KR20100006452A - Method for maintenance of human embryonic stem cells using fibroblast derived from human umbilical cord - Google Patents

Abstract

PURPOSE: A method for culturing human embryonic stem cells using human umbilical cord-derived fibroblast is provided to maintain undifferentiation and pluripotency improve medical usefulness. CONSTITUTION: A human embryonic stem cell is cultured by co-culturing human embryonic stem cells with umbilical cord-derived fibroblast. The cell division of fibroblasts is suppressed using mitomycin C treatment or gamma irradiation when the growth rate of the fibroblasts is 60-80%.

Description

Methods for culturing human embryonic stem cells using human umbilical cord-derived fibroblasts as support cells {Method for Maintenance of Human Embryonic Stem Cells Using Fibroblast Derived from Human Umbilical Cord}

The present invention relates to a method for culturing human embryonic stem cells using human umbilical cord-derived fibroblasts as support cells, and more particularly, to provide human umbilical cord-derived fibroblasts as support cells for maintaining undifferentiated and pluripotent capacity of human embryonic stem cells. It relates to a method for culturing human embryonic stem cells.

Cell therapy or regenerative medicine has received a lot of attention for the fundamental treatment of intractable diseases such as congenital genetic diseases and chronic and degenerative diseases. Human embryonic stem cells are pluripotent cells capable of differentiation into all cells and are highly likely to be used for cell therapy and regenerative medicine. However, although stem cell (stemness) maintenance of human embryonic stem cells has been reported to be involved in a number of factors such as Oct4, Nanog, up to now it is not known how to directly control the stemness of human embryonic stem cells. Thus, the stemness of human embryonic stem cells has been maintained by culturing with supporting cells until now, and fibroblasts derived from mouse embryos are mainly used as supporting cells (Thomson et. al ., Science 282: 1145-1147, 1998). However, by culturing with mouse-derived support cells, the effects of non-human-derived materials and the contamination of mouse cells with human embryonic stem cells are constantly being debated. Research into maintaining human embryonic stem cells without water is ongoing, but it is currently known that culturing with supporting cells is absolutely necessary (Reubinoff et al ., Nat Biotechnol . 18: 399-404, 2000). Therefore, ultimately, human embryonic stem cell lines must be established under conditions that consist only of human-derived materials in the composition of the culture, while human-derived support cells are developed. Human embryonic stem cell line in the sense can be said to be established, and can be guaranteed safer in clinical application. Recently, the development of several kinds of human-derived support cells has been reported, but the developed human-derived support cells have short cell lifespan, which makes it difficult to supply the support cells or to maintain undifferentiation in long-term culture of human embryonic stem cells. Problems have been reported (Hovatta et al ., Hum Reprod ., 18: 1404-1409, 2003; Cheng et al ., Stem Cells 21: 131-142 , 2003; Lee et al . , Biol Reprod ., 72: 42-49, 2005).

Therefore, the inventor of the present invention, after diligently trying to solve the above problems, after separating the fibroblasts from the human umbilical cord, and using them as support cells of human embryonic stem cells, while maintaining the stemness of human embryonic stem cells, long-term stable It was confirmed that the culture can be completed, the present invention was completed.

An object of the present invention is to provide a method for culturing human embryonic stem cells using human umbilical cord-derived fibroblasts, characterized in that the human embryonic stem cells co-cultured with human umbilical cord-derived fibroblasts.

In order to achieve the above object, the present invention provides a method for culturing human embryonic stem cells using human umbilical cord-derived fibroblasts, characterized in that the human embryonic stem cells co-cultured with human umbilical cord-derived fibroblasts.

In the present invention, the human umbilical cord-derived fibroblasts are characterized in that when the growth rate of the fibroblasts in culture is 60% to 80%, cell division is inhibited.

In addition, the inhibition of cell division of the human umbilical cord-derived fibroblasts is characterized in that the mitomycin C treatment or gamma irradiation, the treatment concentration of the mitomycin C is 5 to 15mg / ml It features.

