellulose, polyvinylpyrrolidine, low-substituted hydroxypropyl cellulose, and the like may be used. In addition, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, and the like may be used as diluents, and in some cases, commonly known boiling mixtures, absorbents, colorants, flavoring agents, sweeteners, and the like may be used together.
또한, 상기 화학식 1의 유도체 또는 약학적으로 허용되는 이의 염을 유효성분으로 함유하는 피코르나바이러스 및 코로나바이러스에 의해 유발되는 질환의 예방 또는 치료용 조성물은 비경구 투여할 수 있으며, 비경구 투여는 피하주사제, 정맥주사제, 근육 내 주사제 또는 흉부 내 주사제를 주입하는 방법에 의한다. 이때, 비경구 투여용 제형으로 제제화하기 위하여 상기 화학식 1의 유도체 또는 약학적으로 허용되는 이의 염을 안정제 또는 완충제와 함께 물에서 혼합하여 용액 또는 현탁액으로 제조하고, 이를 앰플 또는 바이알의 단위 투여형으로 제조할 수 있다.In addition, the composition for the prevention or treatment of diseases caused by picornavirus and coronavirus containing the derivative of
상기 조성물은 멸균되거나 또는 방부제, 안정화제, 수화제 또는 유화 촉진제, 삼투압 조절을 위한 염, 완충제 등의 보조제, 및 기타 치료적으로 유용한 물질을 함유할 수 있으며, 통상적인 방법인 혼합, 과립화 또는 코팅 방법에 따라 제제화할 수 있다.The composition may be sterile or contain preservatives, stabilizers, hydrating or emulsifiers, salts for controlling osmotic pressure, adjuvants such as buffers, and other therapeutically useful substances, and conventional methods of mixing, granulating or coating. It can be formulated according to the method.
필요한 경우, 본 발명에 따른 상기 화학식 1의 유도체 또는 약학적으로 허용되는 이의 염을 유효성분으로 함유하는 피코르나바이러스 및 코로나바이러스에 의해 유발되는 질환의 예방 또는 치료용 조성물은 기타의 약제, 예를 들면, 다른 당뇨 치료제와 조합하여 투여할 수도 있다. If necessary, the composition for the prevention or treatment of diseases caused by picornavirus and coronavirus containing a derivative of
본 발명의 상기 화학식 1의 유도체 또는 약학적으로 허용되는 이의 염을 유효성분으로 함유하는 피코르나바이러스 및 코로나바이러스에 의해 유발되는 질환의 예방 또는 치료용 조성물을 단위 용량 형태로 제형화하는 경우, 유효성분으로서 화학식 1의 유도체 또는 이의 약학적으로 허용가능한 염을 약 0.1 ~ 1,500 mg의 단위 용량으로 함유되는 것이 바람직하다. 투여량은 환자의 체중, 나이 및 질병의 특수한 성질과 심각성과 같은 요인에 따라 의사의 처방에 따른다. 그러나, 성인 치료에 필요한 투여량은 투여의 빈도와 강도에 따라 하루에 약 1 ~ 500 mg 범위가 보통이다. 성인에게 근육 내 또는 정맥 내 투여 시 일 회 투여량으로 분리하여 하루에 보통 약 5 ~ 300 mg의 전체 투여량이면 충분할 것이나, 일부 환자의 경우 더 높은 일일 투여량이 바람직할 수 있다.When formulating a composition for the prevention or treatment of diseases caused by picornavirus and coronavirus containing the derivative of
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기의 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기의 실시예에 의해 제한되는 것은 아니다. Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited by the following examples.
<참고예><Reference Example>
본 발명에 따른 화학식 1의 3,5-디아릴-4,5-디히드로 피라졸 유도체는 하기와 같은 과정에 의해 동정(screening)되었다.3,5-Diaryl-4,5-dihydropyrazole derivatives of the general formula (1) according to the present invention were screened by the following procedure.
1. 시약 및 기구: 1. Reagents and Apparatus :
형광 단백질 기질(fluorogenic peptide substrate)로서 Dabcyl-KTSAVLQSGFRK-Edans를 바이오제네시스사(대만)로부터 입수한 것을 사용하였다. 플라스미드 미니프렙(mini-prep) 키트, DNA 겔추출키트 및 닌타수지(NiNTA resin)는 Qiagen사로부터 구입한 것을 사용하였다. FXa 및 단백질 발현 키트(pET32Xa/LIC 벡터와 콤포넌트 JM109 및 BL21 세포 포함)는 노바젠(Novagen)으로부터 구입한 것을 사용하였다. 모든 버퍼 및 시약은 최고등급을 사용하였다.Dabcyl-KTSAVLQSGFRK-Edans obtained from BioGenesis (Taiwan) was used as a fluorogenic peptide substrate. Plasmid mini-prep kit, DNA gel extraction kit and NINTA resin were used from Qiagen. FXa and protein expression kits (including pET32Xa / LIC vectors and components JM109 and BL21 cells) were purchased from Novagen. All buffers and reagents used the highest grades.
2. 화합물 라이브러리: 2. Compound Library :
대략 6800여개의 화합물을 한국화합물은행으로부터 제공받았으며, 이들 화합물들은 모두 저분자 유기물질이다.Approximately 6,800 compounds were provided by the Korea Compound Bank, all of which are low molecular organic materials.
3. 단백질 분해효소의 발현 및 정제: 3. Expression and Purification of Proteases :
인간 코로나바이러스 유래 3CLpro(SARS-CoV 및 HCoV-22 포함)와 피코르나바이러스 유래 3Cpro(CVB3, EV71, 및 RV 포함)을 저해제 분석을 위해 사용하였다. SARS-CoV 3CLpro 및 EV71 3Cpro는 문헌에 보고된 대로 준비하였다. CV, RV 및 229E 단백질 분해효소의 발현을 위해, 창-궁(Chang-Gung) 메모리얼 병원(대만, 타오-위안(Tao-Yuan))으로부터 얻은 바이러스성 cDNAs로부터 PCR법으로 유전자를 클로닝하였다. 정방향 프라이머(forward primer) 5'-CATGCCATGGGCCCTGCCTTTGAGTT-3'와 역방향 프라이머(backward primer) 5'- GCGCTCGAGTCAATGATGATGATGATGATGTTGCTCATCATTGAAGTAGTG-3'), 및 정방향 프라이머 5'-CATGCCATGGGACCAAACACAGAATTT-3'와 역방향 프라이머 5'-GCGCTCGAGTCAATGATGATGATGATGATGTTGTTTCTCTACAAAATATTG-3'가 CV 및 RV 단백질 분해효소에 C-말단 헥사-His와 더불어 각각 사용되었다. 이들 프라이머들은 Nco I와 Xho I 제한부분(밑줄친 부분)을 포함하도록 설계되었다. PCR 생성물은 Nco I와 Xho I와 함께 소화(digestion)되었으며, DNA 단편(fragments)은 pET16b(노바젠사)로 클로닝되었다. Human coronavirus derived 3CL pro (including SARS-CoV and HCoV-22) and picornavirus derived 3C pro (including CVB3, EV71, and RV) were used for inhibitor analysis. SARS-CoV 3CL pro and EV71 3C pro were prepared as reported in the literature. For expression of CV, RV and 229E proteases, genes were cloned by PCR from viral cDNAs obtained from Chang-Gung Memorial Hospital (Tao-Yuan, Taiwan). Forward primer 5'-CATG CCATGG GCCCTGCCTTTGAGTT-3 'and backward primer 5'-GCG CTCGAG TCAATGATGATGATGATGATGTTGCTCATCATTGAAGTAGTG-3'), and forward primer 5'-CATG CCATGGG ACCAAACACAGAATTT-3 'and reverse primer 5' -GCG CTCGAG TCAATGATGATGATGATGATGTTGTTTCTCTACAAAATATTG-3 'was used in addition to C-terminal hexa-His for CV and RV proteases, respectively. These primers were designed to include Nco I and Xho I restriction portions (underlined). PCR products were digested with Nco I and Xho I, and DNA fragments cloned into pET16b (Novazen).
229E 단백질 분해효소의 발현을 위하여, 정방향 프라이머 5'-GGTATTGAGGGTCGCGCTGGTTTGCGCAAAATGGCA-3'와 역방향 프라이머 5'-AGAGGAGAGTTAGAGCCTTATTGCAGGTTAACACCAAACAT-3'가 사용되었다. PCR 생성물은 pET32Xa/Lic 벡터로 연결(ligation)되었다. 각 단백질 분해효소 유전자를 포함하는 플라스미드는 E. coli JM109 세포로 변환되어 사용되었고, 이렇게 변환된 세포는 100 μg/mL 엠피실린(ampicillin)을 포함하는 Luria-Bertani(LB) 아가 플레이트(agar plate)로 스트리킹(streaking)되었다.For the expression of 229E protease, forward primer 5'-GGTATTGAGGGTCGCGCTGGTTTGCGCAAAATGGCA-3 'and reverse primer 5'-AGAGGAGAGTTAGAGCCTTATTGCAGGTTAACACCAAACAT-3' were used. PCR products were ligation with the pET32Xa / Lic vector. Plasmids containing the respective protease genes were converted to E. coli JM109 cells, and the converted cells were Luria-Bertani (LB) agar plates containing 100 μg / mL ampicillin. Streaking.