Hereinafter, the present invention will be described in detail according to specific examples. However, it is obvious that the scope of the present invention is not limited by the following examples.

The method of culturing human embryonic stem cells using human umbilical cord-derived fibroblasts according to the present invention can not only maintain human chromosomal karyotypes of human embryonic stem cells, but also human embryonic stem cells, using human-derived cells rather than mice for a long time. Maintaining the differentiation of the at the same time has the advantage that can maintain the starch. Therefore, it is useful for improving the medical clinical utility of human embryonic stem cells.

In the present invention, through the long-term passage of human embryonic stem cells using human umbilical cord-derived fibroblasts, the establishment of culture conditions capable of maintaining undifferentiated characteristics of human embryonic stem cells, and verifying the maintenance of pluripotency through in vitro and in vitro studies By using support cells derived from human umbilical cord, we tried to prepare a foundation to overcome the ethical problems caused by heterogeneous interactions.

In addition, by comparing the characteristics of supporting cells derived from human umbilical cords by comparing them with previously developed human-derived support cells, they are used as basic data for inducing differentiation. We tried to confirm the technology.

Fibroblasts used in the specification of the present invention may be used in the same sense as the fibroblasts.

In the present invention, after separating the fibroblasts from the human umbilical cord, human embryonic stem cells were cultured using the isolated fibroblasts as support cells. As a result, it was confirmed that the cultured human embryonic stem cells are stably maintained for a long time, maintaining undifferentiated and pluripotent ability.

Therefore, in one aspect, the present invention relates to a method for culturing human embryonic stem cells using human umbilical cord-derived fibroblasts, characterized in that the embryonic stem cells are co-cultured with human umbilical cord-derived fibroblasts.

In the present invention, the fibroblasts can be separated from the human umbilical cord by treating the enzyme mixture solution containing collagenase I, pronase, DNase I and the like.

The human umbilical cord-derived fibroblasts can be used as support cells of human embryonic stem cells without special treatment, but maintain undifferentiated and pluripotent capacity of human embryonic stem cells for a long time, and also stabilize the chromosomal karyotype of human embryonic stem cells. In order to maintain, when the growth rate of the human umbilical cord-derived fibroblasts is 60% to 80%, it is preferable to use the one that inhibited cell division. Here, the growth rate of 60-80% means that the cell fills about 60-80% of the area of the culture plate in which the cells are currently being cultured, which can be observed under a microscope. If the growth rate reaches 100% (when the cell fills up the culture dish), the cell may no longer grow, that is, contact inhibition may occur, and in this case, differentiation of the cell may be induced, thereby changing the characteristics of the cell. have. In addition, since human embryonic stem cells grow to a monolayer between the support cells and grow on the bottom of the culture dish, it is difficult to secure a space for human embryonic stem cells to grow when human cells do not inhibit cell division. There is a problem that can not effectively culture human embryonic stem cells as the growth rate of the fibroblasts is faster than the cells.

In the present invention, co-culture of human embryonic stem cells and human umbilical cord-derived fibroblasts, which are supporting cells, is preferably carried out by adding fibrous cells of 5.0 × 10 ⁴ / cm 2 to 5.0 × 10 ⁵ / cm 2 in a culture dish. In case of a large number of fibroblasts derived from human umbilical cord, which are supporting cells, as mentioned above, it is difficult to secure a space for human embryonic stem cells to grow, and when too small, there is a difficulty in supplying nutrients to support human embryonic stem cells. .

In the present invention, the inhibition of cell division of the human umbilical cord-derived fibroblasts is characterized in that the treatment with mitomycin C or gamma rays, the concentration of the mitomycin C is 5 to 15 mg / ml, preferably 8 to 12 mg / ml, more preferably 10 mg / ml. If the mitomycin (C) is treated at high concentrations may damage fibroblasts, and if treated at low concentrations, there is a problem that no cell inhibition occurs.

The gamma irradition is preferably treated at 35 to 50 Gy, which is a commonly used intensity.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1 Isolation of Fibroblasts from Human Umbilical Cord

A 10-20 cm human umbilical cord is completely submerged in Hanks' Balanced Salt Solution (HBSS) containing 3% Antibiotics-Antiomycotic (Gibro-invitrogen 5240-062) and Gentamycin before transporting the fibroblasts to primary cultures. Tissue damage was minimized. The tissues (human umbilical cord) were washed several times to remove impurities, and then treated with enzyme mixture solution (0.05% collagenase I, 0.02% pronase, 0.2% DNase I) to separate fibroblasts. The separated fibroblasts were suspended in the culture solution of Table 1 and then centrifuged (500G) for 10 minutes at 4 ° C. to remove the supernatant twice, to obtain high-purity fibroblasts.

Experimental Example 1. Establishment of conditions for using human umbilical cord-derived fibroblasts as supporting cells of human embryonic stem cells

In order to use the human umbilical cord-derived fibroblasts isolated in Example 1 as limb cells of human embryonic stem cells, the culture medium of Table 1 was used and cultured in an incubator at 37 ° C. and 5% CO ₂ concentration.

TABLE 1

ingredient content DMEM 980 ml 0.1 mM Nonessential amino acid 10 ml 0.1 mM b-mercaptoethanol 7.0 μl Penicillin / Streptomycin 10 ml

After incubation, when cells grew about 70%, mitomycin C was treated at a concentration of 10 mg / ml to inhibit cell division. After treatment with mitomycin C, the degree of cell division inhibition was analyzed under a microscope every 30 minutes. As a result, mouse-derived fibroblasts commonly used as support cells were efficiently inhibited when treated for 1 hour and 30 minutes, whereas human umbilical cord-derived fibroblasts were efficiently inhibited when treated for 2 hours and 30 minutes. Confirmed.

Example 2 Establishment of Human Embryonic Stem Cell Culture Conditions Using Human Umbilical Cord-derived Fibroblasts as Support Cells

To establish optimal conditions for culturing human embryonic stem cells (H9 cell line, Wicell) and human umbilical cord-derived support cells, human cord-derived fibroblasts treated with mitomycin C were approximately 5.0 × 10 ² / ㎠, 5.0 × 10 ³ / cm 2, 5.0 × 10 ⁴ / cm 2, 5.0 × 10 ⁵ / cm 2 and 5.0 × 10 ⁶ / cm 2 and co-cultured with human embryonic stem cells in an incubator at 37 ° C., 5% CO ₂ concentration. .

As a result, when the human umbilical cord-derived fibroblasts were 5.0 × 10 ⁴ / cm 2 and 5.0 × 10 ⁵ / cm 2, it was found that the growth of human embryonic stem cells was excellent.

Based on this, co-culture between human embryonic stem cells and human umbilical cord-derived support cells, the culture conditions are shown in Table 2 (DMEM / F12 Stock media) and Table 3 (DMEM / F12 working media).

TABLE 2

ingredient content DMEM / F12 500 ml 0.1 mM nonessential amino acid (GIBCO BRL 11140-050) 5 ml 0.1 mM b-mercaptoethanol (Sigma M-7522) 3.5 μl Penicillin / Streptomycin 5 ml

TABLE 3

ingredient content DMEM / F12 Stock media 160 ml 20% Knockout Serum Replacement 40 ml 4ng / l bFGF 80 ng

In subculture, selective culture of undifferentiated stem cells is carried out by physical subculture, which uses manual cutting of cells using yellow tip rather than chemical subculture using enzyme such as trypsin or collagenas. Was maintained. Human embryonic stem cells were cultured in an incubator at 37 ° C. and 5% CO ₂ concentration, and the culture medium was replaced daily, and the culture period was subcultured based on 4-5 days.

Figure 1 is a micrograph of human umbilical cord-derived fibroblasts and human umbilical stem-derived fibroblasts and human embryonic stem cells being co-cultured. From Fig. 1, it was confirmed that human embryonic stem cells cultured using human umbilical cord-derived fibroblasts as support cells were maintained in an undifferentiated cell group.