엠피실린 저항성 콜론(Ampicillin-resistant colonies)은 Luria-Bertani (LB) 아가 플레이트로부터 선택되었고, 100 μg/mL 에피실린을 포함하는 5 mL LB 배지에서 12시간 동안 37 ℃에서 배양되었다. Ampicillin-resistant colonies were selected from Luria-Bertani (LB) agar plates and incubated at 37 ° C. for 12 hours in 5 mL LB medium containing 100 μg / mL epicillin.
유전자서열 결정으로 올바른 구조임을 확인 다음에 단백질 발현을 위해 E.coli Origami B(DE3)(노바젠사)내로 형질전환시켰다. 철야 배양한 5 ml의 단일콜 론을 25 μg/ml 카나마이신과 50 ug/ml의 암피실린을 포함하는 신선한 LB배지 500 ml에 처리하여 사용하였다. 세포들은 A600=0.6까지 성장시켰고 1 mM 이소프로필-β-티오갈락토피라노사이드로 유발시켰다. 4-5시간 후 상기 세포들을 7000 g에서 15분 동안 원심분리하여 모았다. Gene sequence determination confirmed correct structure, and then transformed into E. coli Origami B (DE3) (Novazen) for protein expression. 5 ml of monocolon overnight culture was used in 500 ml fresh LB medium containing 25 μg / ml kanamycin and 50 ug / ml ampicillin. Cells were grown to A600 = 0.6 and induced with 1 mM isopropyl-β-thiogalactopyranoside. After 4-5 hours the cells were collected by centrifugation at 7000 g for 15 minutes.
단백질 정제과정은 본 연구자들의 보고 문헌[Kuo C.J., Shie J.J, Fang J.M, Yen G.R, Hsu J.T, Liu H.G, Tseng S.N, Chang S.C, Lee C.Y, Shih S.R, Liang P.H., Bioorg. Med. Chem. 16, 7388-7398, 2008; Kuo, C.J., Chi, Y.H., Hsu, T.A., Liang, P.H., Biophys. Biochem. Res. Commun. 318, 862-867, 2004]의 방법을 따랐다. 정제된 단백질을 N-말단 서열화 및 질량분석으로 확인하였다. 모든 실험에서 사용된 단백질 농도는 280 nm에서의 흡광도로 결정하였다.Protein purification procedures are reported in our report: Kuo CJ, Shie JJ, Fang JM, Yen GR, Hsu JT, Liu HG, Tseng SN, Chang SC, Lee CY, Shih SR, Liang PH, Bioorg. Med. Chem. 16, 7388-7398, 2008 ; Kuo, CJ, Chi, YH, Hsu, TA, Liang, PH, Biophys. Biochem. Res. Commun. 318, 862-867, 2004 ]. Purified protein was confirmed by N-terminal sequencing and mass spectrometry. The protein concentration used in all experiments was determined by absorbance at 280 nm.