Experimental Example 2. Characterization of human embryonic stem cells passaged using human umbilical cord-derived fibroblasts as support cells

Experimental Example 2-1. Analysis of Undifferentiated Marker Expression in Human Embryonic Stem Cells

In order to evaluate whether undifferentiated characteristics of human embryonic stem cells passaged using human umbilical cord-derived fibroblasts as supporting cells are maintained, they are labeled as undifferentiated markers of human embryonic stem cells during long-term culture (10 passages and 20 passages). , Nanog, SSEA-4, TRA-1-60, TRA-1-81, Alkaline phosphatase, etc.) were analyzed by immunohistochemistry. Immunohistochemistry was performed in the following steps.

Human embryonic stem cells cultured in a 4-well dish for 5 days were allowed to settle for 4 minutes in 4% paraformaldehyde solution and washed three times with PBS. The washed human embryonic stem cells were left standing in 0.1% triton X-100 solution for 10 minutes, washed three times with PBS, and then washed three times on a shaker with PBS for 5 minutes. Next, after removing the water of the washed human embryonic stem cells normal goat serum (normal goat serum) was treated at room temperature, after 1 hour the normal goat serum was removed. Next, human embryonic stem cells were treated with primary antibodies (Oct4, Nanog, SSEA-4, TRA-1-60, TRA-1-81), respectively, and allowed to stand in a 4 ° C. incubator for 8 hours, followed by 3 times with PBS. Washed and treated secondary antibody for 1 hour. At this time, human embryonic stem cells treated with primary antibodies against Oct4 and nanog used Alexa Fluor 488 goat anti-rabbit IgG conjugated with fluorescent material as secondary antibody, and SSEA-4, TRA-1-60 and TRA-1. Human embryonic stem cells treated with the primary antibody against -81 were Peroxidase labeled goat anti-mouse IgG or mouse anti-mouse IgM. After secondary antibody treatment, human embryonic stem cells washed three times with PBS and treated with primary antibodies against Oct-4 and Nanog were observed by fluorescence microscopy, SSEA-4, TRA-1-60 and TRA-1-81. Human embryonic stem cells treated with the primary antibody to were developed for 30 seconds to 1 minute and 30 seconds using DAB, and then observed under an optical microscope. Alkaline phosphatase staining was performed by fixing in 4% paraformaldehyde solution for 10 minutes using a color kit purchased from Chemicon, followed by color development with Naphthol / Fast Red Violet solution.

FIG. 2 is a 200-fold (× 200) photograph of an immunohistochemical test for Alkaline phosphatase, an undifferentiated marker of human embryonic stem cells. From Figure 2, it was confirmed that the differentiation of human embryonic stem cells is maintained.

3 is a 200-fold (× 200) photograph of the immunohistochemistry results for TRA-1-60, TRA-1-81 and SSEA-4, which are undifferentiated markers of human embryonic stem cells. From Figure 3, it was confirmed that the undifferentiation of human embryonic stem cells.

4 is a 200-fold (× 200) photograph of the immunohistochemistry test results for Oct-4, an undifferentiated marker of human embryonic stem cells. From FIG. 4, it was confirmed that undifferentiation of human embryonic stem cells was maintained.

5 is a 200-fold (× 200) photograph of an immunohistochemistry experiment for Nanog, an undifferentiated marker of human embryonic stem cells. From FIG. 5, it was confirmed that undifferentiation of human embryonic stem cells was maintained.

Experimental Example 2-2. In Vitro Differentiation Characteristics of Human Embryonic Stem Cells

In vitro differentiation characteristics of human embryonic stem cells during long-term culture (10 passages and 20 passages) were evaluated to evaluate whether the pluripotency of passaged human embryonic stem cells was maintained using human umbilical cord-derived fibroblasts. Analyzed.

In vitro differentiation was characterized by differentiation of human embryonic stem cells cultured in vitro into embryoid body (EB) in vitro, and the markers of endoderm, mesoderm, and ectoderm cell differentiation were analyzed by RT-PCR. . RT-PCR was performed by the following method.