4. 1차 스크리닝(primary screening): 4. Primary screening
초고속 스크리닝에 사용된 형광 단백질 기질(Dabcyl-KTSAVLQSGFRKME-Edans)과 SARS-CoV 3CLpro는 문헌의 기재대로 준비하였다[21]. 단백질분해효소는 사용전에 -70 ℃에서 12 mM Tris-HCl(pH 7.5), 120 mM NaCl, 0.1 mM EDTA, 7.5 mM b-ME, and 1 mM DTT를 포함하는 버퍼에 저장하여 사용하였다. 분석하는 동안 단백질 분해효소 스톡(stock)을 최종 농도가 50 nM이 되도록 상기 버퍼로 희석하여 96-웰 플레이트(96-well plate)에 넣었다. 1차 스크리닝을 위해, DMSO(5 mM 스톡용액) 내의 화 합물들을 상기 웰에 첨가하고(1웰 당 1 화합물), 최종 농도가 50 μM이 되도록 희석하였다. 10분 동안 효소로 배양한 후, 상기 형광 기질(웰에서의 최종 농도 6 μM)을 반응을 개시하기 위해 첨가하였다. 단백질 분해효소에 의해 분해된 형광을 띠는 펩타이드 기질의 형광도를 형광플레이트 판독기(ThermoLabsytems사, 핀란드)로 355 nm(여기)/538 nm(방사) 조건으로 판독하였다. 50 μM에서 효소활성의 50% 이상이 저해되는 화합물 1) 내지 4)를 선택하고, 이들 화합물에 대하여 10 μM에서의 IC50 값을 하기 실시예 1에서와 같이 측정였다.Fluorescent protein substrates (Dabcyl-KTSAVLQSGFRKME-Edans) and SARS-CoV 3CL pro used for ultrafast screening were prepared as described in the literature [21]. Protease was stored and stored in a buffer containing 12 mM Tris-HCl (pH 7.5), 120 mM NaCl, 0.1 mM EDTA, 7.5 mM b-ME, and 1 mM DTT at −70 ° C. prior to use. During the analysis the protease stock was diluted with the buffer to a final concentration of 50 nM and placed in a 96-well plate. For primary screening, compounds in DMSO (5 mM stock solution) were added to the wells (1 compound per well) and diluted to a final concentration of 50 μΜ. After incubation with enzyme for 10 minutes, the fluorescent substrate (final concentration 6 μM in wells) was added to initiate the reaction. The fluorescence of the fluorescent peptide substrate digested by the protease was read under a 355 nm (excitation) / 538 nm (radiation) condition with a fluorescence plate reader (ThermoLabsytems, Finland). Compounds 1) to 4) where 50% or more of enzymatic activity was inhibited at 50 μM were selected and IC 50 values at 10 μM for these compounds were measured as in Example 1 below.
<실시예 1> 피코르나바이러스 및 코로나바이러스 저해활성(IC50) 측정Example 1 Measurement of Picornavirus and Coronavirus Inhibitory Activity (IC 50 )
1-1. SARS 단백질 분해효소의 저해를 위한 IC 50 결정: 1-1. IC 50 Determination for Inhibition of SARS Protease :
1차 스크리닝에 의해 선발된 화합물 1) 내지 4)에 대하여, 코로나바이러스 저해 활성을 알아보기 위해, 10 μM에서 유효 IC50 값을 0.05 μM SARS 단백질 분해효소와, 0-50 μM 범위의 다양한 저해 화합물 농도하에 pH 7.06의 20 mM Bis-Tris 내의 6 μM 형광기질을 포함하는 반응 혼합물에서 측정하였다. 반응 결과로 인한 형광 변화를 96-웰 형광 플레이트 판독기를 이용하여 시간에 따라 추적하였다. 저해반응의 초기 속도를 하기 식에 따라 IC50을 얻기 위해 상이한 저해농도에 대하여 구성하였다. For compounds 1) to 4) selected by primary screening, to determine coronavirus inhibitory activity, the effective IC 50 value at 10 μM was 0.05 μM SARS protease and various inhibitor compounds ranging from 0-50 μM. The concentration was measured in a reaction mixture containing 6 μΜ fluorescent substrate in 20 mM Bis-Tris at pH 7.06. Fluorescence changes due to reaction results were tracked over time using a 96-well fluorescent plate reader. Initial rates of inhibition reactions were constructed for different inhibitory concentrations to obtain IC 50 according to the following equation.
A(I) = A(0) × {1-[ I/(I + IC50)]} (1)A (I) = A (0) × {1- [I / (I + IC 50 )]} (1)
상기 식에서, A(I)는 저해제 농도 I의 효소활성이고; A(0)는 저해제가 없는 효소활성이고; I는 저해제 농도이다.Wherein A (I) is the enzymatic activity of inhibitor concentration I; A (0) is enzymatic activity without inhibitor; I is the inhibitor concentration.