Total RNA was isolated by treatment with TRIzol solution (Gibco-Invitrogen) in undifferentiated human embryonic stem cells from 10 passages and 20 passages and 4 and 8 week embryoid bodies that induced natural differentiation. The isolated RNA was synthesized in cDNA form using M-MLV Reverse Transcriptase Kit (Bioneer) and oligo-dT primer. Amplification was performed using a PCR instrument (Eppendorf Mastercycler) using 1 μl of each synthesized cDNA as a template, and the primers and amplification sizes used were as shown in Table 4 below.

TABLE 4

Genes Primer sequence (5 '→ 3') Size (bp) Nanog SEQ ID NO: 1 TACCTVAGAAGCATCCGACTGTAAAGAA 370 bp SEQ ID NO: 2 TTCGGAATTCTAGCTGAGGTTCAGGATGTT Oct-4 SEQ ID NO: 3 CTTGCTGCAGAAGTGGGTGGAGGAA 173bp SEQ ID NO: 4 CTGCAGTGTGGTTTCGGGCA hNeurofilament 68kDa SEQ ID NO: 5 GAGTGAAATGGCACGATACCT 473bp SEQ ID NO: 6 TTTCCTCTCCTTCTTCACCTTC α-fetoprotein SEQ ID NO: 7 GCTGGATTGTCTGCAGGATGGGGAA 216 bp SEQ ID NO: 8 TCCCCTGAAGAAAATTGGTTAAAAT α-cadiac actin SEQ ID NO: 9 GGAGTTATGGTGGGTATGGGTC 486 bp SEQ ID NO: 10 AGTGGTGACAAAGGAGTAGCCA

FIG. 6 is a photograph showing RT-PCR analysis of in vitro differentiation characteristics of human embryonic stem cells cultured using human umbilical cord-derived fibroblasts as support cells. From FIG. 6, it was confirmed that human embryonic stem cells of the 10th and 20th generations have differentiation ability of endoderm (α-fetoprotein), mesoderm (α-cadiac actin), and ectoderm (hNeurofilament 68kDa).

Experimental Example 2-3. In Vitro Differentiation Characteristics of Human Embryonic Stem Cells

Analysis of in vivo differentiation of human embryonic stem cells subcultured using human umbilical cord-derived fibroblasts as supporting cells was performed after implantation of human embryonic stem cells into the testis of immunodeficient mice by culture period. The formation of and markers of endoderm, mesoderm, and ectoderm cell differentiation were analyzed by immunocytochemistry. Undifferentiated human embryonic stem cells 10 passaged by the method of Example 2 was isolated and implanted into the testes of immunodeficient mice using a syringe. After 12 weeks, tumor formation was visually confirmed and tumor sites were collected. After fixing the collected tumor site with 4% paraformaldehyde solution, tissue sections were prepared using paraffin.

 The prepared tissue sections were stained with hematoxylin and eosin and observed under a microscope to determine the characteristics of the differentiated tissues.

In addition, RT-PCR was performed on teratoma in the same manner as in Experimental Example 2-2.

 Figure 7 is a teratoma and RT-PCR analysis picture showing the differentiation characteristics of human embryonic stem cells cultured using human umbilical cord-derived fibroblasts as support cells. Teratoma was formed in immunodeficient mice transplanted with human embryonic stem cells (A, B) from FIG. (C) it confirmed that there was a differentiation ability.

FIG. 8 is a 200-fold (× 200) photograph of the morphological differentiation of endoderm, mesoderm, and ectoderm cell differentiation in the teratoma formed in FIG. 7 through immunocytochemistry.

Experimental Example 2-4. Chromosome Stability of Human Embryonic Stem Cells

In order to confirm the chromosomal stability of human embryonic stem cells cultured using human umbilical cord-derived fibroblasts as support cells, karyotypes of 36 embryonic human embryonic stem cells were analyzed. Karyotyping was commissioned by Gendix, a genome analysis service company.

9 is a chromosome photograph of human embryonic stem cells cultured in 36 passages using human umbilical cord-derived fibroblasts as support cells. From Figure 9 it was confirmed that the chromosome of human embryonic stem cells cultured in 36 passages has a normal karyotype.