1-2. 다른 단백질 분해효소에 대한 IC 50 결정: 1-2. IC 50 Determination for Other Proteases :
SARS-CoV 3CLpro를 저해하는 상기 화합물 1) 내지 4)을 이용하여, 추가적으로 코로나바이러스 저해활성을 알아보기 위해 HCoV-229E 3CLpro에 대하여, 피코르나바이러스 저해활성을 알아보기 위해, EV71 3Cpro, CVB3 3Cpro 및 RV14 3Cpro에 대하여 IC50을 측정하였다. 분석 용액에서, pH 6.5 및 6.0 (각각, EV71 및 RV14 단백질 분해효소에 대한 최적 pH)의 10 mM MES와 pH 7.5(HCoV-229E 및 CVB3 단백질 분해효소에 대한 최적 pH)의 10 mM Hepes 버퍼내의 10 μM 형광기질로 단백질 분해효소(0.5 μM)의 활성을 0-50 μM 범위의 다양한 저해 화합물 농도에서 측정하였다. 상기 실시예 1-1 및 1-2의 결과를 하기 표 1에 나타내었다.Using compounds 1) to 4) that inhibit SARS-CoV 3CL pro , to find picornavirus inhibitory activity against HCoV-229E 3CL pro for further coronavirus inhibitory activity, EV71 3C pro IC 50 was measured for CVB3 3C pro and RV14 3C pro . In the assay solution, 10 mM MES at pH 6.5 and 6.0 (optimum pH for EV71 and RV14 protease, respectively) and 10 in 10 mM Hepes buffer at pH 7.5 (optimum pH for HCoV-229E and CVB3 protease). The activity of proteolytic enzymes (0.5 μM) with μM fluorescent substrates was measured at various inhibitor compound concentrations in the range of 0-50 μM. The results of Examples 1-1 and 1-2 are shown in Table 1 below.
표 1을 참조하면, 화합물 1) 내지 4)는 코로나바이러스의 SARS 3CL 및 229E 3CL 단백질 분해효소와 피코르나바이러스의 CVB3 3C, EV71 3C 및 RV14 3C 단백질 분해효소를 동시에 우수하게 저해하는 것을 알 수 있다. 특히, 화합물 1)은 2.5 μM 이하의 아주 낮은 농도에서도 효과적으로 상기 단백질 분해효소의 활성을 저해함을 알 수 있다.Referring to Table 1, it can be seen that Compounds 1) to 4) simultaneously inhibited SARS 3CL and 229E 3CL protease of coronavirus and CVB3 3C, EV71 3C and RV14 3C protease of picornavirus at the same time. have. In particular, it can be seen that Compound 1) effectively inhibits the protease activity even at very low concentrations of 2.5 μM or less.
<실시예 2> 피코르나바이러스 및 코로나바이러스 저해상수(Ki) 측정Example 2 Fikornavirus and Coronavirus Inhibition Constant (K i ) Measurement
0.05 mM SARS 3CL 단백질 분해효소 또는 0.5 mM의 229E 3CL, CVB3 3C, EV71 3C 및 RV14 3C 단백질 분해효소를 포함하는 반응혼합물에서 5-40 μM 범위의 기질 농도와 저해화합물 농도에서 저해상수 Ki를 결정하기 위해 형광분석을 이용하였다. 하기 식 2를 이용하여 경쟁적 저해에 대한 Ki값을 얻기 위해, 비선형회귀(nonlinear recession)에 의해 KinetAsyst II(IntelliKinetics, PA주립대학) 컴퓨터 프로그램으로 속도론적 데이터의 Lineweaver-Burk 그래프를 얻었다.Inhibition constant K i was determined at substrate and inhibitor concentrations ranging from 5-40 μM in reaction mixtures containing 0.05 mM SARS 3CL protease or 0.5 mM 229E 3CL, CVB3 3C, EV71 3C and RV14 3C protease. Fluorescence was used for this purpose. To obtain the K i value for competitive
1/V = Km/Vm(1 + [I]/Ki)1/[S] + 1/Vm (2)1 / V = K m / V m (1 + [I] / K i ) 1 / [S] + 1 / V m (2)
상기 식에서 Km은 기질의 마이클리스(Michaelis) 상수이고, Ki는 저해상수이고, Vm은 최대속도이고, [I] 및 [S]는 반응혼합물 내에서의 저해제 및 기질의 농도를 나타낸다. Where K m is the Michaelis constant of the substrate, K i is the inhibition constant, V m is the maximum velocity, and [I] and [S] represent the concentrations of inhibitor and substrate in the reaction mixture.
실시예 1에서 가장 저해활성이 우수한 것으로 밝혀진 화합물 1)에 대하여 상기 식 (2)에 따른 Lineweaver-Burk 그래프를 도 1 내지 도 5에 나타내었다. For the compound 1), which was found to have the highest inhibitory activity in Example 1, a Lineweaver-Burk graph according to Equation (2) is shown in FIGS. 1 to 5.
도 1 내지 5를 참조하면, 화합물 1)에 대한 저해상수 Ki는 0.85±0.15 mM (SARS-CoV 3CLpro, 도 1), 0.56±0.08 mM (HCoV-229E 3CLpro, 도 2), 0.82±0.13 mM (CVB3 3Cpro, 도 3), 0.3±0.05 mM (EV71 3Cpro, 도 4) 및 0.67±0.14 mM (RV14 3Cpro, 도 5)로 측정되었으며, 모든 Lineweaver-Burk 그래프는 종축에서 교차하며, 화합물의 농도(저해제의 농도)가 증가할수록 기울기가 증가하는 경향을 나타내었다. 이로부터, 본 발명의 화합물과 각각의 단백질 분해효소는 기질에 대하여 전형적인 경쟁적 저해반응을 수행함을 알 수 있다. 따라서, 본 발명의 화합물들은 피코르나바이러스 및 코로나바이러스의 활성을 현저하게 저해함을 알 수 있다. 1 to 5, the inhibition constant K i for Compound 1) was 0.85 ± 0.15 mM (SARS-CoV 3CL pro , FIG. 1), 0.56 ± 0.08 mM (HCoV-229E 3CL pro , FIG. 2), 0.82 ± Measured at 0.13 mM (CVB3 3C pro , FIG. 3), 0.3 ± 0.05 mM (EV71 3C pro , FIG. 4) and 0.67 ± 0.14 mM (RV14 3C pro , FIG. 5), with all Lineweaver-Burk graphs intersecting at the longitudinal axis. As the concentration of the compound (inhibitor concentration) increased, the slope tended to increase. From this, it can be seen that the compound of the present invention and each protease perform a typical competitive inhibition reaction on the substrate. Thus, it can be seen that the compounds of the present invention significantly inhibit the activity of picornavirus and coronavirus.
하기에 본 발명에 따른 화학식 1의 유도체 또는 이의 약학적으로 허용가능한 염을 활성성분으로 함유하는 피코르나바이러스 및 코로나바이러스에 의해 유발되는 질환의 예방 또는 치료용 조성물 위한 제제예를 예시한다.Examples of preparations for compositions for the prevention or treatment of diseases caused by picornaviruses and coronaviruses containing the derivative of
<제제예 1> 정제의 제조(직접 가압)Preparation Example 1 Preparation of Tablet (Direct Pressing)
활성성분 5.0 ㎎Active ingredient 5.0 mg
락토오스 14.1 ㎎Lactose 14.1 mg
크로스포비돈 USNF 0.8 ㎎Crospovidone USNF 0.8 mg
마그네슘 스테아레이트 0.1 ㎎Magnesium Stearate 0.1mg
통상적인 정제의 제조 방법에 따라, 상기 성분들을 제시된 함량으로 첨가하여 균일하게 혼합하고 가압하여 정제를 제조하였다.According to a conventional method for preparing tablets, the tablets were prepared by adding the above ingredients in the contents indicated, mixing them uniformly and pressing.
<제제예 2> 정제의 제조(습식 조립)Preparation Example 2 Preparation of Tablet (Wet Granulation)
활성성분 5.0 ㎎Active ingredient 5.0 mg
락토오스 16.0 ㎎Lactose 16.0 mg
녹말 4.0 mgStarch 4.0 mg
프리솔베이트 80 0.3 mgPresorbate 80 0.3 mg
실리콘 다이옥사이드 2.7 ㎎Silicon dioxide 2.7 mg
마그네슘 스테아레이트 2.0 ㎎Magnesium Stearate 2.0mg
활성성분을 체로 친 후, 락토오스와 녹말을 혼합하였다. 이후, 폴리솔베이트를 순수한 물에 녹인 녹인 후, 적당량을 활성성분, 락토오스 및 녹말 혼합물에 첨가한 다음 미립화하였다. 건조 후에 미립을 제질한 후, 콜로이달 실리콘 다이옥사이드 및 마그네슘 스타아레이트와 혼합하였다. 미립을 가압하여 정제를 제조하였다.After sifting the active ingredient, lactose and starch were mixed. Thereafter, the polysorbate was dissolved in pure water, and then an appropriate amount was added to the active ingredient, lactose and starch mixture, followed by atomization. After drying, the granules were granulated and then mixed with colloidal silicon dioxide and magnesium stearate. Tablets were prepared by pressing the granules.