Comparative example  1. Mouse Origin Fibroblasts  Culture of Human Embryonic Stem Cells Used as Support Cells

To confirm the effectiveness of this experiment, we compared the characteristics of human embryonic stem cells when mouse fibroblasts were used as support cells and human umbilical cord-derived fibroblasts were used as support cells.

That is, except for using human embryonic stem cells cultured using mouse fibroblasts as support cells instead of human umbilical cord-derived fibroblasts, Experimental Example 2-1 (Analysis of expression patterns of undifferentiated markers of human embryonic stem cells), Experimental Example The analysis was performed in the same manner as 2-2 (In vitro differentiation characteristics analysis of human embryonic stem cells) and Experimental Example 2-4 (confirmation of stability of human embryonic stem cells).

As a result, as shown in Figures 10 to 14, the human umbilical cord-derived fibroblasts can be derived as a result similar to the human embryonic stem cells cultured using the support cells. In other words, the development of human-derived support cells through the present invention not only maintains the chromosomal karyotype of human embryonic stem cells, but also maintains the chromosomal karyotype of human embryonic stem cells while excluding the risk of pathogens and viral infections from heterologous animal cells. It was confirmed that the micronization can be maintained while maintaining the micronization.

As described above in detail the specific parts of the present invention, it is apparent to those skilled in the art that such specific description is merely a preferred embodiment, thereby not limiting the scope of the present invention. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

1 is a micrograph of human umbilical cord-derived fibroblasts and human umbilical stem-derived fibroblasts (A: 100-fold (× 100) photograph of human umbilical cord-derived fibroblasts, B: Human umbilical cord-derived fibers) 200-fold (× 200) photos of parental cells, C and D are 200-fold (× 200) photos of human embryonic stem cells co-cultured).

Figure 2 is a 200-fold (× 200) photograph of the results of immunohistochemistry for Alkaline phosphatase, an undifferentiated marker of human embryonic stem cells (A: Human embryonic stem cultured with 10 passages using human umbilical cord-derived fibroblasts as supporting cells Cells, B: human embryonic stem cells cultured in passage 20).

3 is a 200-fold (× 200) photograph of the results of immunohistochemistry for TRA-1-60, TRA-1-81 and SSEA-4, which are undifferentiated markers of human embryonic stem cells (A: TRA-1-60 , B: TRA-1-81, C: SSEA-4, D: TRA-1-60, E: TRA-1-81, F: SSEA-4; A, B, C: 10 passage embryonic stem cells; D , E, F: 20 generation embryonic stem cells).

4 is a 200-fold (× 200) photograph of the results of immunohistochemistry for Oct-4, an undifferentiated marker of human embryonic stem cells (A: Oct-4, B: nucleus, C: Oct-4 + nucleus, D : Oct-4, E: nucleus, F: Oct-4 + nucleus; A, B, C: 10 generation embryonic stem cells; D, E, F: 20 generation embryonic stem cells).

5 is a 200-fold (× 200) photograph of the results of immunohistochemistry for Nanog, an undifferentiated marker of human embryonic stem cells (A: Nanog, B: Nucleus, C: Nanog + Nucleus, D: Nanog, E: Nucleus , F: Nanog + nucleus; A, B, C: 10 generation embryonic stem cells; D, E, F: 20 generation embryonic stem cells).

Figure 6 is an RT-PCR analysis of in vitro differentiation characteristics of human embryonic stem cells cultured with human umbilical cord-derived fibroblasts as support cells (H9 un (P10): 10 passaged undifferentiated human stem cells, EB 4W ( p10): 10 passages, embryoid body of 4 week differentiated human stem cells, EB 8W (p10): 10 passages, embryoid body of 8 week differentiated human stem cells, H9 un (P20): 20 passages Undifferentiated human stem cells, EB 4W (p20): 20 passages, embryoid body of 4 weeks differentiated human stem cells, EB 8W (p20): 20 passages, embryoid body of 8 weeks differentiated human stem cells) .