<제제예 3> 캅셀제의 제조Preparation Example 3 Preparation of Capsule
활성성분 5.0 ㎎Active ingredient 5.0 mg
락토오스 14.8 ㎎Lactose 14.8 mg
폴리비닐피롤리돈 10.0 ㎎Polyvinylpyrrolidone 10.0 mg
마그네슘 스테아레이트 0.2 ㎎Magnesium Stearate 0.2mg
통상적인 캅셀제의 제조 방법에 따라, 상기 성분들을 제시된 함량으로 첨가하여 균일하게 혼합한 후 적절한 크기의 젤라틴 캅셀에 충진하여 목적하는 캅셀제를 제조하였다.According to a conventional method for preparing a capsule, the desired components were prepared by adding the above components in the amounts shown in the present invention, mixing them uniformly, and filling the gelatine capsules with an appropriate size.
<제제예 4> 주사제의 제조Preparation Example 4 Preparation of Injection
활성성분 100 ㎎Active ingredient 100 mg
만니톨 180 mgMannitol 180 mg
Na2HPO4·2H2O 26 mgNa 2 HPO 4 2H 2 O 26 mg
증류수 2974 mgDistilled water 2974 mg
통상적인 주사제의 제조 방법에 따라, 상기 성분들을 제시된 함량으로 함유시켜 주사제를 제조하였다.According to a conventional method of preparing an injection, an injection was prepared by containing the above components in the contents shown.
도 1은 본 발명의 실시예 2에 따른 화학식 1의 유도체의 일종인 화합물 1)의 SARS 3CL 단백질 분해효소에 대한 Lineweaver-Burk 그래프이고;1 is a Lineweaver-Burk graph of SARS 3CL protease of Compound 1), which is a kind of derivative of
도 2는 본 발명의 실시예 2에 따른 화학식 1의 유도체의 일종인 화합물 1)의 229E 3CL 단백질 분해효소에 대한 Lineweaver-Burk 그래프이고;2 is a Lineweaver-Burk graph of 229E 3CL protease of Compound 1), which is a kind of derivative of
도 3은 본 발명의 실시예 2에 따른 화학식 1의 유도체의 일종인 화합물 1)의 CVB3 3C 단백질 분해효소에 대한 Lineweaver-Burk 그래프이고;3 is a Lineweaver-Burk graph of CVB3 3C protease of Compound 1), which is a kind of derivative of
도 4는 본 발명의 실시예 2에 따른 화학식 1의 유도체의 일종인 화합물 1)의 EV71 3C 단백질 분해효소에 대한 Lineweaver-Burk 그래프이고;4 is a Lineweaver-Burk graph of EV71 3C protease of Compound 1), which is a kind of derivative of
도 5는 본 발명의 실시예 2에 따른 화학식 1의 유도체의 일종인 화합물 1)의 RV14 3C 단백질 분해효소에 대한 Lineweaver-Burk 그래프이다.5 is a Lineweaver-Burk graph of RV14 3C protease of Compound 1), which is a kind of derivative of
도면의 부호에 대한 간단한 설명Brief description of the symbols in the drawings
◆ : 화합물 1)(저해제)의 부존재◆: absence of compound 1) (inhibitor)
▲ : 화합물 1)의 농도 5 μM▲: concentration of compound 1) 5 μM
■ : 화합물 1)의 농도 2.5 μM■: Concentration of Compound 1) 2.5 μM
● : 화합물 1)의 농도 1 μM●: Concentration of compound 1) 1 μM
□ : 화합물 1)의 농도 0.5 μM□: Concentration of compound 1) 0.5 μM
△ : 화합물 1)의 농도 0.25 μM△: concentration of compound 1) 0.25 μM
Claims (6)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020080124812A KR101054464B1 (en) | 2008-12-09 | 2008-12-09 | Composition for the prophylaxis or treatment of diseases caused by picornaviruses and coronaviruses containing 3,5-diaryl-4,5-dihydropyrazole derivatives or pharmaceutically acceptable salts thereof as an active ingredient |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020080124812A KR101054464B1 (en) | 2008-12-09 | 2008-12-09 | Composition for the prophylaxis or treatment of diseases caused by picornaviruses and coronaviruses containing 3,5-diaryl-4,5-dihydropyrazole derivatives or pharmaceutically acceptable salts thereof as an active ingredient |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20100066142A true KR20100066142A (en) | 2010-06-17 |
KR101054464B1 KR101054464B1 (en) | 2011-08-05 |
Family
ID=42365273
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020080124812A KR101054464B1 (en) | 2008-12-09 | 2008-12-09 | Composition for the prophylaxis or treatment of diseases caused by picornaviruses and coronaviruses containing 3,5-diaryl-4,5-dihydropyrazole derivatives or pharmaceutically acceptable salts thereof as an active ingredient |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101054464B1 (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111848516A (en) * | 2020-08-04 | 2020-10-30 | 山东大学 | Bromophenol-pyrazoline compound and synthetic method and application thereof |
WO2020242264A1 (en) * | 2019-05-31 | 2020-12-03 | Samjin Pharmaceutical Co., Ltd. | A composition for treating eye diseases |