Figure 7 is a teratoma and RT-PCR analysis picture showing the differentiation characteristics of human embryonic stem cells cultured using human umbilical cord-derived fibroblasts as support cells.

FIG. 8 is a 200-fold (× 200) photograph of the morphological differentiation of endoderm, mesoderm, and ectoderm cell differentiation in the teratoma formed in FIG. 7 through immunocytochemistry (A: muscle, B : bone, C: gut, D: cartilage, E: epithelium, F: goblet cells).

9 is a chromosome picture of human embryonic stem cells cultured in 36 passages using human umbilical cord-derived fibroblasts as support cells (A: unaligned chromosome picture, B: aligned chromosome picture).

10 is a micrograph of human embryonic stem cells co-cultured with mouse-derived fibroblasts (A: 100-fold (× 100) photograph of mouse-derived fibroblasts, B: 200-fold (× 200) photograph of mouse-derived fibroblasts). , C and D are 100 times (× 100) photograph of human embryonic stem cells being co-cultured).

FIG. 11 is a 100-fold (× 100) photograph of an immunohistochemical test for undifferentiated markers of human embryonic stem cells in human embryonic stem cells co-cultured with mouse-derived fibroblasts (A: Alkaline phosphatase, B: TRA-1 -60, C: TRA-1-81, D: SSEA-4).

FIG. 12 is a 100-fold (× 100) photograph of immunohistochemistry for the undifferentiated markers Oct-4 and Nanog in human embryonic stem cells co-cultured with mouse-derived fibroblasts (A: Oct-4, B: nucleus , C: Oct-4 + nucleus, D: Nanog, E: nucleus, F: Nanog + nucleus).

Figure 13 is an RT-PCR analysis of the in vitro differentiation characteristics of human embryonic stem cells co-cultured with mouse-derived fibroblasts (H9 un: undifferentiated human stem cells, EB 4W: embryoid body of 4 weeks differentiated human stem cells) , EB 8W: embryoid body of human stem cells induced 8 weeks of differentiation.

Figure 14 is a chromosome picture of human embryonic stem cells cultured in 36 passages using mouse-derived fibroblasts as support cells (A: unaligned chromosome picture, B: aligned chromosome picture).

<110> Seoul National University Industry Foundation <120> Method for Maintenance of Human Embryonic Stem Cells Using          Fibroblast Derived from Human Umbilical Cord <130> P08-B115 <160> 10 <170> KopatentIn 1.71 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> Nanog primer (F) <400> 1 tacctvagaa gcatccgact gtaaagaa 28 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Nanog primer (R) <400> 2 ttcggaattc tagctgaggt tcaggatgtt 30 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> Oct 4 primer (F) <400> 3 cttgctgcag aagtgggtgg aggaa 25 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> Oct 4 primer (R) <400> 4 ctgcagtgtg gtttcgggca 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> hNeurofilament 68 kDa primer (F) <400> 5 gagtgaaatg gcacgatacc t 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> hNeurofilament 68 kDa primer (R) <400> 6 tttcctctcc ttcttcacct tc 22 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> a-fetoprotein primer (F) <400> 7 gctggattgt ctgcaggatg gggaa 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> a-fetoprotein primer (R) <400> 8 tcccctgaag aaaattggtt aaaat 25 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> a-cadiac actin primer (F) <400> 9 ggagttatgg tgggtatggg tc 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> a-cadiac actin primer (R) <400> 10 agtggtgaca aaggagtagc ca 22  

Claims (4)

A method of culturing human embryonic stem cells using human umbilical cord-derived fibroblasts, comprising co-culturing human embryonic stem cells with human umbilical cord-derived fibroblasts. The method of claim 1, wherein the human umbilical fibroblast-derived fibroblasts are characterized in that the cell division is inhibited when the growth rate of 60% to 80%. The method of claim 2, wherein the inhibition of cell division of the human umbilical cord-derived fibroblasts is characterized in that the mitomycin C treatment or gamma irradiation. 4. The method of claim 3, wherein the treatment concentration of mitomycin C is 5 to 15 mg / ml.

Images