US11034669B2 (en) | 2018-11-30 | 2021-06-15 | Nuvation Bio Inc. | Pyrrole and pyrazole compounds and methods of use thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060019967A1 (en) | 2004-07-21 | 2006-01-26 | Su-Ying Wu | SARS CoV main protease inhibitors |
-
2008
- 2008-12-09 KR KR1020080124812A patent/KR101054464B1/en not_active IP Right Cessation
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US11034669B2 (en) | 2018-11-30 | 2021-06-15 | Nuvation Bio Inc. | Pyrrole and pyrazole compounds and methods of use thereof |
WO2020242264A1 (en) * | 2019-05-31 | 2020-12-03 | Samjin Pharmaceutical Co., Ltd. | A composition for treating eye diseases |
CN111848516A (en) * | 2020-08-04 | 2020-10-30 | 山东大学 | Bromophenol-pyrazoline compound and synthetic method and application thereof |
Also Published As
Publication number | Publication date |
---|---|
KR101054464B1 (en) | 2011-08-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20170313685A1 (en) | Broad-spectrum non-covalent coronavirus protease inhibitors | |
CN116236580B (en) | Application of old medicines such as auranofin and the like and compositions thereof in resisting single positive strand RNA viruses | |
CN115770246B (en) | Use of carmofur or a pharmaceutically acceptable salt thereof for anti-coronavirus | |
US20060014821A1 (en) | Inhibitors of SARS 3C like protease | |
JP2004525942A (en) | Compounds and methods | |
US11464765B2 (en) | Use of an N-substituted pyridyl benzisoselazolone compound | |
WO2021175295A1 (en) | Application of myricetin compound in preparation of drugs for prevention and treatment of novel coronavirus pneumonia | |
Shih et al. | Selective human enterovirus and rhinovirus inhibitors: An overview of capsid‐binding and protease‐inhibiting molecules | |
WO2021223718A1 (en) | Aldehyde group compounds preparation method therefor, pharmaceutical compositions thereof and use thereof | |
JP2004509841A (en) | Pharmaceutical compositions for the treatment of COPD | |
WO2024037520A1 (en) | Amide compound, and preparation method therefor, pharmaceutical composition and use thereof | |
KR20240054338A (en) | Cyano compounds, methods for their preparation and uses | |
CN107445896A (en) | It is a kind of with the benzohydroxamic acid class compound of antitumor activity and its application | |
KR101054464B1 (en) | Composition for the prophylaxis or treatment of diseases caused by picornaviruses and coronaviruses containing 3,5-diaryl-4,5-dihydropyrazole derivatives or pharmaceutically acceptable salts thereof as an active ingredient | |
Liu et al. | Reversible covalent inhibitors suppress enterovirus 71 infection by targeting the 3C protease | |
US11608331B2 (en) | Anti-SARS CoV-2 inhibitors by dual viral-host targeting | |
CN108283631B (en) | Inhibitor of enterovirus and application thereof | |
Diana et al. | Inhibitors of viral uncoating | |
CN112402402A (en) | Application of xanthohumol in preparation of novel coronavirus inhibitor | |
CN104958286B (en) | For treating the compound of disease | |
KR102399732B1 (en) | Pharmaceutical composition for preventing or treating COVID-19 containing 2-[3-[4-(1H-indazol-5-ylamino)quinazolin-2-yl]phenoxy]-N-isopropylacetamideamide as an active ingredient | |
US20240174650A1 (en) | 8-(picolinamide) substituted coumarin compound, and preparation method therefor and use thereof | |
WO2021227887A1 (en) | Compound for treating and/or preventing diseases caused by coronavirus and use thereof | |
WO2022104153A2 (en) | Compounds and methods for treating viral infections | |
WO2022117724A1 (en) | 8-hydroxyquinoline cysteine protease inhibitors for use in the prevention and/or treatment of a corona virus disease |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
LAPS | Lapse due to unpaid annual fee |